Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

Science.gov (United States)

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

NARCIS (Netherlands)

Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

DEFF Research Database (Denmark)

Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

2012-01-01

Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Structure and function of α-glucan debranching enzymes

DEFF Research Database (Denmark)

Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

2016-01-01

α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

Science.gov (United States)

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose

DEFF Research Database (Denmark)

Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.

2016-01-01

The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

Science.gov (United States)

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Antimicrobial and Antitumor Activities of Novel Peptides Derived from the Lipopolysaccharide- and β-1,3-Glucan Binding Protein of the Pacific Abalone Haliotis discus hannai

Directory of Open Access Journals (Sweden)

Bo-Hye Nam

2016-12-01

Full Text Available Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP gene from the pacific abalone Haliotis discus hannai (HDH, which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2. By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa, lung (A549, and colon (HCT 116 carcinoma cell lines but not much on human umbilical vein cell (HUVEC. Fluorescence-activated cell sorter (FACS analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.

Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

β-1,3-glucan in developing cotton fibers

International Nuclear Information System (INIS)

Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

1979-01-01

Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

One precursor, three apolipoproteins: the relationship between two crustacean lipoproteins, the large discoidal lipoprotein and the high density lipoprotein/β-glucan binding protein.

Science.gov (United States)

Stieb, Stefanie; Roth, Ziv; Dal Magro, Christina; Fischer, Sabine; Butz, Eric; Sagi, Amir; Khalaila, Isam; Lieb, Bernhard; Schenk, Sven; Hoeger, Ulrich

2014-12-01

The novel discoidal lipoprotein (dLp) recently detected in the crayfish, differs from other crustacean lipoproteins in its large size, apoprotein composition and high lipid binding capacity, We identified the dLp sequence by transcriptome analyses of the hepatopancreas and mass spectrometry. Further de novo assembly of the NGS data followed by BLAST searches using the sequence of the high density lipoprotein/1-glucan binding protein (HDL-BGBP) of Astacus leptodactylus as query revealed a putative precursor molecule with an open reading frame of 14.7 kb and a deduced primary structure of 4889 amino acids. The presence of an N-terminal lipid bind- ing domain and a DUF 1943 domain suggests the relationship with the large lipid transfer proteins. Two-putative dibasic furin cleavage sites were identified bordering the sequence of the HDL-BGBP. When subjected to mass spectroscopic analyses, tryptic peptides of the large apoprotein of dLp matched the N-terminal part of the precursor, while the peptides obtained for its small apoprotein matched the C-terminal part. Repeating the analysis in the prawn Macrobrachium rosenbergii revealed a similar protein with identical domain architecture suggesting that our findings do not represent an isolated instance. Our results indicate that the above three apolipoproteins (i.e HDL-BGBP and both the large and the small subunit of dLp) are translated as a large precursor. Cleavage at the furin type sites releases two subunits forming a heterodimeric dLP particle, while the remaining part forms an HDL-BGBP whose relationship with other lipoproteins as well as specific functions are yet to be elucidated.

A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

Directory of Open Access Journals (Sweden)

Heather T Taff

Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

Plants with elevated levels of glucan

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

2018-03-20

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

NARCIS (Netherlands)

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

Science.gov (United States)

Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

2016-07-01

This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

Science.gov (United States)

Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

2008-03-20

Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

Science.gov (United States)

Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

2016-01-01

An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

Science.gov (United States)

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chemical modification as an approach for the identification of UDPG-binding polypeptides of UDPG-glucose: (1,3)-Beta-glucan synthase

International Nuclear Information System (INIS)

Mason, T.L.

1989-01-01

The lysine-reactive chemical modification reagents uridine diphosphate pyridoxal (UDP-pyridoxal) and formaldehyde (HCHO) were used to identify UDPG-binding polypeptides of UDP-glucose: (1,3)-β-D-glucan synthase (GS) from red beet storage tissue. Complete enzyme inactivation occurred after exposure to micromolar levels of UDP-pyridoxal and millimolar levels of HCHO. Divalent cations (Mg 2+ and Ca 2+ , particularly Ca 2+ ) were required by both for inactivation. Substrate (UDPG) and chelators (EDTA and EGTA) protected plasma membrane GS (PMGS) against UDP-pyridoxal and HCHO inhibition. UDPG protected CHAPS solubilized GS (CSGS) against UDP-pyridoxal inactivation, but not against HCHO. It was concluded that beet GS contains a lysine residue at the UDPG-binding site. When PMGS was directly labeled with UDP[ 3 H]-pyridoxal or [ 14 C]HCHO, random labeling occurred. Therefore, a multi-step labeling procedure was developed. Nonessential lysine residues were first blocked with HCHO while 5 mM UDPG protected the active site lysine. Background labeling was reduced 4-fold. Membranes were recovered by centrifugation and the active site lysine exposed to [ 14 C] HCHO. Major labeled polypeptides were at 200, 76, and 54 kD. Minor polypeptides were seen at 94, 82, 68, 60, and 20-25 kD. CSGS was labeled by a modified multi-step procedure. CSGS was blocked by reaction with UDP-pyridoxal in the presence of UDPG. CSGS was then recovered by product entrapment and labeled with [ 14 C]HCHO. Background labeling was reduced by 8-fold and potential UDPG-binding polypeptides narrowed to 68, 54, 25 and 22 kD

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

2010-08-01

In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

Peptide binding specificity of the chaperone calreticulin

DEFF Research Database (Denmark)

Sandhu, N.; Duus, K.; Jorgensen, C.S.

2007-01-01

Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length and composit......Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length...... than 5 amino acids showed binding and a clear correlation with hydrophobicity was demonstrated for oligomers of different hydrophobic amino acids. Insertion of hydrophilic amino acids in a hydrophobic sequence diminished or abolished binding. In conclusion our results show that calreticulin has...

Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

Science.gov (United States)

Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

2008-01-01

Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Probing interactions between B-glucan and bile salts at atomic detail by ¹H-¹³C NMR assays

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

2014-01-01

Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

Directory of Open Access Journals (Sweden)

D. El Khoury

2012-01-01

Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

Science.gov (United States)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

International Nuclear Information System (INIS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-01-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Beta-glucans and cholesterol

Czech Academy of Sciences Publication Activity Database

Šíma, Petr; Vannucci, Luca; Větvička, V.

2017-01-01

Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

DEFF Research Database (Denmark)

Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

2013-01-01

Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

Science.gov (United States)

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Thanh Long

2015-01-01

The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

Synthesis of cell wall xylans and glucans by golgi membranes

International Nuclear Information System (INIS)

Gibeaut, D.M.; Carpita, N.C.

1989-01-01

We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

DEFF Research Database (Denmark)

Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

2008-01-01

alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

International Nuclear Information System (INIS)

Tran, Huu Vinh

1983-01-01

After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

Science.gov (United States)

Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

2016-11-01

At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models*

Science.gov (United States)

Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

2016-01-01

Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. PMID:26912662

Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.

Science.gov (United States)

Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

2016-05-06

Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Specific binding of atrial natriuretic factor in brain microvessels

International Nuclear Information System (INIS)

Chabrier, P.E.; Roubert, P.; Braquet, P.

1987-01-01

Cerebral capillaries constitute the blood-brain barrier. Studies of specific receptors (neurotransmitters or hormones) located on this structure can be performed by means of radioligand-binding techniques on isolated brain microvessels. The authors examined on pure bovine cerebral microvessel preparations the binding of atrial natriuretic factor (ANF), using 125 I-labeled ANF. Saturation and competition experiments demonstrated the presence of a single class of ANF-binding sites with high affinity and with a binding capacity of 58 fmol/mg of protein. The binding of 125 I-labeled ANF to brain microvessels is specific, reversible, and time dependent, as is shown by association-dissociation experiments. The demonstration of specific ANF-binding sites on brain microvessels supposes a physiological role of ANF on brain microvasculature. The coexistence of ANF and angiotensin II receptors on this cerebrovascular tissue suggests that the two circulating peptides may act as mutual antagonists in the regulation of brain microcirculation and/or blood-brain barrier function

Study of plasma binding of receptor-specific peptides

OpenAIRE

Gregor, David

2008-01-01

The binding ability of two receptor specific peptides namely 90Y-DOTA-TATE and 111In-DOTA-TATE was studied in therm of interspecies comparison by the method of equilibrium dialysis. This plasma protein binding was different for the chosen animal species (human, rat, rabbit, bovine eventually pork) whereas binding of 90Y-DOTA- TATE was higher than binding of 111In-DOTA-TATE. KEYWORDS: Protein binding, radiofarmaceuticals, equilibrium dialysis, 90Y-DOTA-TATE, 111In- DOTA-TATE

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

DEFF Research Database (Denmark)

Munck, L.; Møller, B.; Jacobsen, Susanne

2004-01-01

-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

The structure of cell wall alpha-glucan from fission yeast

NARCIS (Netherlands)

Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

The structure of cell wall alpha-glucan from fission yeast.

NARCIS (Netherlands)

Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

Directory of Open Access Journals (Sweden)

Claudia Zielke

Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

Characterization and DNA-binding specificities of Ralstonia TAL-like effectors

KAUST Repository

Li, Lixin

2013-07-01

Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

Science.gov (United States)

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

Specific binding of beta-endorphin to normal human erythrocytes

Energy Technology Data Exchange (ETDEWEB)

Chenet, B.; Hollis, V. Jr.; Kang, Y.; Simpkins, C.

1986-03-05

Beta-endorphin (BE) exhibits peripheral functions which may not be mediated by interactions with receptors in the brain. Recent studies have demonstrated binding of BE to both opioid and non-opioid receptors on lymphocytes and monocytes. Abood has reported specific binding of /sup 3/H-dihydromorphine in erythrocytes. Using 5 x 10/sup -11/M /sup 125/I-beta-endorphin and 10/sup -5/M unlabeled BE, they have detected 50% specific binding to human erythrocytes. This finding is supported by results from immunoelectron microscopy using rabbit anti-BE antibody and biotinylated secondary antibody with avidin-biotin complexes horseradish peroxidase. Binding is clearly observed and is confined to only one side of the cells. Conclusions: (1) BE binding to human erythrocytes was demonstrated by radioreceptor assay and immunoelectron microscopy, and (2) BE binding sites exist on only one side of the cells.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

Science.gov (United States)

Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

2010-12-01

Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

Science.gov (United States)

Granger, Bruce L

2018-01-01

Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall

Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

Directory of Open Access Journals (Sweden)

Bruce L Granger

Full Text Available Yeast wall protein 1 (Ywp1 is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA epitopes inserted into

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

NARCIS (Netherlands)

Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

2004-01-01

(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

Science.gov (United States)

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Inhibitors of serotonin reuptake and specific imipramine binding in human blood plasma

International Nuclear Information System (INIS)

Brusov, O.S.; Fomenko, A.M.; Katasonov, A.B.; Lidemann, R.R.

1985-01-01

This paper describes a method of extraction of endogenous inhibitors of specific IMI binding and of 5-HT reuptake, from human blood plasma and the heterogeneity of these compounds is demonstrated. Specific binding was determined as the difference between binding of 3 H-IMI in the absence and in the presence of 50 microM IMI. Under these conditions, specific binding amounted to 70-80% of total binding of 3 H-IMI. It is shown that extract obtained from human blood contains a material which inhibits dose-dependently both 5-HT reuptake and specific binding of 3 H-IMI. Gel-chromatography of extracts of human blood plasma on Biogel P-2 is also shown

Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

Science.gov (United States)

Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

2015-05-04

The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

Science.gov (United States)

Song, Wei; Guo, Jun-Tao

2015-01-01

Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

Identification and Structural Basis of Binding to Host Lung Glycogen by Streptococcal Virulence Factors

Energy Technology Data Exchange (ETDEWEB)

Lammerts van Bueren,A.; Higgins, M.; Wang, D.; Burke, R.; Boraston, A.

2007-01-01

The ability of pathogenic bacteria to recognize host glycans is often essential to their virulence. Here we report structure-function studies of previously uncharacterized glycogen-binding modules in the surface-anchored pullulanases from Streptococcus pneumoniae (SpuA) and Streptococcus pyogenes (PulA). Multivalent binding to glycogen leads to a strong interaction with alveolar type II cells in mouse lung tissue. X-ray crystal structures of the binding modules reveal a novel fusion of tandem modules into single, bivalent functional domains. In addition to indicating a structural basis for multivalent attachment, the structure of the SpuA modules in complex with carbohydrate provides insight into the molecular basis for glycogen specificity. This report provides the first evidence that intracellular lung glycogen may be a novel target of pathogenic streptococci and thus provides a rationale for the identification of the streptococcal {alpha}-glucan-metabolizing machinery as virulence factors.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

Science.gov (United States)

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Ligand-bound Structures and Site-directed Mutagenesis Identify the Acceptor and Secondary Binding Sites of Streptomyces coelicolor Maltosyltransferase GlgE*

Science.gov (United States)

Syson, Karl; Stevenson, Clare E. M.; Miah, Farzana; Barclay, J. Elaine; Tang, Minhong; Gorelik, Andrii; Rashid, Abdul M.; Lawson, David M.; Bornemann, Stephen

2016-01-01

GlgE is a maltosyltransferase involved in α-glucan biosynthesis in bacteria that has been genetically validated as a target for tuberculosis therapies. Crystals of the Mycobacterium tuberculosis enzyme diffract at low resolution so most structural studies have been with the very similar Streptomyces coelicolor GlgE isoform 1. Although the donor binding site for α-maltose 1-phosphate had been previously structurally defined, the acceptor site had not. Using mutagenesis, kinetics, and protein crystallography of the S. coelicolor enzyme, we have now identified the +1 to +6 subsites of the acceptor/product, which overlap with the known cyclodextrin binding site. The sugar residues in the acceptor subsites +1 to +5 are oriented such that they disfavor the binding of malto-oligosaccharides that bear branches at their 6-positions, consistent with the known acceptor chain specificity of GlgE. A secondary binding site remote from the catalytic center was identified that is distinct from one reported for the M. tuberculosis enzyme. This new site is capable of binding a branched α-glucan and is most likely involved in guiding acceptors toward the donor site because its disruption kinetically compromises the ability of GlgE to extend polymeric substrates. However, disruption of this site, which is conserved in the Streptomyces venezuelae GlgE enzyme, did not affect the growth of S. venezuelae or the structure of the polymeric product. The acceptor subsites +1 to +4 in the S. coelicolor enzyme are well conserved in the M. tuberculosis enzyme so their identification could help inform the design of inhibitors with therapeutic potential. PMID:27531751

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

Science.gov (United States)

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation

International Nuclear Information System (INIS)

Lacerda, Camila Maria de Sousa

2016-01-01

Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

Science.gov (United States)

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone

Energy Technology Data Exchange (ETDEWEB)

Kim, Il Hwan; Pham, Van; Jablonka, Willy; Goodman, Walter G.; Ribeiro, José M. C.; Andersen, John F.

2017-07-27

Juvenile hormone (JH) is a key regulator of insect development and reproduction. In adult mosquitoes, it is essential for maturation of the ovary and normal male reproductive behavior, but how JH distribution and activity is regulated after secretion is unclear. Here, we report a new type of specific JH-binding protein, given the name mosquito juvenile hormone-binding protein (mJHBP), which circulates in the hemolymph of pupal and adult Aedes aegypti males and females. mJHBP is a member of the odorant-binding protein (OBP) family, and orthologs are present in the genomes of Aedes, Culex, and Anopheles mosquito species. Using isothermal titration calorimetry, we show that mJHBP specifically binds JH II and JH III but not eicosanoids or JH derivatives. mJHBP was crystallized in the presence of JH III and found to have a double OBP domain structure reminiscent of salivary “long” D7 proteins of mosquitoes. We observed that a single JH III molecule is contained in the N-terminal domain binding pocket that is closed in an apparent conformational change by a C-terminal domain-derived α-helix. The electron density for the ligand indicated a high occupancy of the natural 10R enantiomer of JH III. Of note, mJHBP is structurally unrelated to hemolymph JHBP from lepidopteran insects. A low level of expression of mJHBP in Ae. aegypti larvae suggests that it is primarily active during the adult stage where it could potentially influence the effects of JH on egg development, mating behavior, feeding, or other processes.

A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone.

Science.gov (United States)

Kim, Il Hwan; Pham, Van; Jablonka, Willy; Goodman, Walter G; Ribeiro, José M C; Andersen, John F

2017-09-15

Juvenile hormone (JH) is a key regulator of insect development and reproduction. In adult mosquitoes, it is essential for maturation of the ovary and normal male reproductive behavior, but how JH distribution and activity is regulated after secretion is unclear. Here, we report a new type of specific JH-binding protein, given the name mosquito juvenile hormone-binding protein (mJHBP), which circulates in the hemolymph of pupal and adult Aedes aegypti males and females. mJHBP is a member of the odorant-binding protein (OBP) family, and orthologs are present in the genomes of Aedes , Culex , and Anopheles mosquito species. Using isothermal titration calorimetry, we show that mJHBP specifically binds JH II and JH III but not eicosanoids or JH derivatives. mJHBP was crystallized in the presence of JH III and found to have a double OBP domain structure reminiscent of salivary "long" D7 proteins of mosquitoes. We observed that a single JH III molecule is contained in the N-terminal domain binding pocket that is closed in an apparent conformational change by a C-terminal domain-derived α-helix. The electron density for the ligand indicated a high occupancy of the natural 10 R enantiomer of JH III. Of note, mJHBP is structurally unrelated to hemolymph JHBP from lepidopteran insects. A low level of expression of mJHBP in Ae. aegypti larvae suggests that it is primarily active during the adult stage where it could potentially influence the effects of JH on egg development, mating behavior, feeding, or other processes.

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Quantification of specific bindings of biomolecules by magnetorelaxometry

Directory of Open Access Journals (Sweden)

Steinhoff Uwe

2008-03-01

Full Text Available Abstract The binding reaction of the biomolecules streptavidin and anti-biotin antibody, both labelled by magnetic nanoparticles (MNP, to biotin coated on agarose beads, was quantified by magnetorelaxometry (MRX. Highly sensitive SQUID-based MRX revealed the immobilization of the MNP caused by the biotin-streptavidin coupling. We found that about 85% of streptavidin-functionalised MNP bound specifically to biotin-agarose beads. On the other hand only 20% of antibiotin-antibody functionalised MNP were specifically bound. Variation of the suspension medium revealed in comparison to phosphate buffer with 0.1% bovine serum albumin a slight change of the binding behaviour in human serum, probably due to the presence of functioning (non heated serum proteins. Furthermore, in human serum an additional non-specific binding occurs, being independent from the serum protein functionality. The presented homogeneous bead based assay is applicable in simple, uncoated vials and it enables the assessment of the binding kinetics in a volume without liquid flow. The estimated association rate constant for the MNP-labelled streptavidin is by about two orders of magnitude smaller than the value reported for free streptavidin. This is probably due to the relatively large size of the magnetic markers which reduces the diffusion of streptavidin. Furthermore, long time non-exponential kinetics were observed and interpreted as agglutination of the agarose beads.

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2008-12-01

Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

B700, a murine melanoma-specific antigen, binds Vitamin D3; conservation of binding among albuminoid molecules

International Nuclear Information System (INIS)

Farzaneh, N.K.; Walden, T.L. Jr.; Hearing, V.J.; Gersten, D.M.

1990-01-01

B700, a murine melanoma-specific antigen, is a member of the serum albumin protein family. Other members of this family include serum albumin (SMA), a-fetoprotein (AFP), vitamin D binding protein (DBP), and C700. The primary structure and biochemical functions of B700, as well as its in vivo metabolic fate are largely unknown. The authors examined the functional characteristics of MSA, AFP, and DBP, and for their ability to specifically bind [ 3 H]-1,25-dihydroxy-vitamin D 3 . Scatchard analysis revealed a single binding site for B700 with a Kd of 51,000 M and a Bmax of 4.51 x 10 -7 . There is no significant difference between the Kd and Bmax values among the albuminoid proteins. However, differences in the binding sites could be distinguished by competition of the 1,25-dihydroxy vitamin D 3 with other steroids. 2nM of vitamin D 3 , vitamin D 2 , or estrogen competed for the specific binding of 1,25-dihydroxy vitamin D 3 by B700 but not by DBP. The MSA binding site for 1,25 dihydroxy vitamin D 3 more closely resembles that of DBP than B700. These data indicate that the binding function of the albuminoid proteins has been conserved in the B700 melanoma antigen

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Preliminary studies of 99mTc-PQQ-NMDAR binding and effect of specificity binding by mannitol

International Nuclear Information System (INIS)

Xingqin Zhou; Yanyan Kong; Guoxian Cao; Jiankang Zhang

2013-01-01

Pyrroloquinoline quinone (PQQ) is a powerful neuroprotectant that specifically binds to brain NMDA receptors and inhibits excitotoxicity. Imaging this binding reaction in the brain remains a long sought goal in this field of study, and one of the primary challenges remaining is enabling soluble labeled PQQ to pass the blood-brain barrier (BBB). Previously, our group successfully labeled PQQ with Technetium-99m ( 99m Tc), a metastable nuclear isomer used in radioactive isotope medical tests. In this work, we determined the specific binding of 99m Tc-PQQ and NMDAR by radioligand receptor assay. Ebselen (EB) and MK-801 both effectively inhibited 99m Tc-PQQ binding. We then investigated methods of opening the BBB using mannitol to enable entry to the brain by 99m Tc-PQQ. Our results showed that 7.5 mL/kg of 20 % mannitol effectively opened the BBB and 20 min was the optimum treatment time. Competition studies showed that mannitol did not affect the specific binding between 99m Tc-PQQ and NMDA receptors. Using this method, the amount of 99m Tc-PQQ uptake and retention was increased most significantly in the hippocampus and cortex, and re-opening the BBB did not affect binding. Together, our results demonstrate that the use of mannitol to open the BBB may contribute significantly to improving image quality by increasing the uptake amount of a water-soluble agent in brain. (author)

Specific insulin binding in bovine chromaffin cells; demonstration of preferential binding to adrenalin-storing cells

International Nuclear Information System (INIS)

Serck-Hanssen, G.; Soevik, O.

1987-01-01

Insulin binding was studied in subpopulations of bovine chromaffin cells enriched in adrenalin-producing cells (A-cells) or noradrenalin-producing cells (NA-cells). Binding of 125 I-insulin was carried out at 15 0 C for 3 hrs in the absence or presence of excess unlabeled hormone. Four fractions of cells were obtained by centrifugation on a stepwise bovine serum albumin gradient. The four fractions were all shown to bind insulin in a specific manner and the highest binding was measured in the cell layers of higher densities, containing mainly A-cells. The difference in binding of insulin to the four subpopulations of chromaffin cells seemed to be related to differences in numbers of receptors as opposed to receptor affinities. The authors conclude that bovine chromaffin cells possess high affinity binding sites for insulin and that these binding sites are mainly confined to A-cells. 24 references, 2 figures, 1 table

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

DEFF Research Database (Denmark)

Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

2008-01-01

Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

International Nuclear Information System (INIS)

Salama, S.F.

2011-01-01

1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

Science.gov (United States)

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

First principles insight into the α-glucan structures of starch

DEFF Research Database (Denmark)

Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

2010-01-01

A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

NARCIS (Netherlands)

Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

2007-01-01

The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

Directory of Open Access Journals (Sweden)

TIJANA SAVIC

2006-02-01

Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

Directory of Open Access Journals (Sweden)

Sonja de Vries

Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

Science.gov (United States)

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

Science.gov (United States)

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

An initial event in the insect innate immune response: structural and biological studies of interactions between β-1,3-glucan and the N-terminal domain of β-1,3-glucan recognition protein.

Science.gov (United States)

Dai, Huaien; Hiromasa, Yasuaki; Takahashi, Daisuke; VanderVelde, David; Fabrick, Jeffrey A; Kanost, Michael R; Krishnamoorthi, Ramaswamy

2013-01-08

In response to invading microorganisms, insect β-1,3-glucan recognition protein (βGRP), a soluble receptor in the hemolymph, binds to the surfaces of bacteria and fungi and activates serine protease cascades that promote destruction of pathogens by means of melanization or expression of antimicrobial peptides. Here we report on the nuclear magnetic resonance (NMR) solution structure of the N-terminal domain of βGRP (N-βGRP) from Indian meal moth (Plodia interpunctella), which is sufficient to activate the prophenoloxidase (proPO) pathway resulting in melanin formation. NMR and isothermal calorimetric titrations of N-βGRP with laminarihexaose, a glucose hexamer containing β-1,3 links, suggest a weak binding of the ligand. However, addition of laminarin, a glucose polysaccharide (~6 kDa) containing β-1,3 and β-1,6 links that activates the proPO pathway, to N-βGRP results in the loss of NMR cross-peaks from the backbone (15)N-(1)H groups of the protein, suggesting the formation of a large complex. Analytical ultracentrifugation (AUC) studies of formation of the N-βGRP-laminarin complex show that ligand binding induces self-association of the protein-carbohydrate complex into a macro structure, likely containing six protein and three laminarin molecules (~102 kDa). The macro complex is quite stable, as it does not undergo dissociation upon dilution to submicromolar concentrations. The structural model thus derived from this study for the N-βGRP-laminarin complex in solution differs from the one in which a single N-βGRP molecule has been proposed to bind to a triple-helical form of laminarin on the basis of an X-ray crystallographic structure of the N-βGRP-laminarihexaose complex [Kanagawa, M., Satoh, T., Ikeda, A., Adachi, Y., Ohno, N., and Yamaguchi, Y. (2011) J. Biol. Chem. 286, 29158-29165]. AUC studies and phenoloxidase activation measurements conducted with the designed mutants of N-βGRP indicate that electrostatic interactions involving Asp45, Arg54

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

Conversion of MyoD to a Neurogenic Factor: Binding Site Specificity Determines Lineage

Directory of Open Access Journals (Sweden)

Abraham P. Fong

2015-03-01

Full Text Available MyoD and NeuroD2, master regulators of myogenesis and neurogenesis, bind to a “shared” E-box sequence (CAGCTG and a “private” sequence (CAGGTG or CAGATG, respectively. To determine whether private-site recognition is sufficient to confer lineage specification, we generated a MyoD mutant with the DNA-binding specificity of NeuroD2. This chimeric mutant gained binding to NeuroD2 private sites but maintained binding to a subset of MyoD-specific sites, activating part of both the muscle and neuronal programs. Sequence analysis revealed an enrichment for PBX/MEIS motifs at the subset of MyoD-specific sites bound by the chimera, and point mutations that prevent MyoD interaction with PBX/MEIS converted the chimera to a pure neurogenic factor. Therefore, redirecting MyoD binding from MyoD private sites to NeuroD2 private sites, despite preserved binding to the MyoD/NeuroD2 shared sites, is sufficient to change MyoD from a master regulator of myogenesis to a master regulator of neurogenesis.

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

Science.gov (United States)

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

The influence of surface integrin binding patterns on specific biomaterial-cell interactions

Science.gov (United States)

Beranek, Maggi Marie

As the future of biomaterials progresses toward bioactivity, the biomaterial surface must control non-specific protein adsorption and encourage selective protein and cell adsorption. Integrins alphavbeta3, alpha 1beta1, alpha5beta1 and alpha Mbeta2 are expressed on cells involved in endothelialization, inflammation, and intimal hyperplasia. These cellular events play a vital role in biomaterial biocompatibility, especially in the vascular environment. The overall hypothesis of these studies is that biomaterial surfaces exhibit selective integrin binding, which then specifies differential cell binding. To test this hypothesis, four specific aims were developed. The first aim was designed to determine whether metal and polymeric biomaterials exhibit selective integrin binding. The tested materials included 316L stainless steel, nitinol, gold, Elgiloy RTM, poly(D, L-lactide-co-glycolide), polycarbonate urethane and expanded polytetrafluoroethylene. Discrete integrin binding patterns were detected microscopically using integrin specific fluorescent antibodies. Stainless steel exhibited high level integrin alpha1beta 1 and low level integrin alphaMbeta2 binding pattern. This suggests that this metal surface should selectively encourage endothelial cell to inflammatory cell binding. In contrast, gold bound ten times the amount of integrin alphaMbeta2 compared to integrin alpha1beta1, which should encourage inflammatory cell adhesion. The 65/35 poly(D, L-lactide-co-glycolide) was the only polymeric biomaterial tested that had integrin binding levels comparable to metal biomaterials. Based on these observations, a combinational biomaterial with a surface pattern of 65/35 poly(D, L-lactide-co-glycolide) dots on a 316L stainless steel background was created. A pattern of high level integrin alpha1beta1 binding and low level integrin alpha Mbeta2 binding on this combinational surface indicates that this surface should selectively favor endothelial cell binding. In the second

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

Science.gov (United States)

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

2013-07-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

International Nuclear Information System (INIS)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

2013-01-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

Demonstration of specific binding sites for 3H-RRR-alpha-tocopherol on human erythrocytes

International Nuclear Information System (INIS)

Kitabchi, A.E.; Wimalasena, J.

1982-01-01

Previous work from our laboratory demonstrated specific binding sites for 3 H-RRR-alpha-tocopherol ( 3 H-d alpha T) in membranes of rat adrenal cells. As tocopherol deficiency is associated with increased susceptibility of red blood cells to hemolysis, we investigated tocopherol binding sites in human RBCs. Erythrocytes were found to have specific binding sites for 3 H-d alpha T that exhibited saturability and time and cell-concentration dependence as well as reversibility of binding. Kinetic studies of binding demonstrated two binding sites--one with high affinity (Ka of 2.6 x 10(7) M-1), low capacity (7,600 sites per cell) and the other with low affinity (1.2 x 10(6) M-1), high capacity (150,000 sites per cell). In order to localize the binding sites further, RBCs were fractionated and greater than 90% of the tocopherol binding was located in the membranes. Similar to the findings in intact RBCs, the membranes exhibited two binding sites with a respective Ka of 3.3 x 10(7) M-1 and 1.5 x 10(6) M-1. Specificity data for binding demonstrated 10% binding for RRR-gamma-tocopherol, but not other tocopherol analog exhibited competition for 3 H-d alpha T binding sites. Instability data suggested a protein nature for these binding sites. Preliminary studies on Triton X-100 solubilized fractions resolved the binding sites to a major component with an Mr of 65,000 and a minor component with an Mr of 125,000. We conclude that human erythrocyte membranes contain specific binding sites for RRR-alpha-tocopherol. These sites may be of physiologic significance in the function of tocopherol on the red blood cell membrane

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Multiple Carbohydrate Binding Specificities of Helicobacter pylori

Science.gov (United States)

Teneberg, Susann

Persistent colonization of the human stomach by Helicobacter pylori is a risk factor for the development of peptic ulcer disease and gastric cancer. Adhesion of microbes to the target tissue is an important determinant for successful initiation, establishment and maintenance of infection, and a variety of different candidate carbohydrate receptors for H. pylori have been identified. Here the different the binding specifities, and their potential role in adhesion to human gastric epithelium are described. Finally, recent findings on the roles of sialic acid binding SabA adhesin in interactions with human neutrophils and erythrocytes are discussed.

Position specific variation in the rate of evolution intranscription factor binding sites

Energy Technology Data Exchange (ETDEWEB)

Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.

2003-08-28

The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

Distinction between infection and inflammation by a 99mTc-labeled anti (1→3) – β - D - glucans aptamer

International Nuclear Information System (INIS)

Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R.; Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N.

2015-01-01

The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with 99m Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with 32 P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with 99m Tc by the direct labeling method. The stability of the 99m Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with 99m Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The 32 P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with 99m Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals infected with C. albicans presented a

A Novel Carbohydrate-binding Module from Sugar Cane Soil Metagenome Featuring Unique Structural and Carbohydrate Affinity Properties*

Science.gov (United States)

Campos, Bruna Medeia; Alvarez, Thabata Maria; Zanphorlin, Letícia Maria; Ematsu, Gabriela Cristina; Barud, Hernane; Polikarpov, Igor; Ruller, Roberto; Gilbert, Harry J.; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2016-01-01

Carbohydrate-binding modules (CBMs) are appended to glycoside hydrolases and can contribute to the degradation of complex recalcitrant substrates such as the plant cell wall. For application in bioethanol production, novel enzymes with high catalytic activity against recalcitrant lignocellulosic material are being explored and developed. In this work, we report the functional and structural study of CBM_E1, which was discovered through a metagenomics approach and is the founding member of a novel CBM family, CBM81. CBM_E1, which is linked to an endoglucanase, displayed affinity for mixed linked β1,3-β1,4-glucans, xyloglucan, Avicel, and cellooligosaccharides. The crystal structure of CBM_E1 in complex with cellopentaose displayed a canonical β-sandwich fold comprising two β-sheets. The planar ligand binding site, observed in a parallel orientation with the β-strands, is a typical feature of type A CBMs, although the expected affinity for bacterial crystalline cellulose was not detected. Conversely, the binding to soluble glucans was enthalpically driven, which is typical of type B modules. These unique properties of CBM_E1 are at the interface between type A and type B CBMs. PMID:27621314

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2016-01-01

Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

Specific binding assay technique; standardization of reagent

International Nuclear Information System (INIS)

Huggins, K.G.; Roitt, I.M.

1979-01-01

The standardization of a labelled constituent, such as anti-IgE, for use in a specific binding assay method is disclosed. A labelled ligand, such as IgE, is standardized against a ligand reference substance, such as WHO standard IgE, to determine the weight of IgE protein represented by the labelled ligand. Anti-light chain antibodies are contacted with varying concentrations of the labelled ligand. The ligand is then contacted with the labelled constituent which is then quantitated in relation to the amount of ligand protein present. The preparation of 131 I-labelled IgE is described. Also disclosed is an improved specific binding assay test method for determining the potency of an allergen extract in serum from an allergic individual. The improvement involved using a parallel model system of a second complex which consisted of anti-light chain antibodies, labelled ligand and the standardized labelled constituent (anti-IgE). The amount of standardized labelled constituent bound to the ligand in the first complex was determined, as described above, and the weight of ligand inhibited by addition of soluble allergen was then used as a measure of the potency of the allergen extract. (author)

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

Science.gov (United States)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

Science.gov (United States)

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

Binding proteins enhance specific uptake rate by increasing the substrate-transporter encounter rate.

Science.gov (United States)

Bosdriesz, Evert; Magnúsdóttir, Stefanía; Bruggeman, Frank J; Teusink, Bas; Molenaar, Douwe

2015-06-01

Microorganisms rely on binding-protein assisted, active transport systems to scavenge for scarce nutrients. Several advantages of using binding proteins in such uptake systems have been proposed. However, a systematic, rigorous and quantitative analysis of the function of binding proteins is lacking. By combining knowledge of selection pressure and physiochemical constraints, we derive kinetic, thermodynamic, and stoichiometric properties of binding-protein dependent transport systems that enable a maximal import activity per amount of transporter. Under the hypothesis that this maximal specific activity of the transport complex is the selection objective, binding protein concentrations should exceed the concentration of both the scarce nutrient and the transporter. This increases the encounter rate of transporter with loaded binding protein at low substrate concentrations, thereby enhancing the affinity and specific uptake rate. These predictions are experimentally testable, and a number of observations confirm them. © 2015 FEBS.

Variable Extent of Lineage-Specificity and Developmental Stage-Specificity of Cohesin and CCCTC-Binding Factor Binding Within the Immunoglobulin and T Cell Receptor Loci

Directory of Open Access Journals (Sweden)

Salvatore Loguercio

2018-03-01

Full Text Available CCCTC-binding factor (CTCF is largely responsible for the 3D architecture of the genome, in concert with the action of cohesin, through the creation of long-range chromatin loops. Cohesin is hypothesized to be the main driver of these long-range chromatin interactions by the process of loop extrusion. Here, we performed ChIP-seq for CTCF and cohesin in two stages each of T and B cell differentiation and examined the binding pattern in all six antigen receptor (AgR loci in these lymphocyte progenitors and in mature T and B cells, ES cells, and fibroblasts. The four large AgR loci have many bound CTCF sites, most of which are only occupied in lymphocytes, while only the CTCF sites at the end of each locus near the enhancers or J genes tend to be bound in non-lymphoid cells also. However, despite the generalized lymphocyte restriction of CTCF binding in AgR loci, the Igκ locus is the only locus that also shows significant lineage-specificity (T vs. B cells and developmental stage-specificity (pre-B vs. pro-B in CTCF binding. We show that cohesin binding shows greater lineage- and stage-specificity than CTCF at most AgR loci, providing more specificity to the loops. We also show that the culture of pro-B cells in IL7, a common practice to expand the number of cells before ChIP-seq, results in a CTCF-binding pattern resembling pre-B cells, as well as other epigenetic and transcriptional characteristics of pre-B cells. Analysis of the orientation of the CTCF sites show that all sites within the large V portions of the Igh and TCRβ loci have the same orientation. This suggests either a lack of requirement for convergent CTCF sites creating loops, or indicates an absence of any loops between CTCF sites within the V region portion of those loci but only loops to the convergent sites at the D-J-enhancer end of each locus. The V region portions of the Igκ and TCRα/δ loci, by contrast, have CTCF sites in both orientations, providing many options for

Stereochemical determinants of C-terminal specificity in PDZ peptide-binding domains: a novel contribution of the carboxylate-binding loop.

Science.gov (United States)

Amacher, Jeanine F; Cushing, Patrick R; Bahl, Christopher D; Beck, Tobias; Madden, Dean R

2013-02-15

PDZ (PSD-95/Dlg/ZO-1) binding domains often serve as cellular traffic engineers, controlling the localization and activity of a wide variety of binding partners. As a result, they play important roles in both physiological and pathological processes. However, PDZ binding specificities overlap, allowing multiple PDZ proteins to mediate distinct effects on shared binding partners. For example, several PDZ domains bind the cystic fibrosis (CF) transmembrane conductance regulator (CFTR), an epithelial ion channel mutated in CF. Among these binding partners, the CFTR-associated ligand (CAL) facilitates post-maturational degradation of the channel and is thus a potential therapeutic target. Using iterative optimization, we previously developed a selective CAL inhibitor peptide (iCAL36). Here, we investigate the stereochemical basis of iCAL36 specificity. The crystal structure of iCAL36 in complex with the CAL PDZ domain reveals stereochemical interactions distributed along the peptide-binding cleft, despite the apparent degeneracy of the CAL binding motif. A critical selectivity determinant that distinguishes CAL from other CFTR-binding PDZ domains is the accommodation of an isoleucine residue at the C-terminal position (P(0)), a characteristic shared with the Tax-interacting protein-1. Comparison of the structures of these two PDZ domains in complex with ligands containing P(0) Leu or Ile residues reveals two distinct modes of accommodation for β-branched C-terminal side chains. Access to each mode is controlled by distinct residues in the carboxylate-binding loop. These studies provide new insights into the primary sequence determinants of binding motifs, which in turn control the scope and evolution of PDZ interactomes.

Lack of specific (3H) prazosin binding sites in dog and rabbit cerebral arteries

International Nuclear Information System (INIS)

Ferron, P.M.; Banner, W. Jr.; Duckles, S.P.

1984-01-01

In order to explore the characteristics of alpha adrenergic receptors on cerebrovascular smooth muscle, specific binding sites for the alpha 1 adrenergic ligand, ( 3 H) prazosin, were studied in blood vessel homogenates. No specific ( 3 H) prazosin binding was found in either rabbit or dog cerebral arteries, but specific binding was demonstrated in the rabbit saphenous and ear arteries. In the ear artery 3 H-prazosin binding was saturable with a K/sub d/ of 0.51 +/- 0.20 nM and a Bmax of 89 +/- 29 fmoles/mg protein. To confirm the adequacy of our membrane preparation, homogenates of both dog and rabbit cerebral arteries showed saturable specific binding with two different ligands: one for muscarinic receptors, [ 3 H](-) quinuclidinyl benzilate (QNB) and one for alpha 2 adrenergic receptors, ( 3 H) yohimbine. The results of these studies demonstrate a lack of alpha 1 adrenergic receptors on cerebral blood vessels, confirming functional studies showing only a weak contractile response to norepinephrine. 29 references, 3 figures, 2 tables

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

Science.gov (United States)

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

Science.gov (United States)

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

Directory of Open Access Journals (Sweden)

A. Korpi

2003-01-01

Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

Directory of Open Access Journals (Sweden)

Fengdan Jin

2014-01-01

Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

��-attack on glucose units irrespective of glycosidic linkage and neighborhood. The method was demonstrated to be 1) sufficiently sensitive to allow for the analysis of oxidation products also from a mild ascorbate-driven Fenton reaction, and 2) to be specific for cereal β-glucan even in the presence of other co-oxidized polysaccharides. This opens doors to applications in food processing to assess potential oxidations and provides the detailed structural basis to understand the effect oxidized functional groups have on β-glucan’s health promoting and technological properties.

Distinction between infection and inflammation by a {sup 99m}Tc-labeled anti (1→3) – β - D - glucans aptamer

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R., E-mail: cmslacerda@gmail.com.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N., E-mail: valbertcardoso@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas

2015-07-01

The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with {sup 99m}Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with {sup 32}P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with {sup 99m}Tc by the direct labeling method. The stability of the {sup 99m}Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with {sup 99m}Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The {sup 32}P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with {sup 99m}Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

Functional Equivalence of Retroviral MA Domains in Facilitating Psi RNA Binding Specificity by Gag

Directory of Open Access Journals (Sweden)

Tiffiny Rye-McCurdy

2016-09-01

Full Text Available Retroviruses specifically package full-length, dimeric genomic RNA (gRNA even in the presence of a vast excess of cellular RNA. The “psi” (Ψ element within the 5′-untranslated region (5′UTR of gRNA is critical for packaging through interaction with the nucleocapsid (NC domain of Gag. However, in vitro Gag binding affinity for Ψ versus non-Ψ RNAs is not significantly different. Previous salt-titration binding assays revealed that human immunodeficiency virus type 1 (HIV-1 Gag bound to Ψ RNA with high specificity and relatively few charge interactions, whereas binding to non-Ψ RNA was less specific and involved more electrostatic interactions. The NC domain was critical for specific Ψ binding, but surprisingly, a Gag mutant lacking the matrix (MA domain was less effective at discriminating Ψ from non-Ψ RNA. We now find that Rous sarcoma virus (RSV Gag also effectively discriminates RSV Ψ from non-Ψ RNA in a MA-dependent manner. Interestingly, Gag chimeras, wherein the HIV-1 and RSV MA domains were swapped, maintained high binding specificity to cognate Ψ RNAs. Using Ψ RNA mutant constructs, determinants responsible for promoting high Gag binding specificity were identified in both systems. Taken together, these studies reveal the functional equivalence of HIV-1 and RSV MA domains in facilitating Ψ RNA selectivity by Gag, as well as Ψ elements that promote this selectivity.

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

Science.gov (United States)

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan

Directory of Open Access Journals (Sweden)

Adrian Wiater

2016-09-01

Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.

Mechanism of selective VEGF-A binding by neuropilin-1 reveals a basis for specific ligand inhibition.

Directory of Open Access Journals (Sweden)

Matthew W Parker

Full Text Available Neuropilin (Nrp receptors function as essential cell surface receptors for the Vascular Endothelial Growth Factor (VEGF family of proangiogenic cytokines and the semaphorin 3 (Sema3 family of axon guidance molecules. There are two Nrp homologues, Nrp1 and Nrp2, which bind to both overlapping and distinct members of the VEGF and Sema3 family of molecules. Nrp1 specifically binds the VEGF-A(164/5 isoform, which is essential for developmental angiogenesis. We demonstrate that VEGF-A specific binding is governed by Nrp1 residues in the b1 coagulation factor domain surrounding the invariant Nrp C-terminal arginine binding pocket. Further, we show that Sema3F does not display the Nrp-specific binding to the b1 domain seen with VEGF-A. Engineered soluble Nrp receptor fragments that selectively sequester ligands from the active signaling complex are an attractive modality for selectively blocking the angiogenic and chemorepulsive functions of Nrp ligands. Utilizing the information on Nrp ligand binding specificity, we demonstrate Nrp constructs that specifically sequester Sema3 in the presence of VEGF-A. This establishes that unique mechanisms are used by Nrp receptors to mediate specific ligand binding and that these differences can be exploited to engineer soluble Nrp receptors with specificity for Sema3.

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

Science.gov (United States)

Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

2016-03-01

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

Science.gov (United States)

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

The PP1 binding code: a molecular-lego strategy that governs specificity.

Science.gov (United States)

Heroes, Ewald; Lesage, Bart; Görnemann, Janina; Beullens, Monique; Van Meervelt, Luc; Bollen, Mathieu

2013-01-01

Ser/Thr protein phosphatase 1 (PP1) is a single-domain hub protein with nearly 200 validated interactors in vertebrates. PP1-interacting proteins (PIPs) are ubiquitously expressed but show an exceptional diversity in brain, testis and white blood cells. The binding of PIPs is mainly mediated by short motifs that dock to surface grooves of PP1. Although PIPs often contain variants of the same PP1 binding motifs, they differ in the number and combination of docking sites. This molecular-lego strategy for binding to PP1 creates holoenzymes with unique properties. The PP1 binding code can be described as specific, universal, degenerate, nonexclusive and dynamic. PIPs control associated PP1 by interference with substrate recruitment or access to the active site. In addition, some PIPs have a subcellular targeting domain that promotes dephosphorylation by increasing the local concentration of PP1. The diversity of the PP1 interactome and the properties of the PP1 binding code account for the exquisite specificity of PP1 in vivo. © 2012 The Authors Journal compilation © 2012 FEBS.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

Science.gov (United States)

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Cross-modal working memory binding and word recognition skills: how specific is the link?

Science.gov (United States)

Wang, Shinmin; Allen, Richard J

2018-04-01

Recent research has suggested that the creation of temporary bound representations of information from different sources within working memory uniquely relates to word recognition abilities in school-age children. However, it is unclear to what extent this link is attributable specifically to the binding ability for cross-modal information. This study examined the performance of Grade 3 (8-9 years old) children on binding tasks requiring either temporary association formation of two visual items (i.e., within-modal binding) or pairs of visually presented abstract shapes and auditorily presented nonwords (i.e., cross-modal binding). Children's word recognition skills were related to performance on the cross-modal binding task but not on the within-modal binding task. Further regression models showed that cross-modal binding memory was a significant predictor of word recognition when memory for its constituent elements, general abilities, and crucially, within-modal binding memory were taken into account. These findings may suggest a specific link between the ability to bind information across modalities within working memory and word recognition skills.

Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

Specificity of binding to four-way junctions in DNA by bacteriophage T7 endonuclease I.

OpenAIRE

Parsons, C A; West, S C

1990-01-01

T7 endonuclease I binds specifically to four-way junctions in duplex DNA and promotes their resolution into linear duplexes. Under conditions in which the nuclease activity is blocked by the absence of divalent cations, the enzyme forms a distinct protein-DNA complex with the junction, as detected by gel retardation and filter binding assays. The formation of this complex is structure-specific and contrasts with the short-lived binding complexes formed on linear duplex DNA. The binding comple...

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

Science.gov (United States)

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

Institute of Scientific and Technical Information of China (English)

MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

2015-01-01

This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

Specificity and sensitivity of binding proteins in the radioimmunoassay of cortisol

International Nuclear Information System (INIS)

Gijzen, A.H.J.

1977-01-01

A comparison concerning avidity towards cortisol and 10 other steroids was made between several binding proteins either in solution or bound to cellulose as so called ''solid phase'' reagent. Human blood cortisol binding protein (CBP, transcortin), and two distinctly different cortisol-binding rabbit antisera and the isolated immunoglobulins thereof were compared in their avidity to bind cortisol and several other steroids. The antisera were harvested from rabbits immunized with either cortisol-21-succinyl-albumin (CSA) or cortisol-3-oxim-albumin (COA). The latter antiserum, having the highest titre in cortisol titration, showed the greatest specificity and was most useful as a binding reagent in cortisol radioimmunoassay when used as a solid phase reagent. The determination of cortisol in micro samples of blood serum is possible without steroid extraction or serum protein denaturation and with only minor influence of steroid impurities in the sample to be analyzed. Affinity constants for all compared binding reagents and steroids are given

Specificity of cellular DNA-binding sites of microbial populations in a Florida reservoir

International Nuclear Information System (INIS)

Paul, J.H.; Pichard, S.L.

1989-01-01

The substrate specificity of the DNA-binding mechanism(s) of bacteria in a Florida reservoir was investigated in short- and long-term uptake studies with radiolabeled DNA and unlabeled competitors. Thymine oligonucleotides ranging in size from 2 base pairs to 19 to 24 base pairs inhibited DNA binding in 20-min incubations by 43 to 77%. Deoxynucleoside monophosphates, thymidine, and thymine had little effect on short-term DNA binding, although several of these compounds inhibited the uptake of the radiolabel from DNA in 4-h incubations. Inorganic phosphate and glucose-1-phosphate inhibited neither short- nor long-term binding of [ 3 H]- or [ 32 P]DNA, indicating that DNA was not utilized as a phosphorous source in this reservoir. RNA inhibited both short- and long-term radiolabeled DNA uptake as effectively as unlabeled DNA. Collectively these results indicate that aquatic bacteria possess a generalized nuclei acid uptake/binding mechanism specific for compounds containing phosphodiester bonds and capable of recognizing oligonucleotides as short as dinucleotides. This binding site is distinct from nucleoside-, nucleotide-, phosphomonoester-, and inorganic phosphate-binding sites. Such a nucleic acid-binding mechanism may have evolved for the utilization of extracellular DNA (and perhaps RNA), which is abundant in many marine and freshwater environments

Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

Science.gov (United States)

Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

2013-12-15

A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

Towards a more versatile alpha-glucan biosynthesis in plants

NARCIS (Netherlands)

Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

2003-01-01

Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

Science.gov (United States)

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

Science.gov (United States)

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

RNA binding specificity of Ebola virus transcription factor VP30.

Science.gov (United States)

Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

2016-09-01

The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Correlation between (3H)dopamine specific uptake and (3H)GBR 12783 specific binding during the maturation of rat striatum

International Nuclear Information System (INIS)

Bonnet, J.J.; Costentin, J.

1989-01-01

The development of the specific uptake of dopamine in the rat striatum during the early postnatal period is compared with the ontogenetic changes of the specific binding of ( 3 H)GBR 12783 to the site of uptake inhibition. During maturation, the increase in the specific binding of ( 3 H)GBR 12783 parallels the increase in the specific uptake of dopamine. ( 3 H)GBR 12783 specific binding sites increase in number from day 1 postpartum until 40 days, when they reach the adult level. In 40 day-old rats, the weight of the striatum represents 80% of adult values. The affinity of ( 3 H)GBR 12783 for the inhibition site is similar in membrane preparations obtained from 6 day-old pups and adults; this results in a same ability of the inhibitor to block the specific uptake of dopamine into synaptosomes obtained from pups or adult rats. These data support the hypothesis of the existence of a single molecular entity including both the inhibition site and the carrier itself

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

Science.gov (United States)

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

NARCIS (Netherlands)

Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

2010-01-01

An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

Structural Determinants of Specific Lipid Binding to Potassium Channels

NARCIS (Netherlands)

Weingarth, M.H.|info:eu-repo/dai/nl/330985655; Prokofyev, A.; van der Cruijsen, E.A.W.|info:eu-repo/dai/nl/330826743; Nand, D.|info:eu-repo/dai/nl/337731403; Bonvin, A.M.J.J.|info:eu-repo/dai/nl/113691238; Pongs, O.; Baldus, M.|info:eu-repo/dai/nl/314410864

2013-01-01

We have investigated specific lipid binding to the pore domain of potassium channels KcsA and chimeric KcsAKv1.3 on the structural and functional level using extensive coarse-grained and atomistic molecular dynamics simulations, solid-state NMR, and single channel measurements. We show that, while

Species specificity for HBsAg binding protein endonexin II

NARCIS (Netherlands)

deBruin, WCC; Leenders, WPJ; Moshage, H; vanHaelst, UJGM

Background/Aims: Hepatitis B virus displays a distinct species and tissue tropism, Previously we have demonstrated that a human liver plasma membrane protein,vith a molecular weight of approximately 34 kiloDalton specifically binds to HBsAg. This protein was identified as endonexin II, a Ca2+

Human Blue Cone Opsin Regeneration Involves Secondary Retinal Binding with Analog Specificity.

Science.gov (United States)

Srinivasan, Sundaramoorthy; Fernández-Sampedro, Miguel A; Morillo, Margarita; Ramon, Eva; Jiménez-Rosés, Mireia; Cordomí, Arnau; Garriga, Pere

2018-03-27

Human color vision is mediated by the red, green, and blue cone visual pigments. Cone opsins are G-protein-coupled receptors consisting of an opsin apoprotein covalently linked to the 11-cis-retinal chromophore. All visual pigments share a common evolutionary origin, and red and green cone opsins exhibit a higher homology, whereas blue cone opsin shows more resemblance to the dim light receptor rhodopsin. Here we show that chromophore regeneration in photoactivated blue cone opsin exhibits intermediate transient conformations and a secondary retinoid binding event with slower binding kinetics. We also detected a fine-tuning of the conformational change in the photoactivated blue cone opsin binding site that alters the retinal isomer binding specificity. Furthermore, the molecular models of active and inactive blue cone opsins show specific molecular interactions in the retinal binding site that are not present in other opsins. These findings highlight the differential conformational versatility of human cone opsin pigments in the chromophore regeneration process, particularly compared to rhodopsin, and point to relevant functional, unexpected roles other than spectral tuning for the cone visual pigments. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A constitutive damage specific DNA-binding protein is synthesized at higher levels in UV-irradiated primate cells

International Nuclear Information System (INIS)

Hirschfeld, S.; Levine, A.S.; Ozato, K.; Protic, M.

1990-01-01

Using a DNA band shift assay, we have identified a DNA-binding protein complex in primate cells which is present constitutively and has a high affinity for UV-irradiated, double-stranded DNA. Cells pretreated with UV light, mitomycin C, or aphidicolin have higher levels of this damage-specific DNA-binding protein complex, suggesting that the signal for induction can either be damage to the DNA or interference with cellular DNA replication. Physiochemical modifications of the DNA and competition analysis with defined substrates suggest that the most probable target site for the damage-specific DNA-binding protein complex is a 6-4'-(pyrimidine-2'-one)-pyrimidine dimer: specific binding could not be detected with probes which contain -TT- cyclobutane dimers, and damage-specific DNA binding did not decrease after photoreactivation of UV-irradiated DNA. This damage-specific DNA-binding protein complex is the first such inducible protein complex identified in primate cells. Cells from patients with the sun-sensitive cancer-prone disease, xeroderma pigmentosum (group E), are lacking both the constitutive and the induced damage-specific DNA-binding activities. These findings suggest a possible role for this DNA-binding protein complex in lesion recognition and DNA repair of UV-light-induced photoproducts

Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

International Nuclear Information System (INIS)

Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

2012-01-01

Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

Highly Specific Binding on Antifouling Zwitterionic Polymer-Coated Microbeads as Measured by Flow Cytometry.

Science.gov (United States)

van Andel, Esther; de Bus, Ian; Tijhaar, Edwin J; Smulders, Maarten M J; Savelkoul, Huub F J; Zuilhof, Han

2017-11-08

Micron- and nano-sized particles are extensively used in various biomedical applications. However, their performance is often drastically hampered by the nonspecific adsorption of biomolecules, a process called biofouling, which can cause false-positive and false-negative outcomes in diagnostic tests. Although antifouling coatings have been extensively studied on flat surfaces, their use on micro- and nanoparticles remains largely unexplored, despite the widespread experimental (specifically, clinical) uncertainties that arise because of biofouling. Here, we describe the preparation of magnetic micron-sized beads coated with zwitterionic sulfobetaine polymer brushes that display strong antifouling characteristics. These coated beads can then be equipped with recognition elements of choice, to enable the specific binding of target molecules. First, we present a proof of principle with biotin-functionalized beads that are able to specifically bind fluorescently labeled streptavidin from a complex mixture of serum proteins. Moreover, we show the versatility of the method by demonstrating that it is also possible to functionalize the beads with mannose moieties to specifically bind the carbohydrate-binding protein concanavalin A. Flow cytometry was used to show that thus-modified beads only bind specifically targeted proteins, with minimal/near-zero nonspecific protein adsorption from other proteins that are present. These antifouling zwitterionic polymer-coated beads, therefore, provide a significant advancement for the many bead-based diagnostic and other biosensing applications that require stringent antifouling conditions.

Heparin-associated thrombocytopenia: antibody binding specificity to platelet antigens.

Science.gov (United States)

Lynch, D M; Howe, S E

1985-11-01

Sera from four patients with heparin-associated thrombocytopenia (HAT) were evaluated by a quantitative enzyme-linked immunosorbent assay (ELISA) to detect heparin-dependent serum platelet-bindable immunoglobulin (S-PBIg) and by Western blotting and immunoprecipitation to investigate the specificity of the antibody binding. All HAT sera showed mildly increased S-PBIg (mean, 7.8 fg per platelet; normal, less than 6.0 fg per platelet) to intact target platelets in the ELISA, which was markedly increased in the presence of heparin (mean, 20.9 fg per platelet). This increase was 20-fold greater than normal control sera, which showed a mean differential increase of only 0.5 fg per platelet. Immunoglobulin binding specificity to platelet antigens was investigated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis of platelet lysate with transfer of the platelet fractions onto nitrocellulose strips (Western blotting) and subsequent immunoassay using HAT and normal sera. In the presence of heparin, the four HAT patients demonstrated increased binding of immunoglobulin to platelet antigens of apparent molecular weights of 180, 124, and 82 kd. Radiolabeled heparin when incubated with HAT sera, normal sera, or albumin blanks bound to platelet proteins of the same apparent molecular weights. These observations are consistent with current hypotheses suggesting that HAT antibody is directed to heparin-platelet complexes or, alternatively, that heparin induces conformational change of antigenic sites on the platelet membrane.

Presence of specific growth hormone binding sites in rainbow trout (Oncorhynchus mykiss) tissues: characterization of the hepatic receptor

Energy Technology Data Exchange (ETDEWEB)

Yao, K.; Niu, P.D.; Le Gac, F.; Le Bail, P.Y. (Laboratoire de Physiologie des Poissons, INRA, Rennes, (France))

1991-01-01

The present work outlines the presence of specific binding for chinook salmon growth hormone (sGH) in different tissue preparations of rainbow trout. Optimal incubation conditions (pH, Tris, MgCl{sub 2}) were determined. Specific binding was very sensitive to salt concentration during incubation. The specific binding reached a plateau after 15 and 25 hr of incubation at 12 and 4 {degree}. At 20 {degree}, specific and nonspecific binding were not stable. Specific binding dissociation was slower than association and was only partial. The binding was saturable (Bmax = 187 +/- 167 pmol), of high affinity (Ka = 2.4 +/- 0.8 10(9) M-1), and very specific for GH, properties which are in agreement with the characteristics of hormonal receptors. Sea bream and mammalian GH appeared 2- and 30-fold, respectively, less potent than cold sGH2 for displacing {sup 125}I-sGH2. Tissue preparations from ovary, testis, fat, skin, cartilage, gill, blood pellet, brain, spleen, kidney, and muscle showed significant saturable binding.

Presence of specific growth hormone binding sites in rainbow trout (Oncorhynchus mykiss) tissues: characterization of the hepatic receptor

International Nuclear Information System (INIS)

Yao, K.; Niu, P.D.; Le Gac, F.; Le Bail, P.Y.

1991-01-01

The present work outlines the presence of specific binding for chinook salmon growth hormone (sGH) in different tissue preparations of rainbow trout. Optimal incubation conditions (pH, Tris, MgCl 2 ) were determined. Specific binding was very sensitive to salt concentration during incubation. The specific binding reached a plateau after 15 and 25 hr of incubation at 12 and 4 degree. At 20 degree, specific and nonspecific binding were not stable. Specific binding dissociation was slower than association and was only partial. The binding was saturable (Bmax = 187 +/- 167 pmol), of high affinity (Ka = 2.4 +/- 0.8 10(9) M-1), and very specific for GH, properties which are in agreement with the characteristics of hormonal receptors. Sea bream and mammalian GH appeared 2- and 30-fold, respectively, less potent than cold sGH2 for displacing 125 I-sGH2. Tissue preparations from ovary, testis, fat, skin, cartilage, gill, blood pellet, brain, spleen, kidney, and muscle showed significant saturable binding

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-03-17

Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-01-01

Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

DEFF Research Database (Denmark)

Holst, Gitte Juel; Høst, Arne; Doekes, G

2015-01-01

Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

Candida albicans mannans mediate Streptococcus mutans exoenzyme GtfB binding to modulate cross-kingdom biofilm development in vivo.

Science.gov (United States)

Hwang, Geelsu; Liu, Yuan; Kim, Dongyeop; Li, Yong; Krysan, Damian J; Koo, Hyun

2017-06-01

Candida albicans is frequently detected with heavy infection by Streptococcus mutans in plaque-biofilms from children with early-childhood caries (ECC). This cross-kingdom biofilm contains an extensive matrix of extracellular α-glucans that is produced by an exoenzyme (GtfB) secreted by S. mutans. Here, we report that mannans located on the outer surface of C. albicans cell-wall mediates GtfB binding, enhancing glucan-matrix production and modulating bacterial-fungal association within biofilms formed in vivo. Using single-molecule atomic force microscopy, we determined that GtfB binds with remarkable affinity to mannans and to the C. albicans surface, forming a highly stable and strong bond (1-2 nN). However, GtfB binding properties to C. albicans was compromised in strains defective in O-mannan (pmt4ΔΔ) or N-mannan outer chain (och1ΔΔ). In particular, the binding strength of GtfB on och1ΔΔ strain was severely disrupted (>3-fold reduction vs. parental strain). In turn, the GtfB amount on the fungal surface was significantly reduced, and the ability of C. albicans mutant strains to develop mixed-species biofilms with S. mutans was impaired. This phenotype was independent of hyphae or established fungal-biofilm regulators (EFG1, BCR1). Notably, the mechanical stability of the defective biofilms was weakened, resulting in near complete biomass removal by shear forces. In addition, these in vitro findings were confirmed in vivo using a rodent biofilm model. Specifically, we observed that C. albicans och1ΔΔ was unable to form cross-kingdom biofilms on the tooth surface of rats co-infected with S. mutans. Likewise, co-infection with S. mutans defective in GtfB was also incapable of forming mixed-species biofilms. Taken together, the data support a mechanism whereby S. mutans-secreted GtfB binds to the mannan layer of C. albicans to promote extracellular matrix formation and their co-existence within biofilms. Enhanced understanding of GtfB-Candida interactions

Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

Science.gov (United States)

Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

2014-01-01

Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

Visualization of specific binding sites of benzodiazepine in human brain

International Nuclear Information System (INIS)

Shinotoh, H.; Yamasaki, T.; Inoue, O.; Itoh, T.; Suzuki, K.; Hashimoto, K.; Tateno, Y.; Ikehira, H.

1986-01-01

Using 11C-labeled Ro15-1788 and positron emission tomography, studies of benzodiazepine binding sites in the human brain were performed on four normal volunteers. Rapid and high accumulation of 11C activity was observed in the brain after i.v. injection of [11C]Ro15-1788, the maximum of which was within 12 min. Initial distribution of 11C activity in the brain was similar to the distribution of the normal cerebral blood flow. Ten minutes after injection, however, a high uptake of 11C activity was observed in the cerebral cortex and moderate uptake was seen in the cerebellar cortex, the basal ganglia, and the thalamus. The accumulation of 11C activity was low in the brain stem. This distribution of 11C activity was approximately parallel to the known distribution of benzodiazepine receptors. Saturation experiments were performed on four volunteers with oral administration of 0.3-1.8 mg/kg of cold Ro15-1788 prior to injection. Initial distribution of 11C activity following injection peaked within 2 min and then the accumulation of 11C activity decreased rapidly and remarkably throughout the brain. The results indicated that [11C] Ro15-1788 associates and dissociates to specific and nonspecific binding sites rapidly and has a high ratio of specific receptor binding to nonspecific binding in vivo. Carbon-11 Ro15-1788 is a suitable radioligand for the study of benzodiazepine receptors in vivo in humans

Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

Science.gov (United States)

Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

2013-01-01

WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

Directory of Open Access Journals (Sweden)

Anitha Shanmugham

Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

Science.gov (United States)

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

Science.gov (United States)

Vickerman, M M; Jones, G W

1992-10-01

Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.

Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

Science.gov (United States)

Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

2015-08-01

A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

98 Specific IGE and IGG Binding to Allergoids of Phleum pratense

Science.gov (United States)

Cases, Barbara; Fernandez-Caldas, Enrique; Tudela, Jose Ignacio; Fernandez, Eva Abel; Sanchez-Garcia, Silvia; Ibañez, M. Dolores; Escudero, Carmelo; Casanovas, Miguel

2012-01-01

Background Allergoids were first used in the decades of the 60s and 70s of the last century as an effective treatment of allergic respiratory diseases. Allergoids can be modified with formaldehyde or glutaraldehyde. Modified allergens, or allergoids, decrease the risk of adverse reactions while administering higher allergen doses. The objective of this study was to analyse specific IgE and IgG binding to glutaraldehyde modified and non-modified allergen extracts of Phleum pratense. Methods The sera of 69 patients sensitized to P. pratense were tested. All these patients had signs and symptoms of rhinoconjunctivitis with, or without, asthma in May and June of 2011. All these patients had positive skin prick tests to a standardized extract of P. pratense, and other grass species. Most patients were also sensitized to olive pollen. Specific IgE and IgG binding were analysed by direct ELISA against P. pratense native (non-modified) and allergoid extracts. Relative potencies were evaluated through ELISA inhibition assays, and the protein composition of non-modified and allergoid samples was determined by Mass Spectrometry (MS/MS). Results Mean Specific IgE levels against the native extract was 16.68 ± 11.65 Units (U) and against the allergoid: 7.26 ± 8.24 U (P allergoid (P = 0.16; Mann-Whitney). Linear regression coefficients obtained between immunoglobulin reactivity against both extracts were: r2 = 0.51 for specific IgE and r2 = 0.83 for specific IgG. An important decrease in the allergenic activity, measured by inhibition ELISA, was clearly observed. The MS/MS assay revealed the presence of the mayor allergen, and some isoforms, in non-modified and allergoid extracts. Conclusions Results obtained demonstrate that the glutaraldehyde polymerization process induces an important decrease in specific IgE binding to allergoids of P. pratense while there are no significant differences in specific IgG binding. The allergenic composition of the P. pratense allergoid was

The specific binding of the thyroid hormones to matrix isolated from rat liver nuclei

International Nuclear Information System (INIS)

Wilson, B.D.; Albrecht, C.F.; Wium, C.A.

1982-01-01

Specific binding sites for the thyroid hormones have been demonstrated in the liver nuclear matrix, a structural framework of the nucleus. When labelled 3,5,3'-tri-iodo-L-thyronine ([ 125 l]T 3 ) is injected into rats, 5% of the total nucleus bound T 3 is bound to the matrix after 1 hour. However, when either isolated nuclei or isolated nuclear matrices were incubated with[ 125 l]T 3 in vitro, a 3- to 7- fold greater number of specific T 3 binding sites were revealed in the nuclear matrix. The properties of the matrix-associated thyroid hormone binding sites were investigated in vitro. These binding sites showed limited capacity and high affinity for T 3 ; the equilibrium association constant (K(a)) was 1,3X10 M -1 and the binding capacity was 20,2 fmol T 3 per 100 μg matrix protein

Specific Internalisation of Gold Nanoparticles into Engineered Porous Protein Cages via Affinity Binding.

Science.gov (United States)

Paramelle, David; Peng, Tao; Free, Paul; Fernig, David G; Lim, Sierin; Tomczak, Nikodem

2016-01-01

Porous protein cages are supramolecular protein self-assemblies presenting pores that allow the access of surrounding molecules and ions into their core in order to store and transport them in biological environments. Protein cages' pores are attractive channels for the internalisation of inorganic nanoparticles and an alternative for the preparation of hybrid bioinspired nanoparticles. However, strategies based on nanoparticle transport through the pores are largely unexplored, due to the difficulty of tailoring nanoparticles that have diameters commensurate with the pores size and simultaneously displaying specific affinity to the cages' core and low non-specific binding to the cages' outer surface. We evaluated the specific internalisation of single small gold nanoparticles, 3.9 nm in diameter, into porous protein cages via affinity binding. The E2 protein cage derived from the Geobacillus stearothermophilus presents 12 pores, 6 nm in diameter, and an empty core of 13 nm in diameter. We engineered the E2 protein by site-directed mutagenesis with oligohistidine sequences exposing them into the cage's core. Dynamic light scattering and electron microscopy analysis show that the structures of E2 protein cages mutated with bis- or penta-histidine sequences are well conserved. The surface of the gold nanoparticles was passivated with a self-assembled monolayer made of a mixture of short peptidols and thiolated alkane ethylene glycol ligands. Such monolayers are found to provide thin coatings preventing non-specific binding to proteins. Further functionalisation of the peptide coated gold nanoparticles with Ni2+ nitrilotriacetic moieties enabled the specific binding to oligohistidine tagged cages. The internalisation via affinity binding was evaluated by electron microscopy analysis. From the various mutations tested, only the penta-histidine mutated E2 protein cage showed repeatable and stable internalisation. The present work overcomes the limitations of currently

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

Science.gov (United States)

Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

2011-03-01

This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Uncovering the Peptide-Binding Specificities of HLA-C: A General Strategy To Determine the Specificity of Any MHC Class I Molecule

DEFF Research Database (Denmark)

Rasmussen, Michael; Harndahl, Mikkel; Stryhn, Anette

2014-01-01

MHC class I molecules (HLA-I in humans) present peptides derived from endogenous proteins to CTLs. Whereas the peptide-binding specificities of HLA-A and -B molecules have been studied extensively, little is known about HLA-C specificities. Combining a positional scanning combinatorial peptide...... library approach with a peptide-HLA-I dissociation assay, in this study we present a general strategy to determine the peptide-binding specificity of any MHC class I molecule. We applied this novel strategy to 17 of the most common HLA-C molecules, and for 16 of these we successfully generated matrices...... representing their peptide-binding motifs. The motifs prominently shared a conserved C-terminal primary anchor with hydrophobic amino acid residues, as well as one or more diverse primary and auxiliary anchors at P1, P2, P3, and/or P7. Matrices were used to generate a large panel of HLA-C-specific peptide...

Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

Science.gov (United States)

Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

2017-03-01

Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

Science.gov (United States)

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

Identification of leukotriene D4 specific binding sites in the membrane preparation isolated from guinea pig lung

International Nuclear Information System (INIS)

Mong, S.; Wu, H.L.; Clark, M.A.; Stadel, J.M.; Gleason, J.G.; Crooke, S.T.

1984-01-01

A radioligand binding assay has been established to study leukotriene specific binding sites in the guinea pig and rabbit tissues. Using high specific activity [ 3 H]-leukotriene D4 [( 3 H]-LTD4), in the presence or absence of unlabeled LTD4, the diastereoisomer of LTD4 (5R,6S-LTD4), leukotriene E4 (LTE4) and the end-organ antagonist, FPL 55712, the authors have identified specific binding sites for [ 3 H]-LTD4 in the crude membrane fraction isolated from guinea pig lung. The time required for [ 3 H]-LTD4 binding to reach equilibrium was approximately 20 to 25 min at 37 degrees C in the presence of 10 mM Tris-HCl buffer (pH 7.5) containing 150 mM NaCl. The binding of [ 3 H]-LTD4 to the specific sites was saturable, reversible and stereospecific. The maximal number of binding sites (Bmax), derived from Scatchard analysis, was approximately 320 +/- 200 fmol per mg of crude membrane protein. The dissociation constants, derived from kinetic and saturation analyses, were 9.7 nM and 5 +/- 4 nM, respectively. The specific binding sites could not be detected in the crude membrane fraction prepared from guinea pig ileum, brain and liver, or rabbit lung, trachea, ileum and uterus. In radioligand competition experiments, LTD4, FPL 55712 and 5R,6S-LTD4 competed with [ 3 H]-LTD4. The metabolic inhibitors of arachidonic acid and SKF 88046, an antagonist of the indirectly-mediated actions of LTD4, did not significantly compete with [ 3 H]-LTD4 at the specific binding sites. These correlations indicated that these specific binding sites may be the putative leukotriene receptors in the guinea-pig lung

Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity.

Science.gov (United States)

Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y

1975-10-01

Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

Directory of Open Access Journals (Sweden)

Harry J. Wichers

2010-08-01

Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2013-01-01

Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

Detection of site-specific binding and co-binding of ligands to macromolecules using 19F NMR

International Nuclear Information System (INIS)

Jenkins, B.G.

1991-01-01

Study of ligand-macromolecular interactions by 19 F nuclear magnetic resonance (NMR) spectroscopy affords many opportunities for obtaining molecular biochemical and pharmaceutical information. This is due to the absence of a background fluorine signal, as well as the relatively high sensitivity of 19 F NMR. Use of fluorine-labeled ligands enables one to probe not only binding and co-binding phenomena to macromolecules, but also can provide data on binding constants, stoichiometries, kinetics, and conformational properties of these complexes. Under conditions of slow exchange and macromolecule-induced chemical shifts, multiple 19 F NMR resonances can be observed for free and bound ligands. These shifted resonances are a direct correlate of the concentration of ligand bound in a specific state rather than the global concentrations of bound or free ligand which are usually determined using other techniques such as absorption spectroscopy or equilibrium dialysis. Examples of these interactions are demonstrated both from the literature and from interactions of 5-fluorotryptophan, 5-fluorosalicylic acid, flurbiprofen, and sulindac sulfide with human serum albumin. Other applications of 19 F NMR to study of these interactions in vivo, as well for receptor binding and metabolic tracing of fluorinated drugs and proteins are discussed

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Porcine major histocompatibility complex (MHC) class I molecules and analysis of their peptide-binding specificities

DEFF Research Database (Denmark)

Pedersen, Lasse Eggers; Harndahl, Mikkel; Rasmussen, Michael

2011-01-01

a HLA-I molecule (HLA-A*11:01), thereby generating recombinant human/swine chimeric MHC-I molecules as well as the intact SLA-1*0401 molecule. Biochemical peptide-binding assays and positional scanning combinatorial peptide libraries were used to analyze the peptide-binding motifs of these molecules....... A pan-specific predictor of peptide–MHC-I binding, NetMHCpan, which was originally developed to cover the binding specificities of all known HLA-I molecules, was successfully used to predict the specificities of the SLA-1*0401 molecule as well as the porcine/human chimeric MHC-I molecules. These data......In all vertebrate animals, CD8+ cytotoxic T lymphocytes (CTLs) are controlled by major histocompatibility complex class I (MHC-I) molecules. These are highly polymorphic peptide receptors selecting and presenting endogenously derived epitopes to circulating CTLs. The polymorphism of the MHC...

Specific cell components of Bacteroides gingivalis mediate binding and degradation of human fibrinogen

Energy Technology Data Exchange (ETDEWEB)

Lantz, M.S.; Allen, R.D.; Vail, T.A.; Switalski, L.M.; Hook, M. (Univ. of Alabama at Birmingham (USA))

1991-01-01

Bacteroides (Porphyromonas) gingivalis, which has been implicated as an etiologic agent in human periodontal diseases, has been shown to bind and degrade human fibrinogen. B. gingivalis strains bind fibrinogen reversibly and with high affinity and bind to a specific region of the fibrinogen molecule that appears to be located between the D and E domains. The authors now report that human fibrinogen is bound and then degraded by specific B. gingivalis components that appear to be localized at the cell surface. Fibrinogen binding to bacterial cells occurred at 4, 22, and 37{degree}C. A functional fibrinogen-binding component (M{sub r}, 150 000) was identified when sodium dodecyl sulfate-solubilized bacteria were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and probed with {sup 125}I-fibrinogen. Fibrinogen degradation did not occur at 4{degree}C but did occur at 22 and 37{degree}C. When bacteria and iodinated fibrinogen were incubated at 37{degree}C, two major fibrinogen fragments (M{sub r}, 97 000 and 50 000) accumulated in incubation mixture supernatant fractions. Two major fibrinogen-degrading components (M{sub r}, 120 000 and 150 000) have been identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis in substrate-containing gels. Fibrinogen degradation by the M{sub r}-120 000 and -150 000 proteases was enhanced by reducing agents, completely inhibited by N-{alpha}-p-tosyl-L-lysyl chloromethyl ketone, and partially inhibited by n-ethyl maleimide, suggesting that these enzymes are thiol-dependent proteases with trypsinlike substrate specificity. The fibrinogen-binding component could be separated from the fibrinogen-degrading components by selective solubilization of bacteria in sodium deoxycholate.

Specific cell components of Bacteroides gingivalis mediate binding and degradation of human fibrinogen

International Nuclear Information System (INIS)

Lantz, M.S.; Allen, R.D.; Vail, T.A.; Switalski, L.M.; Hook, M.

1991-01-01

Bacteroides (Porphyromonas) gingivalis, which has been implicated as an etiologic agent in human periodontal diseases, has been shown to bind and degrade human fibrinogen. B. gingivalis strains bind fibrinogen reversibly and with high affinity and bind to a specific region of the fibrinogen molecule that appears to be located between the D and E domains. The authors now report that human fibrinogen is bound and then degraded by specific B. gingivalis components that appear to be localized at the cell surface. Fibrinogen binding to bacterial cells occurred at 4, 22, and 37 degree C. A functional fibrinogen-binding component (M r , 150 000) was identified when sodium dodecyl sulfate-solubilized bacteria were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and probed with 125 I-fibrinogen. Fibrinogen degradation did not occur at 4 degree C but did occur at 22 and 37 degree C. When bacteria and iodinated fibrinogen were incubated at 37 degree C, two major fibrinogen fragments (M r , 97 000 and 50 000) accumulated in incubation mixture supernatant fractions. Two major fibrinogen-degrading components (M r , 120 000 and 150 000) have been identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis in substrate-containing gels. Fibrinogen degradation by the M r -120 000 and -150 000 proteases was enhanced by reducing agents, completely inhibited by N-α-p-tosyl-L-lysyl chloromethyl ketone, and partially inhibited by n-ethyl maleimide, suggesting that these enzymes are thiol-dependent proteases with trypsinlike substrate specificity. The fibrinogen-binding component could be separated from the fibrinogen-degrading components by selective solubilization of bacteria in sodium deoxycholate

Long-term reproducibility of in vivo measures of specific binding of radioligands in rat brain

Energy Technology Data Exchange (ETDEWEB)

Kilbourn, Michael R. E-mail: mkilbour@umich.edu

2004-07-01

The long-term reproducibility of measures of in vivo specific binding of radiolabeled forms of (+)-{alpha}-dihydrotetrabenazine (DTBZ) and d-threo-methylphenidate (MPH) in rat brain was examined. All studies were done using a consistent bolus plus infusion protocol and calculation of equilibrium distribution volume ratios (DVR). Over a period of eight years striatal DVR values for DTBZ binding to the vesicular monoamine transporter 2 (VMAT2) in young adult (8-10 wks old) rats showed very good reproducibility (3.62{+-}0.33, N=35). Equivalent values were obtained using either tritiated or carbon-11 labeled DTBZ, and were irrespective of sex of animals. Older animals (78 wks old) showed losses (-45%) of specific binding. Striatal binding of MPH to the dopamine transporter (DAT) showed a similar reproducibility over a five year period (DVR=2.17{+-}0.39, N=52), again irrespective of radionuclide or sex. These studies demonstrate that use of a consistent in vivo technique can provide reliable measures of specific binding of radioligands to high affinity sites in the rat brain.

Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

KAUST Repository

Lee, Seung-Joo

2010-03-28

DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

DEFF Research Database (Denmark)

Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

2013-01-01

.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

DEFF Research Database (Denmark)

Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

2005-01-01

Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

2014-08-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

Science.gov (United States)

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Specificity of DNA-binding by the FAX-1 and NHR-67 nuclear receptors of Caenorhabditis elegans is partially mediated via a subclass-specific P-box residue

Directory of Open Access Journals (Sweden)

Smith Eric L

2008-01-01

Full Text Available Abstract Background The nuclear receptors of the NR2E class play important roles in pattern formation and nervous system development. Based on a phylogenetic analysis of DNA-binding domains, we define two conserved groups of orthologous NR2E genes: the NR2E1 subclass, which includes C. elegans nhr-67, Drosophila tailless and dissatisfaction, and vertebrate Tlx (NR2E2, NR2E4, NR2E1, and the NR2E3 subclass, which includes C. elegans fax-1 and vertebrate PNR (NR2E5, NR2E3. PNR and Tll nuclear receptors have been shown to bind the hexamer half-site AAGTCA, instead of the hexamer AGGTCA recognized by most other nuclear receptors, suggesting unique DNA-binding properties for NR2E class members. Results We show that NR2E3 subclass member FAX-1, unlike NHR-67 and other NR2E1 subclass members, binds to hexamer half-sites with relaxed specificity: it will bind hexamers with the sequence ANGTCA, although it prefers a purine to a pyrimidine at the second position. We use site-directed mutagenesis to demonstrate that the difference between FAX-1 and NHR-67 binding preference is partially mediated by a conserved subclass-specific asparagine or aspartate residue at position 19 of the DNA-binding domain. This amino acid position is part of the "P box" that plays a critical role in defining binding site specificity and has been shown to make hydrogen-bond contacts to the second position of the hexamer in co-crystal structures for other nuclear receptors. The relaxed specificity allows FAX-1 to bind a much larger repertoire of half-sites than NHR-67. While NR2E1 class proteins bind both monomeric and dimeric sites, the NR2E3 class proteins bind only dimeric sites. The presence of a single strong site adjacent to a very weak site allows dimeric FAX-1 binding, further increasing the number of dimeric binding sites to which FAX-1 may bind in vivo. Conclusion These findings identify subclass-specific DNA-binding specificities and dimerization properties for the NR2E1

Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

Directory of Open Access Journals (Sweden)

RISHIKESH SHUKLA

2012-01-01

Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

Energy Technology Data Exchange (ETDEWEB)

Rao, K.N.; Swaminathan, S.; Burley, S. K.

2008-12-11

We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

Science.gov (United States)

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

2015-01-01

Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

Directory of Open Access Journals (Sweden)

Jie Zheng

2013-12-01

Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

International Nuclear Information System (INIS)

Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

1989-01-01

A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

Directory of Open Access Journals (Sweden)

Michael Allevato

Full Text Available The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX bind Enhancer box (E-box DNA elements (CANNTG and have the greatest affinity for the canonical MYC E-box (CME CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87% of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

Science.gov (United States)

Shao, Yujing; Guo, Yuming; Wang, Zhong

2013-07-01

This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

Specific binding of antigen-antibody in physiological environments: Measurement, force characteristics and analysis

Science.gov (United States)

Gu, Xin; Zhou, Jun; Zhou, Lu; Xie, Shusen; Petti, Lucia; Wang, Shaomin; Wang, Fuyan

2018-05-01

The specific recognition of the antigen by the antibody is the crucial step in immunoassays. Measurement and analysis of the specific recognition, including the ways in which it is influenced by external factors are of paramount significance for the quality of the immunoassays. Using prostate-specific antigen (PSA)/anti-PSA antibody and α-fetoprotein (AFP) /anti-AFP antibody as examples, we have proposed a novel solution for measuring the binding forces between the antigens and their corresponding antibodies in different physiological environments by combining laminar flow control technology and optical tweezers technology. On the basis of the experimental results, the different binding forces of PSA/anti-PSA antibody and AFP/anti-AFP antibody in the same phosphate-buffered saline (PBS) environments are analysed by comparing the affinity constant of the two antibodies and the number of antigenic determinants of the two antigens. In different electrolyte environments, the changes of the binding force of antigens-antibodies are explained by the polyelectrolyte effect and hydrophobic interaction. Furthermore, in different pH environments, the changes of binding forces of antigens-antibodies are attributed to the role of the denaturation of protein. The study aims to recognise the antigen-antibody immune mechanism, thus ensuring further understanding of the biological functions of tumour markers, and it promises to be very useful for the clinical diagnosis of early-stage cancer.

The Non-Specific Binding of Fluorescent-Labeled MiRNAs on Cell Surface by Hydrophobic Interaction.

Science.gov (United States)

Lu, Ting; Lin, Zongwei; Ren, Jianwei; Yao, Peng; Wang, Xiaowei; Wang, Zhe; Zhang, Qunye

2016-01-01

MicroRNAs are small noncoding RNAs about 22 nt long that play key roles in almost all biological processes and diseases. The fluorescent labeling and lipofection are two common methods for changing the levels and locating the position of cellular miRNAs. Despite many studies about the mechanism of DNA/RNA lipofection, little is known about the characteristics, mechanisms and specificity of lipofection of fluorescent-labeled miRNAs. Therefore, miRNAs labeled with different fluorescent dyes were transfected into adherent and suspension cells using lipofection reagent. Then, the non-specific binding and its mechanism were investigated by flow cytometer and laser confocal microscopy. The results showed that miRNAs labeled with Cy5 (cyanine fluorescent dye) could firmly bind to the surface of adherent cells (Hela) and suspended cells (K562) even without lipofection reagent. The binding of miRNAs labeled with FAM (carboxyl fluorescein) to K562 cells was obvious, but it was not significant in Hela cells. After lipofectamine reagent was added, most of the fluorescently labeled miRNAs binding to the surface of Hela cells were transfected into intra-cell because of the high transfection efficiency, however, most of them were still binding to the surface of K562 cells. Moreover, the high-salt buffer which could destroy the electrostatic interactions did not affect the above-mentioned non-specific binding, but the organic solvent which could destroy the hydrophobic interactions eliminated it. These results implied that the fluorescent-labeled miRNAs could non-specifically bind to the cell surface by hydrophobic interaction. It would lead to significant errors in the estimation of transfection efficiency only according to the cellular fluorescence intensity. Therefore, other methods to evaluate the transfection efficiency and more appropriate fluorescent dyes should be used according to the cell types for the accuracy of results.

The Non-Specific Binding of Fluorescent-Labeled MiRNAs on Cell Surface by Hydrophobic Interaction.

Directory of Open Access Journals (Sweden)

Ting Lu

Full Text Available MicroRNAs are small noncoding RNAs about 22 nt long that play key roles in almost all biological processes and diseases. The fluorescent labeling and lipofection are two common methods for changing the levels and locating the position of cellular miRNAs. Despite many studies about the mechanism of DNA/RNA lipofection, little is known about the characteristics, mechanisms and specificity of lipofection of fluorescent-labeled miRNAs.Therefore, miRNAs labeled with different fluorescent dyes were transfected into adherent and suspension cells using lipofection reagent. Then, the non-specific binding and its mechanism were investigated by flow cytometer and laser confocal microscopy. The results showed that miRNAs labeled with Cy5 (cyanine fluorescent dye could firmly bind to the surface of adherent cells (Hela and suspended cells (K562 even without lipofection reagent. The binding of miRNAs labeled with FAM (carboxyl fluorescein to K562 cells was obvious, but it was not significant in Hela cells. After lipofectamine reagent was added, most of the fluorescently labeled miRNAs binding to the surface of Hela cells were transfected into intra-cell because of the high transfection efficiency, however, most of them were still binding to the surface of K562 cells. Moreover, the high-salt buffer which could destroy the electrostatic interactions did not affect the above-mentioned non-specific binding, but the organic solvent which could destroy the hydrophobic interactions eliminated it.These results implied that the fluorescent-labeled miRNAs could non-specifically bind to the cell surface by hydrophobic interaction. It would lead to significant errors in the estimation of transfection efficiency only according to the cellular fluorescence intensity. Therefore, other methods to evaluate the transfection efficiency and more appropriate fluorescent dyes should be used according to the cell types for the accuracy of results.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

Science.gov (United States)

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Specific binding of lactoferrin to Escherichia coli isolated from human intestinal infections

International Nuclear Information System (INIS)

Naidu, S.S.; Erdei, J.; Forsgren, A.; Naidu, A.S.; Czirok, E.; Gado, I.; Kalfas, S.; Thoren, A.

1991-01-01

The degrees of human lactoferrin (HLf) and bovine lactoferrin (BLf) binding in 169 Escherichia coli strains isolated from human intestinal infections, and in an additional 68 strains isolated from healthy individuals, were examined in a 125 I-labelled protein binding assay. The binding was expressed as a percentage calculated from the total labelled ligand added to bacteria. The HLf and BLf binding to E. coli was in the range 3.7 to 73.4% and 4.8 to 61.6%, respectively. Enterotoxigenic strains demonstrated a significantly higher HLf binding (median = 19%) than enteropathogenic, enteroinvasive, enterohaemorrhagic strains or normal intestinal E. coli isolates (medians 6 to 9). Enteropathogenic strains belonging to serotypes O44 and O127 demonstrated significantly higher HLf binding compared to O26, O55, O111, O119 and O126. No significant differences in the degree of HLf or BLf binding were found between aerobactin-producing and non-producing strains. The interaction was further characterized in a high Lf-binging EPEC strain, E34663 (serotype O127). The binding was stable in the pH range 4.0 to 7.5, did not dissociate in the presence of 2M NaCl or 2M urea, and reached saturation within two h. Unlabelled HLf and BLf displaced the 125 I-HLf binding to E34663 in a dose-dependent manner. Apo- and iron-saturated forms of Lf demonstrated similar binding to E34663. Among various unlabelled subephithelial matrix proteins and carbohydrates tested (in 10 4 -fold excess) only fibronectin and fibrinogen caused a moderate inhibition of 125 I-HLf binding. According to Scatchard plot analysis, 5,400 HLf-binding sites/cell, with an affinity constant (K a ) of 1.4 x 10 -7 M, were estimated in strain E34663. These data establish the presence of a specific Lf-binding mechanism in E. coli. (au)

Delineation of the Pasteurellaceae-specific GbpA-family of glutathione-binding proteins

Directory of Open Access Journals (Sweden)

Vergauwen Bjorn

2011-11-01

Full Text Available Abstract Background The Gram-negative bacterium Haemophilus influenzae is a glutathione auxotroph and acquires the redox-active tripeptide by import. The dedicated glutathione transporter belongs to the ATP-binding cassette (ABC-transporter superfamily and displays more than 60% overall sequence identity with the well-studied dipeptide (Dpp permease of Escherichia coli. The solute binding protein (SBP that mediates glutathione transport in H. influenzae is a lipoprotein termed GbpA and is 54% identical to E. coli DppA, a well-studied member of family 5 SBP's. The discovery linking GbpA to glutathione import came rather unexpectedly as this import-priming SBP was previously annotated as a heme-binding protein (HbpA, and was thought to mediate heme acquisition. Nonetheless, although many SBP's have been implicated in more than one function, a prominent physiological role for GbpA and its partner permease in heme acquisition appears to be very unlikely. Here, we sought to characterize five representative GbpA homologs in an effort to delineate the novel GbpA-family of glutathione-specific family 5 SBPs and to further clarify their functional role in terms of ligand preferences. Results Lipoprotein and non-lipoprotein GbpA homologs were expressed in soluble form and substrate specificity was evaluated via a number of ligand binding assays. A physiologically insignificant affinity for hemin was observed for all five GbpA homologous test proteins. Three out of five test proteins were found to bind glutathione and some of its physiologically relevant derivatives with low- or submicromolar affinity. None of the tested SBP family 5 allocrites interacted with the remaining two GbpA test proteins. Structure-based sequence alignments and phylogenetic analysis show that the two binding-inert GbpA homologs clearly form a separate phylogenetic cluster. To elucidate a structure-function rationale for this phylogenetic differentiation, we determined the crystal

Cell-type specificity of ChIP-predicted transcription factor binding sites

Directory of Open Access Journals (Sweden)

Håndstad Tony

2012-08-01

Full Text Available Abstract Background Context-dependent transcription factor (TF binding is one reason for differences in gene expression patterns between different cellular states. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identifies genome-wide TF binding sites for one particular context—the cells used in the experiment. But can such ChIP-seq data predict TF binding in other cellular contexts and is it possible to distinguish context-dependent from ubiquitous TF binding? Results We compared ChIP-seq data on TF binding for multiple TFs in two different cell types and found that on average only a third of ChIP-seq peak regions are common to both cell types. Expectedly, common peaks occur more frequently in certain genomic contexts, such as CpG-rich promoters, whereas chromatin differences characterize cell-type specific TF binding. We also find, however, that genotype differences between the cell types can explain differences in binding. Moreover, ChIP-seq signal intensity and peak clustering are the strongest predictors of common peaks. Compared with strong peaks located in regions containing peaks for multiple transcription factors, weak and isolated peaks are less common between the cell types and are less associated with data that indicate regulatory activity. Conclusions Together, the results suggest that experimental noise is prevalent among weak peaks, whereas strong and clustered peaks represent high-confidence binding events that often occur in other cellular contexts. Nevertheless, 30-40% of the strongest and most clustered peaks show context-dependent regulation. We show that by combining signal intensity with additional data—ranging from context independent information such as binding site conservation and position weight matrix scores to context dependent chromatin structure—we can predict whether a ChIP-seq peak is likely to be present in other cellular contexts.

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Measurement of specific [3H]-ouabain binding to different types of human leucocytes

DEFF Research Database (Denmark)

Boon, Arnold; Oh, V M; Taylor, John E.

1984-01-01

We have studied the specific binding of [3H]-ouabain to intact mononuclear leucocytes (82% lymphocytes) and polymorphonuclear leucocytes. In both types of cells [3H]-ouabain binding was saturable, confined to a single site of high affinity, slow to reach equilibrium, slow to reverse, temperature...... were expressed per square micron of cell surface area the difference between the two cell types was proportionately greater (83 and 186 sites per micron 2 respectively). We conclude that the [3H]-ouabain binding sites on mononuclear and polymorphonuclear leucocytes are similar in nature, but different...

Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

International Nuclear Information System (INIS)

Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

2004-01-01

Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

Specific binding component of the 'inactive' stereoisomer (S,S)-[125I]IQNB to rat brain muscarinic receptors in vivo

International Nuclear Information System (INIS)

Boulay, Sheila F.; McRee, R. Carter; Cohen, Victor I.; Sood, Virendar K.; Zeeberg, Barry R.; Reba, Richard C.

1996-01-01

In vivo nonspecific binding can be estimated using the inactive stereoisomer of a receptor radioligand. However, the binding of the inactive stereoisomer may be partially specific. Specific binding of the inactive (S,S)-[ 125 I]IQNB was estimated from the inhibition induced by a competing nonradioactive ligand. This technique differed from the usual approach, since it was used to study the inactive rather than the active stereoisomer. The results indicate that there is substantial specific binding for (S,S)-[ 125 I]IQNB

Composição centesimal e teor de beta-glucanas em cereais e derivados Nutrient profile and beta-glucans content in cereal seeds and foodstuffs contain them

Directory of Open Access Journals (Sweden)

Alexandre H. Fujita

2003-08-01

Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

Science.gov (United States)

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Specific binding of large aggregates of amphiphilic molecules to the respective antibodies.

Science.gov (United States)

Nabok, Alexei; Tsargorodskaya, Anna; Holloway, Alan; Starodub, Nikolay F; Demchenko, Anna

2007-07-31

The Binding of nonylphenol to respective antibodies immobilized on solid substrates was studied with the methods of total internal reflection ellipsometry (TIRE) and QCM (quartz crystal microbalance) impedance spectroscopy. The binding reaction was proved to be highly specific having an association constant of KA=1.6x10(6) mol(-1) L and resulted in an increase in both the adsorbed layer thickness of 23 nm and the added mass of 18.3 microg/cm2 at saturation. The obtained responses of both TIRE and QCM methods are substantially higher than anticipated for the immune binding of single molecules of nonylphenol. The mechanism of binding of large aggregates of nonylphenol was suggested instead. Modeling of the micelle of amphiphilic nonylphenol molecules in aqueous solutions yielded a micelle size of about 38 nm. The mechanism of binding of large molecular aggregates to respective antibodies can be extended to other hydrophobic low-molecular-weight toxins such as T-2 mycotoxin. The formation of large molecular aggregates of nonylphenol and T-2 mycotoxin molecules on the surface was proved by the AFM study.

Many Routes to an Antibody Heavy-Chain CDR3: Necessary, Yet Insufficient, for Specific Binding

Science.gov (United States)

D’Angelo, Sara; Ferrara, Fortunato; Naranjo, Leslie; Erasmus, M. Frank; Hraber, Peter; Bradbury, Andrew R. M.

2018-01-01

Because of its great potential for diversity, the immunoglobulin heavy-chain complementarity-determining region 3 (HCDR3) is taken as an antibody molecule’s most important component in conferring binding activity and specificity. For this reason, HCDR3s have been used as unique identifiers to investigate adaptive immune responses in vivo and to characterize in vitro selection outputs where display systems were employed. Here, we show that many different HCDR3s can be identified within a target-specific antibody population after in vitro selection. For each identified HCDR3, a number of different antibodies bearing differences elsewhere can be found. In such selected populations, all antibodies with the same HCDR3 recognize the target, albeit at different affinities. In contrast, within unselected populations, the majority of antibodies with the same HCDR3 sequence do not bind the target. In one HCDR3 examined in depth, all target-specific antibodies were derived from the same VDJ rearrangement, while non-binding antibodies with the same HCDR3 were derived from many different V and D gene rearrangements. Careful examination of previously published in vivo datasets reveals that HCDR3s shared between, and within, different individuals can also originate from rearrangements of different V and D genes, with up to 26 different rearrangements yielding the same identical HCDR3 sequence. On the basis of these observations, we conclude that the same HCDR3 can be generated by many different rearrangements, but that specific target binding is an outcome of unique rearrangements and VL pairing: the HCDR3 is necessary, albeit insufficient, for specific antibody binding. PMID:29568296

Ascorbic acid prevents nonreceptor specific binding of [3H]-5-hydroxytryptamine to bovine cerebral cortex membranes

International Nuclear Information System (INIS)

Hamblin, M.W.; Adriaenssens, P.I.; Ariani, K.; Cawthon, R.M.; Stratford, C.A.; Tan, G.L.; Ciaranello, R.D.

1987-01-01

[ 3 H]-5-Hydroxytryptamine ([ 3 H]-5-HT) decomposes rapidly when exposed to air in solution at physiological pH if antioxidants are not present. The decomposition products appear to bind to two saturable sites on brain membranes (apparent Kd values = 1-2 and 100-1000 nM). This binding mimics ''specific'' ligand/receptor binding in that it is inhibited by 10 microM unlabeled 5-HT. This inhibition is not competitive, but rather is due to the prevention of [ 3 H]-5-HT breakdown by excess unlabeled 5-HT. Unlike genuine ligand/receptor binding, the binding of [ 3 H]-5-HT breakdown products is essentially irreversible and does not display a tissue distribution consistent with binding to authentic 5-HT receptors. [ 3 H]-5-HT decomposition can be eliminated by the inclusion of 0.05 to 5 mM ascorbic acid. At these concentrations ascorbic acid is not deleterious to reversible [ 3 H]-5-HT binding. When [ 3 H] 5-HT exposure to air occurs in the presence of brain membranes, the apparent antioxidant activity of brain membranes themselves affords protection against [ 3 H]-5-HT degradation equal to ascorbic acid. This protection is effective below final [ 3 H]-5-HT concentrations of 10 nM. Above 10 nM [ 3 H]-5-HT, addition of ascorbic acid or other antioxidants is necessary to avoid the occurrence of additional low affinity (apparent Kd = 15-2000 nM) binding sites that are specific but nonetheless irreversible. When care is taken to limit [ 3 H]-5-HT oxidation, the only reversible and saturable specific binding sites observed are of the 5-HT1 high affinity (Kd = 1-2 nM) type. Radioligand oxidation artifacts may be involved in previous reports of low affinity (Kd = 15-250 nM) [ 3 H]-5-HT binding sites in brain membrane preparations

Extreme sequence divergence but conserved ligand-binding specificity in Streptococcus pyogenes M protein.

Directory of Open Access Journals (Sweden)

2006-05-01

Full Text Available Many pathogenic microorganisms evade host immunity through extensive sequence variability in a protein region targeted by protective antibodies. In spite of the sequence variability, a variable region commonly retains an important ligand-binding function, reflected in the presence of a highly conserved sequence motif. Here, we analyze the limits of sequence divergence in a ligand-binding region by characterizing the hypervariable region (HVR of Streptococcus pyogenes M protein. Our studies were focused on HVRs that bind the human complement regulator C4b-binding protein (C4BP, a ligand that confers phagocytosis resistance. A previous comparison of C4BP-binding HVRs identified residue identities that could be part of a binding motif, but the extended analysis reported here shows that no residue identities remain when additional C4BP-binding HVRs are included. Characterization of the HVR in the M22 protein indicated that two relatively conserved Leu residues are essential for C4BP binding, but these residues are probably core residues in a coiled-coil, implying that they do not directly contribute to binding. In contrast, substitution of either of two relatively conserved Glu residues, predicted to be solvent-exposed, had no effect on C4BP binding, although each of these changes had a major effect on the antigenic properties of the HVR. Together, these findings show that HVRs of M proteins have an extraordinary capacity for sequence divergence and antigenic variability while retaining a specific ligand-binding function.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan

DEFF Research Database (Denmark)

Yücel, Cigdem; Sotres, Javier; Rascón, Ana

2017-01-01

HYPOTHESIS: Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. EXPERIMENT: Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic...... force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured...

pH-dependence of the specific binding of Cu(II) and Zn(II) ions to the amyloid-β peptide

International Nuclear Information System (INIS)

Ghalebani, Leila; Wahlström, Anna; Danielsson, Jens; Wärmländer, Sebastian K.T.S.; Gräslund, Astrid

2012-01-01

Highlights: ► Cu(II) and Zn(II) display pH-dependent binding to the Aβ(1–40) peptide. ► At pH 7.4 both metal ions display residue-specific binding to the Aβ peptide. ► At pH 5.5 the binding specificity is lost for Zn(II). ► Differential Cu(II) and Zn(II) binding may help explain metal-induced AD toxicity. -- Abstract: Metal ions like Cu(II) and Zn(II) are accumulated in Alzheimer’s disease amyloid plaques. The amyloid-β (Aβ) peptide involved in the disease interacts with these metal ions at neutral pH via ligands provided by the N-terminal histidines and the N-terminus. The present study uses high-resolution NMR spectroscopy to monitor the residue-specific interactions of Cu(II) and Zn(II) with 15 N- and 13 C, 15 N-labeled Aβ(1–40) peptides at varying pH levels. At pH 7.4 both ions bind to the specific ligands, competing with one another. At pH 5.5 Cu(II) retains its specific histidine ligands, while Zn(II) seems to lack residue-specific interactions. The low pH mimics acidosis which is linked to inflammatory processes in vivo. The results suggest that the cell toxic effects of redox active Cu(II) binding to Aβ may be reversed by the protective activity of non-redox active Zn(II) binding to the same major binding site under non-acidic conditions. Under acidic conditions, the protective effect of Zn(II) may be decreased or changed, since Zn(II) is less able to compete with Cu(II) for the specific binding site on the Aβ peptide under these conditions.

Biomimetic conformation-specific assembly of proteins at artificial binding sites nano-patterned on silicon

Science.gov (United States)

de la Rica, Roberto; Matsui, Hiroshi

2009-01-01

Biomolecules such as enzymes and antibodies possess binding sites where the molecular architecture and the physicochemical properties are optimum for their interaction with a particular target, in some cases even differentiating between stereoisomers. Here, we mimic this exquisite specificity via the creation of a suitable chemical environment by fabricating artificial binding sites for the protein calmodulin (CaM). By downscaling well-known surface chemical modification methodologies to the nanometer scale via silicon nanopatterning, the Ca2+-CaM conformer was found to selectively bind the biomimetic binding sites. The methodology could be adapted to mimic other protein-receptor interactions for sensing and catalysis. PMID:19757782

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Specific deficit of colour-colour short-term memory binding in sporadic and familial Alzheimer's disease.

Science.gov (United States)

Parra, Mario A; Sala, Sergio Della; Abrahams, Sharon; Logie, Robert H; Méndez, Luis Guillermo; Lopera, Francisco

2011-06-01

Short-term memory binding of visual features which are processed across different dimensions (shape-colour) is impaired in sporadic Alzheimer's disease, familial Alzheimer's disease, and in asymptomatic carriers of familial Alzheimer's disease. This study investigated whether Alzheimer's disease also impacts on within-dimension binding processes. The study specifically explored whether visual short-term memory binding of features of the same type (colour-colour) is sensitive to Alzheimer's disease. We used a neuropsychological battery and a short-term memory binding task to assess patients with sporadic Alzheimer's disease (Experiment 1), familial Alzheimer's disease (Experiment 2) due to the mutation E280A of the Presenilin-1 gene and asymptomatic carriers of the mutation. The binding task assessed change detection within arrays of unicoloured objects (Colour Only) or bicoloured objects the colours of which had to be remembered separately (Unbound Colours) or together (Bound Colours). Performance on the Bound Colours condition (1) explained the largest proportion of variance between patients (sporadic and familial Alzheimer's disease), (2) combined more sensitivity and specificity for the disease than other more traditional neuropsychological tasks, (3) identified asymptomatic carriers of the mutation even when traditional neuropsychological measures and other measures of short-term memory did not and, (4) contrary to shape-colour binding, correlated with measures of hippocampal functions. Colour-colour binding and shape-colour binding both appear to be sensitive to AD even though they seem to rely on different brain mechanisms. Copyright © 2011 Elsevier Ltd. All rights reserved.

Specific DNA-binding proteins and DNA sequences involved in steroid hormone regulation of gene expression

International Nuclear Information System (INIS)

Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.

1987-01-01

Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule

Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

Directory of Open Access Journals (Sweden)

Anna Bzducha-Wróbel

2014-12-01

Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

The carbohydrate-binding module family 20-diversity, structure, and function

DEFF Research Database (Denmark)

Christiansen, Camilla; Abou Hachem, Maher; Janecek, S.

2009-01-01

, laforins. The clear evolutionary relatedness of CBM20s to CBM21s, CBM48s and CBM53s suggests a common clan hosting most of the known SBDs. This review surveys the diversity within the CBM20 family, and makes an evolutionary comparison with CBM21s, CBM48s and CBM53s, discussing intrafamily and interfamily......Starch-active enzymes often possess starch-binding domains (SBDs) mediating attachment to starch granules and other high molecular weight substrates. SBDs are divided into nine carbohydrate-binding module (CBM) families, and CBM20 is the earliest-assigned and best characterized family. High...... diversity characterizes CBM20s, which occur in starch-active glycoside hydrolase families 13, 14, 15, and 77, and enzymes involved in starch or glycogen metabolism, exemplified by the starch-phosphorylating enzyme glucan, water dikinase 3 from Arabidopsis thaliana and the mammalian glycogen phosphatases...

Pharmacophore screening of the protein data bank for specific binding site chemistry.

Science.gov (United States)

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Molecular Determinants Underlying Binding Specificities of the ABL Kinase Inhibitors: Combining Alanine Scanning of Binding Hot Spots with Network Analysis of Residue Interactions and Coevolution.

Directory of Open Access Journals (Sweden)

Amanda Tse

Full Text Available Quantifying binding specificity and drug resistance of protein kinase inhibitors is of fundamental importance and remains highly challenging due to complex interplay of structural and thermodynamic factors. In this work, molecular simulations and computational alanine scanning are combined with the network-based approaches to characterize molecular determinants underlying binding specificities of the ABL kinase inhibitors. The proposed theoretical framework unveiled a relationship between ligand binding and inhibitor-mediated changes in the residue interaction networks. By using topological parameters, we have described the organization of the residue interaction networks and networks of coevolving residues in the ABL kinase structures. This analysis has shown that functionally critical regulatory residues can simultaneously embody strong coevolutionary signal and high network centrality with a propensity to be energetic hot spots for drug binding. We have found that selective (Nilotinib and promiscuous (Bosutinib, Dasatinib kinase inhibitors can use their energetic hot spots to differentially modulate stability of the residue interaction networks, thus inhibiting or promoting conformational equilibrium between inactive and active states. According to our results, Nilotinib binding may induce a significant network-bridging effect and enhance centrality of the hot spot residues that stabilize structural environment favored by the specific kinase form. In contrast, Bosutinib and Dasatinib can incur modest changes in the residue interaction network in which ligand binding is primarily coupled only with the identity of the gate-keeper residue. These factors may promote structural adaptability of the active kinase states in binding with these promiscuous inhibitors. Our results have related ligand-induced changes in the residue interaction networks with drug resistance effects, showing that network robustness may be compromised by targeted mutations

Molecular Determinants Underlying Binding Specificities of the ABL Kinase Inhibitors: Combining Alanine Scanning of Binding Hot Spots with Network Analysis of Residue Interactions and Coevolution

Science.gov (United States)

Tse, Amanda; Verkhivker, Gennady M.

2015-01-01

Quantifying binding specificity and drug resistance of protein kinase inhibitors is of fundamental importance and remains highly challenging due to complex interplay of structural and thermodynamic factors. In this work, molecular simulations and computational alanine scanning are combined with the network-based approaches to characterize molecular determinants underlying binding specificities of the ABL kinase inhibitors. The proposed theoretical framework unveiled a relationship between ligand binding and inhibitor-mediated changes in the residue interaction networks. By using topological parameters, we have described the organization of the residue interaction networks and networks of coevolving residues in the ABL kinase structures. This analysis has shown that functionally critical regulatory residues can simultaneously embody strong coevolutionary signal and high network centrality with a propensity to be energetic hot spots for drug binding. We have found that selective (Nilotinib) and promiscuous (Bosutinib, Dasatinib) kinase inhibitors can use their energetic hot spots to differentially modulate stability of the residue interaction networks, thus inhibiting or promoting conformational equilibrium between inactive and active states. According to our results, Nilotinib binding may induce a significant network-bridging effect and enhance centrality of the hot spot residues that stabilize structural environment favored by the specific kinase form. In contrast, Bosutinib and Dasatinib can incur modest changes in the residue interaction network in which ligand binding is primarily coupled only with the identity of the gate-keeper residue. These factors may promote structural adaptability of the active kinase states in binding with these promiscuous inhibitors. Our results have related ligand-induced changes in the residue interaction networks with drug resistance effects, showing that network robustness may be compromised by targeted mutations of key mediating

Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

Deep convolutional neural networks for pan-specific peptide-MHC class I binding prediction.

Science.gov (United States)

Han, Youngmahn; Kim, Dongsup

2017-12-28

Computational scanning of peptide candidates that bind to a specific major histocompatibility complex (MHC) can speed up the peptide-based vaccine development process and therefore various methods are being actively developed. Recently, machine-learning-based methods have generated successful results by training large amounts of experimental data. However, many machine learning-based methods are generally less sensitive in recognizing locally-clustered interactions, which can synergistically stabilize peptide binding. Deep convolutional neural network (DCNN) is a deep learning method inspired by visual recognition process of animal brain and it is known to be able to capture meaningful local patterns from 2D images. Once the peptide-MHC interactions can be encoded into image-like array(ILA) data, DCNN can be employed to build a predictive model for peptide-MHC binding prediction. In this study, we demonstrated that DCNN is able to not only reliably predict peptide-MHC binding, but also sensitively detect locally-clustered interactions. Nonapeptide-HLA-A and -B binding data were encoded into ILA data. A DCNN, as a pan-specific prediction model, was trained on the ILA data. The DCNN showed higher performance than other prediction tools for the latest benchmark datasets, which consist of 43 datasets for 15 HLA-A alleles and 25 datasets for 10 HLA-B alleles. In particular, the DCNN outperformed other tools for alleles belonging to the HLA-A3 supertype. The F1 scores of the DCNN were 0.86, 0.94, and 0.67 for HLA-A*31:01, HLA-A*03:01, and HLA-A*68:01 alleles, respectively, which were significantly higher than those of other tools. We found that the DCNN was able to recognize locally-clustered interactions that could synergistically stabilize peptide binding. We developed ConvMHC, a web server to provide user-friendly web interfaces for peptide-MHC class I binding predictions using the DCNN. ConvMHC web server can be accessible via http://jumong.kaist.ac.kr:8080/convmhc

The N-terminal domain determines the affinity and specificity of H1 binding to chromatin

International Nuclear Information System (INIS)

Öberg, Christine; Belikov, Sergey

2012-01-01

Highlights: ► wt Human histone H1.4 and hH1.4 devoid of N-terminal domain, ΔN-hH1.4, were compared. ► Both histones bind to chromatin, however, ΔN-hH1.4 displays lower binding affinity. ► Interaction of ΔN-hH1.4 with chromatin includes a significant unspecific component. ► N-terminal domain is a determinant of specificity of histone H1 binding to chromatin. -- Abstract: Linker histone H1, one of the most abundant nuclear proteins in multicellular eukaryotes, is a key component of the chromatin structure mainly due to its role in the formation and maintenance of the 30 nm chromatin fiber. It has a three-domain structure; a central globular domain flanked by a short N-terminal domain and a long, highly basic C-terminal domain. Previous studies have shown that the binding abilities of H1 are at large determined by the properties of the C-terminal domain; much less attention has been paid to role of the N-terminal domain. We have previously shown that H1 can be reconstituted via cytoplasmic mRNA injection in Xenopus oocytes, cells that lack somatic H1. The heterologously expressed H1 proteins are incorporated into in vivo assembled chromatin at specific sites and the binding event is monitored as an increase in nucleosomal repeat length (NRL). Using this setup we have here compared the binding properties of wt-H1.4 and hH1.4 devoid of its N-terminal domain (ΔN-hH1.4). The ΔN-hH1.4 displays a drastically lower affinity for chromatin binding as compared to the wild type hH1.4. Our data also indicates that ΔN-hH1.4 is more prone to unspecific chromatin binding than the wild type. We conclude that the N-terminal domain of H1 is an important determinant of affinity and specificity of H1-chromatin interactions.

Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

Science.gov (United States)

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

Directory of Open Access Journals (Sweden)

Samir Jawhara

Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation; Aptameros anti-(1→3)-β-D-glucana marcados com Tecnecio-99m: biodistribuicao e imageamento em modelos experimentais de infeccao e inflamacao

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila Maria de Sousa

2016-07-01

Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with {sup 32}P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with {sup 99m}Tc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A {sup 99m}Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with {sup 99m}Tc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the {sup 99m}Tc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the

Dissection of specific binding of HIV-1 Gag to the 'packaging signal' in viral RNA.

Science.gov (United States)

Comas-Garcia, Mauricio; Datta, Siddhartha Ak; Baker, Laura; Varma, Rajat; Gudla, Prabhakar R; Rein, Alan

2017-07-20

Selective packaging of HIV-1 genomic RNA (gRNA) requires the presence of a cis -acting RNA element called the 'packaging signal' (Ψ). However, the mechanism by which Ψ promotes selective packaging of the gRNA is not well understood. We used fluorescence correlation spectroscopy and quenching data to monitor the binding of recombinant HIV-1 Gag protein to Cy5-tagged 190-base RNAs. At physiological ionic strength, Gag binds with very similar, nanomolar affinities to both Ψ-containing and control RNAs. We challenged these interactions by adding excess competing tRNA; introducing mutations in Gag; or raising the ionic strength. These modifications all revealed high specificity for Ψ. This specificity is evidently obscured in physiological salt by non-specific, predominantly electrostatic interactions. This nonspecific activity was attenuated by mutations in the MA, CA, and NC domains, including CA mutations disrupting Gag-Gag interaction. We propose that gRNA is selectively packaged because binding to Ψ nucleates virion assembly with particular efficiency.

Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

Science.gov (United States)

Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

2017-01-01

Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.

Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

Science.gov (United States)

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-07-01

The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

2018-05-14

Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

Science.gov (United States)

Alwis, K U; Mandryk, J; Hocking, A D

1999-09-01

Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

International Nuclear Information System (INIS)

Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

1988-01-01

Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

Directory of Open Access Journals (Sweden)

Amy L Bauer

2010-11-01

Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

Science.gov (United States)

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

Directory of Open Access Journals (Sweden)

R.C.Shendare

2008-01-01

Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

derived from oyster mushroom (Pleurotus ostreatus, Hiratake) shifts in haematological and biochemical profiling were found in half-year-old rainbow trout (O. mykiss) in environmental conditions of a commercial rainbow trout fishery. Biometrical indices were not found significantly altered. No specific effect of β-glucan on immune system response of rainbow trout was found in the study. The use of β-glucan in prosperous, clinically healthy aquaculture is still an issue, nevertheless, its use in breedings endangered by stress stimuli, infectious diseases or adverse environmental factors is indisputable.

Binding of ADAM12, a marker of skeletal muscle regeneration, to the muscle-specific actin-binding protein, alpha -actinin-2, is required for myoblast fusion

DEFF Research Database (Denmark)

Galliano, M F; Huet, C; Frygelius, J

2000-01-01

ADAM12 belongs to the transmembrane metalloprotease ADAM ("a disintegrin and metalloprotease") family. ADAM12 has been implicated in muscle cell differentiation and fusion, but its precise function remains unknown. Here, we show that ADAM12 is dramatically up-regulated in regenerated, newly formed...... of differentiation. Using the yeast two-hybrid screen, we found that the muscle-specific alpha-actinin-2 strongly binds to the cytoplasmic tail of ADAM12. In vitro binding assays with GST fusion proteins confirmed the specific interaction. The major binding site for alpha-actinin-2 was mapped to a short sequence...... in a dominant negative fashion by inhibiting fusion of C2C12 cells, whereas expression of a cytosolic ADAM12 lacking the major alpha-actinin-2 binding site had no effect on cell fusion. Our results suggest that interaction of ADAM12 with alpha-actinin-2 is important for ADAM12 function....

Inositol 1,4,5-trisphosphate binds to a specific receptor and releases microsomal calcium in the arterior pituitary gland

International Nuclear Information System (INIS)

Guillemette, G.; Balla, T.; Baukal, A.J.; Catt, K.J.

1987-01-01

The properties of inositol 1,4,5-trisphosphate (InsP 3 ) receptor sites in the anterior pituitary were evaluated by binding studies with InsP 3 labeled with 32 P to high specific radioactivity. Specific binding of Ins[ 32 P]P 3 was demonstrable in pituitary membrane preparations and was linearly proportional to the amount of membrane added over the range 0.5-2 mg of protein. Kinetic studies showed that specific InsP 3 binding was half-maximal in about 40 sec and reached a plateau after 15 min at 0 0 C. Scatchard analysis of the binding data was consistent with a single set of high affinity sites. The specificity of Ins[ 32 P]P 3 binding to these sites was illustrated by the much weaker affinity for structural analogs such as inositol 1-phosphate, phytic acid, 2,3-bisphosphoglycerate, and fructose 1,6-bisphosphate. To assess the functional relevance of the InsP 3 binding sites, the Ca 2+ -releasing activity of InsP 3 was measured in pituitary membrane preparations. Under physiological conditions within the cytosol, the high-affinity InsP 3 binding sites characterized in pituitary membranes could serve as the putative receptors through which InsP 3 triggers Ca 2+ mobilization in the anterior pituitary gland

Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT genomic binding patterns discerns cell-specific cis-regulatory modules

Directory of Open Access Journals (Sweden)

Kang Keunsoo

2013-01-01

Full Text Available Abstract Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM, which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors.

Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

OpenAIRE

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

2014-01-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

Specific membrane binding of factor VIII is mediated by O-phospho-L-serine, a moiety of phosphatidylserine.

Science.gov (United States)

Gilbert, G E; Drinkwater, D

1993-09-21

Phosphatidylserine, a negatively charged lipid, is exposed on the platelet membrane following cell stimulation, correlating with the expression of factor VIII receptors. We have explored the importance of the negative electrostatic potential of phosphatidylserine vs chemical moieties of phosphatidylserine for specific membrane binding of factor VIII. Fluorescein-labeled factor VIII bound to membranes containing 15% phosphatidic acid, a negatively charged phospholipid, with low affinity compared to phosphatidylserine-containing membranes. Binding was not specific as it was inhibited by other proteins in plasma. Factor VIII bound to membranes containing 10% phosphatidylserine in spite of a varying net charge provided by 0-15% stearylamine, a positively charged lipid. The soluble phosphatidylserine moiety, O-phospho-L-serine, inhibited factor VIII binding to phosphatidylserine-containing membranes with a Ki of 20 mM, but the stereoisomer, O-phospho-D-serine, was 5-fold less effective. Furthermore, binding of factor VIII to membranes containing synthetic phosphatidyl-D-serine was 5-fold less than binding to membranes containing phosphatidyl-L-serine. Membranes containing synthetic phosphatidyl-L-homoserine, differing from phosphatidylserine by a single methylene, supported high-affinity binding, but it was not specific as factor VIII was displaced by other plasma proteins. O-Phospho-L-serine also inhibited the binding of factor VIII to platelet-derived microparticles with a Ki of 20 mM, and the stereoisomer was 4-fold less effective. These results indicate that membrane binding of factor VIII is mediated by a stereoselective recognition O-phospho-L-serine of phosphatidylserine and that negative electrostatic potential is of lesser importance.

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Subfamily-specific adaptations in the structures of two penicillin-binding proteins from Mycobacterium tuberculosis.

Directory of Open Access Journals (Sweden)

Daniil M Prigozhin

Full Text Available Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows that Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

Science.gov (United States)

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding the role of oat ß-glucan in oat-based dough systems

NARCIS (Netherlands)

Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

2015-01-01

B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

A population of Langerin-positive dendritic cells in murine Peyer's patches involved in sampling β-glucan microparticles.

Directory of Open Access Journals (Sweden)

Magdia De Jesus

Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within

Stage-specific adhesion of Leishmania promastigotes to sand fly midguts assessed using an improved comparative binding assay.

Directory of Open Access Journals (Sweden)

Raymond Wilson

2010-09-01

and metacyclic forms. Further they show that although gut binding may be necessary for parasite establishment, in several vector-parasite pairs the specificity of such in vitro binding alone is insufficient to explain overall vector specificity. Other significant barriers to development must exist in certain refractory Leishmania parasite-sand fly vector combinations. A re-appraisal of the specificity of the Leishmania-sand fly relationship is required.

Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

2013-03-01

The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

Directory of Open Access Journals (Sweden)

Patricia de Souza Bonfim-Mendonça

Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

In Vivo Fluorescence Lifetime Imaging Monitors Binding of Specific Probes to Cancer Biomarkers

Science.gov (United States)

Ardeshirpour, Yasaman; Chernomordik, Victor; Zielinski, Rafal; Capala, Jacek; Griffiths, Gary; Vasalatiy, Olga; Smirnov, Aleksandr V.; Knutson, Jay R.; Lyakhov, Ilya; Achilefu, Samuel; Gandjbakhche, Amir; Hassan, Moinuddin

2012-01-01

One of the most important factors in choosing a treatment strategy for cancer is characterization of biomarkers in cancer cells. Particularly, recent advances in Monoclonal Antibodies (MAB) as primary-specific drugs targeting tumor receptors show that their efficacy depends strongly on characterization of tumor biomarkers. Assessment of their status in individual patients would facilitate selection of an optimal treatment strategy, and the continuous monitoring of those biomarkers and their binding process to the therapy would provide a means for early evaluation of the efficacy of therapeutic intervention. In this study we have demonstrated for the first time in live animals that the fluorescence lifetime can be used to detect the binding of targeted optical probes to the extracellular receptors on tumor cells in vivo. The rationale was that fluorescence lifetime of a specific probe is sensitive to local environment and/or affinity to other molecules. We attached Near-InfraRed (NIR) fluorescent probes to Human Epidermal Growth Factor 2 (HER2/neu)-specific Affibody molecules and used our time-resolved optical system to compare the fluorescence lifetime of the optical probes that were bound and unbound to tumor cells in live mice. Our results show that the fluorescence lifetime changes in our model system delineate HER2 receptor bound from the unbound probe in vivo. Thus, this method is useful as a specific marker of the receptor binding process, which can open a new paradigm in the “image and treat” concept, especially for early evaluation of the efficacy of the therapy. PMID:22384092

In vivo fluorescence lifetime imaging monitors binding of specific probes to cancer biomarkers.

Directory of Open Access Journals (Sweden)

Yasaman Ardeshirpour

Full Text Available One of the most important factors in choosing a treatment strategy for cancer is characterization of biomarkers in cancer cells. Particularly, recent advances in Monoclonal Antibodies (MAB as primary-specific drugs targeting tumor receptors show that their efficacy depends strongly on characterization of tumor biomarkers. Assessment of their status in individual patients would facilitate selection of an optimal treatment strategy, and the continuous monitoring of those biomarkers and their binding process to the therapy would provide a means for early evaluation of the efficacy of therapeutic intervention. In this study we have demonstrated for the first time in live animals that the fluorescence lifetime can be used to detect the binding of targeted optical probes to the extracellular receptors on tumor cells in vivo. The rationale was that fluorescence lifetime of a specific probe is sensitive to local environment and/or affinity to other molecules. We attached Near-InfraRed (NIR fluorescent probes to Human Epidermal Growth Factor 2 (HER2/neu-specific Affibody molecules and used our time-resolved optical system to compare the fluorescence lifetime of the optical probes that were bound and unbound to tumor cells in live mice. Our results show that the fluorescence lifetime changes in our model system delineate HER2 receptor bound from the unbound probe in vivo. Thus, this method is useful as a specific marker of the receptor binding process, which can open a new paradigm in the "image and treat" concept, especially for early evaluation of the efficacy of the therapy.

Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

International Nuclear Information System (INIS)

Hurley, L.H.; Needham-VanDevanter, D.R.

1986-01-01

DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

Concanavalin A immobilized magnetic poly(glycidyl methacrylate) beads for prostate specific antigen binding.

Science.gov (United States)

Idil, Neslihan; Perçin, Işık; Karakoç, Veyis; Yavuz, Handan; Aksöz, Nilüfer; Denizli, Adil

2015-10-01

The aim of this study was to prepare Concanavalin A (Con A) immobilized magnetic poly(glycidyl methacrylate) (mPGMA) beads for prostate specific antigen (PSA) binding and to study binding capacities of the beads using lectin-glycoprotein interactions. Firstly, iron oxide nanoparticles were synthesized by co-precipitation method and then, beads were synthesized by dispersion polymerization in the presence of iron oxide nanoparticles. Con A molecules were both covalently immobilized onto the beads directly and through the spacer arm (1,6-diaminohexane-HDMA). The total PSA and free PSA binding onto the mPGMA-HDMA-Con A beads were higher than that of the mPGMA-Con A beads. Maximum PSA binding capacity was observed as 91.2 ng/g. Approximately 45% of the bound PSA was eluted by using 0.1 M mannose as elution agent. The mPGMA-HDMA-Con A beads could be reused without a remarkable decrease in the binding capacities after 5 binding-desorption cycles. Serum fractions were analyzed using SDS-PAGE. The mPGMA-HDMA-Con A beads could be useful for the detection of PSA and suggested as a model system for other glycoprotein biomarkers. Copyright © 2015 Elsevier B.V. All rights reserved.

Guanylate kinase domains of the MAGUK family scaffold proteins as specific phospho-protein-binding modules.

Science.gov (United States)

Zhu, Jinwei; Shang, Yuan; Xia, Caihao; Wang, Wenning; Wen, Wenyu; Zhang, Mingjie

2011-11-25

Membrane-associated guanylate kinases (MAGUKs) are a large family of scaffold proteins that play essential roles in tissue developments, cell-cell communications, cell polarity control, and cellular signal transductions. Despite extensive studies over the past two decades, the functions of the signature guanylate kinase domain (GK) of MAGUKs are poorly understood. Here we show that the GK domain of DLG1/SAP97 binds to asymmetric cell division regulatory protein LGN in a phosphorylation-dependent manner. The structure of the DLG1 SH3-GK tandem in complex with a phospho-LGN peptide reveals that the GMP-binding site of GK has evolved into a specific pSer/pThr-binding pocket. Residues both N- and C-terminal to the pSer are also critical for the specific binding of the phospho-LGN peptide to GK. We further demonstrate that the previously reported GK domain-mediated interactions of DLGs with other targets, such as GKAP/DLGAP1/SAPAP1 and SPAR, are also phosphorylation dependent. Finally, we provide evidence that other MAGUK GKs also function as phospho-peptide-binding modules. The discovery of the phosphorylation-dependent MAGUK GK/target interactions indicates that MAGUK scaffold-mediated signalling complex organizations are dynamically regulated.

Synthesis of Heparan Sulfate with Cyclophilin B-binding Properties Is Determined by Cell Type-specific Expression of Sulfotransferases*

Science.gov (United States)

Deligny, Audrey; Denys, Agnès; Marcant, Adeline; Melchior, Aurélie; Mazurier, Joël; van Kuppevelt, Toin H.; Allain, Fabrice

2010-01-01

Cyclophilin B (CyPB) induces migration and adhesion of T lymphocytes via a mechanism that requires interaction with 3-O-sulfated heparan sulfate (HS). HS biosynthesis is a complex process with many sulfotransferases involved. N-Deacetylases/N-sulfotransferases are responsible for N-sulfation, which is essential for subsequent modification steps, whereas 3-O-sulfotransferases (3-OSTs) catalyze the least abundant modification. These enzymes are represented by several isoforms, which differ in term of distribution pattern, suggesting their involvement in making tissue-specific HS. To elucidate how the specificity of CyPB binding is determined, we explored the relationships between the expression of these sulfotransferases and the generation of HS motifs with CyPB-binding properties. We demonstrated that high N-sulfate density and the presence of 2-O- and 3-O-sulfates determine binding of CyPB, as evidenced by competitive experiments with heparin derivatives, soluble HS, and anti-HS antibodies. We then showed that target cells, i.e. CD4+ lymphocyte subsets, monocytes/macrophages, and related cell lines, specifically expressed high levels of NDST2 and 3-OST3 isoforms. Silencing the expression of NDST1, NDST2, 2-OST, and 3-OST3 by RNA interference efficiently decreased binding and activity of CyPB, thus confirming their involvement in the biosynthesis of binding sequences for CyPB. Moreover, we demonstrated that NDST1 was able to partially sulfate exogenous substrate in the absence of NDST2 but not vice versa, suggesting that both isoenzymes do not have redundant activities but do have rather complementary activities in making N-sulfated sequences with CyPB-binding properties. Altogether, these results suggest a regulatory mechanism in which cell type-specific expression of certain HS sulfotransferases determines the specific binding of CyPB to target cells. PMID:19940140

Synthesis of heparan sulfate with cyclophilin B-binding properties is determined by cell type-specific expression of sulfotransferases.

Science.gov (United States)

Deligny, Audrey; Denys, Agnès; Marcant, Adeline; Melchior, Aurélie; Mazurier, Joël; van Kuppevelt, Toin H; Allain, Fabrice

2010-01-15

Cyclophilin B (CyPB) induces migration and adhesion of T lymphocytes via a mechanism that requires interaction with 3-O-sulfated heparan sulfate (HS). HS biosynthesis is a complex process with many sulfotransferases involved. N-Deacetylases/N-sulfotransferases are responsible for N-sulfation, which is essential for subsequent modification steps, whereas 3-O-sulfotransferases (3-OSTs) catalyze the least abundant modification. These enzymes are represented by several isoforms, which differ in term of distribution pattern, suggesting their involvement in making tissue-specific HS. To elucidate how the specificity of CyPB binding is determined, we explored the relationships between the expression of these sulfotransferases and the generation of HS motifs with CyPB-binding properties. We demonstrated that high N-sulfate density and the presence of 2-O- and 3-O-sulfates determine binding of CyPB, as evidenced by competitive experiments with heparin derivatives, soluble HS, and anti-HS antibodies. We then showed that target cells, i.e. CD4+ lymphocyte subsets, monocytes/macrophages, and related cell lines, specifically expressed high levels of NDST2 and 3-OST3 isoforms. Silencing the expression of NDST1, NDST2, 2-OST, and 3-OST3 by RNA interference efficiently decreased binding and activity of CyPB, thus confirming their involvement in the biosynthesis of binding sequences for CyPB. Moreover, we demonstrated that NDST1 was able to partially sulfate exogenous substrate in the absence of NDST2 but not vice versa, suggesting that both isoenzymes do not have redundant activities but do have rather complementary activities in making N-sulfated sequences with CyPB-binding properties. Altogether, these results suggest a regulatory mechanism in which cell type-specific expression of certain HS sulfotransferases determines the specific binding of CyPB to target cells.

Biodistribution, binding specificity and metabolism of [{sup 18}F]fluoroethylflumazenil in rodents

Energy Technology Data Exchange (ETDEWEB)

Leveque, Philippe; Labar, Daniel; Gallez, Bernard E-mail: gallez@cmfa.ucl.ac.be

2001-10-01

Pre-clinical studies were carried out in order to characterize in rodents the biodistribution, the binding specificity and the metabolism of [{sup 18}F]Fluoroethylflumazenil ([{sup 18}F]FEF), a potential candidate for in vivo imaging of the benzodiazepine receptors. In vivo competition with flumazenil indicates that [{sup 18}F]FEF binds specifically to the benzodiazepine receptor in the brain. The accumulation of [{sup 18}F]FEF was significantly lower than using [{sup 3}H]Flumazenil. The rather low accumulation in the brain is due to a rapid metabolism of [{sup 18}F]FEF in hydrophylic metabolites which cannot cross the blood brain barrier, and are rapidly eliminated in the urine. Inhibition of the metabolism by acetaminophen (chemically induced hepatitis) led to a significant increase of the radioactivity found in the circulating blood and in the brain, while these results were not observed using classical inhibitors of the cytochrome CYP450, cimetidine and ketoconazole.

Las β-(1®3-glucanas: moléculas inmunomoduladoras contaminantes de productos farmacéuticos β-(1®3-glucans as immunomodulating moléculas polluting pharmaceuticals

Directory of Open Access Journals (Sweden)

Zenia Pardo Ruiz

2012-03-01

Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis

Receptor binding proteins of Listeria monocytogenes bacteriophages A118 and P35 recognize serovar-specific teichoic acids

Energy Technology Data Exchange (ETDEWEB)

Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)

2015-03-15

Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.

Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

International Nuclear Information System (INIS)

Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

1998-01-01

The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

Interleukin-11 binds specific EF-hand proteins via their conserved structural motifs.

Science.gov (United States)

Kazakov, Alexei S; Sokolov, Andrei S; Vologzhannikova, Alisa A; Permyakova, Maria E; Khorn, Polina A; Ismailov, Ramis G; Denessiouk, Konstantin A; Denesyuk, Alexander I; Rastrygina, Victoria A; Baksheeva, Viktoriia E; Zernii, Evgeni Yu; Zinchenko, Dmitry V; Glazatov, Vladimir V; Uversky, Vladimir N; Mirzabekov, Tajib A; Permyakov, Eugene A; Permyakov, Sergei E

2017-01-01

Interleukin-11 (IL-11) is a hematopoietic cytokine engaged in numerous biological processes and validated as a target for treatment of various cancers. IL-11 contains intrinsically disordered regions that might recognize multiple targets. Recently we found that aside from IL-11RA and gp130 receptors, IL-11 interacts with calcium sensor protein S100P. Strict calcium dependence of this interaction suggests a possibility of IL-11 interaction with other calcium sensor proteins. Here we probed specificity of IL-11 to calcium-binding proteins of various types: calcium sensors of the EF-hand family (calmodulin, S100B and neuronal calcium sensors: recoverin, NCS-1, GCAP-1, GCAP-2), calcium buffers of the EF-hand family (S100G, oncomodulin), and a non-EF-hand calcium buffer (α-lactalbumin). A specific subset of the calcium sensor proteins (calmodulin, S100B, NCS-1, GCAP-1/2) exhibits metal-dependent binding of IL-11 with dissociation constants of 1-19 μM. These proteins share several amino acid residues belonging to conservative structural motifs of the EF-hand proteins, 'black' and 'gray' clusters. Replacements of the respective S100P residues by alanine drastically decrease its affinity to IL-11, suggesting their involvement into the association process. Secondary structure and accessibility of the hinge region of the EF-hand proteins studied are predicted to control specificity and selectivity of their binding to IL-11. The IL-11 interaction with the EF-hand proteins is expected to occur under numerous pathological conditions, accompanied by disintegration of plasma membrane and efflux of cellular components into the extracellular milieu.

Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

International Nuclear Information System (INIS)

Evans, T.; Reitman, M.; Felsenfeld, G.

1988-01-01

The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Enzymatic hydrolysis on protein and β-glucan content of Sang-yodrice bran hydrolysatesand their anti-inflammatory activityonRAW 264.7 cells

Directory of Open Access Journals (Sweden)

Natcha Phantuwong

2017-12-01

Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9

Distinct phosphotyrosines on a growth factor receptor bind to specific molecules that mediate different signaling pathways.

Science.gov (United States)

Fantl, W J; Escobedo, J A; Martin, G A; Turck, C W; del Rosario, M; McCormick, F; Williams, L T

1992-05-01

The receptor for platelet-derived growth factor (PDGF) binds two proteins containing SH2 domains, GTPase activating protein (GAP) and phosphatidylinositol 3-kinase (PI3-kinase). The sites on the receptor that mediate this interaction were identified by using phosphotyrosine-containing peptides representing receptor sequences to block specifically binding of either PI3-kinase or GAP. These results suggested that PI3-kinase binds two phosphotyrosine residues, each located in a 5 aa motif with an essential methionine at the fourth position C-terminal to the tyrosine. Point mutations at these sites caused a selective elimination of PI3-kinase binding and loss of PDGF-stimulated DNA synthesis. Mutation of the binding site for GAP prevented the receptor from associating with or phosphorylating GAP, but had no effect on PI3-kinase binding and little effect on DNA synthesis. Therefore, GAP and PI3-kinase interact with the receptor by binding to different phosphotyrosine-containing sequence motifs.

Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

NARCIS (Netherlands)

Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

1979-01-01

A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

Two secondary carbohydrate binding sites on the surface of barley alpha-amylase 1 have distinct functions and display synergy in hydrolysis of starch granules.

Science.gov (United States)

Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte

2009-08-18

Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.

Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2014-01-01

Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

KAUST Repository

Mahfouz, Magdy M.

2011-01-24

Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA binding by the plant-specific NAC transcription factors in crystal and solution

DEFF Research Database (Denmark)

Welner, Ditte Hededam; Lindemose, Søren; Grossmann, J. Günter

2012-01-01

angle X-ray scattering on complexes with oligonucleotides, mutagenesis and (DNase I and uranyl photo-) footprinting, is combined to form a structural view of DNA-binding, and for the first time provide experimental evidence for the speculated relationship between plant-specific NAC proteins, WRKY...

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

Science.gov (United States)

de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

2017-12-20

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

Directory of Open Access Journals (Sweden)

Asli Akyol

2014-09-01

Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

Science.gov (United States)

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

Filtration assay for quantitation of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) specific binding to whole cells in culture

International Nuclear Information System (INIS)

Dold, K.M.; Greenlee, W.F.

1990-01-01

A rapid and sensitive filtration assay for quantitating the specific binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) to whole cells in culture is described. Cell monolayers are incubated with [3H]TCDD in the presence or absence of excess unlabeled ligand, detached from the culture dish with trypsin, filtered, and washed with cold (-78 degrees C) acetone to separate free and nonspecifically bound TCDD from specifically bound TCDD. TCDD receptor binding parameters were characterized in the murine hepatoma cell line Hepa1c1c7. The lower limit of detection of TCDD specific binding was in a sample equivalent to 10 micrograms of total cell protein. The equilibrium dissociation constant and stereospecificity for binding to the TCDD receptor were the same as those previously reported with other TCDD receptor assays on broken cell preparations. Analysis of binding in the murine hepatoma TCDD receptor variants TAO-c1BPrc1 and BPrc1 indicated that this assay will detect receptor number or affinity variants, but will not detect nuclear transfer deficient variants. The major advantage of the whole cell binding assay is that it provides the means to rapidly and reproducibly quantitate TCDD specific binding in small samples of whole cells in culture. In addition, this method eliminates loss or degradation of the receptor protein during the fractionation of cells required in previously reported methods. This method should prove useful in screening clonal cell populations for TCDD receptor number and affinity variants, and in screening for TCDD receptor binding activity in complementation studies of receptor deficient cells

On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

Science.gov (United States)

Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

2017-06-01

Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

Directory of Open Access Journals (Sweden)

Eduardo Madrigal-Bujaidar

2015-06-01

Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

Specificity of the Cyclic GMP-Binding Activity and of a Cyclic GMP-Dependent Cyclic GMP Phosphodiesterase in Dictyostelium discoideum

NARCIS (Netherlands)

Haastert, Peter J.M. van; Walsum, Hans van; Meer, Rob C. van der; Bulgakov, Roman; Konijn, Theo M.

1982-01-01

The nucleotide specificity of the cyclic GMP-binding activity in a homogenate of Dictyostelium discoideum was determined by competition of cyclic GMP derivatives with [8-3H] cyclic GMP for the binding sites. The results indicate that cyclic GMP is bound to the binding proteins by hydrogen bonds at

Displacement of specific serotonin and lysergic acid diethylamide binding by Ergalgin, a new antiserotonin drug

International Nuclear Information System (INIS)

Oelszner, W.

1980-01-01

[ 3 H]-serotonin and [ 3 H]-lysergic acid diethylamide (LSD) bind with a high affinity, Ksub(D) = 12 nM and 6 nM, respectively, to distinct receptors of rat caudate membranes in vitro. Displacement experiments with unlabeled serotonin and LSD support the hypothesis of serotonin receptors existing in an agonist and antagonist state. Methysergide and Ergalgin display quite similar potenties in displacing [ 3 H]-serontonin and [ 3 H]-LSD from their specific binding sites (Ksub(i) = 46.7 and 53.4 nM; 22.3 and 36.5 nM, respectively). Contrary to pharmacological findings these binding results are in favour of mixed agonist/antagonist properties of these compounds. (author)

Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

Science.gov (United States)

Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

2017-08-15

Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

Science.gov (United States)

Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

2014-03-19

A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

On binding specificity of (6–4) photolyase to a T(6–4)T DNA photoproduct

DEFF Research Database (Denmark)

Aalbæk Jepsen, Katrine; Solov'yov, Ilia

2017-01-01

this binding for a specific enzyme called (6–4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines...

A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.

Science.gov (United States)

Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji

2011-06-07

The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur

Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

Czech Academy of Sciences Publication Activity Database

Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

2016-01-01

Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

Science.gov (United States)

Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

2003-03-01

Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

Tumor necrosis factor: specific binding and internalization in sensitive and resistant cells

International Nuclear Information System (INIS)

Tsujimoto, M.; Yip, Y.K.; Vilcek, J.

1985-01-01

Highly purified, Escherichia coli-derived recombinant human tumor necrosis factor (TNF) was labeled with 125 I and employed to determine receptor binding, internalization, and intracellular degradation in murine L929 cells (highly sensitive to the cytotoxic action of TNF) and in diploid human FS-4 cells (resistant to TNF cytotoxicity). 125 I-labeled TNF bound specifically to high-affinity receptors on both L929 and FS-4 cells. Scatchard analysis of the binding data indicated the presence of 2200 binding sites per L929 cell and 7500 binding sites per FS-4 cell. The calculated dissociation constants are 6.1 x 10 -10 M and 3.2 x 10 -10 M for L929 and FS-4 cells, respectively. In both L929 and FS-4 cells, incubation at 37 0 C resulted in a rapid internalization of the bulk of the cell-bound TNF, followed by the appearance of trichloroacetic acid-soluble 125 I radioactivity in the tissue culture medium, due to degradation of TNF. Degradation but not cellular uptake of TNF was inhibited in the presence of chloroquine (an inhibitor of lysosomal proteases) in both L929 and FS-4 cells, suggesting that degradation occurs intracellularly, probably within lysosomes. These results show that resistance of FS-4 cells to TNF cytotoxicity is not due to a lack of receptors or their inability to internalize and degrade TNF

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

Science.gov (United States)

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

/sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

Energy Technology Data Exchange (ETDEWEB)

Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

1988-01-01

Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

Thermodynamics of sequence-specific binding of PNA to DNA

DEFF Research Database (Denmark)

Ratilainen, T; Holmén, A; Tuite, E

2000-01-01

For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes) and seq......For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes...

Modulation of DNA binding by gene-specific transcription factors.

Science.gov (United States)

Schleif, Robert F

2013-10-01

The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

The establishment and primary application of specific fatty acid binding protein radioimmunoassay

International Nuclear Information System (INIS)

Yan Guangtao; Zhang Kai; Xue Hui; Hao Xiuhua; Wang Luhuan

2004-01-01

A highly specific and highly sensitive radioimmunoassay method for fatty acid binding protein (FABP) in human serum was developed. The highly effective antibody againist FABP was obtained by immunizing rabbits with human recombined FABP. The FABP was labeled with 125 I by chloramines-T methods and purified by the Sephadex-G25 column. Te reaction between antigen and antibody was carried out by one step balance method and incubated in 4 degree for 24 hours, then binding and free antigen were separated by PR reagent. The detection range of this method is f rom 5 to 405 ng/mL; the lowest detection level is 9 ng/mL. CV's within batch and between batch were less than 6.4% and 8.5% respectively. The serum FABP concentration of healthy persons is 15.68 ± 2.91 ng/mL (n=45), that of ICU patients is 72.08 ± 32.64 ng/mL (n=46) and that of cardiopathy patients is 78.95 ± 24.83 ng/mL (n=73). It suggest that this method is stable, simple, specific and highly sensitive. It is suitable for testing FABP in human serum. (authors)

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

In silico simulations of STAT1 and STAT3 inhibitors predict SH2 domain cross-binding specificity.

Science.gov (United States)

Szelag, Malgorzata; Sikorski, Krzysztof; Czerwoniec, Anna; Szatkowska, Katarzyna; Wesoly, Joanna; Bluyssen, Hans A R

2013-11-15

Signal transducers and activators of transcription (STATs) comprise a family of transcription factors that are structurally related and which participate in signaling pathways activated by cytokines, growth factors and pathogens. Activation of STAT proteins is mediated by the highly conserved Src homology 2 (SH2) domain, which interacts with phosphotyrosine motifs for specific contacts between STATs and receptors and for STAT dimerization. By generating new models for human (h)STAT1, hSTAT2 and hSTAT3 we applied comparative in silico docking to determine SH2-binding specificity of the STAT3 inhibitor stattic, and of fludarabine (STAT1 inhibitor). Thus, we provide evidence that by primarily targeting the highly conserved phosphotyrosine (pY+0) SH2 binding pocket stattic is not a specific hSTAT3 inhibitor, but is equally effective towards hSTAT1 and hSTAT2. This was confirmed in Human Micro-vascular Endothelial Cells (HMECs) in vitro, in which stattic inhibited interferon-α-induced phosphorylation of all three STATs. Likewise, fludarabine inhibits both hSTAT1 and hSTAT3 phosphorylation, but not hSTAT2, by competing with the highly conserved pY+0 and pY-X binding sites, which are less well-preserved in hSTAT2. Moreover we observed that in HMECs in vitro fludarabine inhibits cytokine and lipopolysaccharide-induced phosphorylation of hSTAT1 and hSTAT3 but does not affect hSTAT2. Finally, multiple sequence alignment of STAT-SH2 domain sequences confirmed high conservation between hSTAT1 and hSTAT3, but not hSTAT2, with respect to stattic and fludarabine binding sites. Together our data offer a molecular basis that explains STAT cross-binding specificity of stattic and fludarabine, thereby questioning the present selection strategies of SH2 domain-based competitive small inhibitors. © 2013 Elsevier B.V. All rights reserved.

Relationship of binding specificity and structural property of the technetium-99m complexes for tumor hypoxia and tumor angiogenesis imaging

International Nuclear Information System (INIS)

Su, Z.F.

2005-01-01

The growth of tumor requires nutrition and oxygen. Tumor cells will become hypoxic when the supply of oxygen is insufficient. Hypoxic tumor cells will not only resist radiation therapy and chemotherapy, but also induce angiogenesis for oxygen supply and for metastasis. Therefore, detection of tumor hypoxia and tumor angiogenesis with high sensitive radio labeled imaging agents is important. Hypoxic tumor cells may display some molecules as tumor markers for the specific binding with radiopharmaceuticals. Radiopharmaceuticals, unlike the non-radioactive drugs, are trace compounds in a given dosage. Due to the extreme low concentration, the non-specific accumulation of the radiotracers by blood cells and proteins, tissues, and organs can be even more serious compared to the non-radioactive drugs. The non-specific accumulation of the radiotracers can make the ratios of tumor/tissue (in terms of i.d.%/g) falling to the range of 2∼7 [1-2]. Non-specific binding of radiopharmaceuticals is common, but detailed studies on it are poor documented. This presentation reports the study of the relationship of non-specific accumulation and the structural property of two type of 99m TC labeled compounds: (a) 99m Tc-(amine o xime) containing either 2-nitroimidazole (2-NI, as hypoxia tumor cells specific agents), or 4-nitro- imidazole (4-NI, as control), or aniline (as reference) groups; (b) 99m Tc-(arginine-glycine- aspartic acid, RGD, as tumor angiogenesis specific agents) and 99m Tc-(arginine-glycine- glutarmic acid, RGE, as control). The 99m Tc-(amine-oxime) complexes, in addition to the 2-NI, 4-NI, and aniline groups, contain methyl-, ethyl-, propyl-, iso-butyl-, t-butyl-, phenyl-, and Benzyl- groups as well to make the radiotracers differing in structure and in lipophilicity , while the lipophilicity of a radiotracer plays an important role in non-specific cellular accumulation and protein binding, The results demonstrated that (1) the complex containing 2-NI showed specific

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

Directory of Open Access Journals (Sweden)

Fhernanda R Smiderle

Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

Identification of fluorescent compounds with non-specific binding property via high throughput live cell microscopy.

Directory of Open Access Journals (Sweden)

Sangeeta Nath

Full Text Available INTRODUCTION: Compounds exhibiting low non-specific intracellular binding or non-stickiness are concomitant with rapid clearing and in high demand for live-cell imaging assays because they allow for intracellular receptor localization with a high signal/noise ratio. The non-stickiness property is particularly important for imaging intracellular receptors due to the equilibria involved. METHOD: Three mammalian cell lines with diverse genetic backgrounds were used to screen a combinatorial fluorescence library via high throughput live cell microscopy for potential ligands with high in- and out-flux properties. The binding properties of ligands identified from the first screen were subsequently validated on plant root hair. A correlative analysis was then performed between each ligand and its corresponding physiochemical and structural properties. RESULTS: The non-stickiness property of each ligand was quantified as a function of the temporal uptake and retention on a cell-by-cell basis. Our data shows that (i mammalian systems can serve as a pre-screening tool for complex plant species that are not amenable to high-throughput imaging; (ii retention and spatial localization of chemical compounds vary within and between each cell line; and (iii the structural similarities of compounds can infer their non-specific binding properties. CONCLUSION: We have validated a protocol for identifying chemical compounds with non-specific binding properties that is testable across diverse species. Further analysis reveals an overlap between the non-stickiness property and the structural similarity of compounds. The net result is a more robust screening assay for identifying desirable ligands that can be used to monitor intracellular localization. Several new applications of the screening protocol and results are also presented.

Rational steering of insulin binding specificity by intra-chain chemical crosslinking

Science.gov (United States)

Viková, Jitka; Collinsová, Michaela; Kletvíková, Emília; Buděšínský, Miloš; Kaplan, Vojtěch; Žáková, Lenka; Veverka, Václav; Hexnerová, Rozálie; Aviñó, Roberto J. Tarazona; Straková, Jana; Selicharová, Irena; Vaněk, Václav; Wright, Daniel W.; Watson, Christopher J.; Turkenburg, Johan P.; Brzozowski, Andrzej M.; Jiráček, Jiří

2016-01-01

Insulin is a key hormone of human metabolism with major therapeutic importance for both types of diabetes. New insulin analogues with more physiological profiles and better glycemic control are needed, especially analogues that preferentially bind to the metabolic B-isoform of insulin receptor (IR-B). Here, we aimed to stabilize and modulate the receptor-compatible conformation of insulin by covalent intra-chain crosslinking within its B22-B30 segment, using the CuI-catalyzed Huisgen 1,3-dipolar cycloaddition reaction of azides and alkynes. This approach resulted in 14 new, systematically crosslinked insulin analogues whose structures and functions were extensively characterized and correlated. One of the analogues, containing a B26-B29 triazole bridge, was highly active in binding to both IR isoforms, with a significant preference for IR-B. Our results demonstrate the potential of chemistry-driven modulation of insulin function, also shedding new light on the functional importance of hormone’s B-chain C-terminus for its IR-B specificity.

Simultaneous localization of an hepatic binding protein specific for galactose and of galactose-containing receptors on rat hepatocytes.

Science.gov (United States)

Horisberger, M; VonLanthen, M

1978-11-01

The hepatic binding protein, specific for galactose-terminated glycoproteins (asialoglycoproteins) and the receptors for the Ricinus communis lectin, specific for galactose residues (RCA1), were simultaneously localized on isolated rat hepatocytes by the gold method. The marker for the binding protein was prepared from gold granules (5 nm in diam.) labeled with ceruloplasmin and desialylated. The marker specific for galactose-containing receptors consisted of granules (17 nm in diameter) labeled with RCA1. It was established that both markers did not interact. Hepatocytes (fresh or briefly fixed with glutaraldehyde) were successively incubated with the asialoceruloplasmin and the RCA1 marker. Examination of thin sections by electron microscopy indicated that the binding protein and the RCA1 receptors were often in the proximity of each other on the plasmamembrane. Using the same technique, wheat germ agglutinin (WGA) receptors were generally found on area of the plasmamembrane poorly marked by the RCA1 gold marker. The binding of asialoceruloplasmin gold markers was studied as a function of the size of the granules. It became insignificant when the size was above 17 nm. Previous results have shown that the binding of RCA1 is low when the marker reaches 50 nm in size while WGA markers up to 75 nm are well bound by hepatocytes. It is therefore hypothesized that the binding protein and RCA1 receptors are located between glycoprotein brushes of increasing spacing while part or all of the WGA receptors are located at the periphery of the brushes.

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

Science.gov (United States)

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Generation of a haptoglobin-hemoglobin complex-specific Fab antibody blocking the binding of the complex to CD163

DEFF Research Database (Denmark)

Horn, Ivo R; Nielsen, Marianne Jensby; Madsen, Mette

2003-01-01

During intravascular hemolysis hemoglobin (Hb) binds to haptoglobin (Hp) leading to endocytosis of the complex by the macrophage receptor, CD163. In the present study, we used a phage-display Fab antibody strategy to explore if the complex formation between Hp and Hb leads to exposure of antigenic...... epitopes specific for the complex. By Hp-Hb-affinity screening of a phage-Fab library, we isolated a phage clone against the ligand complex. Surface plasmon resonance analyses of the Fab part expressed as a recombinant protein revealed a high affinity binding (KD = 3.9 nm) to Hp-Hb, whereas no binding...... was measured for non-complexed Hp or Hb. The Fab antibody completely inhibited the binding of 125I-labeled Hp-Hb complexes to CD163 and blocked their uptake in CD163-transfected cells. In conclusion, we have raised a receptor-blocking antibody specifically recognizing the Hp-Hb complex. In addition to provide...

DNA-binding specificity and molecular functions of NAC transcription factors

DEFF Research Database (Denmark)

Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

2005-01-01

The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...

Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

International Nuclear Information System (INIS)

Dugger, W.M.; Palmer, R.L.

1986-01-01

The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

NARCIS (Netherlands)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-01

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

Science.gov (United States)

Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

2018-04-25

Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

NARCIS (Netherlands)

Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

2017-01-01

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

Specificity Characterization of SLA Class I Molecules Binding to Swine-Origin Viral Cytotoxic T Lymphocyte Epitope Peptides in Vitro

Directory of Open Access Journals (Sweden)

Caixia Gao

2017-12-01

Full Text Available Swine leukocyte antigen (SLA class I molecules play a crucial role in generating specific cellular immune responses against viruses and other intracellular pathogens. They mainly bind and present antigens of intracellular origin to circulating MHC I-restricted cytotoxic T lymphocytes (CTLs. Binding of an appropriate epitope to an SLA class I molecule is the single most selective event in antigen presentation and the first step in the killing of infected cells by CD8+ CTLs. Moreover, the antigen epitopes are strictly restricted to specific SLA molecules. In this study, we constructed SLA class I complexes in vitro comprising viral epitope peptides, the extracellular region of the SLA-1 molecules, and β2-microglobulin (β2m using splicing overlap extension polymerase chain reaction (SOE-PCR. The protein complexes were induced and expressed in an Escherichia coli prokaryotic expression system and subsequently purified and refolded. Specific binding of seven SLA-1 proteins to one classical swine fever virus (CSFV and four porcine reproductive and respiratory syndrome virus (PRRSV epitope peptides was detected by enzyme-linked immunosorbent assay (ELISA-based method. The SLA-1∗13:01, SLA-1∗11:10, and SLA-1∗11:01:02 proteins were able to bind specifically to different CTL epitopes of CSFV and PRRSV and the MHC restrictions of the five epitopes were identified. The fixed combination of Asn151Val152 residues was identified as the potentially key amino acid residues influencing the binding of viral several CTL epitope peptides to SLA-1∗13:01 and SLA-1∗04:01:01 proteins. The more flexible pocket E in the SLA-1∗13:01 protein might have fewer steric limitations and therefore be able to accommodate more residues of viral CTL epitope peptides, and may thus play a critical biochemical role in determining the peptide-binding motif of SLA-1∗13:01. Characterization of the binding specificity of peptides to SLA class I molecules provides an

Two-dimensional NMR data of a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans and schizophyllan from Schizophyllum commune

Directory of Open Access Journals (Sweden)

Hiroyuki Kono

2017-12-01

Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled “NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6-glucan from A. pullulans” (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1→3, 1→6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data

Involvement of the N-terminal part of cyclophilin B in the interaction with specific Jurkat T-cell binding sites.

Science.gov (United States)

Mariller, C; Haendler, B; Allain, F; Denys, A; Spik, G

1996-07-15

Cyclophilin B (CyPB) is secreted in biological fluids such as blood or milk and binds to a specific receptor present on the human lymphoblastic cell line Jurkat and on human peripheral blood lymphocytes. This study was intended to specify the areas of CyPB that are involved in the interaction with the receptor. A synthetic peptide corresponding to the first 24 N-terminal amino acid residues of CyPB was shown to specifically recognize the receptor. Moreover, modification of Arg18 of CyPB by p-hydroxyphenlglyoxal led to a dramatic loss of affinity for the receptor. However, when this residue was replaced by an alanine residue using site-directed mutagenesis, no modification of the binding properties was found, suggesting that Arg18 is not directly involved but is sufficiently close to the interaction site to interfere with the binding when modified. Competitive binding experiments using a chimaeric protein made up of the 24 N-terminal amino acid residues of CyPB fused to the cyclophilin A core sequence confirmed the involvement of this region of CyPB in receptor binding.

Towards bilirubin imprinted poly(methacrylic acid-co-ethylene glycol dimethylacrylate) for the specific binding of α-bilirubin

International Nuclear Information System (INIS)

Syu, M.-J.; Deng, J.-H.; Nian, Y.-M.

2004-01-01

With α-bilirubin as a molecular template, polymerization of methacrylic acid (MAA) was carried out with the aid of the initiator 2,2-azobisisobutyronitrile (AIBN) and the cross-linking agent ethylene glycol dimethylacrylate (EGDMA). Bulk polymerization was successfully carried out so that poly(methacrylic acid-co-ethylene glycol dimethylacrylate) (poly(MAA-EGDMA)) imprinted with α-bilirubin was first developed. UV irradiation polymerization and heated polymerization methods were compared. Effect of different ratios of monomer to EGDMA during the polymerization was also discussed. Proper solvent for better desorption of α-bilirubin from the imprinted poly(MAA-EGDMA) was investigated. In addition, SEM photos were provided for observing the differences between the surfaces of the imprinted poly(MAA-EGDMA) before and after extraction. The corresponding binding results of α-bilirubin imprinted poly(MAA-EGDMA) and non-imprinted poly(MAA-EGDMA) both after extraction were compared. How the pH values during extraction stage affected the binding capacities of the imprinted polymer as well as non-imprinted polymer were also discussed. Similar study and comparison were made for different binding pH values. Different compounds of similar molecular weight were used to show the specific binding of the imprinted polymer for bilirubin. The results further confirmed the successful binding as well as specificity of the imprinted poly(MAA-EGDMA) for α-bilirubin

Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants

Directory of Open Access Journals (Sweden)

Xueyong Zhu

2015-11-01

Full Text Available Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA mutants from ferret-transmissible H5N1 viruses of A/Vietnam/1203/2004 and A/Indonesia/5/2005 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6-linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3-linked sialosides. Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogs reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.

Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

NARCIS (Netherlands)

Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

2017-01-01

Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

Characterization of the binding specificity of Anguilla anguilla agglutinin (AAA) in comparison to Ulex europaeus agglutinin I (UEA-I).

Science.gov (United States)

Baldus, S E; Thiele, J; Park, Y O; Hanisch, F G; Bara, J; Fischer, R

1996-08-01

Using immunochemical and immunohistochemical methods, the binding site of Anguilla anguilla agglutinin (AAA) was characterized and compared with the related fucose-specific lectin from Ulex europaeus (UEA-I). In solid-phase enzyme-linked immunoassays, the two lectins recognized Fuc alpha 1-2Gal beta-HSA. AAA additionally cross-reacted with neoglycolipids bearing lacto-N-fucopentaose (LNFP) I [H type 1] and II [Le(a)] and lactodifucotetraose (LDFT) as glycan moieties. UEA-I, on the other hand, bound to a LDFT-derived neoglycolipid but not to the other neoglycolipids tested. Binding of AAA to gastric mucin was competitively neutralized by Le(a)-specific monoclonal antibodies. UEA-I binding, on the other hand, was reduced after co-incubation with H type 2- and Le(y)-specific monoclonal antibodies. According to our results, AAA reacts with fucosylated type 1 chain antigens, whereas UEA-I binds only to the alpha 1-2-fucosylated LDFT-derived neoglycolipid. In immunohistochemical studies, the reactivity of AAA and UEA-I in normal pyloric mucosa from individuals with known Lewis and secretor status was analysed. AAA showed a broad reaction in the superficial pyloric mucosa from secretors and non-secretors, but AAA reactivity was more pronounced in Le(a+b-) individuals. On the other hand, UEA-I stained the superficial pyloric mucosa only from secretor individuals. A staining of deep mucous glands by the lectins was found in all specimens. Both reacted with most human carcinomas of different origin. Slight differences in their binding pattern were observed and may be explained by the different fine-specificities of the lectins.

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

Measuring specific receptor binding of a PET radioligand in human brain without pharmacological blockade: The genomic plot.

Science.gov (United States)

Veronese, Mattia; Zanotti-Fregonara, Paolo; Rizzo, Gaia; Bertoldo, Alessandra; Innis, Robert B; Turkheimer, Federico E

2016-04-15

PET studies allow in vivo imaging of the density of brain receptor species. The PET signal, however, is the sum of the fraction of radioligand that is specifically bound to the target receptor and the non-displaceable fraction (i.e. the non-specifically bound radioligand plus the free ligand in tissue). Therefore, measuring the non-displaceable fraction, which is generally assumed to be constant across the brain, is a necessary step to obtain regional estimates of the specific fractions. The nondisplaceable binding can be directly measured if a reference region, i.e. a region devoid of any specific binding, is available. Many receptors are however widely expressed across the brain, and a true reference region is rarely available. In these cases, the nonspecific binding can be obtained after competitive pharmacological blockade, which is often contraindicated in humans. In this work we introduce the genomic plot for estimating the nondisplaceable fraction using baseline scans only. The genomic plot is a transformation of the Lassen graphical method in which the brain maps of mRNA transcripts of the target receptor obtained from the Allen brain atlas are used as a surrogate measure of the specific binding. Thus, the genomic plot allows the calculation of the specific and nondisplaceable components of radioligand uptake without the need of pharmacological blockade. We first assessed the statistical properties of the method with computer simulations. Then we sought ground-truth validation using human PET datasets of seven different neuroreceptor radioligands, where nonspecific fractions were either obtained separately using drug displacement or available from a true reference region. The population nondisplaceable fractions estimated by the genomic plot were very close to those measured by actual human blocking studies (mean relative difference between 2% and 7%). However, these estimates were valid only when mRNA expressions were predictive of protein levels (i

Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

DEFF Research Database (Denmark)

Peng, Xu; Brügger, Kim; Shen, Biao

2003-01-01

terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...

High non-specific binding of the {beta}{sub 1}-selective radioligand 2-{sup 125}I-ICI-H

Energy Technology Data Exchange (ETDEWEB)

Riemann, B. [Muenster Univ. (Germany). Department of Nuclear Medicine; Law, M.P. [Muenster Univ. (Germany). Department of Nuclear Medicine; Hammersmith Hospital, London (United Kingdom). MRC Clinical Sciences Centre; Kopka, K. [Muenster Univ. (DE). Department of Nuclear Medicine] [and others

2003-08-01

Aim: As results of cardiac biopsies suggest, myocardial {beta}{sub 1}-adrenoceptor density is reduced in patients with chronic heart failure. However, changes in cardiac {beta}{sub 2}-adrenoceptors vary. With suitable radiopharmaceuticals single photon emission computed tomography (SPECT) and positron emission tomography (PET) offer the opportunity to assess {beta}-adrenoceptors non-invasively. Among the novel racemic analogues of the established {beta}{sub 1}-selective adrenoceptor antagonist ICI 89.406 the iodinated 2-I-ICI-H showed high affinity and selectivity to {beta}{sub 1}-adrenoceptors in murine ventricular membranes. The aim of this study was its evaluation as a putative subtype selective {beta}{sub 1}-adrenergic radioligand in cardiac imaging. Methods: Competition studies in vitro and in vivo were used to investigate the kinetics of 2-I-ICI-H binding to cardiac {beta}-adrenoceptors in mice and rats. In addition, the radiosynthesis of 2-{sup 125}I-ICI-H from the silylated precursor 2-SiMe{sub 3}-ICI-H was established. The specific activity was 80 GBq/{mu}mol, the radiochemical yield ranged from 70 to 80%. Results: The unlabelled compound 2-I-ICI-H showed high {beta}{sub 1}-selectivity and -affinity in the in vitro competition studies. In vivo biodistribution studies apparently showed low affinity to cardiac {beta}-adrenoceptors. The radiolabelled counterpart 2-{sup 125}I-ICI-H showed a high degree of non-specific binding in vitro and no specific binding to cardiac {beta}{sub 1}-adrenoceptors in vivo. Conclusion: Because of its high non-specific binding 2-{sup 125}I-ICI-H is no suitable radiotracer for imaging in vivo. (orig.)

Acetylcholine-Binding Protein Engineered to Mimic the α4-α4 Binding Pocket in α4β2 Nicotinic Acetylcholine Receptors Reveals Interface Specific Interactions Important for Binding and Activity