Human γ-globin genes silenced independently of other genes in the β-globin locus.

NARCIS (Netherlands)

N.O. Dillon (Niall); F.G. Grosveld (Frank)

1991-01-01

textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

Search for antisense copies of beta-globin mRNA in anemic mouse spleen

Directory of Open Access Journals (Sweden)

Taylor John M

2001-03-01

Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

Molecular analysis of the human β-globin locus activation region

International Nuclear Information System (INIS)

Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.

1989-01-01

Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

Science.gov (United States)

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

International Nuclear Information System (INIS)

Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

1988-01-01

The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues

International Nuclear Information System (INIS)

Shakin, S.H.; Liebhaber, S.A.

1987-01-01

The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation

High-level transfer and long-term expression of the human beta-globin gene in a mouse transplant model.

Science.gov (United States)

Raftopoulos, H; Ward, M; Bank, A

1998-06-30

Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

Science.gov (United States)

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

Distinctive patterns of evolution of the δ-globin gene (HBD in primates.

Directory of Open Access Journals (Sweden)

Ana Moleirinho

Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

In vivo protein-DNA interactions at the β-globin gene locus

International Nuclear Information System (INIS)

Tohru Ikuta; Yuet Wai Kan

1991-01-01

The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells

Characterization of histone H3K27 modifications in the β-globin locus

International Nuclear Information System (INIS)

Kim, Yea Woon; Kim, AeRi

2011-01-01

Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.

Brain alpha- and beta-globin expression after intracerebral hemorrhage

OpenAIRE

He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua

2010-01-01

Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...

Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.

Science.gov (United States)

Raftopoulos, H; Ward, M; Leboulch, P; Bank, A

1997-11-01

Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.

Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

International Nuclear Information System (INIS)

Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

1988-01-01

In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

International Nuclear Information System (INIS)

Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

1988-01-01

The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

Long-term high-level expression of human beta-globin occurs following transplantation of transgenic marrow into irradiated mice.

Science.gov (United States)

Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A

1993-03-01

When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.

Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

OpenAIRE

Liebhaber, S A; Cash, F E; Main, D M

1985-01-01

alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

An N-myristoylated globin with a redox-sensing function that regulates the defecation cycle in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Lesley Tilleman

Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

Science.gov (United States)

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Oxygen binding properties of non-mammalian nerve globins

DEFF Research Database (Denmark)

Hundahl, Christian; Fago, Angela; Dewilde, Sylvia

2006-01-01

Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...

A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

Directory of Open Access Journals (Sweden)

Marta Durlak

Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

Variation in RNA-Seq transcriptome profiles of peripheral whole blood from healthy individuals with and without globin depletion.

Directory of Open Access Journals (Sweden)

Heesun Shin

Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

Science.gov (United States)

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

Directory of Open Access Journals (Sweden)

Čokić Vladan P.

2014-01-01

Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

Chicken globin gene transcription is cell lineage specific during the time of the switch

International Nuclear Information System (INIS)

Lois, R.; Martinson, H.G.

1989-01-01

Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

NARCIS (Netherlands)

Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

2018-01-01

textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

Position-independent high level expression of the human β-globin gene in transgenic mice.

NARCIS (Netherlands)

F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)

1987-01-01

textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of

Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

Directory of Open Access Journals (Sweden)

Mir A Hossain

2016-01-01

Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

Science.gov (United States)

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

Science.gov (United States)

Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

2016-01-01

We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

Directory of Open Access Journals (Sweden)

Supachai Ekwattanakit

2012-01-01

Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

Nonsense mutations in the human β-globin gene affect mRNA metabolism

International Nuclear Information System (INIS)

Baserga, S.J.; Benz, E.J. Jr.

1988-01-01

A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Directory of Open Access Journals (Sweden)

Giulia Breveglieri

2015-01-01

Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Science.gov (United States)

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

Science.gov (United States)

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

International Nuclear Information System (INIS)

Helder, J.; Deisseroth, A.

1987-01-01

The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

NARCIS (Netherlands)

E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

1983-01-01

textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

Oxygen Association-Dissociation and Stability Analysis on Mouse Hemoglobins with Mutant α- and β-Globins

Science.gov (United States)

D'Surney, S. J.; Popp, R. A.

1992-01-01

Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042

Production and characterization of monoclonal antibodies against α-globin chain-containing human hemoglobins for detecting α-thalassemia disease.

Science.gov (United States)

Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak

2016-01-01

Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.

Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

OpenAIRE

Liebhaber, S A; Kan, Y W

1981-01-01

The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

Science.gov (United States)

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

International Nuclear Information System (INIS)

Moon, A.M.; Ley, T.J.

1990-01-01

DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

International Nuclear Information System (INIS)

Evans, T.; Reitman, M.; Felsenfeld, G.

1988-01-01

The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

Science.gov (United States)

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

Energy Technology Data Exchange (ETDEWEB)

Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

1994-09-01

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids

DEFF Research Database (Denmark)

Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S

2008-01-01

Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

Science.gov (United States)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice

DEFF Research Database (Denmark)

Runck, Amy M; Weber, Roy E.; Fago, Angela

2010-01-01

exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

Directory of Open Access Journals (Sweden)

Elza Miyuki Kimura

2015-04-01

Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

Science.gov (United States)

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Coordinate expression of heme and globin is essential for effective erythropoiesis.

Science.gov (United States)

Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L

2015-12-01

Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

Science.gov (United States)

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

International Nuclear Information System (INIS)

Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

2004-01-01

The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

Expression of human gamma-globin genes in human erythroleukemia (K562) cells.

Science.gov (United States)

Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A

1987-12-15

K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Geographical distribution of β-globin gene mutations in Syria.

Science.gov (United States)

Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

2018-04-11

Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

Dominant control region of the human β- like globin gene cluster

NARCIS (Netherlands)

Blom van Assendelft, Margaretha van

1989-01-01

The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

OpenAIRE

Walker, Aisha L.; Ofori-Acquah, Solomon

2016-01-01

The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

Variation in Gamma-Globin Expression before and after Induction with Hydroxyurea Associated with BCL11A, KLF1 and TAL1.

Directory of Open Access Journals (Sweden)

Amanda J Grieco

Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.

Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin

International Nuclear Information System (INIS)

Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.

1989-01-01

The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches

Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

International Nuclear Information System (INIS)

Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

1987-01-01

The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

International Nuclear Information System (INIS)

Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

1991-01-01

The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

Science.gov (United States)

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

Science.gov (United States)

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events

Energy Technology Data Exchange (ETDEWEB)

Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)

1994-05-01

The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

Science.gov (United States)

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

International Nuclear Information System (INIS)

Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

1987-01-01

The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

Science.gov (United States)

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

Molecular Properties of Globin Channels and Pores: Role of Cholesterol in Ligand Binding and Movement

Directory of Open Access Journals (Sweden)

Gene A Morrill

2016-09-01

Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and

Delayed globin synthesis leads to excess heme and the macrocytic anemia of Diamond Blackfan anemia and del(5q) myelodysplastic syndrome.

Science.gov (United States)

Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L

2016-05-11

Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.

Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

Science.gov (United States)

Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

2012-01-01

Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

Science.gov (United States)

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

Science.gov (United States)

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

Science.gov (United States)

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

S-(3-Aminobenzanthron-2-yl)cysteine in the globin of rats as a novel type of adduct and possible biomarker of exposure to 3-nitrobenzanthrone, a potent environmental carcinogen.

Science.gov (United States)

Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka

2017-10-01

3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.

Towards a "Golden Standard" for computing globin stability: Stability and structure sensitivity of myoglobin mutants

DEFF Research Database (Denmark)

Kepp, Kasper Planeta

2015-01-01

Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...

Hb A2 Episkopi - a novel δ-globin chain variant [HBD:c.428C>T] in a family of mixed Cypriot-Lebanese descent.

Science.gov (United States)

Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina

2017-06-01

Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.

Targeted correction of a thalassemia-associated beta-globin mutation induced by pseudo-complementary peptide nucleic acids

DEFF Research Database (Denmark)

Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y

2009-01-01

Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...

Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate

International Nuclear Information System (INIS)

Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.

1980-01-01

A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)

TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION

Directory of Open Access Journals (Sweden)

Amit Kumar

2013-06-01

Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.

The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

Directory of Open Access Journals (Sweden)

Zulema Romero

Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

Science.gov (United States)

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

2014-05-13

Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

NARCIS (Netherlands)

R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

1999-01-01

textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

Generation of a high-titer retroviral vector capable of expressing high levels of the human β-globin gene

NARCIS (Netherlands)

M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan

1995-01-01

textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and

N-alkylvaline levels in globin as a new type of biomarker in risk assessment of alkylating agents.

Science.gov (United States)

Lewalter, J

1996-01-01

Adducts with the N-terminal valine of erythrocyte globin can serve as individual biomarkers of systemic and cellular exposure to endogenous and exogenous alkylating agents. In contrast to "detoxification markers" of this kind of mecapturic acids derived from alkylation of glutathione, individual N-alkylations of valine in globin reflect the formally "toxifying" part of the stress due to alkylating agents transformed into the ultimate toxicant. Thus, in contrast to the traditional methods of biological monitoring this approach enables a better evaluation of systemic exposure to reactive agents, adapted more sensibly to the exposure situation over the whole life span of erythrocytes, and it can serve as a specific biomarker of exposure for the purpose of health surveillance in occupational medicine. An individual evaluation of exposures in comparison with the range of corresponding background levels is discussed from the point of view of supplementary risk assessment in medical surveillance of occupationally exposed persons.

Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

NARCIS (Netherlands)

A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

1996-01-01

textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

NARCIS (Netherlands)

A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

2003-01-01

textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies

OpenAIRE

Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias

2003-01-01

The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...

CTCF-mediated transcriptional regulation through cell type-specific chromosome organization in the β-globin locus

OpenAIRE

Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann

2012-01-01

International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...

Increased expression of alpha- and beta-globin mRNAs at the pituitary following exposure to estrogen during the critical period of neonatal sex differentiation in the rat

DEFF Research Database (Denmark)

Leffers, H; Navarro, V M; Nielsen, John E

2006-01-01

Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...

Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

Science.gov (United States)

Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

2015-04-01

Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

International Nuclear Information System (INIS)

Abass, M.M.E.

2004-01-01

β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

Directory of Open Access Journals (Sweden)

Rita de Cassia Mousinho-Ribeiro

2003-01-01

Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.

OpenAIRE

Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T

1983-01-01

We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells

Czech Academy of Sciences Publication Activity Database

Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav

2004-01-01

Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

Science.gov (United States)

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

Science.gov (United States)

Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

2014-06-01

Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

Science.gov (United States)

Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

2018-03-01

There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea

Directory of Open Access Journals (Sweden)

Abbas Najjari

2014-05-01

Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.

Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

International Nuclear Information System (INIS)

Studencki, A.B.; Wallace, R.B.

1984-01-01

The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

Directory of Open Access Journals (Sweden)

Mohammed Alanazi

Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

International Nuclear Information System (INIS)

Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-08-01

The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

Science.gov (United States)

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Evaluation of photo destruction of chromophores of heme and globin components in UV-irradiated human carboxyhemoglobin and its electrophoretic fractions

International Nuclear Information System (INIS)

Putintseva, O.V.; Artykhov, V.G.; Kalaeva, E.A.

2000-01-01

The contribution of hem and globin components of electrophoretic fractions of UV-irradiated human carboxyhemoglobin to photo destruction of the protein was studied. The changes observed are the result of summation of some processes unequal in intensity and direction that take place in microgeterogenous media of photo modified protein. Photo sensitivity of hemoproteid in electrophoretic fraction depends on apoprotein condition, whereas the hem photo resistance cannot be the evidence of the photo stability of the whole molecule [ru

Multivariate analysis of matrix-assisted laser desorption/ionization mass spectrometric data related to glycoxidation products of human globins in nephropathic patients.

Science.gov (United States)

Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro

2007-06-01

To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.

Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

OpenAIRE

Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M

1988-01-01

We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...

EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

Directory of Open Access Journals (Sweden)

Anita Nadkarni

2013-02-01

Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

Science.gov (United States)

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Contribution of long-range interactions to the secondary structure of an unfolded globin.

Science.gov (United States)

Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia

2010-09-08

This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

International Nuclear Information System (INIS)

Somaya, E.T.; Soliman, M.D

2010-01-01

The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

Hb H disease resulting from the association of an αº-thalassemia allele [-(α20.5] with an unstable α-globin variant [Hb Icaria]: first report on the occurrence in Brazil

Directory of Open Access Journals (Sweden)

Elza M. Kimura

2009-01-01

Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.

Effect of gamma irradiation on the α and β chains of bovine hemoglobin and globin

International Nuclear Information System (INIS)

Duda, W.

1981-01-01

Hemoglobin was obtained from the blood of lowland black and white cattle with HbA phenotype. Water solutions of hemoglobin (Hb) or globin (Gl) in 20 mM KH 2 PO 4 were γ-irradiated with a dose of 2 Mrad, and the amino acid composition of α and β chains of control and irradiated Hb and Gl was analyzed. Quantitative differences were found between the radiation sensitivities of α and β chains of Hb and Gl. A sequence of radiation sensitivity of individual amino acids in α and β chains of Hb and Gl was determined. In the β chains, amino acid destruction was considerably higher than in α chains. These changes were confirmed by amino acid analysis which showed that Cys, Met, Tyr, Arg, Ser, Thr, Pro, and His residues were most destroyed or modified following irradiation

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

Science.gov (United States)

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

Science.gov (United States)

Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

1999-06-01

Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

zeta-, epsilon-, and gamma-Globin mRNA in blood samples and CD71(+) cell fractions from fetuses and from pregnant and nonpregnant women, with special attention to identification of fetal erythroblasts

DEFF Research Database (Denmark)

Høgh, A M; Hviid, T V; Christensen, B

2001-01-01

BACKGROUND: Information about the appearance of gamma-, epsilon-, and zeta-globin mRNAs in fetal erythroblasts during gestation and about the presence and amounts of these mRNAs in pregnant and nonpregnant women is important from the perspective of using these molecules as a marker of fetal eryth...

Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

Science.gov (United States)

Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

2015-03-01

Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

OpenAIRE

Babiss, L E; Friedman, J M; Darnell, J E

1986-01-01

In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

Science.gov (United States)

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

Energy Technology Data Exchange (ETDEWEB)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

1987-10-16

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia.

Science.gov (United States)

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-12-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

Science.gov (United States)

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

Role of novel and rare nucleotide substitutions of the β-globin gene

Directory of Open Access Journals (Sweden)

Margherita Vinciguerra

2012-11-01

Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序，旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段：1）血液及血红蛋白数据；2）珠蛋白基因分子分析以及家族遗传研究（如有可能）。 自2003年以来，我们已对这类病例进行DNA序列分析：传统的分子方法无法给出完整的诊断响应，尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。 �

Coexpression of Human α- and Circularly Permuted β-Globins Yields a Hemoglobin with Normal R State but Modified T State Properties†

Science.gov (United States)

Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.

2009-01-01

For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368

Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

International Nuclear Information System (INIS)

Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

1988-01-01

Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

Characterization of adult α- and β-globin elevated by hydrogen peroxide in cervical cancer cells that play a cytoprotective role against oxidative insults.

Directory of Open Access Journals (Sweden)

Xiaolei Li

Full Text Available OBJECTIVES: Hemoglobin (Hgb is the main oxygen and carbon dioxide carrier in cells of erythroid lineage and is responsible for oxygen delivery to the respiring tissues of the body. However, Hgb is also expressed in nonerythroid cells. In the present study, the expression of Hgb in human uterine cervix carcinoma cells and its role in cervical cancer were investigated. METHODOLOGY: The expression level of Hgb in cervical cancer tissues was assessed by quantitative reverse transcriptase-PCR (qRT-PCR. We applied multiple methods, such as RT-PCR, immunoblotting, and immunohistochemical analysis, to confirm Hgb expression in cervical cancer cells. The effects of ectopic expression of Hgb and Hgb mutants on oxidative stress and cell viability were investigated by cellular reactive oxygen species (ROS analysis and lactate dehydrogenase (LDH array, respectively. Both Annexin V staining assay by flow cytometry and caspase-3 activity assay were used, respectively, to evaluate cell apoptosis. RESULTS: qRT-PCR analysis showed that Hgb-α- (HBA1 and Hgb-β-globin (HBB gene expression was significantly higher in cervical carcinoma than in normal cervical tissues, whereas the expression of hematopoietic transcription factors and erythrocyte specific marker genes was not increased. Immunostaining experiments confirmed the expression of Hgb in cancer cells of the uterine cervix. Hgb mRNA and protein were also detected in the human cervical carcinoma cell lines SiHa and CaSki, and Hgb expression was up-regulated by hydrogen peroxide-induced oxidative stress. Importantly, ectopic expression of wild type HBA1/HBB or HBA1, rather than mutants HBA1(H88R/HBB(H93R unable to bind hemo, suppressed oxidative stress and improved cell viability. CONCLUSIONS: The present findings show for the first time that Hgb is expressed in cervical carcinoma cells and may act as an antioxidant, attenuating oxidative stress-induced damage in cervical cancer cells. These data provide a

alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

Directory of Open Access Journals (Sweden)

M.R.S.C. Wenning

2000-09-01

Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

Directory of Open Access Journals (Sweden)

Carla Maria Meireles

1999-09-01

Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

International Nuclear Information System (INIS)

EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

2008-01-01

The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

Directory of Open Access Journals (Sweden)

Ikuta T

2013-12-01

Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

Expression of fully functional tetrameric human hemoglobin in Escherichia coli

International Nuclear Information System (INIS)

Hoffman, S.J.; Looker, D.L.; Roehrich, J.M.; Cozart, P.E.; Durfee, S.L.; Tedesco, J.L.; Stetler, G.L.

1990-01-01

Synthesis genes encoding the human α- and β-globin polypeptides have been expressed from a single operon in Escherichia coli. The α- and β-globin polypeptides associate into soluble tetramers, incorporate heme, and accumulate to >5% of the total cellular protein. Purified recombinant hemoglobin has the correct stoichiometry of α- and β-globin chains and contains a full complement of heme. Each globin chain also contains an additional methionine as an extension to the amino terminus. The recombinant hemoglobin has a C 4 reversed-phase HPLC profile essentially identical to that of human hemoglobin A 0 and comigrates with hemoglobin A 0 on SDS/PAGE. The visible spectrum and oxygen affinity are similar to that of native human hemoglobin A 0 . The authors have also expressed the α- and β-globin genes separately and found that the expression of the α-globin gene alone results in a marked decrease in the accumulation of α-globin in the cell. Separate expression of the β-globin gene results in high levels of insoluble β-globin. These observations suggest that the presence of α- and β-globin in the same cell stabilizes α-globin and aids the correct folding of β-globin. This system provides a simple method for expressing large quantities of recombinant hemoglobin and allows facile manipulation of the genes encoding hemoglobin to produce functionally altered forms of this protein

Towards a "Golden Standard" for computing globin stability: Stability and structure sensitivity of myoglobin mutants.

Science.gov (United States)

Kepp, Kasper P

2015-10-01

Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports benchmarking of six protein stability calculators (POPMUSIC 2.1, I-Mutant 2.0, I-Mutant 3.0, CUPSAT, SDM, and mCSM) against 134 experimental stability changes for mutations of sperm-whale myoglobin. Six different high-resolution structures were used to test structure sensitivity that may impair protein calculations. The trend accuracy of the methods decreased as I-Mutant 2.0 (R=0.64-0.65), SDM (R=0.57-0.60), POPMUSIC2.1 (R=0.54-0.57), I-Mutant 3.0 (R=0.53-0.55), mCSM (R=0.35-0.47), and CUPSAT (R=0.25-0.48). The mean signed errors increased as SDMMean absolute errors increased as I-Mutant 2.0

β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

Directory of Open Access Journals (Sweden)

Wellington dos Santos Silva

2010-01-01

Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

OpenAIRE

Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

1987-01-01

An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

Hematological Characterizations and Molecular Diagnostic Aspects of Hb Wiangpapao [α44(CE2)Pro→Ser (α1), CCG>TCG; HBA1: c.133C>T], a New α-Globin Variant Found in a Pregnant Thai Woman.

Science.gov (United States)

Panyasai, Sitthichai; Pornprasert, Sakorn

2017-03-01

We report the hematological parameters and provide a rapid molecular analysis method for detection of Hb Wiangpapao [α44(CE2)Pro→Ser, CCG>TCG; HBA1: c.133C>T], a new α-globin variant found in a pregnant Thai woman. Her red cell indices were measured by an automated blood counter. The results were: red blood cell (RBC) count 4.03 × 10 12 /L, Hb 13.1 (g/dL), packed cell volume (PCV) 0.39 L/L, mean corpuscular volume (MCV) 97.0 fL, mean corpuscular hemoglobin (Hb) (MCH) 32.5 pg, mean corpuscular Hb concentration (MCHC) 33.4 g/dL, and RBC distribution width (RDW) 9.4%. The Hb typing by high performance liquid chromatography (HPLC) showed 13.6% abnormal Hb at a retention time of 2.20 min. that was difficult to distinguish from Hb A. On the capillary electrophoresis (CE) electropherogram, this hemoglobinopathy peak did not separate from the Hb A peak. DNA sequencing showed a C>T transition at the first position of codon 44 (CCG>TCG) of the α1-globin gene that led to a substitution of proline for serine. This mutation has not been recorded in the public databases. Therefore, we named it Hb Wiangpapao as it was first discovered in the Wiangpapao District, Chiang Rai, Thailand. The multiplex allele-specific polymerase chain reaction (ASPCR) for detection of Hb Wiangpapao was developed and revealed a 510 bp specifically amplified fragment. The better understanding of hematological characterizations and the newly developed multiplex ASPCR for diagnosis of Hb Wiangpapao are useful for genetic counseling and family education.

Detection in a Japanese population of a length polymorphism in the 5' flanking region of the human β-globin gene with denaturing gradient gel electrophoresis

International Nuclear Information System (INIS)

Takahashi, Noria; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko

1992-10-01

An analysis of the ATTTT repeat polymorphism located approximately 1,400 base pairs upstream from the β-globin structural gene was carried out by denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes. Genomic or cloned DNAs were digested with restriction enzymes and hybridized with 32 P-labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. A difference in the number of repeat units was recognized by differences in duplex mobility on the DGGE gel. In this study of 81 unrelated Japanese from Hiroshima, a sequence heteromorphism was observed at this site. Alleles with 5 and 6 repeats of the ATTTT unit, which had already been reported, were found in polymorphic proportions. In addition, two unreported alleles, one having 7 repeats and the other having an A-to-G nucleotide substitution in the 5th repeat, were detected. Family study data showed that the segregation of these four types of variants is consistent with an autosomal codominant mode of inheritance. This study also demonstrated that DGGE of RNA:DNA duplexes is a sensitive tool for detecting variations in DNA. (author)

ORF Alignment: NC_004722 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available konkukian str. 97-27] ... gb|AAS40246.1| protozoan/cyanobacterial globin family ... protein [B...tozoan/cyanobacterial globin family protein [Bacillus ... ....1| ... globin family protein [Bacillus thuringiensis serovar ... konkukian str. 97-27] ref|NP_977638.1| ... pro

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Directory of Open Access Journals (Sweden)

Jackie A Pallister

Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Science.gov (United States)

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

A five' splice-region G → C mutation in exon 1 of the human β-globin gene inhibits pre-mRNA splicing: A mechanism for β+-thalassemia

International Nuclear Information System (INIS)

Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.

1989-01-01

The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5

A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

NARCIS (Netherlands)

Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

2010-01-01

Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

STORAGESEVER

2010-01-04

Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.

A practical platform for blood biomarker study by using global gene expression profiling of peripheral whole blood.

Directory of Open Access Journals (Sweden)

Ze Tian

Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.

Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

NARCIS (Netherlands)

Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank

2013-01-01

β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin

Detection of trans-acting factors for hemoglobin switching by cell fusions

International Nuclear Information System (INIS)

Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.

1986-01-01

The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

Science.gov (United States)

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

The onset of hemoglobin synthesis in spleens of irradiated mice after bone marrow transplantation

International Nuclear Information System (INIS)

Ponka, P.; Fuchs, O.; Borova, J.; Necas, E.

1977-01-01

Messenger RNA (mRNA) for globin was isolated from spleens of irradiated mice in which erythroid differentiation was induced by a bone marrow graft. The globin mRNA was isolated either by means of sucrose gradients of reticulocyte polysomal RNA or by affinity chromatography of total spleen RNA on poly (U)-sepharose. The globin mRNA was tested in a wheat embryo cell-free system. The appearance of mRNA in the spleen erythroid colonies was correlated with other parameters of erythroid differentiation such as globin synthesis, activity of delta-aminolevulinic acid synthetase and iron uptake. Poly(A) containing mRNA did appear already on the 3rd day after grafting. However, significant translational activity of globin mRNA could be demonstrated only one day later together with increase in globin synthesis and delta-aminolevulinic acid synthetase and enhanced iron uptake. In the second part of this study mouse spleen cells rich in erythroid elements were incubated with a specific heme synthesis inhibitor (isonicotinic acid hydrazide, INH) and the synthesis of 9 S RNA was estimated. It was found that a 40-minute incubation with INH reduced uridine incorporation into 9 S RNA fraction by about 40%. (author)

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

Science.gov (United States)

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Comparative genomics of neuroglobin reveals its early origins.

Directory of Open Access Journals (Sweden)

Jasmin Dröge

Full Text Available Neuroglobin (Ngb is a hexacoordinated globin expressed mainly in the central and peripheral nervous system of vertebrates. Although several hypotheses have been put forward regarding the role of neuroglobin, its definite function remains uncertain. Ngb appears to have a neuro-protective role enhancing cell viability under hypoxia and other types of oxidative stress. Ngb is phylogenetically ancient and has a substitution rate nearly four times lower than that of other vertebrate globins, e.g. hemoglobin. Despite its high sequence conservation among vertebrates Ngb seems to be elusive in invertebrates.We determined candidate orthologs in invertebrates and identified a globin of the placozoan Trichoplax adhaerens that is most likely orthologous to vertebrate Ngb and confirmed the orthologous relationship of the polymeric globin of the sea urchin Strongylocentrotus purpuratus to Ngb. The putative orthologous globin genes are located next to genes orthologous to vertebrate POMT2 similarly to localization of vertebrate Ngb. The shared syntenic position of the globins from Trichoplax, the sea urchin and of vertebrate Ngb strongly suggests that they are orthologous. A search for conserved transcription factor binding sites (TFBSs in the promoter regions of the Ngb genes of different vertebrates via phylogenetic footprinting revealed several TFBSs, which may contribute to the specific expression of Ngb, whereas a comparative analysis with myoglobin revealed several common TFBSs, suggestive of regulatory mechanisms common to globin genes.Identification of the placozoan and echinoderm genes orthologous to vertebrate neuroglobin strongly supports the hypothesis of the early evolutionary origin of this globin, as it shows that neuroglobin was already present in the placozoan-bilaterian last common ancestor. Computational determination of the transcription factor binding sites repertoire provides on the one hand a set of transcriptional factors that are

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

Science.gov (United States)

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

OpenAIRE

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

Stabilization of apoglobin by low temperature increases yield of soluble recombinant hemoglobin in Escherichia coli.

Science.gov (United States)

Weickert, M J; Pagratis, M; Curry, S R; Blackmore, R

1997-01-01

Accumulation of soluble recombinant hemoglobin (rHb1.1) in Escherichia coli requires proper protein folding, prosthetic group (heme) addition, and subunit assembly. This served as a new model system for the study of the effects of temperature, protein synthesis rates, and protein accumulation rates on protein solubility in E. coli. Fermentation expression of rHb1.1 at 30 degrees C from cultures containing a medium or high globin gene dosage (pBR-based or pUC-based plasmids with rHb1.1 genes under the control of the tac promoter) was compared. A medium gene dosage resulted in rHb1.1 accumulating to approximately 7% of the soluble cell protein, of which 78% was soluble. A high globin gene dosage resulted in a > or = 3-fold increase in total globin to 23 to 24% of the soluble cell protein, but 70% was insoluble. Accumulation of insoluble rHb1.1 began immediately upon induction. The proportion of rHb1.1 from the high globin gene dosage that accumulated as insoluble globin was affected by reducing (i) the inducer concentration and (ii) the temperature. Reducing the inducer concentration reduced globin synthesis up to eightfold but increased the proportion of soluble rHb1.1 to 93%. In contrast, total globin protein synthesis was barely affected by reducing the temperature from 30 to 26 degrees C, while soluble globin accumulation increased > 2-fold to approximately 15% of the soluble cell protein. The contrast between the effects of reducing rates of protein synthesis and accumulation and those of reducing temperature suggests that lower temperature stabilizes one or more folding intermediates. We propose a simplified physical model which integrates protein synthesis, folding, and heme association. This model shows that temperature-dependent apoglobin stability is the most critical factor in soluble rHb1.1 accumulation. PMID:9361418

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

Science.gov (United States)

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

ORF Alignment: NC_005945 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_005945 gi|49184136 >1dlwA 1 115 7 124 8e-22 ... ref|YP_017820.1| protozoan/cyanoba...cterial globin family protein [Bacillus anthracis ... str. 'Ames Ancestor'] ref|NP_843684.1| ... protozoa...n/cyanobacterial globin family protein [Bacillus ... anthracis str. Ames] ref|YP_027388.1| ... protozoa...racis str. ... A2012] gb|AAP25170.1| protozoan/cyanobacterial globin ... family protein [Bacil...lus anthracis str. Ames] ... gb|AAT30295.1| protozoan/cyanobacterial globi

ORF Alignment: NC_007530 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_007530 gi|47526471 >1dlwA 1 115 7 124 8e-22 ... ref|YP_017820.1| protozoan/cyanoba...cterial globin family protein [Bacillus anthracis ... str. 'Ames Ancestor'] ref|NP_843684.1| ... protozoa...n/cyanobacterial globin family protein [Bacillus ... anthracis str. Ames] ref|YP_027388.1| ... protozoa...racis str. ... A2012] gb|AAP25170.1| protozoan/cyanobacterial globin ... family protein [Bacil...lus anthracis str. Ames] ... gb|AAT30295.1| protozoan/cyanobacterial globi

ORF Alignment: NC_003997 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_003997 gi|30261307 >1dlwA 1 115 7 124 8e-22 ... ref|YP_017820.1| protozoan/cyanoba...cterial globin family protein [Bacillus anthracis ... str. 'Ames Ancestor'] ref|NP_843684.1| ... protozoa...n/cyanobacterial globin family protein [Bacillus ... anthracis str. Ames] ref|YP_027388.1| ... protozoa...racis str. ... A2012] gb|AAP25170.1| protozoan/cyanobacterial globin ... family protein [Bacil...lus anthracis str. Ames] ... gb|AAT30295.1| protozoan/cyanobacterial globi

ORF Alignment: NC_003995 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_003995 gi|21399119 >1dlwA 1 115 7 124 8e-22 ... ref|YP_017820.1| protozoan/cyanoba...cterial globin family protein [Bacillus anthracis ... str. 'Ames Ancestor'] ref|NP_843684.1| ... protozoa...n/cyanobacterial globin family protein [Bacillus ... anthracis str. Ames] ref|YP_027388.1| ... protozoa...racis str. ... A2012] gb|AAP25170.1| protozoan/cyanobacterial globin ... family protein [Bacil...lus anthracis str. Ames] ... gb|AAT30295.1| protozoan/cyanobacterial globi

The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

Science.gov (United States)

Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

1996-09-01

To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

Directory of Open Access Journals (Sweden)

Ali Dehghanifard

2012-07-01

Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

Science.gov (United States)

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

Phylogeny of Echinoderm Hemoglobins.

Directory of Open Access Journals (Sweden)

Ana B Christensen

Full Text Available Recent genomic information has revealed that neuroglobin and cytoglobin are the two principal lineages of vertebrate hemoglobins, with the latter encompassing the familiar myoglobin and α-globin/β-globin tetramer hemoglobin, and several minor groups. In contrast, very little is known about hemoglobins in echinoderms, a phylum of exclusively marine organisms closely related to vertebrates, beyond the presence of coelomic hemoglobins in sea cucumbers and brittle stars. We identified about 50 hemoglobins in sea urchin, starfish and sea cucumber genomes and transcriptomes, and used Bayesian inference to carry out a molecular phylogenetic analysis of their relationship to vertebrate sequences, specifically, to assess the hypothesis that the neuroglobin and cytoglobin lineages are also present in echinoderms.The genome of the sea urchin Strongylocentrotus purpuratus encodes several hemoglobins, including a unique chimeric 14-domain globin, 2 androglobin isoforms and a unique single androglobin domain protein. Other strongylocentrotid genomes appear to have similar repertoires of globin genes. We carried out molecular phylogenetic analyses of 52 hemoglobins identified in sea urchin, brittle star and sea cucumber genomes and transcriptomes, using different multiple sequence alignment methods coupled with Bayesian and maximum likelihood approaches. The results demonstrate that there are two major globin lineages in echinoderms, which are related to the vertebrate neuroglobin and cytoglobin lineages. Furthermore, the brittle star and sea cucumber coelomic hemoglobins appear to have evolved independently from the cytoglobin lineage, similar to the evolution of erythroid oxygen binding globins in cyclostomes and vertebrates.The presence of echinoderm globins related to the vertebrate neuroglobin and cytoglobin lineages suggests that the split between neuroglobins and cytoglobins occurred in the deuterostome ancestor shared by echinoderms and vertebrates.

Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

Directory of Open Access Journals (Sweden)

Biaoru Li

Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

[Positive Distribution Rate of Coombs Test in Patients with Clinical Anemia and Blood Transfusion and Its Effect on Clinical Blood Transfusion].

Science.gov (United States)

Wu, Gang; Duan, Yu-Han

2018-02-01

To study the positive distribution rate of Coombs test in patients with clinical anemia and blood transfusion, and its effect on clinical blood transfusion. Seventy patients with hemoglobin level in the normal range were enrolled into control group, while 130 patients with anemia or blood transfusion who' s hemoglobin level was lower comfirmed by micro-column gel antihuman globin detection card and 70 surgical patients with anemia or blood transfusion who' s hemoglobin level was lower comfirmed by micro-column gel anti-human globin card were enrolled into anemia or blood transfusion (A or BT) group. And coomb' s test performed for all the patients, in which the positive patients in Department of Internal Medicine need to be re-typed. Among 70 surgical patients with anemia or blood transfusion, 14 cases were directly detected to be anti-human globine positive with detection rate 20%; among 130 internal medicine patients with anemia or blood transfusion, 54 cases were directly detected to be anti-human globine positive with detection rate 41.4%. Among 270 cases, the highest positive rate (66.7%) was observed in patients with 50-59 g/L of hemoglobin. According to type test, the samples of 54 patients with anemia in Department of Internal Medicine, who were directly selected to be anti-human globin positive, could be divided into anti-C3d(7 cases, accounting for 13.0%), anti-IgG(12 cases accounting for, 22.2%) and anti-C3d+anti-IgG(35 cases, accounting for 64.8%), while according to diseases, the anti-human globin positive ratio was high in tumor cancer, hephropathy and gastroenteropathy patients, and patients in intensive care unit, moreover the blood transfusion frequency of these patients was higher than that of patients with anti-human globin negative(Pblood transfusion, so as to ensure the effectiveness of blood transfusion.

Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks

Directory of Open Access Journals (Sweden)

Marcelo M. Santoro

2010-10-01

Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.

Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

Science.gov (United States)

Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

2017-10-01

The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Science.gov (United States)

Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

1999-09-01

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

Bovine Blood Constituents as Fat Replacers in Ham Pâté

Directory of Open Access Journals (Sweden)

Fabiana Ribeiro Viana

2004-01-01

Full Text Available Some tests were carried out in this work with the aim of evaluating a partial replacement of fat in the raw batter of ham pâté by using bovine blood constituents, such as globin (GL, plasma (PL or 1:1 globin and plasma (GP. Plasma was separated from red cells by blood centrifugation, and globin was extracted by the carboxymethylcellulose method. The salt-soluble protein content (SSP and the binding properties including water holding capacity (WHC and raw batter stability (RBS were estimated. The results indicated that among the 3 treatments studied, the use of globin showed to be a little more advantageous for the quality of the raw batter of ham pâté, since its incorporation as fat replacer led to an increase in RBS but no change of SSP was observed.

Caracterização química e funcional do caseinato de sódio e da globina bovina Chemical and functional characterization of sodium caseinate and bovine globin

Directory of Open Access Journals (Sweden)

Janaína Guernica SILVA

2000-08-01

Full Text Available Visando à aplicação industrial de proteínas do sangue bovino, foram testadas duas metodologias de extração da globina. Determinou-se, também, a composição química dessa proteína e o efeito da adição de NaCl sobre algumas propriedades fun-cionais, sendo os resultados obtidos comparados com os do caseinato de sódio comercial. O método de extração pela acetona acidificada apresentou maiores rendimentos e recuperação protéica do que o da carboximetilcelulose, entretanto, devido à presença de resíduos de solventes orgânicos na proteína obtida, seu uso não é recomendável em alimentos. Observaram-se, ainda, diferenças entre as composições químicas da globina bovina em função do procedimento de extração utilizado. Na avaliação das propriedades funcionais das proteínas, a adição de sal exerceu efeitos variados, tendo sido verificada uma redução da solubilidade da globina bovina, da capacidade emulsionante (EC e do índice de atividade emulsionante (EAI, sendo essa mais acentuada na concentração salina próxima à dos produtos cárneos (0,25mol/L. Para o caseinato de sódio, esse nível de sal prejudicou todas as propriedades funcionais estudadas, exceto a estabilidade da emulsão (ES. Por outro lado, o emprego de uma concentração de NaCl 10 vezes menor contribuiu para melhorar o EAI e a ES.With the aim of finding an industrial utilization for proteins from bovine blood, two methodologies for globin extraction were tested. Also, the chemical composition of this protein and the effect of the addition of NaCl on some functional properties were evaluated. The results were compared to those obtained for commercial sodium caseinate. The extraction method using acidified acetone showed a better yield and protein recuperation when compared to the carboxymethyl cellulose method. However, the former is not recommended for food use, due to the presence of organic solvent residues in the protein. Moreover, the

Development of methods to measure hemoglobin adducts by gel electrophoresis - Preliminary results

International Nuclear Information System (INIS)

Sun, J.D.; McBride, S.M.

1988-01-01

Chemical adducts formed on blood hemoglobin may be a useful biomarker for assessing human exposures to these compounds. This paper reports preliminary results in the development of methods to measure such adducts that may be generally applicable for a wide variety of chemicals. Male F344/N rats were intraperitoneally injected with 14 C-BaP dissolved in corn oil. Twenty-four hours later, the rats were sacrificed. Blood samples were collected and globin was isolated. Globin protein was then cleaved into peptide fragments using cyanogen bromide and the fragments separated using 2-dimensional gel electrophoresis. The results showed that the adducted 14 C-globin fragments migrated to different areas of the gel than did unadducted fragments. Further research is being conducted to develop methods that will allow quantitation of separated adducted globin fragments from human blood samples without the use of a radiolabel. (author)

Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease.

Science.gov (United States)

Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

2016-01-01

Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.

LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

NARCIS (Netherlands)

M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

1992-01-01

textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin

Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies.

NARCIS (Netherlands)

G.P. Patrinos (George); B. Giardine (Belinda); C. Riemer (Cathy); W. Miller (Webb); D.H. Chui (David); N.P. Anagnou (Nicholas); H. Wajcman (Henri); R.C. Hardison (Ross)

2004-01-01

textabstractHbVar (http://globin.cse.psu.edu/globin/hbvar/) is a relational database developed by a multi-center academic effort to provide up-to-date and high quality information on the genomic sequence changes leading to hemoglobin variants and all types of thalassemia and

Biochemical and molecular investigations on qualitative and quantitative Hb polymorphism in the river buffalo (Bubalus bubalis L. population reared in Southern Italy

Directory of Open Access Journals (Sweden)

Mario Iorio

2004-01-01

Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.

Synthetic review on the different anthropological aspects of ...

African Journals Online (AJOL)

Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

Science.gov (United States)

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

Science.gov (United States)

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

Science.gov (United States)

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Hb TAYBE: clinical and morphological findings IN 43 patients.

Science.gov (United States)

Koren, Ariel; Levin, Carina; Zalman, Luci; Palmor, Haya; Filon, Dvora; Chubar, Evgeny; Resnitzky, Peretz; Bennett, Michael

2016-08-01

Hereditary sequence variants in globin genes are usually silent and are rarer in α-globin chains than β-globin chains. Some may lead to an unstable protein with a hemolytic or thalassemic phenotype. Hb Taybe is an unstable α-chain hemoglobin variant caused by the deletion of a threonine residue at codon 38 or 39 of the α1 globin gene. This deletion results in a structural abnormality that affects the α1 β2 contact and the α1 β1 interface, producing a highly unstable Hb. We describe the clinical, laboratory, and morphological characteristics of 43 patients with Hb Taybe, sixteen of whom are heterozygous, eight are homozygous, and nineteen are double heterozygous for Hb Taybe and other α-gene mutations or deletions. The clinical presentation is very variable from a mild hemolytic anemia to the need for red cell transfusion. Morphological characteristics include erythroid hyperplasia, defective hemoglobin production, and dyserythropoietic features. On electron microscopy dyserythropoiesis and cytoplasmic precipitation of globin compatible optical dense material is seen. This is the largest report of Hb Taybe patients. Previous reported cohorts are not related to these cases. We conclude that patients carrying Hb Taybe have a unique hematological and clinical phenotype distinct from other hemoglobinopathies and from congenital dyserythropoietic anemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

NARCIS (Netherlands)

F. Pourfarzad, F. (Farzin); M.M. von Lindern (Marieke); A. Azarkeivan (Azita); J. Hou (Jun); S.K. Kia; F. Esteghamat (Fatemehsadat); W.F.J. van IJcken (Wilfred); J.N.J. Philipsen (Sjaak); H. Najmabadi (Hossein); F.G. Grosveld (Frank)

2013-01-01

textabstractβ-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult

Avaliação da estabilidade e da qualidade do patê de presunto, adicionado de globina bovina e de caseinato de sódio, como agente emulsionante Stability and quality of ham paté added of bovine globin and sodium caseinate as emulsifiers

Directory of Open Access Journals (Sweden)

Janaína Guernica Silva

2003-04-01

Full Text Available Este trabalho foi conduzido para avaliar o efeito da incorporação das globinas bovina extraída pelo método da acetona acidificada (GT e pelo da carboximetilcelulose (GCMC e do caseinato de sódio (CA sobre a composição química e as qualidades microbiológica e sensorial do patê de presunto. Foi, ainda, avaliada a estabilidade do produto durante os 45 dias de estocagem sob refrigeração, por meio das determinações de pH e do grau de oxidação lipídica. De acordo com os resultados obtidos, pôde-se verificar que a adição dessas proteínas elevou o teor protéico das amostras analisadas. Além disso, observou-se que apenas a GT provocou uma queda do pH e uma elevação de substâncias reativas ao ácido 2-tiobarbitúrico (thiobarbiuric acid reactive substances - TBARS. Com relação à qualidade microbiológica dos produtos, não foram observadas alterações após a incorporação das proteínas e, pela análise sensorial, foram identificadas diferenças significativas entre as duas formulações de patê avaliadas (PCA e PGCMC.This study evaluated the effect of the use of bovine globin extracted by acidified acetone method (GT, bovine globin extracted by carboxymethyl cellulose method (GCMC and sodium caseinate (CA on the chemical composition and on microbiological and sensorial qualities of the ham paté. Also, the stability of this meat product was studied during the storage for 45 days under refrigeration, on the pH and on the lipid oxidation measurements. An increase of the protein contents was observed in all samples. Moreover, only the incorporation of GT produced a significant decrease of pH and an increasing of thiobarbiuric acid reactive substances (TBARS values during storage. No microbial effects were observed while some significant differences were observed between PCA and PGCMC added patés.

Hemoglobin genetics: recent contributions of GWAS and gene editing

Science.gov (United States)

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

Science.gov (United States)

Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

2017-12-22

The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A Family with γ-Thalassemia and High Hb A2 Levels.

Science.gov (United States)

Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna

2016-06-01

We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.

The 3D chromatin structure of the mouse β-haemoglobin gene cluster

NARCIS (Netherlands)

M.P.C. van de Corput (Mariëtte); T.A. Knoch (Tobias); E. de Boer (Ernie); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)

2010-01-01

textabstractHere we show a 3D DNA-FISH method to visualizes the 3D structure of the β-globin locus. Geometric size and shape measurements of the 3D rendered signals (128Kb) show that the volume of the β-globin locus decreases almost two fold upon gene activation. A decrease in length and a

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

Science.gov (United States)

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

Directory of Open Access Journals (Sweden)

Türker Bilgen

2011-09-01

Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)

DEFF Research Database (Denmark)

Juul, Maja Bech; Vestergaard, Hanne; Petersen, Jesper

2012-01-01

Hb Taybe is a highly unstable hemoglobin (Hb) variant caused by a 3 bp deletion at codons 38/39 (-ACC) on the α1-globin gene. We report for the first time, a patient with a compound heterozygosity for Hb Taybe and a 5 bp deletion at the splice donor site of IVS-I on the α2-globin gene and ischemic...

Thalassemia and related hemoglobinopathies.

Science.gov (United States)

Sarnaik, Sharada A

2005-04-01

Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

A Novel β-Globin Chain Hemoglobin Variant, Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp], Associated with Low Oxygen Saturation, Intermittent Aplastic Crises and Splenomegaly.

Science.gov (United States)

Collier, Anderson B; Coon, Lea M; Monteleone, Philip; Umaru, Samuel; Swanson, Kenneth C; Hoyer, James D; Oliveira, Jennifer L

2016-01-01

Hemoglobin (Hb) variants may be associated with low oxygen saturation and exacerbated episodes of anemia from common stressors such as viral infections. These attributes frequently cause increased clinical concern and unnecessary and expensive testing if not considered early in the evaluation of the patient. Some clinically significant Hb variants result in a normal Hb electrophoresis result, which can be method-dependent. Herein we describe a patient with low oxygen saturation and a history of hemolytic anemia who was subsequently found to carry a novel, unstable β-globin variant that we have named Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp] for the place of identification of the variant. Hb Allentown is formed by a rare double nucleotide substitution within the same codon. Additionally, positive identification of rare Hb variants characterized by a single method is discouraged, as the Hb variant was misclassified as Hb S-South End or β6(A3)Glu→Val;β132(H10)Lys→Asn (HBB: c.[20A > T;399A > C]) by the initial laboratory.

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

Science.gov (United States)

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4

Directory of Open Access Journals (Sweden)

Zhijing Liu

2015-01-01

Full Text Available Shortage of red blood cells (RBCs, erythrocytes can have potentially life-threatening consequences for rare or unusual blood type patients with massive blood loss resulting from various conditions. Erythrocytes have been derived from human pluripotent stem cells (PSCs, but the risk of potential tumorigenicity cannot be ignored, and a majority of these cells produced from PSCs express embryonic ε- and fetal γ-globins with little or no adult β-globin and remain nucleated. Here we report a method to generate erythrocytes from human hair follicle mesenchymal stem cells (hHFMSCs by enforcing OCT4 gene expression and cytokine stimulation. Cells generated from hHFMSCs expressed mainly the adult β-globin chain with minimum level of the fetal γ-globin chain. Furthermore, these cells also underwent multiple maturation events and formed enucleated erythrocytes with a biconcave disc shape. Gene expression analyses showed that OCT4 regulated the expression of genes associated with both pluripotency and erythroid development during hHFMSC transdifferentiation toward erythroid cells. These findings show that mature erythrocytes can be generated from adult somatic cells, which may serve as an alternative source of RBCs for potential autologous transfusion.

Hb Presbyterian (HBB: c.327C>G) in a Nicaraguan Family.

Science.gov (United States)

Pernudy-Ubau, Allan; Salinas-Molina, Jaslyn; Requenez, Yaneris; Ortiz-Lopez, Marianela; Puller, Ann-Christin; García-Rosales, Kenia; Rodríguez-Estrada, Anaishelle; Rodríguez-Romero, Walter; Mejía-Baltodano, Gerardo; Luo, Hong-Yuan; Chui, David H K

2017-01-01

Hemoglobin (Hb) is the protein responsible for oxygen transportation. It is a tetrameric protein comprising two α- and two β-globin subunits. In the literature, a large number of mutations in the α- and β-globin genes have been documented. Among these mutations, Hb Presbyterian (HBB: c.327 C>G), is a naturally occurring mutant exerting low oxygen affinity. The C to G exchange (AAC>AAG) at codon 108 of the β-globin gene results in the substitution of asparagine by lysine. Here, we document the identification of HBB: c.327 C>G in a 6-year-old female patient and her father from Nicaragua and Cuba, respectively. The presence of the abnormal Hb was confirmed by cellulose acetate electrophoresis, high performance liquid chromatography (HPLC) and genomic DNA sequencing. The β-globin gene sequences for both, father and daughter, disclosed the heterozygous mutation at codon 108 to be Hb Presbyterian or HBB: c.327 C>G. The mutant Hb was previously reported in four families from North America, Germany, Japan and Spain, respectively. This is the fifth family carrying HBB: c.327 C>G described to date and the first report from Latin America.

First Case of a Compound Heterozygosity for Two Nondeletional α-Thalassemia mutations, Hb Constant Spring and Hb Quong Sze.

Science.gov (United States)

Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi

2016-06-01

Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.

LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

Science.gov (United States)

Krivega, Ivan; Dean, Ann

2017-08-21

Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

Science.gov (United States)

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

International Nuclear Information System (INIS)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

1981-01-01

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

International Nuclear Information System (INIS)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

2012-01-01

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

Science.gov (United States)

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

Energy Technology Data Exchange (ETDEWEB)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

Science.gov (United States)

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Comparison of different methods for erythroid differentiation in the K562 cell line.

Science.gov (United States)

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

Science.gov (United States)

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

Science.gov (United States)

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

Science.gov (United States)

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

Science.gov (United States)

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

Science.gov (United States)

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Recent trends in the gene therapy of β-thalassemia

Science.gov (United States)

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

Science.gov (United States)

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Heme and erythropoieis: more than a structural role

OpenAIRE

Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela

2014-01-01

Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own ...

Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

Science.gov (United States)

Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

2010-05-16

Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

The effect of histone deacetylase inhibitors on AHSP expression

Science.gov (United States)

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p sodium valproate had a more considerable effect than sodium phenylbutyrate (p sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

Science.gov (United States)

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Elevated Hb A₂ Levels in a Patient with a Compound Heterozygosity for the (β⁺) -31 (A > G) and (β⁰) Codon 17 (A > T) Mutations Together with a Single α-Globin Gene.

Science.gov (United States)

Panyasai, Sitthichai; Jaiping, Kanokwan; Pornprasert, Sakorn

2015-01-01

We report the molecular and hematological feature of a Thai woman who had clinical diagnosis of β-thalassemia intermedia (β-TI). Hemoglobin (Hb) high performance liquid chromatography (HPLC) analysis identified Hb A (64.4%), Hb F (12.3%) and Hb A2/E (15.9%) with small peaks of Hb Bart's (γ4) and Hb H (β4). She was initially diagnosed as EA Bart's disease, which occurs from combination of Hb H disease and Hb E (HBB: c.79G > A) trait. However, the Hb analysis using capillary electrophoresis (CE) demonstrated no Hb E, 68.5% Hb A, 15.5% Hb F and 16.0% Hb A2. DNA analysis showed a compound heterozygosity for (β(+)) -31 (A > G) (HBB: c.-81A > G) and (β(0)) codon 17 (A > T) (HBB: c.52A > T) mutations and deletional Hb H (- -(SEA)/-α(3.7)). Thus, she was finally diagnosed with a combination of Hb H disease and compound heterozygosity of β(+)/β(0)-thalassemia (β(+)/β(0)-thal). The β-globin mutations could affect not only hematological parameters but also elevate the Hb A2 levels. These effects could not be ameliorated by the coinheritance of Hb H disease. Therefore, a better understanding of the effects of this combination on hematological analysis data will be useful for providing accurate diagnosis, genetic counseling, prevention and control programs of β-thalassemia major (β-TM).

The isolation of the γ subunit of fetal hemoglobin (HbF) and its use in a radioimmunoassay for HbF

International Nuclear Information System (INIS)

James, R.F.L.; Shuster, J.; Freedman, S.O.; Gold, P.

1980-01-01

A method is described for the purification, from fetal hemoglobin (HbF), of the fetal specific globin chain (γ chain) in its native state. In the absence of α chain (the globin chain common to all adult human hemoglobins) γ chain, when used as an immunogen, is able to express its unique antigenicity. Here, a specific, high titer antiserum raised against γ chain has been used to establish a sensitive radioimmunoassay for HbF. This approach may be applicable to the measurement of other normal and abnormal hemoglobins. (Auth.)

The effect of histone deacetylase inhibitors on AHSP expression.

Directory of Open Access Journals (Sweden)

Mohammad Ali Okhovat

Full Text Available Alpha-hemoglobin stabilizing protein (AHSP is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms, γ-globin genes (HBG1/2, and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05, except for the expression of BCL11A, which was down-regulated (p < 0.05 in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005 on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies.

Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

Directory of Open Access Journals (Sweden)

Laura Breda

Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

AB027. Developing capacity for variant data sharing in low and middle income countries: HVP’s Global Globin 2020 Challenge

Science.gov (United States)

Robinson, Helen M.

2015-01-01

The hemoglobinopathies, collectively, are cause for significant morbidity and mortality. Children are the most severely affected. Despite much of the genetics and biology of hemoglobinopathies being known for a long time, and being used successfully in some countries to systematically reduce burden of disease, many low and medium income countries remain practically untouched by recent developments in human genomics involving the systematic collection and sharing of variation data to fighting hemoglobinopathies (notably thalassaemias and sickle cell disease, but also G6PD). Commitment to systematic variant data collection is increasing, but this is occurring mostly in high-income countries where much of the diagnosis and testing takes place. There is a risk that countries with the highest burden of these diseases are being left behind in a form of “genomic divide”. Capacity to generate quality data on variants, to store this information so that it can be shared internationally, needs to be built in these countries. Tackling hemoglobinopathies is an ideal entry point for these countries to develop the necessary infrastructure and expertise that can expand into other areas of health. This genomic capacity will enable building: (I) the genetic evidence base for better management of delivery of local treatment, care and eventually even cure; (II) a foundation for genomic medicine by working with national, regional and local health care professionals to raise public awareness of the genetic basis of hemoglobinopathies. Global Globin 2020 Challenge has been initiated with two goals: (I) to see growth in the quality and quantity of curated inputs into internationally recognized genetic databases from low- and middle-income countries participating in the project, and to harmonize the sharing of all relevant variant data between countries in accordance with international best practice that integrates all the relevant ethical and regulatory frameworks and policies

Biochemical and Molecular Analysis of the Hb Lepore Boston Washington in a Syrian Homozygous Child

Directory of Open Access Journals (Sweden)

Monica Pirastru

2017-01-01

Full Text Available Hemoglobin (Hb Lepore is composed of two normal α chains and two δβ fusion globins that arise from unequal crossover events between the δ- and β-globin genes. The Hb Lepore is widespread all over the world and in many ethnic groups. It includes some of the few clinically significant Hb variants that are associated with a β-thalassemia phenotype. Here, we describe the first occurrence of Hb Lepore Boston Washington in a Syrian individual. The patient, a 10-year-old child, shows severe anemia with a Hb level of 6.85 g/dL and typical thalassemic red cell indices. The diagnostic procedure implies hematological, biochemical, and molecular analysis, including multiplex ligation-dependent probe amplification (MLPA assay, GAP-PCR, and DNA sequencing. This latter allowed us to define the correct structure of the hybrid δβ-globin gene. The knowledge of the spectrum of mutations associated with different geographical areas is the prerequisite to set up large-scale screening programs and be able to offer genetic counseling to couples at risk.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

Science.gov (United States)

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

Science.gov (United States)

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR/Cas9 Toxicity in Human Hematopoietic Stem Cells

Directory of Open Access Journals (Sweden)

Chang Li

2018-06-01

Full Text Available We generated helper-dependent HDAd5/35++ adenovirus vectors expressing CRISPR/Cas9 for potential hematopoietic stem cells (HSCs gene therapy of β-thalassemia and sickle cell disease through re-activation of fetal γ-globin expression (HDAd-globin-CRISPR. The process of CRISPR/Cas9 gene transfer using these vectors was not associated with death of human CD34+ cells and did not affect their in vitro expansion and erythroid differentiation. However, functional assays for primitive HSCs, e.g., multi-lineage progenitor colony formation and engraftment in irradiated NOD/Shi-scid/interleukin-2 receptor γ (IL-2Rγ null (NSG mice, revealed toxicity of HDAd-globin-CRISPR vectors related to the prolonged expression and activity of CRISPR/Cas9. To control the duration of CRISPR/Cas9 activity, we generated an HDAd5/35++ vector that expressed two anti-CRISPR (Acr peptides (AcrII4 and AcrII2 capable of binding to the CRISPR/Cas9 complex (HDAd-Acr. CD34+ cells that were sequentially infected with HDAd-CRISPR and HDAd-Acr engrafted at a significantly higher rate. Target site disruption frequencies in engrafted human cells were similar to those in pre-transplantation CD34+ cells, indicating that genome-edited primitive HSCs survived. In vitro differentiated HSCs isolated from transplanted mice demonstrated increased γ-globin expression as a result of genome editing. Our data indicate that the HDAd-Acr vector can be used as a tool to reduce HSC cytotoxicity of the CRISPR/Cas9 complex.

Análise dos haplótipos do gene da betaS-globina no Ceará Analysis of betaS-globin gene haplotypes in Ceará, Brazil

Directory of Open Access Journals (Sweden)

Gentil Claudino de Galiza Neto

2005-10-01

Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

Science.gov (United States)

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

Science.gov (United States)

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

Current and future alternative therapies for beta-thalassemia major

Directory of Open Access Journals (Sweden)

Edouard de Dreuzy

2016-02-01

Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

Science.gov (United States)

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

Gene Therapy Approaches to Hemoglobinopathies.

Science.gov (United States)

Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

2017-10-01

Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

Hemoglobin and Myoglobin as Reducing Agents in Biological Systems. Redox Reactions of Globins with Copper and Iron Salts and Complexes.

Science.gov (United States)

Postnikova, G B; Shekhovtsova, E A

2016-12-01

In addition to reversible O2 binding, respiratory proteins of the globin family, hemoglobin (Hb) and myoglobin (Mb), participate in redox reactions with various metal complexes, including biologically significant ones, such as those of copper and iron. HbO 2 and MbO 2 are present in cells in large amounts and, as redox agents, can contribute to maintaining cell redox state and resisting oxidative stress. Divalent copper complexes with high redox potentials (E 0 , 200-600 mV) and high stability constants, such as [Cu(phen) 2 ] 2+ , [Cu(dmphen) 2 ] 2+ , and CuDTA oxidize ferrous heme proteins by the simple outer-sphere electron transfer mechanism through overlapping π-orbitals of the heme and the copper complex. Weaker oxidants, such as Cu2+, CuEDTA, CuNTA, CuCit, CuATP, and CuHis (E 0 ≤ 100-150 mV) react with HbO 2 and MbO 2 through preliminary binding to the protein with substitution of the metal ligands with protein groups and subsequent intramolecular electron transfer in the complex (the site-specific outer-sphere electron transfer mechanism). Oxidation of HbO 2 and MbO 2 by potassium ferricyanide and Fe(3) complexes with NTA, EDTA, CDTA, ATP, 2,3-DPG, citrate, and pyrophosphate PP i proceeds mainly through the simple outer-sphere electron transfer mechanism via the exposed heme edge. According to Marcus theory, the rate of this reaction correlates with the difference in redox potentials of the reagents and their self-exchange rates. For charged reagents, the reaction may be preceded by their nonspecific binding to the protein due to electrostatic interactions. The reactions of LbO 2 with carboxylate Fe complexes, unlike its reactions with ferricyanide, occur via the site-specific outer-sphere electron transfer mechanism, even though the same reagents oxidize structurally similar MbO 2 and cytochrome b 5 via the simple outer-sphere electron transfer mechanism. Of particular biological interest is HbO 2 and MbO 2 transformation into met-forms in the presence

Systematic documentation and analysis of human genetic variation using the microattribution approach

Science.gov (United States)

Giardine, Belinda; Borg, Joseph; Higgs, Douglas R.; Peterson, Kenneth R.; Maglott, Donna; Basak, A. Nazli; Clark, Barnaby; Faustino, Paula; Felice, Alex E.; Francina, Alain; Gallivan, Monica V. E.; Georgitsi, Marianthi; Gibbons, Richard J.; Giordano, Piero C.; Harteveld, Cornelis L.; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N.; Papadopoulos, Petros; Pavlovic, Sonja; Philipsen, Sjaak; Radmilovic, Milena; Riemer, Cathy; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John; Wiemann, Claudia; Zukic, Branka; Chui, David H. K.; Wajcman, Henri; Hardison, Ross C.; Patrinos, George P.

2013-01-01

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to these disorders, and then implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories 1. A total of 1,941 unique genetic variants in 37 genes, encoding globins (HBA2, HBA1, HBG2, HBG1, HBD, HBB) and other erythroid proteins (ALOX5AP, AQP9, ARG2, ASS1, ATRX, BCL11A, CNTNAP2, CSNK2A1, EPAS1, ERCC2, FLT1, GATA1, GPM6B, HAO2, HBS1L, KDR, KL, KLF1, MAP2K1, MAP3K5, MAP3K7, MYB, NOS1, NOS2, NOS3, NOX3, NUP133, PDE7B, SMAD3, SMAD6, and TOX) are currently documented in these databases with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants and now provides a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The large repository of previously reported data, together with more recent data, acquired by microattribution, demonstrates how the comprehensive documentation of human variation will provide key insights into normal biological processes and how these are perturbed in human genetic disease. Using the microattribution process set out here, datasets which took decades to accumulate for the globin genes could be assembled rapidly for other genes and disease systems. The principles established here for the globin gene system will serve as a model for other systems and the analysis of other common and/or complex human genetic diseases. PMID:21423179

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

Directory of Open Access Journals (Sweden)

Roberta Faria Camilo-Araújo

2014-10-01

Full Text Available Objectives: To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method: The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction. Results: The genotype distribution of haplotypes was 43 (36.7% Central African Republic/Benin, 41 (35.0% Central African Republic/Central African Republic, 20 (17.0% Rare/atypical, and 13 (11.1% Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7 and 11.9% as heterozygous (−α3.7/αα. The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions: In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations.

Thalassemia

Science.gov (United States)

Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...

Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

Directory of Open Access Journals (Sweden)

Alexandra Agapidou

2018-01-01

Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

Disulfiram generates a stable N,N-diethylcarbamoyl adduct on Cys-125 of rat hemoglobin beta-chains in vivo

DEFF Research Database (Denmark)

Erve, J C; Jensen, Ole Nørregaard; Valentine, H S

2000-01-01

residues each. MALDI-TOF MS analysis of two new globin species from DSF-treated rats collected by HPLC revealed increments of 99 Da above the mass of the unmodified chains (beta-2 and beta-3). In a separate experiment, the globin mixture was digested for 2 h with Glu-C and reanalyzed by MALDI-TOF MS....... Results showed a peptide at m/z 2716.3 having a mass 99 Da higher than a known Cys-containing peptide. Subsequently, the Glu-C digest was analyzed using Q-TOF tandem MS, enabling observation of the +4 charge state of the peptide with m/z 2716.3. This peptide was fragmented to produce y-sequence ions...

Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Eitan Fibach

2017-12-01

Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

Science.gov (United States)

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Two-photon excited fluorescence emission from hemoglobin

Science.gov (United States)

Sun, Qiqi; Zeng, Yan; Zhang, Wei; Zheng, Wei; Luo, Yi; Qu, Jianan Y.

2015-03-01

Hemoglobin, one of the most important proteins in blood, is responsible for oxygen transportation in almost all vertebrates. Recently, we discovered two-photon excited hemoglobin fluorescence and achieved label-free microvascular imaging based on the hemoglobin fluorescence. However, the mechanism of its fluorescence emission still remains unknown. In this work, we studied the two-photon excited fluorescence properties of the hemoglobin subunits, heme/hemin (iron (II)/(III) protoporphyrin IX) and globin. We first studied the properties of heme and the similar spectral and temporal characteristics of heme and hemoglobin fluorescence provide strong evidence that heme is the fluorophore in hemoglobin. Then we studied the fluorescence properties of hemin, globin and methemoglobin, and found that the hemin may have the main effect on the methemoglobin fluorescence and that globin has tryptophan fluorescence like other proteins. Finally, since heme is a centrosymmetric molecule, that the Soret band fluorescence of heme and hemoglobin was not observed in the single photon process in the previous study may be due to the parity selection rule. The discovery of heme two-photon excited fluorescence may open a new window for heme biology research, since heme as a cofactor of hemoprotein has many functions, including chemical catalysis, electron transfer and diatomic gases transportation.

Characterization of Hb Bart's Hydrops Fetalis Caused by - -SEA and a Large Novel α0-Thalassemia Deletion.

Science.gov (United States)

He, Sheng; Li, Jihui; Huang, Peng; Zhang, Shujie; Lin, Li; Zuo, Yangjin; Tian, Xiaoxian; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

2018-01-01

Hb Bart's hydrops fetalis is the most severe and generally fatal clinical phenotype of α-thalassemia (α-thal), which is due to the deletion of all four functional α-globin genes of hemoglobin (Hb), resulting in no α-globin chain production (- -/- -). Homozygosity for the - - SEA (Southeast Asian) α-globin gene deletion is the main cause of the Hb Bart's hydrops fetalis in Asia, especially South China. Occasionally, other α 0 -thal deletions can also be found. In this study, we report a case with an atypical form of Hb Bart's hydrops fetalis that was caused by - - SEA and a large novel α 0 -thal deletion (- - GX ) (Guangxi). The fetus with Hb Bart's in our study presented fetal hydrops features in early gestation which was different from that of traditional Hb Bart's hydrops fetalis with a homozygous - - SEA deletion. The early onset of fetal hydrops is attributed to the decreased formation of embryonic Hb Portland (ζ2γ2), which is proposed as a candidate for reactivation in cases of severe α-thal. Our findings indicated that it was important to characterize new or rare mutations, and highlighted the significance of using ultrasonography to identify signs of Hb Bart's hydrops fetalis.

Highly efficient expression of interleukin-2 under the control of rabbit β-globin intron II gene enhances protective immune responses of porcine reproductive and respiratory syndrome (PRRS DNA vaccine in pigs.

Directory of Open Access Journals (Sweden)

Yijun Du

Full Text Available Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2 and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

Directory of Open Access Journals (Sweden)

Dongsheng Wang

2018-03-01

Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

Neuroglobin and Cytoglobin expression in the human brain

DEFF Research Database (Denmark)

Hundahl, Christian Ansgar; Kelsen, Jesper; Hay-Schmidt, Anders

2013-01-01

Neuroglobin and Cytoglobin are new members of the heme-globin family. Both globins are primarily expressed in neurons of the brain and retina. Neuroglobin and Cytoglobin have been suggested as novel therapeutic targets in various neurodegenerative diseases based on their oxygen binding and cell...... protecting properties. However, findings in Neuroglobin-deficient mice question the endogenous neuroprotective properties. The expression pattern of Neuroglobin and Cytoglobin in the rodent brain is also in contradiction to a major role of neuronal protection. In a recent study, Neuroglobin was ubiquitously...... expressed and up-regulated following stroke in the human brain. The present study aimed at confirming our previous observations in rodents using two post-mortem human brains. The anatomical localization of Neuroglobin and Cytoglobin in the human brain is much like what has been described for the rodent...

Molecular ecophysiology of Antarctic notothenioid fishes.

Science.gov (United States)

Cheng, C-H Christina; Detrich, H William

2007-12-29

the mechanistic understanding of the dynamics of AFGP gene gain and loss. In humans and most vertebrates, mutations in the alpha- or beta-globin genes or defects in globin chain synthesis are causes of severe genetic disease. Thus, the 16 species of haemoglobinless, erythrocyte-null icefishes are surprising anomalies -- in fact, they could only have evolved and thrived due to relaxed selection pressure for oxygen-binding proteins in the cold, oxygen-rich waters of the Southern Ocean. Fifteen of the sixteen icefish species have lost most of the adult alphabeta-globin locus and retain only a small 3' fragment of the alpha-globin gene. The only exception to this pattern occurs in Neopagetopsis ionah, which possesses a disrupted alphabeta-globin gene complex that probably represents a non-functional intermediate on the evolutionary pathway to near total globin gene extinction. By contrast, six of the icefish species fail to express myoglobin. The absence of myoglobin expression has occurred by several independent mutations and distinct mechanisms. Haemoprotein loss is correlated with dramatic increases in cellular mitochondrial density, heart size, blood volume and capillary bed volume. Evolution of these compensatory traits was probably facilitated by the homeostatic activity of nitric oxide, a key modulator of angiogenesis and mitochondrial biogenesis. These natural knockouts of the red blood cell lineage are an excellent genomic resource for erythroid gene discovery by comparative genomics, as illustrated for the newly described gene, bloodthirsty.

Phenotype-genotype correlation in β-thalassemia

Directory of Open Access Journals (Sweden)

R. Galanello

2011-12-01

Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血，再到无症状携带状态，β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因（初级基因修饰因子）发生各种变异，主要表现为显著的表型变异。 �

ORF Alignment: NC_003911 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_003911 gi|56696447 >1dlwA 19 115 21 125 4e-12 ... gb|AAV94850.1| protozoan/cyanoba...cterial globin family protein [Silicibacter ... pomeroyi DSS-3] ref|YP_166804.1| ... protozoan

ORF Alignment: NC_002977 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_002977 gi|53804116 >1dlwA 19 113 26 120 5e-13 ... gb|AAU92168.1| protozoan/cyanoba...cterial globin family protein [Methylococcus ... capsulatus str. Bath] ref|YP_114018.1| ... protozoa

SAMJ

African Journals Online (AJOL)

expensive and laborious and £00 limited in application for routine use ... Applications of PCR to oncology ... Whether PCR is feasible for routine use in the South .... globin genomic sequences and restriction site analysis for diagnosis.

ORF Alignment: NC_006348 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_006348 gi|53725407 >1dlwA 1 115 25 145 1e-19 ... ref|YP_103467.1| protozoan/cyanob...acterial globin family protein [Burkholderia mallei ... ATCC 23344] gb|AAU49423.1| protozoan/cyanobac

ORF Alignment: NC_002976 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_002976 gi|57866545 >1dlwA 19 115 47 146 6e-19 ... ref|YP_188173.1| protozoan/cyano...bacterial globin family protein [Staphylococcus ... epidermidis RP62A] gb|AAW53991.1| ... protozoa

ORF Alignment: NC_002951 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_002951 gi|57650195 >1dlwA 19 115 21 120 3e-19 ... ref|YP_185875.1| protozoan/cyano...bacterial globin family protein [Staphylococcus ... aureus subsp. aureus COL] gb|AAW36475.1| ... protozoa

ORF Alignment: NC_006350 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_006350 gi|53718816 >1dlwA 1 115 25 145 1e-19 ... ref|YP_103467.1| protozoan/cyanob...acterial globin family protein [Burkholderia mallei ... ATCC 23344] gb|AAU49423.1| protozoan/cyanobac

Differences in Hematological Traits between High- and Low-Altitude Lizards (Genus Phrynocephalus.

Directory of Open Access Journals (Sweden)

Songsong Lu

Full Text Available Phrynocephalus erythrurus (Lacertilia: Agamidae is considered to be the highest living reptile in the world (about 4500-5000 m above sea level, whereas Phrynocephalus przewalskii inhabits low altitudes (about 1000-1500 m above sea level. Here, we report the differences in hematological traits between these two different Phrynocephalus species. Compared with P. przewalskii, the results indicated that P. erythrurus own higher oxygen carrying capacity by increasing red blood cell count (RBC, hemoglobin concentration ([Hb] and hematocrit (Hct and these elevations could promote oxygen carrying capacity without disadvantage of high viscosity. The lower partial pressure of oxygen in arterial blood (PaO2 of P. erythrurus did not cause the secondary alkalosis, which may be attributed to an efficient pulmonary system for oxygen (O2 loading. The elevated blood-O2 affinity in P. erythrurus may be achieved by increasing intrinsic O2 affinity of isoHbs and balancing the independent effects of potential heterotropic ligands. We detected one α-globin gene and three β-globin genes with 1 and 33 amino acid substitutions between these two species, respectively. Molecular dynamics simulation results showed that amino acids substitutions in β-globin chains could lead to the elimination of hydrogen bonds in T-state Hb models of P. erythrurus. Based on the present data, we suggest that P. erythrurus have evolved an efficient oxygen transport system under the unremitting hypobaric hypoxia.

Specificity of N-terminal methionyl peptidase: analysis by site-directed mutagenesis

International Nuclear Information System (INIS)

Kasper, T.J.; Boissel, J.P.; Bunn, H.F.

1987-01-01

The start site of eukaryotic translation is normally an AUG codon. The corresponding N-terminal methionine is most often removed when the nascent chain reaches about 30 residues. Data from a survey of 1764 eukaryotic protein sequences suggest that the residue adjacent to the initiator Met determines Met cleavage. In order to investigate the mechanism of this reaction, the authors have prepared oligonucleotide-directed mutants of human β-globin from gapped heteroduplexes of a T3/T7 plasmid containing a globin cDNA clone. To date, the authors have produced mutants encoding for 15 of 19 possible amino acid replacements at position 1 in the β-globin chain. These mutants have been confirmed by dideoxy sequencing, transcribed in vitro, and translated in a rabbit reticulocyte lysate in the presence of 35 S-methionine. Labeled translation products were then isolated by cation exchange HPLC, and tryptic peptides were analyzed by RP-HPLC. Thus far, this structural analysis has shown that for β-1 Val, Ala, and Ser, the initiator Met is cleaved, whereas for β-1 Lys, Met, Glu, Trp, Asn, Tyr, and Glu, initiator Met is retained. For β-1 Leu initiator Met is cleaved with a frequency of about 50%. These results are consistent with the data obtained from the previous survey. The expression of site-directed mutants in a cell-free system can also be used to investigate other N-terminal processing events, such as acetylation and myristylation

Application of 15N labeling to topics in molecular hematology

International Nuclear Information System (INIS)

Lapidot, A.; Irving, C.S.

1975-01-01

The amount of information which can be obtained from many types of spectrometric analysis of compounds of hematological interest can be greatly enhanced when measurements are made on a series of isotopically labeled compounds. A murine Friend virus-induced erythroleukemic cell (FLC) culture was found to be a superior biosynthetic system for the preparation of highly and selectively 15 N and 13 C enriched hemoglobins. A mutant of Rhodopseudomonas spheroides was found suitable for the preparation of larger quantities of >90 percent enriched protoporphyrin-IX- 15 N and coproporphyrin-III-- 15 N. A comparison of the 15 N and 13 C NMR spectra of FLC carbomonoxy-[Gly- 15 N]-hemoglobin, carbomonoxy-[Gly- 13 C/sub alpha/]-hemoglobin, α and β globin-[Gly- 15 N] and globin-[Gly- 13 C/sub alpha/] demonstrated 1) 15 N peptide chemical shifts are sensitive to polypeptide sequence, whereas 13 C α-carbon chemical shifts are not, (2) variations in the solvation of the peptide N-H group can be detected in the 15 N spectra but not the 13 C spectra, (3) 15 N heme resonances could not be detected, whereas 13 C resonances could. These studies indicated that in hemoglobin the glycyl N-H resonances are either solvated by H 2 O or hydrogen bonded to peptide C=0 groups. In denatured globin, the majority of the glycyl residues are rapidly exchanging between these two states

Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

Science.gov (United States)

Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

2015-01-01

To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

International Nuclear Information System (INIS)

Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

2008-01-01

Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

Acrylonitrile exposure assessment in the emergency responders of a major train accident in Belgium: a human biomonitoring study.

Science.gov (United States)

Van Nieuwenhuyse, A; Fierens, S; De Smedt, T; De Cremer, K; Vleminckx, C; Mertens, B; Van Overmeire, I; Bader, M; De Paepe, P; Göen, T; Nemery, B; Schettgen, T; Stove, C; Van Oyen, H; Van Loco, J

2014-12-15

On May 4, 2013, a train transporting chemicals derailed in Wetteren, Belgium. Several tanks loaded with acrylonitrile (ACN) exploded, resulting in a fire and a leakage of ACN. To determine exposure to ACN and to assess discriminating factors for ACN exposure in the emergency responders involved in the on-site management of the train accident. The study population consisted of 841 emergency responders. Between May 21 and June 28, they gave blood for the determination of N-2-cyanoethylvaline (CEV) hemoglobin adducts and urine for the measurement of cotinine. They also filled in a short questionnaire. 163 (26%) non-smokers and 55 (27%) smokers showed CEV concentrations above the reference values of 10 and 200 pmol/g globin, respectively. The 95th percentile in the non-smokers was 73 pmol/g globin and the maximum was 452 pmol/g globin. ACN exposure among the non-smokers was predicted by (1) the distance to the accident, (2) the duration of exposure, and (3) the occupational function. Emergency responders involved in the on-site management of the train accident were clearly exposed to ACN from the accident. However, the extent of exposure remained relatively moderate with CEV concentrations staying within the ranges described in literature as background for a smoking population. Moreover, the exposure was less pronounced in the emergency responders as compared to that in the local population. Copyright © 2014. Published by Elsevier Ireland Ltd.

ORF Alignment: NC_002952 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_002952 gi|49483165 >1dlwA 19 115 21 120 3e-19 ... ref|YP_040389.1| protozoan/cyano...bacterial globin family protein [Staphylococcus ... aureus subsp. aureus MRSA252] emb|CAG39975.1| ... protozoa

Anaesthesia for a patient with beta thalassaemia major

African Journals Online (AJOL)

Creative Commons License [CC BY-NC-ND 4.0] ... monitoring and management instituted. The first arterial blood ... thalassaemia is a defect of the beta globin chains of the ... Decreased supply due to anaemia, chronic infections and frequent ...

A Survey of ABO, Rhesus (D) Antigen and Haemoglobin Genes ...

African Journals Online (AJOL)

olayemitoyin

transporting the bound oxygen throughout the body where it is used in ... the globin genes that alter the protein composition but not necessarily ... oxygen carrying capacity and hence the rate of aerobic metabolic ... to participate in the exercise.

Neuroglobin expression in the rat suprachiasmatic nucleus: colocalization, innervation, and response to light

DEFF Research Database (Denmark)

Hundahl, C A; Hannibal, J; Fahrenkrug, J

2010-01-01

Neuroglobin (Ngb) is a myoglobin-like (Mb) heme-globin, belonging the globin family located only in neuronal tissue of the central nervous system. Ngb has been shown to be upregulated in and to protect neurons from hypoxic and ischemic injury, but the function of Ngb-in particular how Ngb may...... protect neurons-remains largely elusive. We have previously described the localization of Ngb in the rat brain and found it to be expressed in areas primarily involved in sleep/wake, circadian, and food regulation. The present study was undertaken, using immunohistochemistry, to characterize......-containing cells received input from neuropeptide Y (NPY)-containing nerve fibers of the geniticulo-hypothalamic tract (GHT), whereas no direct input from the eye or the midbrain raphe system was demonstrated. The results indicate that the Ngb could be involved in both photic and nonphotic entrainment via input...

Genetic differences in hemoglobin function between highland and lowland deer mice

DEFF Research Database (Denmark)

Storz, Jay F.; Runck, Amy M.; Moriyama, Hideaki

2010-01-01

In high-altitude vertebrates, adaptive changes in blood–O2 affinity may be mediated by modifications of hemoglobin (Hb) structure that affect intrinsic O2 affinity and/or responsiveness to allosteric effectors that modulate Hb–O2 affinity. This mode of genotypic specialization is considered typical...... of mammalian species that are high-altitude natives. Here we investigated genetically based differences in Hb–O2 affinity between highland and lowland populations of the deer mouse (Peromyscus maniculatus), a generalist species that has the broadest altitudinal distribution of any North American mammal....... The results of a combined genetic and proteomic analysis revealed that deer mice harbor a high level of Hb isoform diversity that is attributable to allelic polymorphism at two tandemly duplicated -globin genes and two tandemly duplicated β-globin genes. This high level of isoHb diversity translates...

Case Presentation at a Clinico-Pathological Conference*

African Journals Online (AJOL)

globin 15 g/lOO ml, and his white blood cell count 22000/ mm', with 80% neutrophil .... respiration commenced. ... exception a cardiac granuloma may occur with minimal or no joint .... thickened because of oedema and a limited cellular infiltra-.

Fulltext PDF

Indian Academy of Sciences (India)

2014-10-20

Oct 20, 2014 ... for the existence of enhancers was also obtained in the case of the globin ... in previous decades: use of restriction enzymes, construction ... accident. Viruses were considered as the gateway to the study of eukaryotes, as ...

ORF Alignment: NC_004578 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NC_004578 gi|28871348 >1dlwA 1 114 25 138 3e-25 ... ref|NP_793967.1| protozoan/cyanob...acterial globin family protein [Pseudomonas ... syringae pv. tomato str. DC3000] gb|AAO57662.1| ... protozoa

Structural and functional properties of designed globins

Indian Academy of Sciences (India)

De novo design of artificial proteins is an essential approach to elucidate the principles of protein architecture and to understand specific functions of natural proteins and also to yield novel molecules for medical and industrial aims. We have designed artificial sequences of 153 amino acids to fit the main-chain framework of ...

Structural and functional properties of designed globins

Indian Academy of Sciences (India)

Administrator

Such artificial heme proteins provide simplified models of. *For correspondence ... sequence folds into a monomeric, compact, highly helical and globular form with an ... equilibrium between the five- and six-coordinated states. The ferrous ...

Spatial organisation of the ß-globin locus

NARCIS (Netherlands)

R.-J.T.S. Palstra (Robert-Jan)

2005-01-01

textabstractAlle multi-cellulaire organismen beginnen als een enkele bevruchte eicel. Gedurende de differentiatie wordt het aantal cellen vermeerderd door middel van celdeling. De cellen specialiseren zich tevens in verschillende celtypes zoals hersen-, bloed- en spiercellen. Toch bevatten al deze

β-Thalassemia and Polycythemia vera : Targeting chronic stress erythropoiesis

NARCIS (Netherlands)

Crielaard, Bart J; Rivella, Stefano

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective

Hemoglobins, Hemorphins, and 11p15.5 Chromosomal Region in Cancer Biology and İmmunity with Special Emphasis for Brain Tumors.

Science.gov (United States)

Altinoz, Meric Adil; Elmaci, Ilhan; Ince, Bahri; Ozpinar, Aysel; Sav, Aydin Murat

2016-05-01

In systemic cancers, increased hemolysis leads to extracellular hemoglobin (HB), and experimental studies have shown its provoking role on tumor growth and metastasis. However, investigations have shown that HB chains presented by tumor vascular pericytes or serum protein complexes of HB could also induce antitumor immunity, which may be harnessed to treat refractory cancers and brain tumors. Mounting recent evidence shows that expression of HBs is not restricted to erythrocytes and that HBs exist in the cells of lung and kidney, in macrophages, and in neurons and glia of the central nervous system (CNS). HBs mediate coping with hypoxia and free radical stress in normal and tumor cells, and they are increased in certain tumors including breast, lung, colon, and squamous cell cancers. Recent studies showed HBs in meningioma, in the cyst fluid of craniopharyngioma, in the cerebrospinal fluid (CSF) of pediatric patients with posterior fossa tumors, and in glioblastoma cell lines. Hemorphins, abundant brain peptides formed via HB-chain cleavage, exert opioid activity and antiproliferative and immunomodifier effects. Hence mutations in HBs may modify brain tumorigenesis via influencing hemorphins and perturbing regulations of immune surveillance and cell growth in the neuroectodermal tissues. The β-globin gene cluster resides in the chromosome region 11p15.5, harboring important immunity genes and IGF2, H19, PHLDA2/TSSC3, TRIM3, and SLC22A18 genes associated with cancers and gliomas. 11p15.5 is a prominent region subject to epigenetic regulation. Thus the β-globin loci may exert haplotypal interactions with these. Some clues support this theory. It is well established that iron load induces liver cancer in thalassemia major; however iron load-independent associations also exist. Enhanced rates of hematologic malignancies are associated with HB Lepore, association of hemoglobin E with cholangiocarcinoma, and enhanced gastric cancer rates in the thalassemia trait. In

Expression and purification of recombinant hemoglobin in Escherichia coli

DEFF Research Database (Denmark)

Natarajan, Chandrasekhar; Jiang, Xiaoben; Fago, Angela

2011-01-01

BACKGROUND: Recombinant DNA technologies have played a pivotal role in the elucidation of structure-function relationships in hemoglobin (Hb) and other globin proteins. Here we describe the development of a plasmid expression system to synthesize recombinant Hbs in Escherichia coli, and we describe...

α-Thalassaemia in Tunisia: some epidemiological and molecular data

Indian Academy of Sciences (India)

the absence or reduced rate of the α-globin chain synthesis. In fetal or adult life, the ... The Hb Bart's carriers at birth was conducted on 529 cord blood samples ... with variable distribution, with the most affected regions be- ing the northeast ...

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Manal Michel Wilson

2015-03-04

Mar 4, 2015 ... The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net ... RDB, a panel of probes (n = 22) using the beta globin strip assay was used ... (20 pmol) of primer R and 5 ll (100 ng) of genomic extracted. DNA.

Identification of the -α(2.4) Deletion in One Family and in One Hb H Disease Patient in Guangxi, People's Republic of China.

Science.gov (United States)

Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong

2016-06-01

The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.

Involvement of the 5'-leader sequence in coupling the stability of a human H3 histone mRNA with DNA replication

International Nuclear Information System (INIS)

Morris, T.; Marashi, F.; Weber, L.; Hickey, E.; Greenspan, D.; Bonner, J.; Stein, J.; Stein, G.

1986-01-01

Two lines of evidence derived from fusion gene constructs indicate that sequences residing in the 5'-nontranslated region of a cell cycle-dependent human H3 histone mRNA are involved in the selective destabilization that occurs when DNA synthesis is terminated. The experimental approach was to construct chimeric genes in which fragments of the mRNA coding regions of the H3 histone gene were fused with fragments of genes not expressed in a cell cycle-dependent manner. After transfection in HeLa S3 cells with the recombinant plasmids, levels of fusion mRNAs were determined by S1 nuclease analysis prior to and following DNA synthesis inhibition. When the first 20 nucleotides of an H3 histone mRNA leader were replaced with 89 nucleotides of the leader from a Drosophila heat-shock (hsp70) mRNA, the fusion transcript remained stable during inhibition of DNA synthesis, in contrast to the rapid destabilization of the endogenous histone mRNA in these cells. In a reciprocal experiment, a histone-globin fusion gene was constructed that produced a transcript with the initial 20 nucleotides of the H3 histone mRNA substituted for the human β-globin mRNA leader. In HeLa cells treated with inhibitors of DNA synthesis and/or protein synthesis, cellular levels of this histone-globin fusion mRNA appeared to be regulated in a manner similar to endogenous histone mRNA levels. These results suggest that the first 20 nucleotides of the leader are sufficient to couple histone mRNA stability with DNA replication

α-Thalassemia Associated with Hb Instability: A Tale of Two Features. The Case of Hb Rogliano or α1 Cod 108(G15)Thr→Asn and Hb Policoro or α2 Cod 124(H7)Ser→Pro.

Science.gov (United States)

Musollino, Gennaro; Cardiero, Giovanna; Flagiello, Angela; La Porta, Gaetana; Lagona, Laura; Prezioso, Romeo; Qualtieri, Gabriele; Gaudiano, Carlo; Medulla, Emilia; Merlino, Antonello; Pucci, Piero; Lacerra, Giuseppina

2015-01-01

We identified two new variants in the third exon of the α-globin gene in families from southern Italy: the Hb Rogliano, α1 cod108 ACC>AAC or α1[α108(G15)Thr→Asn] and the Hb Policoro, α2 cod124 TCC>CCC or α2[α124(H7)Ser→Pro]. The carriers showed mild α-thalassemia phenotype and abnormal hemoglobin stability features. These mutations occurred in the G and H helices of the α-globin both involved in the specific recognition of AHSP and β1 chain. Molecular characterization of mRNA, globin chain analyses and molecular modelling studies were carried out to highlight the mechanisms causing the α-thalassemia phenotype. The results demonstrated that the α-thalassemia defect associated with the two Hb variants originated by different defects. Hb Rogliano showed an intrinsic instability of the tetramer due to anomalous intra- and inter-chain interactions suggesting that the variant chain is normally synthesized and complexed with AHSP but rapidly degraded because it is unable to form the α1β1 dimers. On the contrary in the case of Hb Policoro two different molecular mechanisms were shown: the reduction of the variant mRNA level by an unclear mechanism and the protein instability due to impairment of AHSP interaction. These data highlighted that multiple approaches, including mRNA quantification, are needed to properly identify the mechanisms leading to the α-thalassemia defect. Elucidation of the specific mechanism leads to the definition of a given phenotype providing important guidance for the diagnosis of unstable variants. PMID:25730315

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

Science.gov (United States)

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

Experiment list: SRX1098180 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ensitivity source_name=Cultured K562 cells || transduced gene=dCas9-KRAB || grna target=globin HS2 enhancer ...is=Leukemia Chronic Myelogenous 106502015,0.0,52.4,0 GSM1824418: dCas9 KRAB rep2; Homo sapiens; DNase-Hypers

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

We have calculated the most probable mass distributions for Lumbricus and Riftia assemblies and their globin and linker subassemblies, based on the Lumbricus Er stoichiometry and using accurate subunit masses obtained by electrospray ionization mass spectrometry. The expected masses of Lumbricus and Riftia Ers ...

Airway Management and Smoke Inhalation Injury in the Burn Patient

Science.gov (United States)

2009-10-01

see the previous discussion in this article), patient history and physical examination, and carboxyhemoglobin levels (if available) are used. The...addition to combining with hemoglobin to form carboxyhemoglobin (COHb), where in the CO has an affinity for hemo- globin which is 200 times that of

In vitro adduct formation of phosgene with albumin and hemoglobin in human blood

NARCIS (Netherlands)

Noort, D.; Hulst, A.G.; Fidder, A.; Gurp, R.A. van; Jong, L.P.A. de; Benschop, H.P.

2000-01-01

The development of procedures for retrospective detection and quantitation of exposure to phosgene, based on adducts to hemoglobin and albumin, is described. Upon incubation of human blood with [14C]phosgene (0-750 μM), a significant part of radioactivity (0-13%) became associated with globin and

Updates of the HbVar database of human hemoglobin variants and thalassemia mutations

NARCIS (Netherlands)

B. Giardine (Belinda); J. Borg (Joseph); E. Viennas (Emmanouil); C. Pavlidis (Cristiana); K. Moradkhani (Kamran); P. Joly (Philippe); M. Bartsakoulia (Marina); C. Riemer (Cathy); W. Miller (Webb); G. Tzimas (Giannis); H. Wajcman (Henri); R.C. Hardison (Ross); G.P. Patrinos (George)

2014-01-01

textabstractHbVar (http://globin.bx.psu.edu/hbvar) is one of the oldest and most appreciated locus-specific databases launched in 2001 by a multi-center academic effort to provide timely information on the genomic alterations leading to hemoglobin variants and all types of thalassemia and

Neuroglobin-deficiency exacerbates Hif1A and c-FOS response, but does not affect neuronal survival during severe hypoxia in vivo

DEFF Research Database (Denmark)

Hundahl, Christian Ansgar; Luuk, Hendrik; Ilmjärv, Sten

2011-01-01

Neuroglobin (Ngb), a neuron-specific globin that binds oxygen in vitro, has been proposed to play a key role in neuronal survival following hypoxic and ischemic insults in the brain. Here we address whether Ngb is required for neuronal survival following acute and prolonged hypoxia in mice...

Loss of Major DNase I Hypersensitive Sites in Duplicatedglobin Gene Cluster Incompletely Silences HBB Gene Expression

Czech Academy of Sciences Publication Activity Database

Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.

2016-01-01

Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016

Dietary determinants for Hb-acrylamide and Hb-glycidamide adducts in Danish non-smoking women

DEFF Research Database (Denmark)

Outzen, Malene; Egeberg, Rikke; Dragsted, Lars

2011-01-01

in erythrocytes were analysed by liquid chromatography/MS/MS. Dietary determinants were evaluated by multiple linear regression analyses adjusted for age and smoking behaviour among ex-smokers. The median for Hb-AA was 35 pmol/g globin (5th percentile 17, 95th percentile 89) and for Hb-GA 21 pmol/g globin (5th......Acrylamide (AA) is a probable human carcinogen that is formed in heat-treated carbohydrate-rich foods. The validity of FFQ to assess AA exposure has been questioned. The aim of the present cross-sectional study was to investigate dietary determinants of Hb-AA and Hb-glycidamide (GA) adducts....... The study included 537 non-smoking women aged 50–65 years who participated in the Diet, Cancer and Health cohort (1993–97). At study baseline, blood samples and information on dietary and lifestyle variables obtained from self-administered questionnaires were collected. From blood samples, Hb-AA and Hb-GA...

Hb Agenogi [β90(F6)Glu→Lys (GAG>AAG) HBB: c.271G>A)] in a Pregnant Thai Woman.

Science.gov (United States)

Panyasai, Sitthichai; Thongsuk, Pollawat; Pornprasert, Sakorn

2016-01-01

Hb Agenogi [β90(F6)Glu→Lys (GAG>AAG) HBB: c.271G>A)] is a very rare β-globin chain variant. We report for the first time this hemoglobinopathy in a pregnant 20-year-old Thai woman. She was seen by an obstetrician at her 14th week of gestation. She was pale and had an inflammatory lesion of her lower left leg. The hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) and low pressure liquid chromatography (LPLC) showed a peak of abnormal Hb at the C window. On capillary electrophoresis (CE), the abnormal Hb peak was observed at electrophoretic zone 4 that corresponded to the Hb E (HBB: c.79G>A) peak. Direct DNA sequencing revealed a GAG>AAG mutation at codon 90 of the β-globin gene. Thus, even though Hb Agenogi is very rare, it can be found in Thai people. The knowledge and understanding of this hemoglobinopathy will be used to assist in diagnosis, management and counseling for patients.

A gene-environment study of cytoglobin in the human and rat hippocampus

DEFF Research Database (Denmark)

Hundahl, Christian Ansgar; Elfving, Betina; Müller, Heidi Kaastrup

2013-01-01

Cytoglobin (Cygb) was discovered a decade ago as the fourth vertebrate heme-globin. The function of Cygb is still unknown, but accumulating evidence from in vitro studies point to a putative role in scavenging of reactive oxygen species and nitric oxide metabolism and in vivo studies have shown C......NOS) in the rat hippocampus; 3) The effect of chronic restraint stress (CRS) on Cygb and nNOS expression.......Cytoglobin (Cygb) was discovered a decade ago as the fourth vertebrate heme-globin. The function of Cygb is still unknown, but accumulating evidence from in vitro studies point to a putative role in scavenging of reactive oxygen species and nitric oxide metabolism and in vivo studies have shown...... Cygb to be up regulated by hypoxic stress. This study addresses three main questions related to Cygb expression in the hippocampus: 1) Is the rat hippocampus a valid neuroanatomical model for the human hippocampus; 2) What is the degree of co-expression of Cygb and neuronal nitric oxide synthase (n...

Increased efficiency of exogenous messenger RNA translation in a Krebs ascites cell lysate.

Science.gov (United States)

Metafora, S; Terada, M; Dow, L W; Marks, P A; Bank, A

1972-05-01

Addition of a 0.5 M KCl wash fraction from rabbit reticulocyte ribosomes causes a 3- to 10-fold increase in the extent of translation of natural mRNAs by Krebs-cell lysates. In the presence of the wash fraction, 1 pmol of rabbit or mouse 10S RNA directs the incorporation of 80 pmol of leucine into rabbit globin. The addition of human 10S RNA results in the synthesis of equal amounts of human alpha and beta chains, identified by column chromatography. The stimulation by the wash fraction is almost completely dependent on added mammalian tRNA. In contrast to the wash fraction from rabbit reticulocytes, the wash fraction isolated from Krebs-cell ribosomes is inhibitory to both endogenous and exogenous mRNA translation. The stimulation by the wash fraction from rabbit ribosomes is not specific for globin mRNAs, but also increases endogenous, phage Qbeta, and viral RNA-directed protein synthesis.

Erythropoiesis in Malaria Infections and Factors Modifying the Erythropoietic Response

Directory of Open Access Journals (Sweden)

Vrushali A. Pathak

2016-01-01

Full Text Available Anemia is the primary clinical manifestation of malarial infections and is responsible for the substantial rate of morbidity. The pathophysiology discussed till now catalogued several causes for malarial anemia among which ineffective erythropoiesis being remarkable one occurs silently in the bone marrow. A systematic literature search was performed and summarized information on erythropoietic response upon malaria infection and the factors responsible for the same. This review summarizes the clinical and experimental studies on patients, mouse models, and in vitro cell cultures reporting erythropoietic changes upon malaria infection as well as factors accountable for the same. Inadequate erythropoietic response during malaria infection may be the collective effect of various mediators generated by host immune response as well as parasite metabolites. The interplay between various modulators causing the pathophysiology needs to be explored further. Globin gene expression profiling upon malaria infection should also be looked into as abnormal production of globin chains could be a possible contributor to ineffective erythropoiesis.

Beta thalassemia - a review

Directory of Open Access Journals (Sweden)

R Jha

2014-09-01

Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: http://dx.doi.org/10.3126/jpn.v4i8.11609 Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671

Fetal Anemia and Hydrops Fetalis Associated with Homozygous Hb Constant Spring (HBA2: c.427T > C).

Science.gov (United States)

He, Yi; Zhao, Ying; Lou, Ji-Wu; Liu, Yan-Hui; Li, Dong-Zhi

2016-01-01

Hb Constant Spring (Hb CS, HBA2: c.427T > C) is a common nondeletional α-thalassemia (α-thal) that results from a nucleotide substitution at the termination codon of the α2-globin gene. Homozygosity for Hb CS (α(CS)α/α(CS)α) is relatively rare, and generally characterized with mild hemolytic anemia, jaundice, and splenomegaly. In this report we present a fetus with cardiomegaly, pericardial effusion, enlarged placenta and increased middle cerebral artery-peak systolic velocity (MCA-PSV) at 24 weeks' gestation. Fetal blood sampling revealed the severe anemia [hemoglobin (Hb) level being 4.8 g/dL] and Hb H (β4) disease-like hematological findings with Hb Bart's (γ4) level of 17.9%. DNA sequencing of the α-globin genes found that both partners were Hb CS carriers and the fetus was an Hb CS homozygote. Therefore, this was a rare case of homozygous Hb CS which demonstrated an unusual and serious anemia and hydrops fetalis in utero.

Neuroglobin Overexpression Inhibits AMPK Signaling and Promotes Cell Anabolism.

Science.gov (United States)

Cai, Bin; Li, Wenjun; Mao, XiaoOu; Winters, Ali; Ryou, Myoung-Gwi; Liu, Ran; Greenberg, David A; Wang, Ning; Jin, Kunlin; Yang, Shao-Hua

2016-03-01

Neuroglobin (Ngb) is a recently discovered globin with preferential localization to neurons. Growing evidence indicates that Ngb has distinct physiological functions separate from the oxygen storage and transport roles of other globins, such as hemoglobin and myoglobin. We found increased ATP production and decreased glycolysis in Ngb-overexpressing immortalized murine hippocampal cell line (HT-22), in parallel with inhibition of AMP-activated protein kinase (AMPK) signaling and activation of acetyl-CoA carboxylase (ACC). In addition, lipid and glycogen content was increased in Ngb-overexpressing HT-22 cells. AMPK signaling was also inhibited in the brain and heart from Ngb-overexpressing transgenic mice. Although Ngb overexpression did not change glycogen content in whole brain, glycogen synthase was activated in cortical neurons of Ngb-overexpressing mouse brain and Ngb overexpression primary neurons. Moreover, lipid and glycogen content was increased in hearts derived from Ngb-overexpressing mice. These findings suggest that Ngb functions as a metabolic regulator and enhances cellular anabolism through the inhibition of AMPK signaling.

Testing for haemoglobinopathies in Johannesburg, South Africa: A ...

African Journals Online (AJOL)

Thus, haemoglobinopathies are seen in diverse populations in SA, broadly reflecting their origins. Further, the globin genes were among the first human genes cloned in the recombinant DNA era and they served as model genes for the establishment of genetic services worldwide, with the first molecular prenatal diagnosis ...

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Dilay Ciglidag Dungul

carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...

Chromatin loops, gene positioning, and gene expression

NARCIS (Netherlands)

Holwerda, S.; de Laat, W.

2012-01-01

Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

Characterization of sulfur mustard induced structural modifications in human hemoglobin by liquid chromatography-tandem mass spectrometry

NARCIS (Netherlands)

Noort, D.; Verheij, E.R.; Hulst, A.G.; Jong, L.P.A. de; Benschop, H.P.

1996-01-01

In this paper we describe the use of tandem mass spectrometry to identify modified sites in human hemoglobin after in vitro exposure to bis(2- chloroethyl) sulfide (sulfur mustard). Globin isolated from human whole blood which had been exposed to sulfur mustard was degraded with trypsin, and the

Exploring cellular memory molecules marking competent and active transcriptions

Directory of Open Access Journals (Sweden)

Liu De-Pei

2007-05-01

Full Text Available Abstract Background Development in higher eukaryotes involves programmed gene expression. Cell type-specific gene expression is established during this process and is inherited in succeeding cell cycles. Higher eukaryotes have evolved elegant mechanisms by which committed gene-expression states are transmitted through numerous cell divisions. Previous studies have shown that both DNase I-sensitive sites and the basal transcription factor TFIID remain on silenced mitotic chromosomes, suggesting that certain trans-factors might act as bookmarks, maintaining the information and transmitting it to the next generation. Results We used the mouse globin gene clusters as a model system to examine the retention of active information on M-phase chromosomes and its contribution to the persistence of transcriptional competence of these gene clusters in murine erythroleukemia cells. In cells arrested in mitosis, the erythroid-specific activator NF-E2p45 remained associated with its binding sites on the globin gene loci, while the other major erythroid factor, GATA-1, was removed from chromosome. Moreover, despite mitotic chromatin condensation, the distant regulatory regions and promoters of transcriptionally competent globin gene loci are marked by a preserved histone code consisting in active histone modifications such as H3 acetylation, H3-K4 dimethylation and K79 dimethylation. Further analysis showed that other active genes are also locally marked by the preserved active histone code throughout mitotic inactivation of transcription. Conclusion Our results imply that certain kinds of specific protein factors and active histone modifications function as cellular memory markers for both competent and active genes during mitosis, and serve as a reactivated core for the resumption of transcription when the cells exit mitosis.

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: Implications for the enzyme mechanism‡

Science.gov (United States)

Ogura, Hiroshi; Evans, John P.; Peng, Dungeng; Satterlee, James D.; de Montellano, Paul R. Ortiz; Mar, Gerd N. La

2009-01-01

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase-1, (hHO) has been investigated by 1H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. 2D 1H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts, that places the lone iron π-spin in the dxz orbital, rather than the dyz orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy and magnetic susceptibilities argues for a low-spin, (dxy)2(dyz,dxz)3, ground state in both azide and cyanide complexes. The switch from singly-occupied dyz for the cyanide to dxz for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide π-plane in the latter complex, which is ∼90° in-plane rotated from that of the imidazole π-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicate that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 → Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed. PMID:19243105

Analytical determination of specific 4,4'-methylene diphenyl diisocyanate hemoglobin adducts in human blood.

Science.gov (United States)

Gries, Wolfgang; Leng, Gabriele

2013-09-01

4,4'-Methylene diphenyl diisocyanate (MDI) is one of the most important isocyanates in the industrial production of polyurethane and other MDI-based synthetics. Because of its high reactivity, it is known as a sensitizing agent, caused by protein adducts. Analysis of MDI is routinely done by determination of the nonspecific 4,4'-methylenedianiline as a marker for MDI exposure in urine and blood. Since several publications have reported specific adducts of MDI and albumin or hemoglobin, more information about their existence in humans is necessary. Specific adducts of MDI and hemoglobin were only reported in rats after high-dose MDI inhalation. The aim of this investigation was to detect the hemoglobin adduct 5-isopropyl-3-[4-(4-aminobenzyl)phenyl]hydantoin (ABP-Val-Hyd) in human blood for the first time. We found values up to 5.2 ng ABP-Val-Hyd/g globin (16 pmol/g) in blood samples of workers exposed to MDI. Because there was no information available about possible amounts of this specific MDI marker, the analytical method focused on optimal sensitivity and selectivity. Using gas chromatography-high-resolution mass spectrometry with negative chemical ionization, we achieved a detection limit of 0.02 ng ABP-Val-Hyd/g globin (0.062 pmol/g). The robustness of the method was confirmed by relative standard deviations between 3.0 and 9.8 %. Combined with a linear detection range up to 10 ng ABP-Val-Hyd/g globin (31 pmol/g), the enhanced precision parameter demonstrates that the method described is optimized for screening studies of the human population.

Novel interactions of two α-Hb variants with SEA deletion α0-thalassemia: hematological and molecular analyses.

Science.gov (United States)

Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2018-04-01

To report the hematological and molecular features as well as diagnostic aspects of the hitherto un-described interactions of two rare α-globin chain variants with α 0 -thalassemia commonly found among Southeast Asian populations. The study was done on two adult Thai patients (P1 and P2) who had hypochromic microcytic anemia. Hb analysis was carried out using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE). Mutations were identified by PCR and related techniques. Hb analysis of P1 using HPLC showed a normal Hb pattern, but CE demonstrated an abnormal peak at zone 7. DNA sequencing identified a CCG-CTG mutation at codon 95 of the α2 globin gene corresponding to the Hb G-Georgia [α95(G2)Pro → Leu(α2)] previously undescribed in the Thai population. In contrast, Hb analysis of P2 demonstrated an abnormal peak not fully separated from Hb A on HPLC, but not on CE. DNA analysis identified the rarely described Hb Nakhon Ratchasima [α63(E12)Ala → Val(α2)] mutation. Routine DNA analysis detected the SEA deletion α 0 -thalassemia in trans to the Hb variants in both cases. Hematological parameters were compared with those of patients with compound heterozygote for other α-globin variants and α 0 -thalassemia previously documented. Identification of the patients confirmed that interaction of these rare Hb variants with α 0 -thalassemia does not lead to the Hb H disease. Differentiation of these two Hb variants from other clinically relevant hemoglobinopathies in a routine setting is, however, necessary. This can be accomplished using a combined Hb-HPLC and CE analysis followed by PCR-RFLP assays.

Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

Directory of Open Access Journals (Sweden)

Sandro Eridani

2014-09-01

Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

The conserved Phe GH5 of importance for hemoglobin intersubunit contact is mutated in gadoid fish

Science.gov (United States)

2014-01-01

Background Functionality of the tetrameric hemoglobin molecule seems to be determined by a few amino acids located in key positions. Oxygen binding encompasses structural changes at the interfaces between the α1β2 and α2β1 dimers, but also subunit interactions are important for the oxygen binding affinity and stability. The latter packing contacts include the conserved Arg B12 interacting with Phe GH5, which is replaced by Leu and Tyr in the αA and αD chains, respectively, of birds and reptiles. Results Searching all known hemoglobins from a variety of gnathostome species (jawed vertebrates) revealed the almost invariant Arg B12 coded by the AGG triplet positioned at an exon-intron boundary. Rare substitutions of Arg B12 in the gnathostome β globins were found in pig, tree shrew and scaled reptiles. Phe GH5 is also highly conserved in the β globins, except for the Leu replacement in the β1 globin of five marine gadoid species, gilthead seabream and the Comoran coelacanth, while Cys and Ile were found in burbot and yellow croaker, respectively. Atlantic cod β1 globin showed a Leu/Met polymorphism at position GH5 dominated by the Met variant in northwest-Atlantic populations that was rarely found in northeast-Atlantic cod. Site-specific analyses identified six consensus codons under positive selection, including 122β(GH5), indicating that the amino acid changes identified at this position may offer an adaptive advantage. In fact, computational mutation analysis showed that the replacement of Phe GH5 with Leu or Cys decreased the number of van der Waals contacts essentially in the deoxy form that probably causes a slight increase in the oxygen binding affinity. Conclusions The almost invariant Arg B12 and the AGG codon seem to be important for the packing contacts and pre-mRNA processing, respectively, but the rare mutations identified might be beneficial. The Leu122β1(GH5)Met and Met55β1(D6)Val polymorphisms in Atlantic cod hemoglobin modify the

Recent trends in the gene therapy of β-thalassemia

Directory of Open Access Journals (Sweden)

Finotti A

2015-02-01

Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

Effect of family counsellling on psychological distress among ...

African Journals Online (AJOL)

Background: Sickle Cell Anaemia (SCA) is a haematological disorder of red blood cells, caused by mutation in the beta globin gene. Caring for patients with the disorder poses a significant psychological burden on the sufferers, the caregivers and their families, thereby affecting their quality of life. Family counselling has ...

Problem-Solving Test: The Mechanism of Protein Synthesis

Science.gov (United States)

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

Diagnosis and dosimetry of exposure to sulfur mustard: Development of a standard operating procedure for hemoglobin adducts: Exploratory research on albumin and keratin adducts

NARCIS (Netherlands)

Noort, D.; Fidder, A.; Jong, L.P.A. de; Schans, G.P. van der; Benschop, H.P.

2000-01-01

A standard operating procedure (SOP) for determination of the sulfur mustard adduct to the N-terminal valine in hemoglobin was developed. By using this SOP, it was found that the Nterminal valine adduct in globin of hairless guinea pigs and marmosets which had been exposed to sulfur mustard (0.5

Author Details

African Journals Online (AJOL)

Abdelrazik, HN. Vol 13, No 3 (2006) - Articles Molecular characterization of chromosome 7 in AML and MDS patients. Abstract PDF · Vol 13, No 3 (2006) - Articles Rapid screening of β-Globin gene mutations by Real-Time PCR in Egyptian thalassemic children. Abstract PDF. ISSN: 1022-9272. AJOL African Journals Online.

Chromatin Dynamics of the mouse β-globin locus

NARCIS (Netherlands)

M.P.C. van de Corput (Mariëtte); E. de Boer (Ernie); T.A. Knoch (Tobias); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)

2010-01-01

textabstractLately it has become more clear that (subtle) changes in 3D organization of chromatin can either trigger transcription or silence genes or gene clusters. It has also been postulated that due to changes in chromatin structure, a change in chromatin accessibility of transcription factors

RESEARCH ARTICLE Association of GSTM1, GSTT1 and GSTP1 ...

Indian Academy of Sciences (India)

2017-01-12

Jan 12, 2017 ... 2Haemato-Oncology Unit & Department of Internal Medicine, School ... risk for the development of resistance to IM with OR: 1.951 (95 % CI: 1.186 .... primers were used simultaneously in which β – globin served as a control (shown in Table ..... LeukemiaNet recommendations for the management of CML.

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

Efeito do pH e da hidrólise tríptica sobre as propriedades emulsionantes da globina bovina The effect of the pH and the tryptic hydrolysis on the emulsifying properties of bovine globin

Directory of Open Access Journals (Sweden)

Cleia Batista Dias ORNELLAS

2001-01-01

Full Text Available No intuito de estudar o efeito do pH e da ação da tripsina sobre as propriedades emulsionantes da globina bovina, extraída pelo método da acetona acidificada, foram determinados neste trabalho, a capacidade emulsionante (EC, o índice de atividade emulsionante (EAI e a estabilidade da emulsão (ES. Testaram-se os valores de pH de 3,0 a 8,0 e os tempos de hidrólise de 5,0 a 60 min. Os dados obtidos indicam que os maiores valores de EC e ES foram obtidos no pH 5,0 e 6,0, respectivamente, correspondente à faixa de alta solubilidade da proteína. Por outro lado, o EAI, além de apresentar um máximo no pH 3,0, foi igualmente elevado nos valores de pH 7,0 e 8,0, situados na zona onde a globina é praticamente insolúvel. A hidrólise tríptica, nas condições empregadas, contribuiu para melhorar a EC, em toda a faixa de pH estudada, enquanto que para o EAI somente foi benéfico em pH 4,0 e 5,0. No caso da ES, este tratamento enzimático não foi vantajoso, promovendo melhoras apenas no pH 7,0, onde a proteína é insolúvel, e somente após 60 min de hidrólise.The effect of the pH and of the trypsin on the emulsifying properties of bovine globin, extracted by the acidified acetone method, was studied. The emulsifying capacity (EC, the emulsifying activity index (EAI and the emulsion stability (ES were determined at pH varying from 3.0 to 8.0 and employing hydrolysis times from 5 to 60 min. The highest vaules for EC and ES were obtained at pH 5.0 and 6.0, respectively, corresponding to the range of large protein solubility. On the other hand, the EAI was higher at pH 3.0 and also at pH 7.0 and 8.0, where the protein is insoluble. The tryptic hydrolysis produced an increase in EC, in all pH ranges studied, while for the EAI the same effect was observed only in pH 4.0 and 5.0, and for ES at pH 7.0 after 60 min of hydrolysis.

Spin trapping combined with quantitative mass spectrometry defines free radical redistribution within the oxidized hemoglobin:haptoglobin complex.

Science.gov (United States)

Vallelian, Florence; Garcia-Rubio, Ines; Puglia, Michele; Kahraman, Abdullah; Deuel, Jeremy W; Engelsberger, Wolfgang R; Mason, Ronald P; Buehler, Paul W; Schaer, Dominik J

2015-08-01

Extracellular or free hemoglobin (Hb) accumulates during hemolysis, tissue damage, and inflammation. Heme-triggered oxidative reactions can lead to diverse structural modifications of lipids and proteins, which contribute to the propagation of tissue damage. One important target of Hb׳s peroxidase reactivity is its own globin structure. Amino acid oxidation and crosslinking events destabilize the protein and ultimately cause accumulation of proinflammatory and cytotoxic Hb degradation products. The Hb scavenger haptoglobin (Hp) attenuates oxidation-induced Hb degradation. In this study we show that in the presence of hydrogen peroxide (H2O2), Hb and the Hb:Hp complex share comparable peroxidative reactivity and free radical generation. While oxidation of both free Hb and Hb:Hp complex generates a common tyrosine-based free radical, the spin-trapping reaction with 5,5-dimethyl-1-pyrroline N-oxide (DMPO) yields dissimilar paramagnetic products in Hb and Hb:Hp, suggesting that radicals are differently redistributed within the complex before reacting with the spin trap. With LC-MS(2) mass spectrometry we assigned multiple known and novel DMPO adduct sites. Quantification of these adducts suggested that the Hb:Hp complex formation causes extensive delocalization of accessible free radicals with drastic reduction of the major tryptophan and cysteine modifications in the β-globin chain of the Hb:Hp complex, including decreased βCys93 DMPO adduction. In contrast, the quantitative changes in DMPO adduct formation on Hb:Hp complex formation were less pronounced in the Hb α-globin chain. In contrast to earlier speculations, we found no evidence that free Hb radicals are delocalized to the Hp chain of the complex. The observation that Hb:Hp complex formation alters free radical distribution in Hb may help to better understand the structural basis for Hp as an antioxidant protein. Copyright © 2015 Elsevier Inc. All rights reserved.

Integrating evolutionary and functional tests of adaptive hypotheses: a case study of altitudinal differentiation in hemoglobin function in an Andean Sparrow, Zonotrichia capensis.

Science.gov (United States)

Cheviron, Zachary A; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K; Jones, Jennifer; Carling, Matthew D; Witt, Christopher C; Moriyama, Hideaki; Weber, Roy E; Fago, Angela; Storz, Jay F

2014-11-01

In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the α(A)-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the α(D)-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative α(A)-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: implications for the enzyme mechanism.

Science.gov (United States)

Ogura, Hiroshi; Evans, John P; Peng, Dungeng; Satterlee, James D; Ortiz de Montellano, Paul R; La Mar, Gerd N

2009-04-14

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase 1 (hHO) has been investigated by (1)H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. Two-dimensional (1)H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts that places the lone iron pi-spin in the d(xz) orbital, rather than the d(yz) orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy, and magnetic susceptibilities argues for a low-spin, (d(xy))(2)(d(yz),d(xz))(3), ground state in both azide and cyanide complexes. The switch from singly occupied d(yz) for the cyanide to d(xz) for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide pi-plane in the latter complex, which is approximately 90 degrees in-plane rotated from that of the imidazole pi-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicates that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 --> Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed.

Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)]: Incidental Detection of a New Clinically Silent β Chain Variant During Hb A1c Determination by High Performance Liquid Chromatography.

Science.gov (United States)

Pianezze, Graziano; Toniolo, Manuele; Taddei Masieri, Marina; Dolcini, Bernardetta; Ravani, Anna

2016-06-01

A previously unreported β chain variant, Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)], was incidentally discovered in a woman suffering from diabetes, during glycated hemoglobin (Hb A1c) assay. Its presence was suspected because of a small abnormal peak with a retention time just shorter than that of normal Hb A1c. Standard high performance liquid chromatography (HPLC), capillary zone electrophoresis (CZE) and agarose gel electrophoresis did not allow to separate the variant from Hb A. The reversed phase HPLC of globin chains showed the presence of a heterozygous β-globin variant amounting to approximately 43.5% of the total β chains. Later, this variant was found in five other members of the same family and DNA sequencing analysis confirmed a β-globin gene mutation. The variant is clinically silent in all patients and showed a slight instability with both heat and isopropanol tests. The other three mutations at this locus also affect stability. Hemoglobin (Hb) variants may invalidate the results of Hb A1c analysis and could result in mismanagement of diabetes. A comment alerting the requesting clinician to the presence of the Hb variant must be appended to the Hb A1c result. Additionally, many Hb variants can be chromatographically and/or electrophoretically silent. Therefore, when the clinician suspects a variant Hb, it is not sufficient to get a negative response from an HPLC screening test to rule it out. A dialogue with the pathologist is essential, involving exchange of information and sharing a diagnostic work-up including surveys to assess Hb stability and oxygen affinity, as much as DNA sequencing.

Fish hemoglobins

Directory of Open Access Journals (Sweden)

P.C. de Souza

2007-06-01

Full Text Available Vertebrate hemoglobin, contained in erythrocytes, is a globular protein with a quaternary structure composed of 4 globin chains (2 alpha and 2 beta and a prosthetic group named heme bound to each one. Having myoglobin as an ancestor, hemoglobin acquired the capacity to respond to chemical stimuli that modulate its function according to tissue requirements for oxygen. Fish are generally submitted to spatial and temporal O2 variations and have developed anatomical, physiological and biochemical strategies to adapt to the changing environmental gas availability. Structurally, most fish hemoglobins are tetrameric; however, those from some species such as lamprey and hagfish dissociate, being monomeric when oxygenated and oligomeric when deoxygenated. Fish blood frequently possesses several hemoglobins; the primary origin of this finding lies in the polymorphism that occurs in the globin loci, an aspect that may occasionally confer advantages to its carriers or even be a harmless evolutionary remnant. On the other hand, the functional properties exhibit different behaviors, ranging from a total absence of responses to allosteric regulation to drastic ones, such as the Root effect.

Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

Directory of Open Access Journals (Sweden)

Claudia R. Bonini-Domingos

2003-06-01

Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

Gene therapy for sickle cell disease: An update.

Science.gov (United States)

Demirci, Selami; Uchida, Naoya; Tisdale, John F

2018-05-30

Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.

Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series.

Science.gov (United States)

Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen

2007-08-01

To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.

Implementation of immunochemical faecal occult blood test in general practice

DEFF Research Database (Denmark)

Juul, Jakob Søgaard; Bro, Flemming; Hornung, Nete

2016-01-01

anvendelsen af immunochemical faecal occult blood test (iFOBT) i almen praksis. iFOBT detekterer humant globin i fæces og indikerer gastrointestinal blødning. Studiet udgør en del af et ph.d.-studie, der bidrager med ny viden til at optimere udredningen af patienter med tarmkræft. Der er et stort behov...

Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...

African Journals Online (AJOL)

Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...

The role of OMICS research in understanding phenotype variation in thalassaemia: the THALAMOSS project

Directory of Open Access Journals (Sweden)

Roberto Gambari

2014-12-01

Full Text Available The β-thalassaemias are a group of severe and rare anaemias with monogenic inheritance, a complex systemic phenotype and several treatment-related complications, caused by more than 300 mutations of the β-globin gene. Novel therapeutic protocols, most of which are based on still experimental treatments, show great promise but significant variability of success between patients. These strategies include chemical/ molecular induction of the endogenous β-like g-globin gene or the restoration of clinically relevant β-globin levels by gene therapy. A small number of modifiers with significant impact on disease penetrance, severity and efficacy of treatments are known, but most remain elusive. Improvements of existing treatment regimens and optimization and application of novel treatments will critically depend on the characterization of additional disease modifiers and the stratification of patients for customized treatment regimens. This requires extensive analyses based on “OMICS”, an English-language neologism which refer to different but connected fields in molecular biology and biochemistry, such as genomics, transcriptomics, exomics, proteomics, metabolomics. The major objective of OMICS is a collective characterization of pools of biological molecules (gene sequences, transcripts, proteins and protein domains controlling biological structures, functions and dynamics, including several involved in pathological conditions. One of the most interesting observations of genomics in β-thalassaemias is the association between genomic sequences and high fetal haemoglobin (HbF levels, in consideration of the fact that high HbF levels are usually associated with milder forms of β-thalassaemia. Related to this issue, is the possibility to predict response to different therapeutic protocols on the basis of genomic analyses. For instance, three major loci (Xmn1-HBG2 single nucleotide polymorphism, HBS1L-MYB intergenic region on chromosome 6q, and

Induction of nano pore in Agrobacterial hemoglobin

Directory of Open Access Journals (Sweden)

Mojtaba Tousheh

2014-01-01

Full Text Available Introduction: A variety of oxygen-transport and -binding proteins exist in organisms including bacteria, protozoans, and fungi all have hemoglobin-like proteins. In addition to dealing with transport and sensing of oxygen, they may also deal with NO2, CO2, sulfide compounds, and even O2 scavenging in environments. Also they detoxified chlorinated materials like P450 enzymes and peroxidases and use as a detector of nitrate and hydrogen peroxide. Pore-forming bacterial globins are interested for filtration. Materials and methods: Although there are data for bacterial toxin as a filter, here we used Agrobacterial hem to induce nano pore in the heme structure using point mutation. Results: Investigations showed that three amino acids leucine 76, alanine 83 and histidine 80 are important for pore formation in Agrobacterium hemoglobin. A point mutation on leucine 76 to glycine, histidine 80 to asparagine and alanine 83 to lysine step by step led to create the nano pore 0.7- 0.8 nm in the globin. Discussion and conclusion: These mutations in bacterial hemoglobin increase the stability when mutation is with it’s at pH7. This mutation decreases the aliphatic index however increase the stability index.

Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major.

Science.gov (United States)

Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh

2018-04-01

The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

Characterization of Hb Lepore variants in the UK population.

Science.gov (United States)

Guo, Lina; Kausar, Anika; Old, John M; Henderson, Shirley J; Gallienne, Alice E

2015-01-01

A molecular study of Hb Lepore heterozygotes identified by the UK population screening program has revealed four out of the five known Lepore variants. The region of homologous δ- and β-globin gene sequence was determined in 58 unrelated Hb Lepore heterozygotes referred for confirmation of their carrier status by DNA analysis through the national thalassemia and sickle cell screening program over a period of 10 years. The most common variant found was Hb Lepore-Boston-Washington (Hb LBW, HBD: c.265 C > c.315 + 7 C) observed in 46 carriers (79.0%). Hb Lepore-Hollandia (HBD: c.69 A > c.92 + 16 A) was found in nine cases (16.0%); Hb Lepore-Baltimore (HBD: c.208 G > c.254 C) in two cases (4.0%) and Hb Lepore-ARUP (HBD: c.97 C > c.150 C) in one carrier (2.0%). Analysis of the hematological findings showed no significant differences between the four groups. The wide range of Hb Lepore variants observed in this study confirms the very diverse range of α- and β-globin gene mutations observed in the UK population by previous studies.

Hemoglobin system of Sparus aurata: Changes in fishes farmed under extreme conditions

International Nuclear Information System (INIS)

Campo, Salvatore; Nastasi, Giancarlo; D'Ascola, Angela; Campo, Giuseppe M.; Avenoso, Angela; Traina, Paola; Calatroni, Alberto; Burrascano, Emanuele; Ferlazzo, Alida; Lupidi, Giulio; Gabbianelli, Rosita; Falcioni, Giancarlo

2008-01-01

In order to gain more knowledge on the stress responses of gilhead seabream (Sparus aurata) under extreme conditions, this study investigated the functional properties of the hemoglobin system and globin gene expression under hypoxia and low salinity. The oxygen affinity for the two hemoglobin components present inside the S. aurata erythrocyte was practically identical as was the influence of protons and organic phosphates (Root effect). The quantification of S. aurata hemoglobin fractions performed by HPLC and the data on gene expression of globin chains assayed by PCR indicate that under hypoxia and low salinity there is a change in the ratio between the two different hemoglobin components. The result indicating that the distinct hemoglobins present in S. aurata erythrocyte have almost identical functional properties, does not explain the adaptive response (expression change) following exposure of the animal to hypoxia or low salinity on the basis of their function as oxygen transporter. We hypothesize that other parallel biological functions that the hemoglobin molecule is known to display within the erythrocyte are involved in adaptive molecular mechanisms. The autoxidation-reduction cycle of hemoglobin could be involved in the response to particular living conditions

The radiological manifestations of sickle cell disease

International Nuclear Information System (INIS)

Madani, G.; Papadopoulou, A.M.; Holloway, B.; Robins, A.; Davis, J.; Murray, D.

2007-01-01

Sickle cell disease (SCD) is an inherited abnormality of the ss-globin chain, which causes a spectrum of haemolytic anaemias. Clinical manifestations in SCD include anaemia, jaundice, recurrent vaso-occlusive crises, and infections (particularly by encapsulated bacteria) due to functional asplenia and cerebrovascular accidents. Radiological investigations play a critical role both in the diagnosis and in the primary prevention of the complications of SCD

The radiological manifestations of sickle cell disease

Energy Technology Data Exchange (ETDEWEB)

Madani, G. [Department of Radiology, Royal Free Hospital NHS Trust, London (United Kingdom)]. E-mail: gittamadani@yahoo.com; Papadopoulou, A.M. [Department of Radiology, Royal Free Hospital NHS Trust, London (United Kingdom); Holloway, B. [Department of Radiology, Royal Free Hospital NHS Trust, London (United Kingdom); Robins, A. [Department of Paediatrics, Whittington Hospital NHS Trust, London (United Kingdom); Davis, J. [Department of Radiology, Whittington Hospital NHS Trust, London (United Kingdom); Murray, D. [Department of Radiology, Whittington Hospital NHS Trust, London (United Kingdom)

2007-06-15

Sickle cell disease (SCD) is an inherited abnormality of the ss-globin chain, which causes a spectrum of haemolytic anaemias. Clinical manifestations in SCD include anaemia, jaundice, recurrent vaso-occlusive crises, and infections (particularly by encapsulated bacteria) due to functional asplenia and cerebrovascular accidents. Radiological investigations play a critical role both in the diagnosis and in the primary prevention of the complications of SCD.

Predicting Natural Neuroprotection in Marine Mammals: Environmental and Biological Factors Affecting the Vulnerability to Acoustically Mediated Tissue Trauma in Marine Species

Science.gov (United States)

2013-09-30

comparing both globin deposition profiles from carcasses ranging in age from neonates to adults, as well as the change in mass-specific metabolic demands...to acoustically mediated trauma, 1) molecular and biochemical evaluation of neuroprotection at the tissue level, and 2) whole animal /physiological...Noren, UCSC.) The second component of this study examined the susceptibility of marine mammals to decompression illness at the whole animal

Hydroxylamine-induced oxidation of ferrous carbonylated truncated hemoglobins from Mycobacterium tuberculosis and Campylobacter jejuni is limited by carbon monoxide dissociation.

Science.gov (United States)

Ascenzi, Paolo; Ciaccio, Chiara; Gasperi, Tecla; Pesce, Alessandra; Caporaso, Lucia; Coletta, Massimo

2017-08-01

Hydroxylamine (HA) is an oxidant of ferrous globins and its action has been reported to be inhibited by CO, even though this mechanism has not been clarified. Here, kinetics of the HA-mediated oxidation of ferrous carbonylated Mycobacterium tuberculosis truncated hemoglobin N and O (Mt-trHbN(II)-CO and Mt-trHbO(II)-CO, respectively) and Campylobacter jejuni truncated hemoglobin P (Cj-trHbP(II)-CO), at pH 7.2 and 20.0 °C, are reported. Mixing Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO solution with the HA solution brings about absorption spectral changes reflecting the disappearance of the ferrous carbonylated derivatives with the concomitant formation of the ferric species. HA oxidizes irreversibly Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO with the 1:2 stoichiometry. The dissociation of CO turns out to be the rate-limiting step for the oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO by HA. Values of the second-order rate constant for HA-mediated oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO range between 8.8 × 10 4 and 8.6 × 10 7 M -1 s -1 , reflecting different structural features of the heme distal pocket. This study (1) demonstrates that the inhibitory effect of CO is linked to the dissociation of this ligand, giving a functional basis to previous studies, (2) represents the first comparative investigation of the oxidation of ferrous carbonylated bacterial 2/2 globins belonging to the N, O, and P groups by HA, (3) casts light on the correlation between kinetics of HA-mediated oxidation and carbonylation of globins, and (4) focuses on structural determinants modulating the HA-induced oxidation process.

β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint

Science.gov (United States)

De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael

2017-01-01

Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of

β-THALASSEMIA DISTRIBUTION IN THE OLD WORLD: A HISTORICAL STANDPOINT OF AN ANCIENT DISEASE

Directory of Open Access Journals (Sweden)

Vincenzo De Sanctis

2017-02-01

Full Text Available Abstract Background: Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β -thalassaemia is characterised by the reduced synthesis (β + or absence (β o of the β-globin chains in the HbA molecule, resulting in accumulation of  excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers of the β-thalassemias: there is a high incidence in populations extending from the Mediterranean basin throughout the Middle East, the Indian subcontinent, Southeast Asia, Melanesia and into the Pacific Islands Aim: The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and  in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations.     Results: Mutations involving the ß-globin gene are the most common cause of genetic disorders  in humans. To date, more than 350 β -thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of individual population’s specific mutations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions: Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at its geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity and settlements. The

Efficient assembly of de novo human artificial chromosomes from large genomic loci

Directory of Open Access Journals (Sweden)

Stromberg Gregory

2005-07-01

Full Text Available Abstract Background Human Artificial Chromosomes (HACs are potentially useful vectors for gene transfer studies and for functional annotation of the genome because of their suitability for cloning, manipulating and transferring large segments of the genome. However, development of HACs for the transfer of large genomic loci into mammalian cells has been limited by difficulties in manipulating high-molecular weight DNA, as well as by the low overall frequencies of de novo HAC formation. Indeed, to date, only a small number of large (>100 kb genomic loci have been reported to be successfully packaged into de novo HACs. Results We have developed novel methodologies to enable efficient assembly of HAC vectors containing any genomic locus of interest. We report here the creation of a novel, bimolecular system based on bacterial artificial chromosomes (BACs for the construction of HACs incorporating any defined genomic region. We have utilized this vector system to rapidly design, construct and validate multiple de novo HACs containing large (100–200 kb genomic loci including therapeutically significant genes for human growth hormone (HGH, polycystic kidney disease (PKD1 and ß-globin. We report significant differences in the ability of different genomic loci to support de novo HAC formation, suggesting possible effects of cis-acting genomic elements. Finally, as a proof of principle, we have observed sustained ß-globin gene expression from HACs incorporating the entire 200 kb ß-globin genomic locus for over 90 days in the absence of selection. Conclusion Taken together, these results are significant for the development of HAC vector technology, as they enable high-throughput assembly and functional validation of HACs containing any large genomic locus. We have evaluated the impact of different genomic loci on the frequency of HAC formation and identified segments of genomic DNA that appear to facilitate de novo HAC formation. These genomic loci

Stability and Application of Reactive Nitrogen and Oxygen Species-Induced Hemoglobin Modifications in Dry Blood Spots As Analyzed by Liquid Chromatography Tandem Mass Spectrometry.

Science.gov (United States)

Chen, Hauh-Jyun Candy; Fan, Chih-Huang; Yang, Ya-Fen

2016-12-19

Dried blood spot (DBS) is an emerging microsampling technique for the bioanalysis of small molecules, including fatty acids, metabolites, drugs, and toxicants. DBS offers many advantages as a sample format including easy sample collection and cheap sample shipment. Hemoglobin adducts have been recognized as a suitable biomarker for monitoring chemical exposure. We previously reported that certain modified peptides in hemoglobin derived from reactive chlorine, nitrogen, and oxygen species are associated with factors including smoking, diabetes mellitus, and aging. However, the stability of these oxidation-induced modifications of hemoglobin remains unknown and whether they can be formed artifactually during storage of DBS. To answer these questions, globin extracted from the DBS cards was analyzed, and the stability of the modifications was evaluated. After storage of the DBS cards at 4 °C or room temperature up to 7 weeks, we isolated globin from a quarter of the spot every week. The extents of 11 sites and types of post-translational modifications (PTMs), including nitration and nitrosylation of tyrosine and oxidation of cysteine and methionine residues, in human hemoglobin were measured in the trypsin digest by nanoflow liquid chromatography-nanospray ionization tandem mass spectrometry (nanoLC-NSI/MS/MS) using selected reaction monitoring. The extents of all these PTMs are stable within 14 days when stored on DBS at room temperature and at 4 °C, while those from direct extraction of fresh blood are stable for at least 8 weeks when stored as an aqueous solution at -20 °C. Extraction of globin from a DBS card is of particular importance for hemolytic blood samples. To our knowledge, this is the first report on the stability of oxidative modifications of hemoglobin on DBSs, which are stable for 14 days under ambient conditions (room temperature, in air). Therefore, it is feasible and convenient to analyze these hemoglobin modifications from DBSs in studies

Magnetoresistive sensor for real-time single nucleotide polymorphism genotyping

DEFF Research Database (Denmark)

Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

2014-01-01

We demonstrate a magnetoresistive sensor platform that allows for the real-time detection of point mutations in DNA targets. Specifically, we detect point mutations at two sites in the human beta globin gene. For DNA detection, the present sensor technology has a detection limit of about 160p...... of magnetic beads, which enables real-time quantification of the specific binding of magnetic beads to the sensor surface under varying experimental conditions....

Gene Therapy in Thalassemia and Hemoglobinopathies

OpenAIRE

Breda, Laura; Gambari, Roberto; Rivella, Stefano

2009-01-01

Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

Science.gov (United States)

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

Heme and erythropoieis: more than a structural role.

Science.gov (United States)

Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela

2014-06-01

Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.

Iron deficiency anaemia: with the conclusion of a need for iron reader

Science.gov (United States)

Lim, Wai Feng; Yap, Boon Kar; Lai, Mei I.; Talik, Noorazrina; Nasser, Ammar Ahmed; Al-Haiqi, Ahmed Mubarak Ahmed; Sankar Krishnan, Prajindra

2017-10-01

In our bloodstream, there are plenty of red blood cells (RBC), which function as an important oxygen carrier in our bodies. Each RBC consists of millions of haemoglobin (Hb), which is made up from globin and iron. If any deficiency/malfunction of any globin, it will lead to anaemia as indicated in low Hb level while iron deficiency anaemia (IDA) is anaemic due to the lacking of iron as indicated in low Hb and ferritin levels. IDA affects almost two billion people globally while anaemia without iron deficiency, such as thalassaemia, affects almost 4.5% in Malaysian population. These anaemic conditions have similar clinical symptoms like fatigue, dizziness, in which disturb their cognitive development and productivity in workplace. In areas without proper medical access, many anaemic individuals were misdiagnosed and treated with iron tablets because they were thought to have iron deficiency anaemia due to low Hb content. But, excess iron is toxic to the body. Misdiagnosis can be avoided by iron status assessment. We hereby review the currently available iron status parameters in laboratory and field study with the conclusion of demonstrating the importance of a need for iron reader, in the effort to reduce the prevalence of IDA globally.

Spectroscopic characterization of a truncated hemoglobin from the nitrogen-fixing bacterium Herbaspirillum seropedicae.

Science.gov (United States)

Razzera, Guilherme; Vernal, Javier; Baruh, Debora; Serpa, Viviane I; Tavares, Carolina; Lara, Flávio; Souza, Emanuel M; Pedrosa, Fábio O; Almeida, Fábio C L; Terenzi, Hernán; Valente, Ana Paula

2008-09-01

The Herbaspirillum seropedicae genome sequence encodes a truncated hemoglobin typical of group II (Hs-trHb1) members of this family. We show that His-tagged recombinant Hs-trHb1 is monomeric in solution, and its optical spectrum resembles those of previously reported globins. NMR analysis allowed us to assign heme substituents. All data suggest that Hs-trHb1 undergoes a transition from an aquomet form in the ferric state to a hexacoordinate low-spin form in the ferrous state. The close positions of Ser-E7, Lys-E10, Tyr-B10, and His-CD1 in the distal pocket place them as candidates for heme coordination and ligand regulation. Peroxide degradation kinetics suggests an easy access to the heme pocket, as the protein offered no protection against peroxide degradation when compared with free heme. The high solvent exposure of the heme may be due to the presence of a flexible loop in the access pocket, as suggested by a structural model obtained by using homologous globins as templates. The truncated hemoglobin described here has unique features among truncated hemoglobins and may function in the facilitation of O(2) transfer and scavenging, playing an important role in the nitrogen-fixation mechanism.

Diagnostic utility of isoelectric focusing and high performance liquid chromatography in neonatal cord blood screening for thalassemia and non-sickling hemoglobinopathies.

Science.gov (United States)

Uaprasert, Noppacharn; Settapiboon, Rung; Amornsiriwat, Supaporn; Sarnthammakul, Patsita; Thanapat, Tassanee; Rojnuckarin, Ponlapat; Sutcharitchan, Pranee

2014-01-01

Thalassemia syndromes are highly prevalent in Southeast Asia. In Thailand, high performance liquid chromatography (HPLC) is the most common technique routinely performed in diagnosis of thalassemia and hemoglobinopathies, while isoelectric focusing (IEF) is rarely employed. We compared the diagnostic utility of IEF and HPLC in neonatal screening for thalassemia and non-sickling hemoglobinopathies. Two-hundred and forty-one cord blood samples were analyzed using IEF and HPLC, β-thalassemia short program. The results were correlated with red cell indices and molecular analyses. Hemoglobin (Hb) Bart's was quantified only on IEF. Of 241 newborns, IEF and HPLC yielded 85.4% and 76.4% sensitivity to identify α-thalassemia syndrome, respectively. HbBart's≥2% yielded 100% sensitivity to identify 2 α-globin gene deletions and/or mutations, while MCV≤95fl and MCH≤30pg yielded 100% sensitivity to identify 2 α-globin gene deletions. DNA analysis revealed HbE mutation in all 61 subjects with HbA2>1% on both IEF and HPLC. IEF is an effective method in neonatal screening for thalassemia and non-sickling hemoglobinopathies. The HbBart's level, MCV and MCH are helpful for identifying α-thalassemia. The presence of HbA2 higher than 1% in cord blood indicates HbE carriers in Southeast Asian newborns. © 2013.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

Science.gov (United States)

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

GENETIC FACTORS INFLUENCING HEMOGLOBIN F LEVEL IN β-THALASSEMIA/HB E DISEASE.

Science.gov (United States)

Ruangrai, Waraporn; Jindadamrongwech, Sumalee

2016-01-01

Genetic factors influencing Hb F content in adult red blood cells include β-thalassemia genotypes, co-inheritance of α-thalassemia traits and single nucleotide polymorphisms (SNPs). Genotyping of α- and β-thalassemia and five SNPs in β-globin gene cluster previously identified in genome-wide association studies as being markers of elevated Hb F in β-thalassemia were performed in 81 subjects diagnosed with β-thalassemia/Hb E. Hb F levels are higher (0.9-7.1 g/dl) in subjects (n = 57) with the severe compared to mild β-thalassemia (0.8-2.5 g/ dl) (n = 4) genotypes, and are similarly low (0.7-3.5 g/dl) in those (n = 15) with α-thalassemia co-inheritance. Hb F levels in non-thalassemia controls (n = 150) range from 0 to 0.15 g/dl. The presence of homozygous minor alleles of the 5 SNPs are significant indicators of β-thalassemia/Hb E individuals with high Hb F (> 4 g/dl), independent of their thalassemia genotypes. Given that re-activation of γ-globin genes leads to amelioration of β-thalassemia severity, understanding how genetic factors up-regulate Hb F production may lead to possible therapeutic interventions, genetically or pharmacologically, of this debilitating disease in the not too distant future.

Fish hemoglobins

OpenAIRE

Souza,P.C. de; Bonilla-Rodriguez,G.O.

2007-01-01

Vertebrate hemoglobin, contained in erythrocytes, is a globular protein with a quaternary structure composed of 4 globin chains (2 alpha and 2 beta) and a prosthetic group named heme bound to each one. Having myoglobin as an ancestor, hemoglobin acquired the capacity to respond to chemical stimuli that modulate its function according to tissue requirements for oxygen. Fish are generally submitted to spatial and temporal O2 variations and have developed anatomical, physiological and biochemica...

Future prospects for treatment of hemoglobinopathies.

OpenAIRE

Stamatoyannopoulos, J A

1992-01-01

Strategies for the treatment of sickle cell anemia and beta-thalassemia are founded on the knowledge that these disorders result from structural or functional defects in an adult gene for which an intact fetal counterpart exists. During the past decade, several pharmacologic agents have been investigated for their potential to ameliorate sickle cell anemia and beta-thalassemia by increasing the synthesis of fetal hemoglobin in adults. Progress in understanding globin gene regulation is now be...

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Ilham Saleh Abuljadayel

2006-01-01

Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

Nitrite-reductase and peroxynitrite isomerization activities of Methanosarcina acetivorans protoglobin.

Directory of Open Access Journals (Sweden)

Paolo Ascenzi

Full Text Available Within the globin superfamily, protoglobins (Pgb belong phylogenetically to the same cluster of two-domain globin-coupled sensors and single-domain sensor globins. Multiple functional roles have been postulated for Methanosarcina acetivorans Pgb (Ma-Pgb, since the detoxification of reactive nitrogen and oxygen species might co-exist with enzymatic activity(ies to facilitate the conversion of CO to methane. Here, the nitrite-reductase and peroxynitrite isomerization activities of the CysE20Ser mutant of Ma-Pgb (Ma-Pgb* are reported and analyzed in parallel with those of related heme-proteins. Kinetics of nitrite-reductase activity of ferrous Ma-Pgb* (Ma-Pgb*-Fe(II is biphasic and values of the second-order rate constant for the reduction of NO2- to NO and the concomitant formation of nitrosylated Ma-Pgb*-Fe(II (Ma-Pgb*-Fe(II-NO are k(app1= 9.6 ± 0.2 M(-1 s(-1 and k(app2 = 1.2 ± 0.1 M(-1 s(-1 (at pH 7.4 and 20 °C. The k(app1 and k(app2 values increase by about one order of magnitude for each pH unit decrease, between pH 8.3 and 6.2, indicating that the reaction requires one proton. On the other hand, kinetics of peroxynitrite isomerization catalyzed by ferric Ma-Pgb* (Ma-Pgb*-Fe(III is monophasic and values of the second order rate constant for peroxynitrite isomerization by Ma-Pgb*-Fe(III and of the first order rate constant for the spontaneous conversion of peroxynitrite to nitrate are h(app = 3.8 × 10(4 M(-1 s(-1 and h0 = 2.8 × 10(-1 s(-1 (at pH 7.4 and 20 °C. The pH-dependence of hon and h0 values reflects the acid-base equilibrium of peroxynitrite (pKa = 6.7 and 6.9, respectively; at 20 °C, indicating that HOONO is the species that reacts preferentially with the heme-Fe(III atom. These results highlight the potential role of Pgbs in the biosynthesis and scavenging of reactive nitrogen and oxygen species.

Best practices for transfusion for patients with sickle cell disease

OpenAIRE

Ted Wun; Kathryn Hassell

2010-01-01

The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with S...

Influence of Asymptomatic Pneumonia on the Response to Hemorrhage and Resuscitation in Swine

Science.gov (United States)

2010-01-01

Glycopyrrolate, IM, to control salivation , and sedated with Telezol (3 mg/kg), IM, followed by anesthesia with isoflurane (2-3%) in 50% O2 using an Ohmeda...arterial and venous blood gases, pH and base excess (AVL Omni 9 Analyzer, Roche Diagnostics, Indianapolis, IN); 2) hematocrit (Hct), hemo- globin (Hb...following hemorrhage, with a decrease in HCO3, base excess and pH and an increase in lactate; however, a significant difference in these parameters was

Molecular basis for dominantly inherited inclusion body β-thalassemia

International Nuclear Information System (INIS)

Thein, S.L.; Hesketh, C.; Wood, W.G.; Clegg, J.B.; Old, J.M.; Weatherall, D.J.; Taylor, P.; Temperley, I.J.; Hutchinson, R.M.

1990-01-01

Analysis of the molecular basis of dominantly inherited β-thalassemia in four families has revealed different mutations involving exon 3 of the β-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of β-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

Science.gov (United States)

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-07-09

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

Feasibility of mapping low-multiplicity genes by in situ hybridization. [/sup 125/I and tritium tracers

Energy Technology Data Exchange (ETDEWEB)

Atwood, K C; Henderson, A S; Kacian, D; Eicher, E M

1975-01-01

The assignment of human hemoglobin loci to 2q and Bq was followed by objections based on the low specific activity of their /sup 3/H-mRNA, estimated as somewhere between 100 and 1000 dpm/..mu..g. With that preparation, the time required for one disintegration per molecule is between 80,000 and 8000 years. The consideration that globin loci may contain as many as 10 copies does not help. In view of these incontestably valid objections, it is instructive to compare the foregoing experiment with another in which the chromosomes were hybridized with cDNA copied from human reticulocyte mRNA by means of the reverse transcriptase from avian myeloblastosis virus. Our preparation had a specific activity of 1.4 x 10/sup 8/ dpm/..mu..g, requiring less than a month per disintegration per molecule. Despite the rather more favorable anticipated exposure time, successful localization was by no means expected. The use of cDNA precluded the enzymatic removal of background; the concentration of DNA applied to the slides, 0.03 ..mu..g/ml, was unfavorable for hybridization; and the copying reaction, primed with oligo-dT, probably attached stretches up to T/sub 20/ to the structural sequence, with the possibility that these might hybridize to uninteresting chromosomal regions. Results indicate that the original assignments of the human globin loci are correct.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

Science.gov (United States)

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

A Comprehensive, Ethnically Diverse Library of Sickle Cell Disease-Specific Induced Pluripotent Stem Cells

Directory of Open Access Journals (Sweden)

Seonmi Park

2017-04-01

Full Text Available Summary: Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes, and fetal hemoglobin (HbF levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS mutation. : In this resource article, Mostoslavsky, Murphy, and colleagues of the NextGen consortium describe a diverse, comprehensive, and characterized library of sickle cell disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes and fetal hemoglobin (HbF levels. This bank is readily available and accessible to all investigators. Keywords: induced pluripotent stem cells, iPSCs, sickle cell disease, disease modeling, directed differentiation, gene correction

Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

Science.gov (United States)

Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

2011-01-01

Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

Energy Technology Data Exchange (ETDEWEB)

Serrano, Vesna de; D’Antonio, Jennifer; Franzen, Stefan; Ghiladi, Reza A., E-mail: reza-ghiladi@ncsu.edu [North Carolina State University (United States)

2010-05-01

The crystal structure of dehaloperoxidase (DHP) isoenzyme B from the terebellid polychaete A. ornata, which exhibits both hemoglobin and peroxidase functions, has been determined at 1.58 Å resolution. As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHP B refined to 1.58 Å resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distal and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure–function relationships.

Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh.

Science.gov (United States)

Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia

2015-01-01

Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.

Effect of 2-Mercaptopropionyl-Glycine on the hemoglobin of rats exposed to low doses of fast neutrons

International Nuclear Information System (INIS)

Selim, N.S.; Ashry, H.A.

2001-01-01

Adult male rats weighing 150± 10 gm, were divided into six groups: one group was kept untreated as normal control, one group received single administration of 20 mg/kg body weight 2-mercapto-propionyl glycine, commercially called thiola, the remaining four groups were injected with thiola and exposed to different doses of fast neutrons (4.32, 36, 70 and 140 mSv) 30 minutes after injection. The analysis of the hemoglobin molecule was performed 24 hours after irradiation. The UV-visible spectrum of the hemoglobin was recorded from 200 to nm using CECIL-3041 UV-Vis spectrophotometer. The following parameters were calculated for the evaluation of the hemoglobin spectrum: 1- The maximum absorbance at 271, 340, 410, 540 and 574 nm, 2- The full width at half maximum of each peak (FWHM), 3-evaluation of the ratio between different peaks as follows: a) A 41 0/A 271 (iron to globin ratio) c) A 574 / A 271 : (heme to globin ratio), d)- A 574 /A 540 (spin state of the iron) and 4- recording the appearance of new peaks or the disappearance of normally occurring peaks. The injection of thiola, only, was found to affect the spatial distribution of the hemoglobin molecule. Also, it was shown to minimize the damaging effects of fast neutrons on the hemoglobin and decreased environmental perturbations

Neuroglobin over expressing mice

DEFF Research Database (Denmark)

Raida, Zindy; Hundahl, Christian Ansgar; Nyengaard, Jens R

2013-01-01

BACKGROUND: Stroke is a major cause of death and severe disability, but effective treatments are limited. Neuroglobin, a neuronal heme-globin, has been advocated as a novel pharmacological target in combating stroke and neurodegenerative disorders based on cytoprotective properties. Using...... contribution from compensatory mechanisms to the phenotype following a genetic perturbation. We also stress, that care should be taken when comparing results where different mouse strains and colonies have been used due to large genetic background contribution to the observed phenotype....

Genetic determinants and stroke in children with sickle cell disease

Directory of Open Access Journals (Sweden)

Daniela O.W. Rodrigues

2016-11-01

Conclusion: There is a high incidence of stroke in male children and in children with SCA. Coexistence with α‐thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non‐reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD.

Why are there two kinds of chain in tetrameric hemoglobins

International Nuclear Information System (INIS)

Ferreira, R.; Jacchieri, S.G.

1981-01-01

The homeotropic allosteric interactions responsible for the sigmoidal oxygen saturation curves of α 2 β 2 hemoglobins are shown to be larger than those of hypothetical hemoglobins obeying identical curves and built from equivalent chains, γ 4 . It is also shown that this ensures for the α 2 β 2 species a more dependable cooperativity, through a biologically significative temperature range. On the basis of these findings it is argued that the existence of two different globin chains is advantageous in an evolutionary sense. (Author) [pt

Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

Science.gov (United States)

Jukes, T. H.; Kimura, M.

1984-01-01

The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Science.gov (United States)

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

Characterizing a cohort of α-thalassemia couples collected during screening for hemoglobinopathies: 14 years of an Iranian experience.

Science.gov (United States)

Hafezi-Nejad, Nima; Khosravi, Mohsen; Bayat, Nooshin; Kariminejad, Ariana; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Najmabadi, Hossein

2014-01-01

Our study aimed to determine the number of couples with normal hemoglobin (Hb) electrophoresis and low-borderline hematological values, which may come up with a clinically critical status in their offspring. The number of couples at risk for severe α-thalassemia (α-thal) needed to be estimated before recommending genetic counseling and prenatal diagnosis (PND). During the past 14 years, from at least 7000 referrals, 754 couples were investigated for α-thal by direct mutation detection methods followed by reverse strip assay and α-globin gene sequencing for inconclusive cases. Detection of silent β-thalassemia (β-thal) mutations was done in suspected cases by complete β-globin gene sequencing. We were able to provide a molecular diagnosis in 87.3% (658/754) of couples. A total of 9.1% (60/658) may have a clinically significant hemoglobinopathy in their offspring. Significant conditions included hydrops fetalis (20.0%; 12/60), certain Hb H (β4) genotypes (78.3%; 47/60) and β-thal intermedia (β-TI) (1.7%; 1/60). The diagnostic flowchart for couples with microcytic hypochromic anemia in countries with a high prevalence of hemoglobinopathies should include α and β gene sequencing. As our results indicate, every nine out of 100 of these couples will face significant hemoglobinopathies and every two out of 100 can carry Hb Bart's (γ4) hydrops fetalis in their pregnancies. For such cases, PND should be utilized to allow the carrier couples to decide whether or not to abort the fetus.

Influence of heme environment structure on dioxygen affinity for the dual function Amphitrite ornata hemoglobin/dehaloperoxidase. Insights into the evolutional structure-function adaptations

Energy Technology Data Exchange (ETDEWEB)

Sun, Shengfang; Sono, Masanori; Wang, Chunxue; Du, Jing; Lebioda, Lukasz; Dawson, John H. [SC

2014-05-15

Sea worm, Amphitrite ornata, has evolved its globin (an O₂ carrier) also to serves as a dehaloperoxidase (DHP) to detoxify haloaromatic pollutants generated by competing species. A previous mutagenesis study by our groups on both DHP and sperm whale myoglobin (SW Mb) revealed some structural factors that influence the dehaloperoxidase activities (significantly lower for Mb) of both proteins. Using an isocyanide/O₂ partition constant measurement method in this study, we have examined the effects of these structural factors on the O₂ equilibrium constants (K_O2) of DHP, SW Mb, and their mutants. A clear trend of decreasing O₂ affinity and increasing catalytic activity along with the increase in the distal His N^ε–heme iron distance is observed. An H93K/T95H Mb double mutant mimicking the DHP proximal His positioning exhibited markedly enhanced O₂ affinity, confirming the essential effect of proximal His rotation on the globin function of DHP. For DHP, the L100F, T56G and M86E variants showed the effects of distal volume, distal His flexibility and proximal electronic push, respectively, on the O₂ affinity. This study provides insights into how DHP has evolved its heme environment to gain significantly enhanced peroxidase capability without compromising its primary function as an O₂ carrier.

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

Science.gov (United States)

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

Factor IX gene haplotypes in Amerindians.

Science.gov (United States)

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Hematological and Molecular Characterization of a Novel Hb A2 Variant with Homozygous α-Thalassemia-2 in a Southern Thai Individual.

Science.gov (United States)

Nuinoon, Manit; Jeenduang, Nutjaree; Kesornsit, Aumpika; Horpet, Dararat; Plyduang, Thunyaluk

2017-05-01

We report here the hematological and molecular features of a novel δ-globin chain variant found in a Southern Thai woman. Her complete blood count was as follows: red blood cell (RBC) count 5.90 × 10 12 /L, hemoglobin concentration (Hb) 12.6 g/dL, packed cell volume (PCV) 0.41 L/L, mean corpuscular volume (MCV) 69.5 fL, mean corpuscular Hb (MCH) 21.4 pg, mean corpuscular Hb concentration (MCHC) 30.7 g/dL and RBC distribution width (RDW) 13.1%. The blood smear demonstrated microcytic hypochromic RBCs suggestive of thalassemia trait. Hemoglobin analysis identified Hb A 2  + Hb A 2 -Kiriwong (2.4%) and Hb F (0.1%) on high performance liquid chromatography (HPLC). To characterize the α-thalassemia (α-thal) genotype, common α-thal-1 and α-thal-2 alleles were characterized by multiplex gap-polymerase chain reaction (gap-PCR). The results revealed homozygous α-thal-2 (-α 3.7 /-α 3.7 ) in this case. DNA sequencing showed the presence of a novel δ-globin gene mutation [δ77(EF1)His→Arg; HBD: c.233A>G] that we named Hb A 2 -Kiriwong for the village from where the proband lived. In summary, the presence of microcytic hypochromic RBCs in this case was likely the result of the homozygous -α 3.7 (rightward) deletion and was not affected by this Hb A 2 variant.

Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen.

Science.gov (United States)

Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino

2016-08-01

A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

1 kb of the lactase-phlorizin hydrolase promoter directs post-weaning decline and small intestinal-specific expression in transgenic mice

DEFF Research Database (Denmark)

Troelsen, J T; Mehlum, A; Spodsberg, N

1994-01-01

Adult-type hypolactasia is a genetic condition making approximately one half of the human population intolerant to milk because of abdominal symptoms. The cause is a post-weaning down-regulation of the intestinal-specific enzyme lactase-phlorizin hydrolase (LPH) reducing the intestinal capacity...... to hydrolyze lactose. We here demonstrate that the stretch -17 to -994 in the pig LPH-promoter carries cis-elements which direct a small intestinal-specific expression and a post-weaning decline of a linked rabbit beta-globin gene. These data demonstrate that the post-weaning decline of LPH is mainly due...

Use of a multi-thermal washer for DNA microarrays simplifies probe design and gives robust genotyping assays

DEFF Research Database (Denmark)

Petersen, J.; Poulsen, Lena; Petronis, S.

2008-01-01

is called a multi-thermal array washer (MTAW), and it has eight individually controlled heating zones, each of which corresponds to the location of a subarray on a slide. Allele-specific oligonucleotide probes for nine mutations in the beta-globin gene were spotted in eight identical subarrays at positions......DNA microarrays are generally operated at a single condition, which severely limits the freedom of designing probes for allele-specific hybridization assays. Here, we demonstrate a fluidic device for multi-stringency posthybridization washing of microarrays on microscope slides. This device...

Detection of the Unstable Hb Köln (HBB: c.295G>A) by a Capillary Electrophoresis Method.

Science.gov (United States)

Li, You-Qiong; Ye, Li-Hua; Mo, Yun

2016-11-01

Hb Köln (HBB: c.295G>A) is an unstable β-globin gene variant with a GTG>ATG substitution at codon 98. This variant is quite frequent in Europe and the USA but rare in China. It can easily be misdiagnosed as Hb Constant Spring (Hb CS; HBA2: c.427T>C) by high performance liquid chromatography (HPLC), but detection and quantification of both Hb Köln and degraded Hb Köln by capillary electrophoresis (CE) are possible. Thus, we concluded that CE was the preferred method for Hb Köln detection.

Hb Matera (HBB: c.167 T > A): A Second Case Detected in a Pregnant Chinese Woman by the Capillary Electrophoresis Method.

Science.gov (United States)

Li, You-qiong; Ye, Li-Hua; Mo, Yun

2016-01-01

Hb Matera (HBB: c.167 T > A) is an unstable β-globin gene variant with an ATG > AAG substitution at codon 55. Its coelution with Hb A2 on high performance liquid chromatography (HPLC) makes it difficult to discriminate between Hb Matera and Hb E (HBB: c.79 G > A) that also coelutes with Hb A2 in this method. However, we found that capillary electrophoresis (CE) was able to detect Hb Matera and discriminate it from Hb E, based on the quantification of the peaks and on hematological parameters.

Coinheritance of High Oxygen Affinity Hb Helsinki [HBB: c.248A>T; β82(EF6)Lys→Met] with Hb H Disease.

Science.gov (United States)

Lee, Shir-Ying; Goh, Jia-Hui; Tan, Karen M L; Liu, Te-Chih

2017-05-01

Hb Helsinki [HBB: c.248A>T; β82(EF6)Lys→Met] is a high oxygen affinity hemoglobin (Hb) causing polycythemia, whereas Hb H (β4) disease causes mild to severe chronic hemolytic anemia. The clinical characteristics, gel electrophoresis, capillary electrophoresis (CE) and molecular genotyping of a case of Hb Helsinki coinherited with Hb H disease in an ethnic Malay is described, illustrating the interaction between the β-globin variant and coinheritance of three α gene deletions. The proband was asymptomatic, exhibited microcytosis and a normal with Hb value.

Variations in the β-Globin genes of Sickle Cell Anaemia Patients in ...

African Journals Online (AJOL)

2016-07-28

Jul 28, 2016 ... Context: Sickle Cell Anaemia (SCA) is a genetic disorder with a life-long disability .... also cause diagnostic difficulties with routine diagnostic facilities.[10] ..... doi: 10.1038/npg.els.0005005. Available at www.els.net. [Last.

Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

African Journals Online (AJOL)

Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

Hemoglobin Q-Iran detected in family members from Northern Iran: a case report

Directory of Open Access Journals (Sweden)

Khorshidi Mohammad

2012-02-01

Full Text Available Abstract Introduction Hemoglobin Q-Iran (α75Asp→His is an important member of the hemoglobin Q family, molecularly characterized by the replacement of aspartic acid by histidine. The first report of hemoglobin Q-Iran and the nomenclature of this hemoglobinopathy dates back to 1970. Iran is known as a country with a high prevalence of α- and β-thalassemia and different types of hemoglobinopathy. Many of these variants are yet to be identified as the practice of molecular laboratory techniques is limited in this part of the world. Applying such molecular methods, we report the first hemoglobin Q-Iran cases in Northern Iran. Case presentation An unusual band was detected in an isoelectric focusing test and cellulose acetate electrophoresis of a sample from a 22-year-old Iranian man from Mazandaran Province. Capillary zone electrophoresis analysis identified this band as hemoglobin Q. A similar band was also detected in his mother's electrophoresis (38 years, Iranian ethnicity. The cases underwent molecular investigation and the presence of a hemoglobin Q-Iran mutation was confirmed by the amplification refractory mutation system polymerase chain reaction method. Direct conventional sequencing revealed a single guanine to cytosine missense mutation (c.226G > C; GAC >CAC at codon 75 in the α-globin gene in both cases. Conclusion The wide spectrum and high frequency of nondeletional α-globin mutations in Mazandaran Province is remarkable and seem to differ considerably from what has been found in Mediterranean populations. This short communication reports the first cases of patients with hemoglobin Q found in that region.

Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated.

Directory of Open Access Journals (Sweden)

Sehjeong Kim

Full Text Available Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE, various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term.

Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

Science.gov (United States)

Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

2013-06-01

Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate β-Thalassemia Patients.

Science.gov (United States)

Motovali-Bashi, Majid; Ghasemi, Tayyebeh

2015-01-01

β-thalassemia is the most common monogenic disorder in human. The (C-->T) polymorphism at -158 upstream region of the γG-globin gene and pharmacological factors such as hydroxyurea have been reported to influence γ-globin gene expression and the severity of clinical symptoms of β-thalassemia. In the present study, 51 β-thalassemia intermediate patients were studied. Xmn1γG polymorphism genotype was determined using Tetra-Primer ARMS-PCR technique. Hemoglobin (Hb) and fetal hemoglobin (HbF) levels were determined by gel electrophoresis. Of 51 patients, 35 (68.6%) patients were heterozygous (CT) and 16 (31.4%) patients were homozygous (CC). Of 30 patients under treatment by hydroxyurea, 20 (66.7%) patients were heterozygous (CT) and 10 (33.3%) patients were homozygous (CC). Our results demonstrated that in the heterozygous (CT) genotype, the Hb (9.58 ± 1.25 gm/dl) and HbF (89.30 ± 21.87) levels were significantly higher in comparison with homozygous (CC) genotype (7.94 ± 1.34 gm/dl and 70.32 ± 40.56, respectively). Furthermore, we observed that after drug usage, the Hb and HbF levels in patients with heterozygous (CT) genotype (0.7 ± 1.26 gm/dl and 5.95 ± 14.8, respectively) raised more in comparison with homozygous (CC) genotype (0.26 ± 1.43 gm/dl and 0.8 ± 1.31, respectively). Hb and HbF levels in the patients carrying T allele are increased significantly, and they also response to hydroxyurea treatment.

Adipocytokine concentrations in children with different types of beta-thalassemia.

Science.gov (United States)

Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

2014-06-01

Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

Clinical and molecular characteristics of sickle cell anemia in the northeast of Brazil

Directory of Open Access Journals (Sweden)

Elisângela Vitória Adorno

2008-01-01

Full Text Available Beta S-globin gene (βS-globin haplotypes, markers for severe sickle cell anemia (SCA, and the alpha-thalassemia 2 gene 3.7 kb deletion (-α2(3.7 kb thal along with demographic and clinical data were investigated in SCA outpatients (n = 125, 63 female and 62 male in the Brazilian state of Bahia, which has a high prevalence SCA. PCR-RFLP showed that the Central African Republic/Benin (CAR/BEN, 51.2% haplotype was most frequent, followed by the Benin/Benin (Ben/Ben, 28.8%. At least one CAR haplotype was present in every outpatient with a history of cerebrovascular accident. The Cameroon (Cam, Senegal (Sen and Arab-India haplotypes occurred in small numbers, as did atypical haplotypes. Fetal hemoglobin (HbF, % was unevenly distributed. Compared to those > 18 y, those aged < 18 y had had fewer erythrocyte transfusions and high HbF levels (12.3% ± 7.01 to 7.9% ± 4.36 but a higher frequency of spleen sequestration and pneumonia. Compared with normal α - genes carriers values, the outpatients with -α2(3.7 kb thal (determined by PCR analysis had significantly higher mean hemoglobin concentration (Hb (8.3 ± 1.34 g/dL, p = 0.018 and packed cell volume (PCV = 27.1% ± 4.26, p = 0.019 but low mean corpuscular volume (MCV = 86.1 fL = 10-15 L ± 9.56, p = 0.0004 and mean corpuscular hemoglobin (MCH = 26.6% ± 4.60, p = 0.039.

Genetic determinants and stroke in children with sickle cell disease,

Directory of Open Access Journals (Sweden)

Daniela O.W. Rodrigues

Full Text Available Abstract Objective: To verify genetic determinants associated with stroke in children with sickle cell disease (SCD. Methods: Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal, haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA, using the chi-squared test in the program SPSS® version 14.0. Results: Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p = 0.001 and males (24.1% vs. 9.6%; p = 0.044. The presence of α-thal (p = 0.196, the CAR haplotype (p = 0.543, and socioeconomic factors were not statistically significant in association with the occurrence of stroke. Conclusion: There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD.

Genotypes of human papilloma virus in Sudanese women with cervical pathology

Directory of Open Access Journals (Sweden)

Tobi Khater

2010-12-01

Full Text Available Abstract Background Knowledge of the distribution of human papillomavirus (HPV genotypes among women with cervical lesion and in invasive cervical cancer is crucial to guide the introduction of prophylactic vaccines. There is no published data concerning HPV and cervical abnormalities in Sudan. This study aimed to define the prevalence of HPV and its subtypes in the cervical smears of women presenting with gynecological complains at Omdurman Military Hospital, Sudan. During the period between March 2003 and April 2004, 135 cervical smears collected from these women, were screened using cytological techniques, and analysed by PCR for (beta-globin and HPV DNA using gel electrophoresis and ELISA. Results Of these 135 smears, there were 94 (69.3% negative, 22 (16.3% positive for inflammation, 12(8.9 mild dyskaryosis, 5 (3.7 moderate dyskaryosis and 2 (1.8 severe dyskaryosis. There were 60.7% ß. globin positive samples for HPV indicating DNA integrity. HPV DNA was identified in three samples (2.2% by gel electrophoresis and. was positive in four samples (2.9% as single and multiple infections by PCR-ELISA. The high risk HPV types 16 and 58 were identified in one sample as a mixed infection. The low risk HPV types 40 and 42 were also found as a mixed infection in another patient. HPV types 58 and 42 were identified in the other two patients. Conclusion HPV type distribution in Sudan appears to differ from that in other countries. The HPV genotypes identified were not associated with cancer.

[Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

Science.gov (United States)

Mazur, G; Braunitzer, G

1984-09-01

The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

Electron microscope studies

International Nuclear Information System (INIS)

Crewe, A.V.; Kapp, O.H.

1991-01-01

This year our laboratory has continued to make progress in the design of electron-optical systems, in the study of structure-function relationships of large multi-subunit proteins, in the development of new image processing software and in achieving a workable sub-angstrom STEM. We present an algebraic approach to the symmetrical Einzel (unipotential) lens wherein we simplify the analysis by specifying a field shape that meets some preferred set of boundary or other conditions and then calculate the fields. In a second study we generalize this approach to study of three element electrostatic lenses of which the symmetrical Einzel lens is a particular form. The purpose is to develop a method for assisting in the design of a lens for a particular purpose. In our biological work we study a stable and functional dodecameric complex of globin chains from the hemoglobin of Lumbricus terrestris. This is a complex lacking the ''linker'' subunit first imaged in this lab and required for maintenance of the native structure. In addition, we do a complete work-up on the hemoglobin of the marine polychaete Eudistylia vancouverii demonstrating the presence of a hierarchy of globin complexes. We demonstrate stable field-emission in the sub-angstrom STEM and the preliminary alignment of the beam. We continue our exploration of a algorithms for alignment of sequences of protein and DNA. Our computer facilities now include four second generation RISC workstations and we continue to take increasing advantage of the floating-point and graphical performance of these devices

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

Science.gov (United States)

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

Life style and biochemical adaptation in Antarctic fishes

Science.gov (United States)

di Prisco, Guido

2000-12-01

Respiration and metabolism are under investigation in Antarctic fish, in an effort to understand the interplay between ecology and biochemical and physiological processes. Fish of the dominant suborder Notothenioidei are red-blooded, except Channichthyidae (the most phyletically derived family), whose genomes retain transcriptionally inactive DNA sequences closely related to the α-globin gene of red-blooded notothenioids and have lost the β-globin locus. Our structure/function studies on 38 of the 80 red-blooded species are aimed at correlating sequence, multiplicity and oxygen binding with ecological constraints and at obtaining phylogenetic information on evolution. For comparative purposes, this work has been extended to non-Antarctic notothenioids. All sluggish bottom dwellers have a single major hemoglobin (Hb) and often a minor, functionally similar one. Three species of the family Nototheniidae have different life styles. They have uniquely specialised oxygen-transport systems, adjusted to the mode of life of each species. Artedidraconidae have a single Hb, lacking oxygen-binding cooperativity, similar to the ancestral hemoproteins of primitive organisms. The amino acid sequences are currently used in the molecular modelling approach. The study of several enzymes with key roles in metabolism (e.g. glucose-6-phosphate dehydrogenase, L-glutamate dehydrogenase, phosphorylase b, carbonic anhydrase) indicate that some aspects of the molecular structure (e.g. molecular mass, number of subunits, amino acid sequence, temperature of irreversible heat inactivation) have been conserved during development of cold adaptation. However, high catalytic efficiency, possibly due to subtle molecular changes, is observed at low temperature.

Chemical Inhibition of Histone Deacetylases 1 and 2 Induces Fetal Hemoglobin through Activation of GATA2.

Directory of Open Access Journals (Sweden)

Jeffrey R Shearstone

Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.

A Clinical Update of the Hb Siirt [β27(B9)Ala→Gly; HBB: c.83C>G] Hemoglobin Variant.

Science.gov (United States)

Cappabianca, Maria Pia; Colosimo, Alessia; Sabatucci, Annalaura; Dainese, Enrico; Di Biagio, Paola; Piscitelli, Roberta; Sarra, Ofelia; Zei, Daniela; Amato, Antonio

2017-01-01

We report a clinical update of the hemoglobin (Hb) variant [β27(B9)Ala→Gly; HBB: c.83C>G], named Hb Siirt, that was previously described as a silent variant in a 23-year-old Kurdish female. The patient was also a carrier of the codon 5 (-CT) (HBB: c.17_18delCT) frameshift mutation and of the ααα anti 3.7 triplication. Her initial moderate β-thalassemia intermedia (β-TI) phenotype worsened with time, causing the patient to become a transfusion-dependent subject at the age of ∼40 years. Subsequent molecular characterization of both parents revealed that the Hb Siirt variant was inherited by the mother, while the other two globin alterations (HBB: c.17_18delCT and ααα anti 3.7 triplication) were genetically transmitted by the father. The latter remained a carrier of a mild β-TI phenotype throughout his life, at least until the age of 65 years. We hypothesize that the worsened clinical conditions in the daughter were due to the additional, maternally inherited Hb Siirt variant. However, protein 3D conformational analysis did not seem to reveal substantial overall structural changes. Among the other three described variants [Hb Volga (HBB: c.83C>A), Hb Knossos (HBB: c.82 G>T), Hb Grange-Blanche (HBB: c.83C>T] that are due to nucleotide substitutions at codon 27 of the β-globin gene; only Hb Knossos causes a β + -thalassemia (β + -thal) phenotype.

An improved method for detecting genetic variation in DNA using denaturing gradient gel electrophoresis

International Nuclear Information System (INIS)

Takahashi, Norio; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-05-01

We have examined the feasibility of denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes to detect variations in genomic and cloned DNAs. The result has demonstrated that use of RNA:DNA duplexes makes DGGE much more practical for screening a large number of samples than use of DNA:DNA heteroduplexes, because preparation of RNA probes is easier than that of DNA probes. Three different 32 P-labeled RNA probes were produced. Genomic or cloned DNAs were digested with restriction enzymes and hybridized to labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. The presence of a mismatch(es) was detected as a difference in the mobility of bands on the gel. The experimental conditions were determined using DNA segments from cloned normal and three thalassemic human β-globin genes. The results from experiments on the cloned DNAs suggest that DGGE of RNA:DNA duplexes will detect nucleotide substitutions and deletions in DNA. In the course of these studies, a polymorphism due to a single-base substitution at position 666 of IVS2 (IVS2-666) of the human β-globin gene was directly identified using genomic DNA samples. A study of 59 unrelated Japanese from Hiroshima was undertaken in which the frequency of the allele with C at IVS2-666 was 0.48 and that of the allele with T was 0.52. This approach was found to be very effective for detecting heritable variation and should be a powerful tool for detecting fresh mutations in DNA, which occur outside the known restriction sites. (author)

Hemoglobin analyses in the Netherlands reveal more than 80 different variants including six novel ones.

Science.gov (United States)

van Zwieten, Rob; Veldthuis, Martijn; Delzenne, Barend; Berghuis, Jeffrey; Groen, Joke; Ait Ichou, Fatima; Clifford, Els; Harteveld, Cornelis L; Stroobants, An K

2014-01-01

More than 20,000 blood samples of individuals living in The Netherlands and suspected of hemolytic anemia or diabetes were analyzed by high resolution cation exchange high performance liquid chromatography (HPLC). Besides common disease-related hemoglobins (Hbs), rare variants were also detected. The variant Hbs were retrospectively analyzed by capillary zone electrophoresis (CZE) and by isoelectric focusing (IEF). For unambiguous identification, the globin genes were sequenced. Most of the 80 Hb variants detected by initial screening on HPLC were also separated by capillary electrophoresis (CE), but a few variants were only detectable with one of these methods. Some variants were unstable, had thalassemic properties or increased oxygen affinity, and some interfered with Hb A2 measurement, detection of sickle cell Hb or Hb A1c quantification. Two of the six novel variants, Hb Enschede (HBA2: c.308G  > A, p.Ser103Asn) and Hb Weesp (HBA1: c.301C > T, p.Leu101Phe), had no clinical consequences. In contrast, two others appeared clinically significant: Hb Ede (HBB: c.53A > T, p.Lys18Met) caused thalassemia and Hb Waterland (HBB: c.428C > T, pAla143Val) was related to mild polycytemia. Hb A2-Venlo (HBD: c.193G > A, p.Gly65Ser) and Hb A2-Rotterdam (HBD: c.38A > C, p.Asn13Thr) interfered with Hb A2 quantification. This survey shows that HPLC analysis followed by globin gene sequencing of rare variants is an effective method to reveal Hb variants.

Complex Interaction of Hb Q-Thailand with α0- and β0-Thalassemia in a Chinese Family.

Science.gov (United States)

He, Sheng; Qin, Qian; Lin, Li; Chen, Qiuli; Yi, Shang; Wei, Honhwei; Du, Juan; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

2017-01-01

Hb Q-Thailand [α74(EF3)Asp→His (α1); HBA1: c.223 G>C] is an abnormal hemoglobin (Hb), variant found mainly in China and Southeast Asian countries. The association of the α Q -Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report a hitherto undescribed condition of patients with a double heterozygosity for Hb Q-Thailand with α 0 -thalassemia (α 0 -thal) and in combination with β 0 -thalassemia (β 0 -thal) in a Chinese family. Our study will provide some clinical manifestations, laboratory diagnosis and genetic counseling for complex hemoglobinopathies.

The polydeoxyadenylate tract of Alu repetitive elements is polymorphic in the human genome

International Nuclear Information System (INIS)

Economou, E.P.; Bergen, A.W.; Warren, A.C.; Antonarakis, S.E.

1990-01-01

To identify DNA polymorphisms that are abundant in the human genome and are detectable by polymerase chain reaction amplification of genomic DNA, the authors hypothesize that the polydeoxyadenylate tract of the Alu family of repetitive elements is polymorphic among human chromosomes. Analysis of the 3' ends of three specific Alu sequences showed two occurrences, one in the adenosine deaminase gene and other in the β-globin pseudogene, were polymorphic. This novel class of polymorphism, termed AluVpA [Alu variable poly(A)] may represent one of the most useful and informative group of DNA markers in the human genome

A Novel Double Heterozygous Hb D-Punjab/Hb J-Meerut Hemoglobinopathy.

Science.gov (United States)

Chandra, Dinesh; Tyagi, Seema; Deka, Roopam; Chauhan, Richa; Seth, Tulika; Saxena, Renu; Pati, H P

2017-12-01

A comprehensive laboratory diagnosis of hemoglobinopathies forms an integral part in workup of disorders of globin chain synthesis. Clinical findings, complete blood counts, peripheral smear examination along with hemoglobin (Hb) electrophoresis and/or cation exchange high performance liquid chromatography findings and parental study helps to clinch a final diagnosis. Compound heterozygous hemoglobinopathy presents with variable clinical findings and some of them are picked up on screening tests done as part of routine antenatal workup. Here we report a rare double heterozygous hemoglobinopathy of Hb D-Punjab and Hb J-Meerut in a 35 year antenatal female.

O2-mediated oxidation of ferrous nitrosylated human serum heme-albumin is limited by nitrogen monoxide dissociation

International Nuclear Information System (INIS)

Ascenzi, Paolo; Gullotta, Francesca; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

2011-01-01

Research highlights: → Human serum heme-albumin displays globin-like properties. → O 2 -mediated oxidation of ferrous nitrosylated human serum heme-albumin. → Allosteric modulation of human serum heme-albumin reactivity. → Rifampicin is an allosteric effector of human serum heme-albumin. → Human serum heme-albumin is a ROS and NOS scavenger. -- Abstract: Human serum heme-albumin (HSA-heme-Fe) displays globin-like properties. Here, kinetics of O 2 -mediated oxidation of ferrous nitrosylated HSA-heme-Fe (HSA-heme-Fe(II)-NO) is reported. Values of the first-order rate constants for O 2 -mediated oxidation of HSA-heme-Fe(II)-NO (i.e., for ferric HSA-heme-Fe formation) and for NO dissociation from HSA-heme-Fe(II)-NO (i.e., for NO replacement by CO) are k = 9.8 x 10 -5 and 8.3 x 10 -4 s -1 , and h = 1.3 x 10 -4 and 8.5 x 10 -4 s -1 , in the absence and presence of rifampicin, respectively, at pH = 7.0 and T = 20.0 o C. The coincidence of values of k and h indicates that NO dissociation represents the rate limiting step of O 2 -mediated oxidation of HSA-heme-Fe(II)-NO. Mixing HSA-heme-Fe(II)-NO with O 2 does not lead to the formation of the transient adduct(s), but leads to the final ferric HSA-heme-Fe derivative. These results reflect the fast O 2 -mediated oxidation of ferrous HSA-heme-Fe and highlight the role of drugs in modulating allosterically the heme-Fe-atom reactivity.

Translation of satellite tobacco necrosis virus RNA modified by (not equal to)-r-7,t-8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene is inhibited in a wheat germ cell-free system

International Nuclear Information System (INIS)

Haas, R.; Pulkrabek, P.; Takanami, Y.; Grunberger, D.

1983-01-01

It has been shown that (not equal to)-r-7-,t-8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) modification of rabbit globin mRNA results in inhibition of translational initiation. In order to explore the possibility that modification of the 5' cap structure was responsible for this inhibition, the naturally non-capped mRNA from satellite tobacco necrosis virus (STNV) was reacted with BPDE and translated in a wheat germ cell-free system. The extent of modification was 1.3 and 2.9 BPDE residues/molecule. High performance liquid chromatography of the modified nucleosides from enzymatically hydrolyzed STNV RNA revealed that greater than 90% of the nucleoside adducts were substituted at the exocyclic amino group of guanosine. The translational ability of the lower and higher modified STNV, measured by incorporation of [ 14 C]amino acids into acid-precipitable polypeptides is inhibited by 55% and 63%, respectively. Polyacrylamide gel electrophoretic analyses of the translation products indicate that predominantly full-length coat proteins are synthesized but with the carcinogen-modified STNV the amount is reduced. On the other hand, 80S initiation complex formation is not inhibited as measured by binding of the BPDE-modified STNV to ribosomes and followed by glycerol gradient centrifugation. Under these conditions, aurintricarboxylic acid completely inhibits 80S initiation complex formation in the presence of either modified or native STNV. These results suggest that inhibition of in vitro translation of BPDE-modified STNV, in contrast to that of globin mRNA, is not at the level of initiation complex formation but possibly by premature termination of growing polypeptides

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

Science.gov (United States)

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

Science.gov (United States)

Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

2018-04-01

Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

Hemoglobin Constant Spring among Southeast Asian Populations: Haplotypic Heterogeneities and Phylogenetic Analysis.

Directory of Open Access Journals (Sweden)

Wittaya Jomoui

Full Text Available Hemoglobin Constant Spring (Hb CS is an abnormal Hb caused by a mutation at the termination codon of α2-globin gene found commonly among Southeast Asian and Chinese people. Association of Hb CS with α°-thalassemia leads to a thalassemia intermedia syndrome commonly encountered in the region. We report chromosome background and addressed genetic origins of Hb CS observed in a large cohort of Hb CS among Southeast Asian populations.A study was done on 102 Vietnamese (aged 15-49 year-old and 40 Laotian (aged 18-39 year-old subjects with Hb CS and results compared with 120 Hb CS genes in Thailand. Hematological parameters were recorded and Hb analysis was performed using capillary electrophoresis. Hb CS mutation and thalassemia genotypes were defined by DNA analysis. Six DNA polymorphisms within α-globin gene cluster including 5'Xba I, Bgl I, Inter-zeta HVR, AccI, RsaI and αPstI 3', were determined using PCR-RFLP assay.Nine different genotypes of Hb CS were observed. In contrast to the Thai Hb CS alleles which are mostly linked to haplotype (+-S + + -, most of the Vietnamese and the Laotian Hb CS genes were associated with haplotype (+-M + + -, both of which are different from that of the European Hb CS.Hb CS is commonly found in combination with other thalassemias among Southeast Asian populations. Accurate genotyping of the cases requires both hematologic and DNA analyses. At least two independent origins are associated with the Hb CS gene which could indirectly explain the high prevalence of this Hb variant in the region.

Phenotypic Diversity of Sickle Cell Disease in Patients with a Double Heterozygosity for Hb S and Hb D-Punjab.

Science.gov (United States)

Torres, Lidiane S; Okumura, Jéssika V; Belini-Júnior, Édis; Oliveira, Renan G; Nascimento, Patrícia P; Silva, Danilo G H; Lobo, Clarisse L C; Oliani, Sonia M; Bonini-Domingos, Claudia R

2016-09-01

Phenotypic heterogeneity for sickle cell disease is associated to several genetic factors such as genotype for sickle cell disease, β-globin gene cluster haplotypes and Hb F levels. The coinheritance of Hb S (HBB: c.20A > T) and Hb D-Punjab (HBB: c.364G > C) results in a double heterozygosity, which constitutes one of the genotypic causes of sickle cell disease. This study aimed to assess the phenotypic diversity of sickle cell disease presented by carriers of the Hb S/Hb D-Punjab genotype and the Bantu [- + - - - -] haplotype. We evaluated medical records from 12 patients with sickle cell disease whose Hb S/Hb D-Punjab genotype and Bantu haplotype were confirmed by molecular analysis. Hb S and Hb D-Punjab levels were quantified by chromatographic analysis. Mean concentrations of Hb S and Hb D-Punjab were 44.8 ± 2.3% and 43.3 ± 1.8%, respectively. Painful crises were present in eight (66.7%) patients evaluated, representing the most common clinical event. Acute chest syndrome (ACS) was the second most prevalent manifestation, occurring in two individuals (16.7%). Three patients were asymptomatic, while another two exhibited greater diversity of severe clinical manifestations. Medical records here analyzed reported a significant clinical diversity in sickle cell disease ranging from the absence of symptoms to wide phenotypic variety. The sickle cell disease genotype, Bantu haplotype and hemoglobin (Hb) levels did not influence the clinical diversity. Thus, we concluded that the phenotypic variation in sickle cell disease was present within a specific genotype for disease regardless of the β-globin gene cluster haplotypes.

Genetic determinants and stroke in children with sickle cell disease.

Science.gov (United States)

Rodrigues, Daniela O W; Ribeiro, Luiz C; Sudário, Lysla C; Teixeira, Maria T B; Martins, Marina L; Pittella, Anuska M O L; Junior, Irtis de O Fernandes

To verify genetic determinants associated with stroke in children with sickle cell disease (SCD). Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal), haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA), using the chi-squared test in the program SPSS ® version 14.0. Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR) was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p=0.001) and males (24.1% vs. 9.6%; p=0.044). The presence of α-thal (p=0.196), the CAR haplotype (p=0.543), and socioeconomic factors were not statistically significant in association with the occurrence of stroke. There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Identification of 2,4-toluenediisocyanate (2,4-TDI) adducts with globin and albumin

Czech Academy of Sciences Publication Activity Database

Mráz, J.; Šimek, Petr; Nohová, H.; Boušková, Š.; Gálová, E.; Linhart, I.; Šmejkal, J.

1998-01-01

Roč. 14, - (1998), s. 40-41 [International Symposium on Biological Monitoring in Occupational and Environmental Health /4./. 23.09.1998-25.09.1998, Seoul] R&D Projects: GA ČR GA313/96/0375 Keywords : Streptomyces griseus Subject RIV: FR - Pharmacology ; Medidal Chemistry

molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

International Nuclear Information System (INIS)

Kamel, S.A.L.M.

2004-01-01

β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

Solid pseudopapillary tumor of pancreas with sickle cell trait: A rare case report

Directory of Open Access Journals (Sweden)

Harish S Permi

2013-01-01

Full Text Available Solid pseudopapillary tumor of pancreas is a rare pancreatic neoplasm affecting young women, has low malignant potential and amenable for surgical excision with good long-term survival. Sickle cell trait is benign condition, which involves one normal beta-globin chain and one HbS chain. Although it is a benign condition, individuals are prone to have rare complications that may predispose to death under certain circumstances. We report a rare coexistence of solid pseudopapillary tumor of pancreas with sickle cell trait in an 18-year-old female who underwent distal pancreatectomy with splenectomy. Histopathological examination and haemoglobin electrophoresis confirmed the diagnosis.

Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues

Directory of Open Access Journals (Sweden)

Mini P Singh

2017-01-01

Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.

A space-efficient algorithm for local similarities.

Science.gov (United States)

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease.

Science.gov (United States)

Panyasai, Sitthichai; Satthakarn, Surada; Pornprasert, Sakorn

2018-01-01

Hb Q-Thailand [α74(EF3)Asp→His (α1), GAC>CAC, HBA1: c.223G>C] is an abnormal hemoglobin (Hb) frequently found in Thailand and Southeast Asian countries. The association of the α Q-Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report how to diagnose the coinheritance of Hb Q-Thailand with β-thalassemia (β-thal)/Hb E disease in four Thai samples from high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) testing results. Understanding of the HPLC chromatogram and CE electropherogram patterns of this complex mutation is important for interpretation of testing results and providing genetic counseling.

Effects of low dose radiation on differential expression of serum protein in mice

International Nuclear Information System (INIS)

Chen Wei; He Ying; Shen Xianrong

2014-01-01

The aim is to find out the key proteins related with low dose radiation (Ld) by parametric technology, which provided the theory foundation for LDR protection Two-dimensional electrophoresis (2-DE) was performed on serum protein Differential expression proteins were identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) and database analysis Compared with the control group, 7 altered proteins was definite in terms of apolipoprotein C-Ⅲ, beta-globin parotid secretory protein alpha-2-macroglobulin precursor, mouse transthyretin, C1qc protein and clusterin. Some proteins related with LDR are found. It may provide some new explanations for the mechanism of LDR. (authors)

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

Science.gov (United States)

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

Clinical and molecular genetic features of Hb H and AE Bart's diseases in central Thai children.

Science.gov (United States)

Traivaree, Chanchai; Boonyawat, Boonchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Photia, Apichat

2018-01-01

α-Thalassemia, one of the major thalassemia types in Thailand, is caused by either deletion or non-deletional mutation of one or both α-globin genes. Inactivation of three α-globin genes causes hemoglobin H (Hb H) disease, and the combination of Hb H disease with heterozygous hemoglobin E (Hb E) results in AE Bart's disease. This study aimed to characterize the clinical and hematological manifestations of 76 pediatric patients with Hb H and AE Bart's diseases treated at Phramongkutklao Hospital, a tertiary care center for thalassemia patients in central Thailand. Seventy-six unrelated pediatric patients, 58 patients with Hb H disease and 18 patients with AE Bart's disease, were enrolled in this study. Their clinical presentations, transfusion requirement, laboratory findings, and mutation analysis were retrospectively reviewed and analyzed. A total of 76 pediatric patients with Hb H and AE Bart's diseases who mainly lived in central Thailand were included in this study. The clinical severities of patients with non-deletional mutations were more severe than those with deletional mutations. Eighty-six percent of patients with non-deletional AE Bart's disease required more blood transfusion compared to 12.5% of patients with deletional AE Bart's disease. Non-deletional AE Bart's disease also had a history of urgent blood transfusion with the average of 6±0.9 times compared to 1±0.3 times in patients with deletional Hb H disease. The difference was statistically significant. This study revealed the differences in clinical spectrum between patients with Hb H disease and those with AE Bart's disease in central Thailand. The differentiation of α-thalassemia is essential for appropriate management of patients. The molecular diagnosis is useful for diagnostic confirmation and genotype-phenotype correlation.

A stable murine-based RD114 retroviral packaging line efficiently transduces human hematopoietic cells.

Science.gov (United States)

Ward, Maureen; Sattler, Rose; Grossman, I Robert; Bell, Anthony J; Skerrett, Donna; Baxi, Laxmi; Bank, Arthur

2003-11-01

Several barriers exist to high-efficiency transfer of therapeutic genes into human hematopoietic stem cells (HSCs) using complex oncoretroviral vectors. Human clinical trials to date have used Moloney leukemia virus-based amphotropic and gibbon ape leukemia virus-based envelopes in stable retroviral packaging lines. However, retroviruses pseudotyped with these envelopes have low titers due to the inability to concentrate viral supernatants efficiently by centrifugation without damaging the virus and low transduction efficiencies because of low-level expression of viral target receptors on human HSC. The RD114 envelope from the feline endogenous virus has been shown to transduce human CD34+ cells using transient packaging systems and to be concentrated to high titers by centrifugation. Stable packaging systems have potential advantages over transient systems because greater and more reproducible viral productions can be attained. We have, therefore, constructed and tested a stable RD114-expressing packaging line capable of high-level transduction of human CD34+ cells. Viral particles from this cell line were concentrated up to 100-fold (up to 10(7) viral particles/ml) by ultracentrifugation. Human hematopoietic progenitors from cord blood and sickle cell CD34+ cells were efficiently transduced with a Neo(R)-containing vector after a single exposure to concentrated RD114-pseudotyped virus produced from this cell line. Up to 78% of progenitors from transduced cord blood CD34+ cells and 51% of progenitors from sickle cell CD34+ cells expressed the NeoR gene. We also show transfer of a human beta-globin gene into progenitor cells from CD34+ cells from sickle cell patients with this new RD114 stable packaging system. The results indicate that this packaging line may eventually be useful in human clinical trials of globin gene therapy.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

Science.gov (United States)

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Leishmania donovani infection induces anemia in hamsters by differentially altering erythropoiesis in bone marrow and spleen.

Directory of Open Access Journals (Sweden)

William P Lafuse

Full Text Available Leishmania donovani is a parasite that causes visceral leishmaniasis by infecting and replicating in macrophages of the bone marrow, spleen, and liver. Severe anemia and leucopenia is associated with the disease. Although immune defense mechanisms against the parasite have been studied, we have a limited understanding of how L. donovani alters hematopoiesis. In this study, we used Syrian golden hamsters to investigate effects of L. donovani infection on erythropoiesis. Infection resulted in severe anemia and leucopenia by 8 weeks post-infection. Anemia was associated with increased levels of serum erythropoietin, which indicates the hamsters respond to the anemia by producing erythropoietin. We found that infection also increased numbers of BFU-E and CFU-E progenitor populations in the spleen and bone marrow and differentially altered erythroid gene expression in these organs. In the bone marrow, the mRNA expression of erythroid differentiation genes (α-globin, β-globin, ALAS2 were inhibited by 50%, but mRNA levels of erythroid receptor (c-kit, EpoR and transcription factors (GATA1, GATA2, FOG1 were not affected by the infection. This suggests that infection has a negative effect on differentiation of erythroblasts. In the spleen, erythroid gene expression was enhanced by infection, indicating that the anemia activates a stress erythropoiesis response in the spleen. Analysis of cytokine mRNA levels in spleen and bone marrow found that IFN-γ mRNA is highly increased by L. donovani infection. Expression of the IFN-γ inducible cytokine, TNF-related apoptosis-inducing ligand (TRAIL, was also up-regulated. Since TRAIL induces erythroblasts apoptosis, apoptosis of bone marrow erythroblasts from infected hamsters was examined by flow cytometry. Percentage of erythroblasts that were apoptotic was significantly increased by L. donovani infection. Together, our results suggest that L. donovani infection inhibits erythropoiesis in the bone marrow by

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Directory of Open Access Journals (Sweden)

Capretto L

2012-01-01

Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol

Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

Science.gov (United States)

Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

2015-05-01

Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

Molecular Epidemiology of Hemoglobinopathies in Cambodia.

Science.gov (United States)

Munkongdee, Thongperm; Tanakulmas, Jatuporn; Butthep, Punnee; Winichagoon, Pranee; Main, Barbara; Yiannakis, Miriam; George, Joby; Devenish, Robyn; Fucharoen, Suthat; Svasti, Saovaros

2016-06-01

Determining the magnitude of the thalassemia problem in a country is important for implementing a national prevention and control program. In order to acquire accurate thalassemia prevalence data, the gene frequency of α- and β-thalassemia (α- and β-thal) in different regions of a country should be determined. The molecular basis of thalassemia in Cambodia was performed by polymerase chain reaction (PCR)-based techniques in a community-based cross-sectional survey of 1631 unrelated individuals from three regions, Battambang, Preah Vihear and Phnom Penh. Thalassemia mutations were detected in 62.7% of the three studied population of Cambodia. Hb E (HBB: c.79G > A) was the most common β-globin gene mutation with a frequency ranging from 0.139 to 0.331, while the most frequent α-globin gene mutation was the -α(3.7) (rightward) deletion (0.098-0.255). The other frequencies were 0.001-0.003 for β-thal, 0.008-0.011 for α-thal-1 (- -(SEA)), 0.003-0.008 for α-thal-2 [-α(4.2) (leftward deletion)], 0.021-0.044 for Hb Constant Spring (Hb CS, HBA2: c.427T > C) and 0.009-0.036 for Hb Paksé (HBA2: c.429A > T). A regional specific thalassemia gene frequency was observed. Preah Vihear had the highest prevalence of Hb E (55.9%), α-thal-2 (24.0%) and nondeletional α-thal (15.1%), whereas Phnom Penh had the lowest frequency of thalassemia genes. Interestingly, in Preah Vihear, the frequency of Hb Paksé was extremely high (0.036), almost equivalent to that of Hb CS (0.044). Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Cambodia.

Xmsx-1 modifies mesodermal tissue pattern along dorsoventral axis in Xenopus laevis embryo.

Science.gov (United States)

Maeda, R; Kobayashi, A; Sekine, R; Lin, J J; Kung, H; Maéno, M

1997-07-01

This study analyzes the expression and the function of Xenopus msx-1 (Xmsx-1) in embryos, in relation to the ventralizing activity of bone morphogenetic protein-4 (BMP-4). Expression of Xmsx-1 was increased in UV-treated ventralized embryos and decreased in LiCl-treated dorsalized embryos at the neurula stage (stage 14). Whole-mount in situ hybridization analysis showed that Xmsx-1 is expressed in marginal zone and animal pole areas, laterally and ventrally, but not dorsally, at mid-gastrula (stage 11) and late-gastrula (stage 13) stages. Injection of BMP-4 RNA, but not activin RNA, induced Xmsx-1 expression in the dorsal marginal zone at the early gastrula stage (stage 10+), and introduction of a dominant negative form of BMP-4 receptor RNA suppressed Xmsx-1 expression in animal cap and ventral marginal zone explants at stage 14. Thus, Xmsx-1 is a target gene specifically regulated by BMP-4 signaling. Embryos injected with Xmsx-1 RNA in dorsal blastomeres at the 4-cell stage exhibited a ventralized phenotype, with microcephaly and swollen abdomen. Histological observation and immunostaining revealed that these embryos had a large block of muscle tissue in the dorsal mesodermal area instead of notochord. On the basis of molecular marker analysis, however, the injection of Xmsx-1 RNA did not induce the expression of alpha-globin, nor reduce cardiac alpha-actin in dorsal marginal zone explants. Furthermore, a significant amount of alpha-actin was induced and alpha-globin was turned off in the ventral marginal zone explants injected with Xmsx-1. These results indicated that Xmsx-1 is a target gene of BMP-4 signaling, but possesses a distinct activity on dorsal-ventral patterning of mesodermal tissues.

Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

International Nuclear Information System (INIS)

Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

2010-01-01

Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

Insulated piggyBac vectors for insect transgenesis

Directory of Open Access Journals (Sweden)

Horn Carsten

2006-06-01

Full Text Available Abstract Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species.

Effect of permanent middle cerebral artery occlusion on Cytoglobin expression in the mouse brain

DEFF Research Database (Denmark)

Raida, Zindy; Reimets, Riin; Hay-Schmidt, Anders

2012-01-01

Cytoglobin, a new member of the mammalian heme-globin family has been shown to bind oxygen and to have cell protective properties in vitro. Cytoglobin is specifically expressed in a subpopulation of brain neurons. Based on hypoxia-induced up regulation and proposed scavenging of reactive oxygen...... species Cytoglobin was suggested as a candidate for pharmaceutical stroke treatment. Since production of reactive oxygen species is a hallmark of ischemia, we hypothesized that Cytoglobin expression would be increased and that Cytoglobin expressing neurons would be spared after ischemic injury. Twenty...... mice. This suggests that Cytoglobin is likely not important for global neuronal protection following ischemia and the role of Cytoglobin in relation to endogenous neuroprotection remains unresolved....

Hematological and Molecular Characterization of Hb J-Buda [α61(E10)Lys → Asn, AAG > AAT].

Science.gov (United States)

Panyasai, Sitthichai; Permsripong, Nopphadol; Jaiping, Kanokwan; Khantarag, Pisuttinee; Pornprasert, Sakorn

2016-06-01

Hemoglobin (Hb) J-Buda [α61(E10)Lys → Asn, AAG > AAT] is a very rare α-chain variant found in South-East Asia. We analyzed hematological parameters and provided a rapid molecular analysis method for detection of this hemoglobinopathy in two Thai women who had severe microcytic anemia with Hb and MCV AAG → AAT mutation at codon 61 for Hb J-Buda on one allele of the α1-globin gene. The developed Allele-specific PCR (ASPCR) showed the 455 bp amplified fragment from Hb J-Buda allele. Thus, understanding of hematological characterizations and the developed ASPCR for diagnosis of Hb J-Buda are essential for genetic counseling of this hemoglobinopathy.

Empirical potentials for recombination reactions of photo-dissociated ligands. Final report

International Nuclear Information System (INIS)

Elber, R.

1998-01-01

The aim of this research was to design an appropriate potential and simulation methodology to describe the effect of radiation on ligands bound to metal-proteins. As model systems the authors investigated myoglobin, hemoglobin and their mutants. The great advantage of the globins as a target for theoretical studies is the wealth of experimental data available for them. They focused on studies that combine fast spectroscopy with mutation experiments. The mutations make it possible to examine detailed changes in the kinetic curves with atomically detailed information. The first spectroscopy, which is in the same time scale as of ordinary molecular dynamics (sub nanoseconds), makes it possible to compare the results of the computations to raw experimental data

Induction of HBF

Directory of Open Access Journals (Sweden)

Mehran Karimi

2013-03-01

Full Text Available The role of HbF inducers in ameliorating the pathophysiology and severity associated with hemoglobinopathies like sickle cell disease and thalassemia is well demonstrated. So many studies have focused on explain the pathways that involved in the re-activation of γ-globin gene expression. The HbF inducers are mainly includes chemotherapeutic agents (e.g. 5-Azacytidine and hydroxyurea, short-chain fatty acid derivatives (e.g. butyrates, valporate, sodium phenylbutyrate and other HbF inducers like stem cell factor and synthetic gene-targeted transcription factors. These HbF inducers have significant effects on improve clinical manifestations of hemoglobinopathies and decreasing transfusion dependency. But regarding some limitations of these agents, more studies for the investigation of new agents with more safety and effectiveness is needed.

Genomic variants in the ASS1 gene, involved in the nitric oxide biosynthesis and signaling pathway, predict hydroxyurea treatment efficacy in compound sickle cell disease/β-thalassemia patients.

Science.gov (United States)

Chalikiopoulou, Constantina; Tavianatou, Anastasia-Gerasimoula; Sgourou, Argyro; Kourakli, Alexandra; Kelepouri, Dimitra; Chrysanthakopoulou, Maria; Kanelaki, Vasiliki-Kaliopi; Mourdoukoutas, Evangelos; Siamoglou, Stavroula; John, Anne; Symeonidis, Argyris; Ali, Bassam R; Katsila, Theodora; Papachatzopoulou, Adamantia; Patrinos, George P

2016-03-01

Hemoglobinopathies exhibit a remarkable phenotypic diversity that restricts any safe association between molecular pathology and clinical outcomes. Herein, we explored the role of genes involved in the nitric oxide biosynthesis and signaling pathway, implicated in the increase of fetal hemoglobin levels and response to hydroxyurea treatment, in 119 Hellenic patients with β-type hemoglobinopathies. We show that two ASS1 genomic variants (namely, rs10901080 and rs10793902) can serve as pharmacogenomic biomarkers to predict hydroxyurea treatment efficacy in sickle cell disease/β-thalassemia compound heterozygous patients. These markers may exert their effect by inducing nitric oxide biosynthesis, either via altering splicing and/or miRNA binding, as predicted by in silico analysis, and ultimately, increase γ-globin levels, via guanylyl cyclase targeting.

Effects of the addition of blood plasma proteins on physico-chemical properties of emulsion-type pork sausage during cold storage.

Science.gov (United States)

Kim, Sungho; Jin, Sangkeun; Choi, Jungseok

2017-10-01

Most slaughter blood is discarded, resulting in problems related to costs for wastewater disposal and environmental pollution. However, animal blood contains various proteins such as albumin, globulin and globin and can be used as a natural emulsifier, stabiliser and colour additive. Thus, this study was carried out to investigate the effect of blood plasma proteins on the physico-chemical properties of emulsion-type pork sausages stored at 4°C over 5 weeks. The emulsion-type pork sausages with plasma powders had higher pH than the other treatments during week 5, and higher shear force than the control (P binder for the production of excellent meat products compared to other binders. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

International Nuclear Information System (INIS)

Xiao Yi; Huang Yanzhao

2004-01-01

DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

REC-2006-A Fractionated Extract of Podophyllum hexandrum Protects Cellular DNA from Radiation-Induced Damage by Reducing the Initial Damage and Enhancing Its Repair In Vivo.

Science.gov (United States)

Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar

2011-01-01

Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg(-1) body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair.

REC-2006—A Fractionated Extract of Podophyllum hexandrum Protects Cellular DNA from Radiation-Induced Damage by Reducing the Initial Damage and Enhancing Its Repair In Vivo

Science.gov (United States)

Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar

2011-01-01

Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg−1 body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair. PMID:20008078

PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

Directory of Open Access Journals (Sweden)

Luisella Saba

2009-06-01

Full Text Available

Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

Science.gov (United States)

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

Hypoxic regulation of cytoglobin and neuroglobin expression in human normal and tumor tissues

Directory of Open Access Journals (Sweden)

Emara Marwan

2010-09-01

Full Text Available Abstract Background Cytoglobin (Cygb and neuroglobin (Ngb are recently identified globin molecules that are expressed in vertebrate tissues. Upregulation of Cygb and Ngb under hypoxic and/or ischemic conditions in vitro and in vivo increases cell survival, suggesting possible protective roles through prevention of oxidative damage. We have previously shown that Ngb is expressed in human glioblastoma multiforme (GBM cell lines, and that expression of its transcript and protein can be significantly increased after exposure to physiologically relevant levels of hypoxia. In this study, we extended this work to determine whether Cygb is also expressed in GBM cells, and whether its expression is enhanced under hypoxic conditions. We also compared Cygb and Ngb expression in human primary tumor specimens, including brain tumors, as well as in human normal tissues. Immunoreactivity of carbonic anhydrase IX (CA IX, a hypoxia-inducible metalloenzyme that catalyzes the hydration of CO2 to bicarbonate, was used as an endogenous marker of hypoxia. Results Cygb transcript and protein were expressed in human GBM cells, and this expression was significantly increased in most cells following 48 h incubation under hypoxia. We also showed that Cygb and Ngb are expressed in both normal tissues and human primary cancers, including GBM. Among normal tissues, Cygb and Ngb expression was restricted to distinct cell types and was especially prominent in ductal cells. Additionally, certain normal organs (e.g. stomach fundus, small bowel showed distinct regional co-localization of Ngb, Cygb and CA IX. In most tumors, Ngb immunoreactivity was significantly greater than that of Cygb. In keeping with previous in vitro results, tumor regions that were positively stained for CA IX were also positive for Ngb and Cygb, suggesting that hypoxic upregulation of Ngb and Cygb also occurs in vivo. Conclusions Our finding of hypoxic up-regulation of Cygb/Ngb in GBM cell lines and human

The prevalence of human papillomavirus in oropharyngeal cancer in a New Zealand population.

Directory of Open Access Journals (Sweden)

Rebecca Lucas-Roxburgh

Full Text Available The incidence of oropharyngeal cancer (OPC in New Zealand (NZ has more than doubled over the last 14 years with 126 cases in 2010. Overseas studies have shown that human papillomavirus (HPV plays a significant role in the development of these cancers. However, the role of HPV in OPC and the burden on the NZ health system is unclear.The aim of the study was to determine the prevalence and the genotypes of HPV associated with OPC in New Zealand.In this study, 621 OPC were identified from cancer registry data from 1996-98, 2003-05, and 2010-12. Biopsies of 267 cases were then retrieved from laboratories throughout New Zealand. p16 immunohistochemistry and a human beta globin PCR were performed on all specimens. HPV genotyping was performed on all beta globin positive specimens using real-time PCR with melt analysis.Using a p16/PCR algorithm, 77.9% (95% CI: 71.1-83.5% of cases were attributable to HPV. Of these, 98.5% were HPV 16 positive. There was also one case each of HPV 33 and 35. The percentage of HPV positive cases increased from 61.9% (95% CI: 40.9%- 79.2% in 1996-98 to 87.5% (95% CI: 79.8%- 92.5% in 2010-12. Results from the multivariable model, adjusted for sex and ethnicity found statistically significant associations between HPV positivity and timeframe (OR: 5.65, 95% CI: 2.60-12.30, 2010-12 vs 1996-98, and between HPV positivity and patient age (OR: 0.55, 95% CI: 0.33-0.99, ≥61 years vs ≤60 years.This data is consistent with data from other developed countries showing an increase in cases of HPV positive OPC in New Zealand, and the majority of cases being attributable to HPV 16. These results support the recent inclusion of males into the nationally funded immunization schedule for Gardasil® 9.

Realizing effectiveness across continents with hydroxyurea: Enrollment and baseline characteristics of the multicenter REACH study in Sub-Saharan Africa.

Science.gov (United States)

McGann, Patrick T; Williams, Thomas N; Olupot-Olupot, Peter; Tomlinson, George A; Lane, Adam; Luís Reis da Fonseca, José; Kitenge, Robert; Mochamah, George; Wabwire, Ham; Stuber, Susan; Howard, Thad A; McElhinney, Kathryn; Aygun, Banu; Latham, Teresa; Santos, Brígida; Tshilolo, Léon; Ware, Russell E

2018-08-01

Despite its well-described safety and efficacy in the treatment of sickle cell anemia (SCA) in high-income settings, hydroxyurea remains largely unavailable in sub-Saharan Africa, where more than 75% of annual SCA births occur and many comorbidities exist. Realizing Effectiveness Across Continents with Hydroxyurea (REACH, ClinicalTrials.gov NCT01966731) is a prospective, Phase I/II open-label trial of hydroxyurea designed to evaluate the feasibility, safety, and benefits of hydroxyurea treatment for children with SCA in four sub-Saharan African countries. Following comprehensive training of local research teams, REACH was approved by local Ethics Committees and achieved full enrollment ahead of projections with 635 participants enrolled over a 30-month period, despite half of families living >12 km from their clinical site. At enrollment, study participants (age 5.4 ± 2.4 years) had substantial morbidity, including a history of vaso-occlusive pain (98%), transfusion (68%), malaria (85%), and stroke (6%). Significant differences in laboratory characteristics were noted across sites, with lower hemoglobin concentrations (P < .01) in Angola (7.2 ± 1.0 g/dL) and the DRC (7.0 ± 0.9 g/dL) compared to Kenya (7.4 ± 1.1 g/dL) and Uganda (7.5 ± 1.1 g/dL). Analysis of known genetic modifiers of SCA demonstrated a high frequency of α-thalassemia (58.4% with at least a single α-globin gene deletion) and G6PD deficiency (19.7% of males and 2.4% of females) across sites. The CAR β-globin haplotype was present in 99% of participants. The full enrollment to REACH confirms the feasibility of conducting high-quality SCA research in Africa; this study will provide vital information to guide safe and effective dosing of hydroxyurea for children with SCA living in Africa. © 2018 Wiley Periodicals, Inc.

Hb variants in Korea: effect on HbA1c using five routine methods.

Science.gov (United States)

Yun, Yeo-Min; Ji, Misuk; Ko, Dae-Hyun; Chun, Sail; Kwon, Gye Cheol; Lee, Kyunghoon; Song, Sang Hoon; Seong, Moon Woo; Park, Sung Sup; Song, Junghan

2017-07-26

Quantification of glycated hemoglobin (HbA1c) is a challenge in patients with hemoglobin (Hb) variants. We evaluated the impact of various Hb variants on five routine HbA1c assays by comparing with the IFCC reference measurement procedure (RMP). Whole blood samples showing warning flags or no results on routine HPLC HbA1c assays were confirmed for Hb variants and were submitted to HbA1c quantification using Sebia Capillarys 2 Flex Piercing, Roche Tina-quant HbA1c Gen. 2, Bio-Rad Variant II Turbo 2.0, ADAMS HA-8180, Tosoh G8 standard mode, and IFCC RMP using LC-MS. Among 114 samples, the most common variants were Hb G-Coushatta (n=47), Queens (n=41), Ube-4 (n=11), Chad (n=4), Yamagata (n=4), G-His-Tsou (n=2), G-Taipei (n=1), Fort de France (n=1), Hoshida (n=1), and two novel variants (Hb α-globin, HBA 52 Gly>Cys and Hb β-globin, HBB 146 His>Asn). In terms of control samples, all the result of HbA1c were "acceptable", within the criteria of ±7% compared to IFCC RMP target values. However, percentage of "unacceptable" results of samples with Hb variants were 16% for Capillarys 2, 7% for Tina-quant, 51% for Variant II Turbo 2.0, 95% for G8 standard mode, and 89% for HA-8180. The Capillarys 2 and HA-8180 assay did not provide the results in 5 and 40 samples with Hb variants, respectively. HbA1c results from five routine assays in patients with relatively common Hb variants in Korea showed various degrees of bias compared to those of IFCC RMP. Therefore, laboratories should be aware of the limitation of their methods with respect to interference from Hb variants found commonly in their local population and suggest an alternative HbA1c quantification method.

Rapid Simultaneous Amplification and Detection of the MBR/JH Chromosomal Translocation by Fluorescence Melting Curve Analysis

Science.gov (United States)

Bohling, Sandra D.; King, Thomas C.; Wittwer, Carl T.; Elenitoba-Johnson, Kojo S. J.

1999-01-01

Polymerase chain reaction (PCR) amplification and product analysis for the detection of chromosomal translocations, such as the t(14;18), has traditionally been a two-step process. PCR product detection has generally entailed gel electrophoresis and/or hybridization or sequencing for confirmation of assay specificity. Using a microvolume fluorimeter integrated with a thermal cycler and a PCR-compatible double-stranded DNA (dsDNA) binding fluorescent dye (SYBR Green I), we investigated the feasibility of simultaneous thermal amplification and detection of MBR/JH translocation products by fluorescence melting curve analysis. We analyzed DNA from 30 cases of lymphoproliferative disorders comprising 19 cases of previously documented MBR/JH-positive follicle center lymphoma and 11 reactive lymphadenopathies. The samples were coded and analyzed blindly for the presence of MBR/JH translocations by fluorescence melting curve analysis. We also performed dilutional assays using the MBR/JH-positive cell line SUDHL-6. Multiplex PCR for MBR/JH and β-globin was used to simultaneously assess sample adequacy. All (100%) of the 19 cases previously determined to be MBR/JH positive by conventional PCR analysis showed a characteristic sharp decrease in fluorescence at ∼90°C by melting curve analysis after amplification. Fluorescence melting peaks obtained by plotting the negative derivative of fluorescence over temperature (−dF/dT) versus temperature (T) showed melting temperatures (Tm) at 88.85 ± 1.15°C. In addition, multiplex assays using both MBR/JH and β-globin primers yielded easily distinguishable fluorescence melting peaks at ∼90°C and 81.2°C, respectively. Dilutional assays revealed that fluorescence melting curve analysis was more sensitive than conventional PCR and agarose gel electrophoresis with ultraviolet transillumination by as much as 100-fold. Simultaneous amplification and fluorescence melting curve analysis is a simple, reliable, and sensitive method

Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

Energy Technology Data Exchange (ETDEWEB)

Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

1995-12-01

T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

The Reaction of Oxy Hemoglobin with Nitrite

DEFF Research Database (Denmark)

Hathazi, Denisa; Scurtu, Florina; Bischin, Cristina

2018-01-01

The autocatalytic reaction between nitrite and the oxy form of globins involves free radicals. For myoglobin (Mb), an initial binding of nitrite to the iron-coordinated oxygen molecule was proposed; the resulting ferrous-peroxynitrate species was not detected, but its decay product, the high...... to a simple kinetic model involving a transient met-aqua form, in contrast to the ferryl detected in the case of Mb in a similar reaction sequence. These data are in line with a previous observation of a transient accumulation of ferryl Hb under auto-catalytic conditions at much lower concentrations......-peroxynitrate. Density functional theory (DFT) calculations support this latter assignment. The reaction allows for differentiating between the reactivities of various chemically modified hemoglobins, including candidates for blood substitutes. Polymerization of hemoglobin slows the nitrite-induced oxidation, in sharp...

Preparation of Cu{sup 2+}/NTA-derivatized branch polyglycerol magnetic nanoparticles for protein adsorption

Energy Technology Data Exchange (ETDEWEB)

ShiXing Wang, E-mail: wsxkm@sina.com; Sun Wentong [Yunnan Institute of Product Quality Supervision and Inspection (China); Zhou Yang, E-mail: zhouyang8250@sohu.co [Kunming University of Science and Technology, Faculty of Metallurgical and Energy Engineering (China)

2010-09-15

In this report, we described the preparation of Cu{sup 2+}/nitrilotriacetic acids (NTA)-derivatized branch polyglycerol magnetic nanoparticles for protein adsorption with avoidance of nonspecific interactions at the same time. Magnetic nanoparticles (MNPs) were synthesized by the coprecipitation method. The transmission electron microscopy results showed that the average diameter of MNPs was 15.8 {+-} 4.6 nm. X-ray photoelectron spectroscopy and Fourier Transform infrared measurements indicated that branch polyglycerols were grafted on MNPs via the ring-opening polymerization of glycidol and that Cu{sup 2+} ions had been successfully immobilized on the surface of MNPs. The protein immobilization effect was characterized by UV-Vis spectrum. The results proved that Cu{sup 2+}/NTA-derivatized branch polyglycerol magnetic nanoparticles effectively adsorbed bovine haemoglobin and rarely adsorbed lysozyme and {gamma}-globin.

Association in Long-Evans hooded rats of red cell 2,3-diphosphoglycerate levels with hemoglobin types.

Science.gov (United States)

Brewer, G; Gilman, J; Noble, N; Crews, V

1978-08-01

Two sublines of commercially available Long-Evans hooded rats have been developed by genetic selection. These sublines have widely differing levels of erythrocyte 2,3-diphosphoglycerate (DPG) due to different alleles at a single genetic locus. In the present work, it is shown that rats from the commercial population are also polymorphic at a hemoglobin locus, probably involving two alleles of the IIIbeta-globin chain locus. Particular hemoglobin types have been found to be strongly associated with certain DPG types, not only in the high-DPG and low-DPG lines but also in the commercial population. Two explanations for this association are considered. One is a single-locus hypothesis, with hemoglobin allelic variation causing DPG variation, and the other is a two-locus hypothesis, with marked linkage disequilibrium.

Expression and purification of recombinant hemoglobin in Escherichia coli

DEFF Research Database (Denmark)

Natarajan, Chandrasekhar; Jiang, Xiaoben; Fago, Angela

2011-01-01

BACKGROUND: Recombinant DNA technologies have played a pivotal role in the elucidation of structure-function relationships in hemoglobin (Hb) and other globin proteins. Here we describe the development of a plasmid expression system to synthesize recombinant Hbs in Escherichia coli, and we describe...... a protocol for expressing Hbs with low intrinsic solubilities. Since the alpha- and beta-chain Hbs of different species span a broad range of solubilities, experimental protocols that have been optimized for expressing recombinant human HbA may often prove unsuitable for the recombinant expression......-translational modifications. CONCLUSION/SIGNIFICANCE: Our protocol should prove useful for the experimental study of recombinant Hbs in many non-human animals. One of the chief advantages of our protocol is that we can express soluble recombinant Hb without co-expressing molecular chaperones, and without the need...

ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

Directory of Open Access Journals (Sweden)

Marco Gabbianelli

2009-11-01

In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

Science.gov (United States)

Crielaard, Bart J; Rivella, Stefano

2014-06-01

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Relative deformability of red blood cells in sickle cell trait and sickle cell anemia by trapping and dragging

Science.gov (United States)

Solomon, Rance; Cooper, James; Welker, Gabriel; Aguilar, Elaura; Flanagan, Brooke; Pennycuff, Chelsey; Scott, David; Farone, Anthony; Farone, Mary; Erenso, Daniel; Mushi, Robert; del Pilar Aguinaga, Maria

2013-06-01

Genetic mutation of the β-globin gene or inheritance of this mutated gene changes the chemical composition of the oxygen-carrying hemoglobin molecule that could lead to either the heterozygote genotype, resulting in sickle cell trait (SCT), or the homozygote genotype, resulting in sickle cell anemia (SCA). These mutations could affect the reversible elastic deformations of the red blood cells (RBCs) which are vital for biological functions. We have investigated this effect by studying the differences in the deformability of RBCs from blood samples of an individual with SCT and an untreated patient with SCA along with hemoglobin quantitation of each blood sample. Infrared 1064 nm laser trap force along with drag shear force are used to induce deformation in the RBCs. Ultra2-High Performance Liquid Chromatography (UHPLC) is used for the hemoglobin quantitation.

Dificuldades na identificação laboratorial da talassemia alfa Difficulty on laboratory identification of alpha thalassemia

Directory of Open Access Journals (Sweden)

Karlla Greick Batista Dias-Penna

2010-04-01

Full Text Available Introdução: Talassemia alfa é uma síndrome associada à redução da síntese de cadeias de globina do tipo alfa. A gravidade das manifestações clínicas está relacionada com a quantidade de globinas produzida e a estabilidade das cadeias beta presentes em excesso. A talassemia alfa mínima resulta da deleção de apenas um dos quatro genes a (-α/αα. Clinicamente apresenta anemia leve com microcitose ou ausência de anemia, sendo o diagnóstico realizado por meio de visualização da hemoglobina (Hb H por eletroforese alcalina em acetato de celulose ou por identificação de inclusões celulares de Hb H coradas pelo azul de crezil brilhante. Objetivo: Avaliar portadores de talassemia alfa e seus respectivos progenitores, correlacionando perfil hematológico e presença de Hb H, utilizando procedimentos laboratoriais clássicos em três diferentes amostragens. Discussão e conclusão: Os dados obtidos mostram que a presença de Hb H, indicativo de talassemia alfa, pode não ser confirmada em uma análise posterior. Entre os fatores que podem influenciar no não aparecimento de Hb H em pessoa comprovadamente com talassemia alfa está a deficiência de ferro. A talassemia alfa está associada a defeitos envolvendo os genes codificadores da cadeia alfa, mas também pode estar relacionada com desbalanciamento temporário na expressão dos genes globina, diminuição de alfa ou aumento de beta, o que poderia explicar o aparecimento de tetrâmeros de cadeia beta (Hb H, sugerindo diagnóstico de talassemia alfa mínima.Introduction: Alpha thalassemia is a syndrome with associated with the reduction of alpha globin chain synthesis. The severity of clinical manifestations is related to the amount of globins produced and the stability of beta chains that are present in excess. Alpha thalassemia minor is caused by the deletion of one of the four genes a (-α/αα. Clinically, it presents mild anemia with microcytosis or absence of anemia. The

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

Science.gov (United States)

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Functional and structural analysis of the DNA sequence conferring glucocorticoid inducibility to the mouse mammary tumor virus gene

International Nuclear Information System (INIS)

Skroch, P.

1987-05-01

In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de

Hemoglobin Wayne Trait with Incidental Polycythemia.

Science.gov (United States)

Ambelil, Manju; Nguyen, Nghia; Dasgupta, Amitava; Risin, Semyon; Wahed, Amer

2017-01-01

Hemoglobinopathies, caused by mutations in the globin genes, are one of the most common inherited disorders. Many of the hemoglobin variants can be identified by hemoglobin analysis using conventional electrophoresis and high performance liquid chromatography; however hemoglobin DNA analysis may be necessary in other cases for confirmation. Here, we report a case of a rare alpha chain hemoglobin variant, hemoglobin Wayne, in a 47-year-old man who presented with secondary polycythemia. Capillary zone electrophoresis and high performance liquid chromatography revealed a significant amount of a hemoglobin variant, which was further confirmed by hemoglobin DNA sequencing as hemoglobin Wayne. Since the patient was not homozygous for hemoglobin Wayne, which is associated with secondary polycythemia, the laboratory diagnosis in this case was critical in ruling out hemoglobinopathy as the etiology of his polycythemia. © 2017 by the Association of Clinical Scientists, Inc.

Human papillomavirus (HPV types 16, 18, 31, 45 DNA loads and HPV-16 integration in persistent and transient infections in young women

Directory of Open Access Journals (Sweden)

Ferenczy Alex

2010-11-01

Full Text Available Abstract Background HPV burden is a predictor for high-grade cervical intraepithelial neoplasia and cancer. The natural history of HPV load in young women being recently exposed to HPV is described in this paper. Methods A total of 636 female university students were followed for 2 years. Cervical specimens with HPV-16, -18, -31, or -45 DNA by consensus PCR were further evaluated with type-specific and β-globin real-time PCR assays. Proportional hazards regression was used to estimate hazard ratios (HR of infection clearance. Generalized estimating equations assessed whether HPV loads was predictive of HPV infection at the subsequent visit. Results HPV loads were consistently higher among women Conclusions The association between HPV load and persistence is not uniform across high-risk genital genotypes. HPV-16 integration was only rarely demonstrated in young women.

Technology Optimization of Lysozyme's Fresh Maintaining Effect on Apple.

Science.gov (United States)

Jun-Hong, Liu; Kun-Yu, Wang

2016-10-03

Lysozyme is a kind of alkaline globin, which functions well in the degradation of the cell wall of microbe. Currently, lysozyme is widely used in various fields, such as medicine, fruit, and vegetable industry, dairy industry, and so on. Therefore, the exploitation and utilization of lysozyme is of significant economic benefit. Taking apple as material, weight loss ratio and reducing sugar content as objectives, this paper studied the fresh-keeping effect of lysozyme. Influential factors, lysozyme concentration, soaking time, modified temperature, and reaction time were discussed in detail. The results showed that reducing sugar content was 2.043% and the weight loss ratio was the minimum in the presence of soaking time of 2 min, modified temperature of 65 °C, reaction time of 4 d, and lysozyme concentration of 0.5 g/L. © 2016 Institute of Food Technologists®.

Moessbauer spectroscopic evidence on the heme binding to the proximal histidine in unfolded carbonmonoxy myoglobin by guanidine hydrochloride

Energy Technology Data Exchange (ETDEWEB)

Harami, Taikan, E-mail: harami.taikan@jaea.go.jp [Japan Atomic Energy Agency (Japan); Kitao, Shinji; Kobayashi, Yasuhiro [Kyoto University, Research Reactor Institute (Japan); Mitsui, Takaya [Japan Atomic Energy Agency (Japan)

2008-01-15

The unfolded heme structure in myoglobin is controversial because of no chance of direct X-ray structure analyses. The unfolding of carbonmonoxy myoglobin (MbCO) by guanidine hydrochloride (GdnHCl) was studied by the Moessbauer spectroscopy. The spectra show the presence of a sort of spectrum in the unfolded MbCO, independent on the concentration of GdnHCl from 1 to 6 M and the increase of the fraction of unfolded MbCO, depending on the GdnHCl concentration. The isomer shift of the iron of heme in the unfolded MbCO was identified to be different from that of the native MbCO as the globin structure in Mb collapses under the unfolded conditions. This result and the existing related Moessbauer data proved that the heme in the unfolded MbCO may remain coordinated to the proximal histidine.

Influence of βS-Globin Haplotypes and Hydroxyurea on Arginase I Levels in Sickle Cell Disease

Directory of Open Access Journals (Sweden)

J. A. Moreira

2016-01-01

Full Text Available Introduction. Sickle cell disease (SCD is characterized by hemoglobin S homozygosity, leading to hemolysis and vasoocclusion. The hemolysis releases arginase I, an enzyme that decreases the bioavailability of nitric oxide, worsening the symptoms. The different SCD haplotypes are related to clinical symptoms and varied hemoglobin F (HbF concentration. The aim of this study was to evaluate the impact of the βS gene haplotypes and HbF concentration on arginase I levels in SCD patients. Methods. Fifty SCD adult patients were enrolled in the study and 20 blood donors composed the control group. Arginase I was measured by ELISA. The βS haplotypes were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. Statistical analyses were performed with GraphPad Prism program and the significance level was p<0.05. Results. Significant increase was observed in the arginase I levels in SCD patients compared to the control group (p<0.0001. The comparison between the levels of arginase I in three haplotypes groups showed a difference between the Bantu/Bantu × Bantu/Benin groups; Bantu/Bantu × Benin/Benin, independent of HU dosage. An inverse correlation with the arginase I levels and HbF concentration was observed. Conclusion. The results support the hypothesis that arginase I is associated with HbF concentration, also measured indirectly by the association with haplotypes.

GENETIC HETEROGENEITY OF BETA GLOBIN MUTATIONS AMONG ASIAN-INDIANS AND IMPORTANCE IN GENETIC COUNSELLING AND DIAGNOSIS

Directory of Open Access Journals (Sweden)

Ravindra Kumar

2013-01-01

Full Text Available There are an estimated 45 million carriers of β-thalassemia trait and about 12,000-15,000 infants with β-thalassemia major are born every year in India. The consanguinity rates are higher in India, and thalassemia major constitutes a significant burden on the health care system. In present study, β-thalassemia mutations were characterized in 300 thalassemia cases from 2007 to 2010 using ARMS-PCR and DNA sequencing. The five most common mutations accounted 79.3% of the studied chromosomes that includes IVS1-5(G>C, Cod 41-42(-TCTT, Cod8-9(+G, Cod16(-C and 619bp del. Though IVS1-5(G>C is most common mutation when all the communities were included, the percentage prevalence were calculated on sub caste basis and found that IVS1-5(G>C percentage prevalence varied from 25 to 60 in Aroras & Khatris and Thakur respectively. Interestingly Cod41-42(-TCTT mutation which is the second commonest among the mutations reported was totally absent in Kayasthas and Muslim community. These findings have implications for providing molecular diagnosis, genetic counseling and prenatal diagnosis to high risk couples of β-thalassemia.

A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

OpenAIRE

Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David

1989-01-01

textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...

A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

NARCIS (Netherlands)

D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)

1989-01-01

textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell

Closely linked polymorphic marker: successful application in preimplantation genetic diagnosis for beta-thalassemia%紧密连锁的多态性位点在β地中海贫血植入前遗传学诊断中的应用

Institute of Scientific and Technical Information of China (English)

邓捷; 庄广伦; 彭文林; 周灿权; 李洁; 方丛; 李穗萍; 陈勇; 童大跃

2005-01-01

目的探讨与β珠蛋白基因紧密连锁的多态性位点 HumTH01在β地中海贫血(β地贫)植入前遗传学诊断(preimplantation genetic diagnosis,PGD)中的作用.方法对4例已出生重型β地贫患儿的、双方均为β地贫基因携带者的夫妇进行了6个周期的PGD治疗,应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因,选择健康的胚胎移植入子宫.结果 6个周期共活检44个胚胎,获得44个卵裂球,其中41个卵裂球扩增成功,35个胚胎经PCR分析后获得明确诊断,移植了14个胚胎,获得1例临床妊娠.孕17周时经脐带血穿刺,证实为完全正常胚胎,现已出生一正常女婴.单个卵裂球平均扩增效率为89.7%,等位基因脱扣(allele drop-out, ADO)率为14.4%. HumTH01基因可以帮助检测出ADO及污染的发生.结论本研究为国内首次报道应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因对β地贫进行植入前遗传学诊断并成功获得临床妊娠.在PGD中同时检测与β珠蛋白基因紧密连锁的多态性位点可以降低PGD中由于ADO及污染造成的误诊的风险.%Objective To evaluate the applicability of the polymorphic marker closely linked with beta-globin gene for the preimplantati on genetic diagnosis (PGD) in couples at risk of having child with beta-thalassemia. Methods Single cell multiplex nested PCR which coamplifies the beta-globin gene and the closely linked polymorphic marker, HumTHO1 gene, was applied in six clinical PGD cycles for four couples with beta-thalassemia. Results In six clinical PGD cycles, a total of 44 embryos were biopsied and 44 blastomeres were obtained. Forty-one blastomeres were amplified and thirty-five embryos were given definite diagnoses. Fourteen embryos were transferred back to the uterus of the patients and one pregnancy went on well and ended with one live healthy birth, which confirmed the results of PGD. The average amplification efficiency of single blastomere was 89.7% and

Common Β- Thalassaemia Mutations in

Directory of Open Access Journals (Sweden)

P Azarfam

2005-01-01

Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

Amphitrite ornata dehaloperoxidase (DHP): investigations of structural factors that influence the mechanism of halophenol dehalogenation using "peroxidase-like" myoglobin mutants and "myoglobin-like" DHP mutants.

Science.gov (United States)

Du, Jing; Huang, Xiao; Sun, Shengfang; Wang, Chunxue; Lebioda, Lukasz; Dawson, John H

2011-09-27

Dehaloperoxidase (DHP), discovered in the marine terebellid polychaete Amphitrite ornata, is the first heme-containing globin with a peroxidase activity. The sequence and crystal structure of DHP argue that it evolved from an ancient O(2) transport and storage globin. Thus, DHP retains an oxygen carrier function but also has the ability to degrade halophenol toxicants in its living environment. Sperm whale myoglobin (Mb) in the ferric state has a peroxidase activity ∼10 times lower than that of DHP. The catalytic activity enhancement observed in DHP appears to have been generated mainly by subtle changes in the positions of the proximal and distal histidine residues that appeared during DHP evolution. Herein, we report investigations into the mechanism of action of DHP derived from examination of "peroxidase-like" Mb mutants and "Mb-like" DHP mutants. The dehalogenation ability of wild-type Mb is augmented in the peroxidase-like Mb mutants (F43H/H64L, G65T, and G65I Mb) but attenuated in the Mb-like T56G DHP variant. X-ray crystallographic data show that the distal His residues in G65T Mb and G65I are positioned ∼0.3 and ∼0.8 Å, respectively, farther from the heme iron compared to that in the wild-type protein. The H93K/T95H double mutant Mb with the proximal His shifted to the "DHP-like" position has an increased peroxidase activity. In addition, a better dehaloperoxidase (M86E DHP) was generated by introducing a negative charge near His89 to enhance the imidazolate character of the proximal His. Finally, only minimal differences in dehalogenation activities are seen among the exogenous ligand-free DHP, the acetate-bound DHP, and the distal site blocker L100F DHP mutant. Thus, we conclude that binding of halophenols in the internal binding site (i.e., distal cavity) is not essential for catalysis. This work provides a foundation for a new structure-function paradigm for peroxidases and for the molecular evolution of the dual-function enzyme DHP.

Amphitrite ornata Dehaloperoxidase (DHP): Investigations of Structural Factors That Influence the Mechanism of Halophenol Dehalogenation Using ;Peroxidase-like; Myoglobin Mutants and ;Myoglobin-like; DHP Mutants

Energy Technology Data Exchange (ETDEWEB)

Du, Jing; Huang, Xiao; Sun, Shengfang; Wang, Chunxue; Lebioda, Lukasz; Dawson, John H. (SC)

2012-05-14

Dehaloperoxidase (DHP), discovered in the marine terebellid polychaete Amphitrite ornata, is the first heme-containing globin with a peroxidase activity. The sequence and crystal structure of DHP argue that it evolved from an ancient O{sub 2} transport and storage globin. Thus, DHP retains an oxygen carrier function but also has the ability to degrade halophenol toxicants in its living environment. Sperm whale myoglobin (Mb) in the ferric state has a peroxidase activity {approx}10 times lower than that of DHP. The catalytic activity enhancement observed in DHP appears to have been generated mainly by subtle changes in the positions of the proximal and distal histidine residues that appeared during DHP evolution. Herein, we report investigations into the mechanism of action of DHP derived from examination of 'peroxidase-like' Mb mutants and 'Mb-like' DHP mutants. The dehalogenation ability of wild-type Mb is augmented in the peroxidase-like Mb mutants (F43H/H64L, G65T, and G65I Mb) but attenuated in the Mb-like T56G DHP variant. X-ray crystallographic data show that the distal His residues in G65T Mb and G65I are positioned {approx}0.3 and {approx}0.8 {angstrom}, respectively, farther from the heme iron compared to that in the wild-type protein. The H93K/T95H double mutant Mb with the proximal His shifted to the 'DHP-like' position has an increased peroxidase activity. In addition, a better dehaloperoxidase (M86E DHP) was generated by introducing a negative charge near His89 to enhance the imidazolate character of the proximal His. Finally, only minimal differences in dehalogenation activities are seen among the exogenous ligand-free DHP, the acetate-bound DHP, and the distal site blocker L100F DHP mutant. Thus, we conclude that binding of halophenols in the internal binding site (i.e., distal cavity) is not essential for catalysis. This work provides a foundation for a new structure-function paradigm for peroxidases and for the

Radical transfer between proteins: role of tyrosine, tryptophan and protein peroxyl radicals

International Nuclear Information System (INIS)

Irwin, J.A.; Ostdal, H.; Davies, M.J.

1998-01-01

Reaction of the Fe(III) forms of the heme proteins myoglobin (Mb) and horseradish peroxidase (HRP) with H 2 O 2 gives rise to high-oxidation-state heme-derived species which can be described as a Fe(IV)-oxo porphyrin radical-cation ('Compound 1'). In the case of Mb, the Fe(IV)-oxo porphyrin radical-cation undergoes rapid electron transfer with the surrounding protein to give protein (globin)-derived radicals and an Fe(lV)-oxo species ('Compound 2'). The globin-derived radicals have been shown to be located at two (or more) sites: Tyr-103 or Trp-14, with the latter radical known to react with oxygen to give a Trp-derived peroxyl radical (Mb-Trp-OO*). With HRP, the Fe(lV)-oxo porphyrin radical-cation carries out two successive one-electron oxidation reactions at the exposed heme edge to give firstly 'Compound 2' [the Fe(lV)oxo species] and then the resting Fe(III) state of the enzyme. n this study we have investigated whether the Trp-14 peroxyl radical from Mb and the Compound 1 and 2 species from HRP (in the absence and presence of free Tyr) can oxidise amino acids, peptides and proteins. Such reactions constitute intermolecular protein-to-protein radical transfer reactions and hence protein chain-oxidation. We have also examined whether these oxidants react with antioxidants. Reaction of these heme-protein derived oxidants with amino acids, proteins and antioxidants has been carried out at room temperature for defined periods of time before freeze-quenching to 77K to halt reaction. The radical species present in the reaction system at the time of freezing were subsequently examined by EPR spectroscopy at 77K. Three free amino acids, Tyr, Trp and Cys (with Cys the least efficient) have been shown to react rapidly with Mb-Trp-OO*, as evidenced by the loss of the characteristic EPR features of Mb-Trp-OO* on inclusion of increasing concentrations of the amino acids. All other amino acids are much less reactive. Evidence has also been obtained for (inefficient) hydrogen

α-thalassaemia

Directory of Open Access Journals (Sweden)

Higgs Douglas R

2010-05-01

Full Text Available Abstract Alpha-thalassaemia is inherited as an autosomal recessive disorder characterised by a microcytic hypochromic anaemia, and a clinical phenotype varying from almost asymptomatic to a lethal haemolytic anaemia. It is probably the most common monogenic gene disorder in the world and is especially frequent in Mediterranean countries, South-East Asia, Africa, the Middle East and in the Indian subcontinent. During the last few decades the incidence of alpha thalassaemia in North-European countries and Northern America has increased because of demographic changes. Compound heterozygotes and some homozygotes have a moderate to severe form of alpha thalassaemia called HbH disease. Hb Bart's hydrops foetalis is a lethal form in which no alpha-globin is synthesized. Alpha thalassaemia most frequently results from deletion of one or both alpha genes from the chromosome and can be classified according to its genotype/phenotype correlation. The normal complement of four functional alpha-globin genes may be decreased by 1, 2, 3 or all 4 copies of the genes, explaining the clinical variation and increasing severity of the disease. All affected individuals have a variable degree of anaemia (low Hb, reduced mean corpuscular haemoglobin (MCH/pg, reduced mean corpuscular volume (MCV/fl and a normal/slightly reduced level of HbA2. Molecular analysis is usually required to confirm the haematological observations (especially in silent alpha-thalassaemia and alpha-thalassaemia trait. The predominant features in HbH disease are anaemia with variable amounts of HbH (0.8-40%. The type of mutation influences the clinical severity of HbH disease. The distinguishing features of the haemoglobin Bart's hydrops foetalis syndrome are the presence of Hb Bart's and the total absence of HbF. The mode of transmission of alpha thalassaemia is autosomal recessive. Genetic counselling is offered to couples at risk for HbH disease or haemoglobin Bart's Hydrops Foetalis Syndrome

Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion

Directory of Open Access Journals (Sweden)

Sandra Capellera-Garcia

2016-06-01

Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.

Molecular identification of Sicilian (dߺ-thalassemia associated with ß-thalassemia and hemoglobin S in Brazil

Directory of Open Access Journals (Sweden)

Andrade T.G. de

2002-01-01

Full Text Available We describe the clinical and molecular characteristics of two unrelated Brazilian families with an association of the Sicilian form of (deltaߺ-thalassemia with hemoglobin S and ß-thalassemia. Direct sequencing of the ß-globin gene showed only the hemoglobin S mutation in patient 1 and the ß-thalassemia IVS1-110 in patient 2. The other allele was deleted in both patients and PCR of DNA samples of the breakpoint region of both patients showed a band of approximately 1,150 bp, expected to be observed in the DNA of carriers of Sicilian (deltaߺ-thalassemia. The nucleotide sequence of this fragment confirmed the Sicilian deletion. There are few reports concerning the Hb S/(deltaߺ-thalassemia association and patient 2 is the first reported case of Sicilian type of (deltaߺ-thalassemia in association with ß-thalassemia documented at the molecular level.

An Atomistic View on Human Hemoglobin Carbon Monoxide Migration Processes

Science.gov (United States)

Lucas, M. Fátima; Guallar, Víctor

2012-01-01

A significant amount of work has been devoted to obtaining a detailed atomistic knowledge of the human hemoglobin mechanism. Despite this impressive research, to date, the ligand diffusion processes remain unclear and controversial. Using recently developed computational techniques, PELE, we are capable of addressing the ligand migration processes. First, the methodology was tested on myoglobin's CO migration, and the results were compared with the wealth of theoretical and experimental studies. Then, we explored both hemoglobin tense and relaxed states and identified the differences between the α-and β-subunits. Our results indicate that the proximal site, equivalent to the Xe1 cavity in myoglobin, is never visited. Furthermore, strategically positioned residues alter the diffusion processes within hemoglobin's subunits and suggest that multiple pathways exist, especially diversified in the α-globins. A significant dependency of the ligand dynamics on the tertiary structure is also observed. PMID:22385860

Musculoskeletal manifestations in sickle cell anemia

Directory of Open Access Journals (Sweden)

Reddy Ravikanth

2017-01-01

Full Text Available Sickle cell anemia is an inherited hemoglobin disorder characterized by substitution of glutamic acid by valine at the sixth position of the beta globin chain. The sequence of events leads to pain crisis. Ischemia of the tissues resulting from decreased blood flow is believed to occur in pain crisis. Repeated or prolonged sickling causes red cell death in the form of hemolytic anemia. The majority of hospital admissions are due to painful crisis. These patients are at increased risk for both osteomyelitis and infarction of the long bones. Magnetic resonance imaging has been shown to be helpful in the diagnosis of early osteomyelitis and its differentiation from infarction in sickle cell disease patients with acute bone crisis. Others findings include dactylitis, medullary infarcts, diploic space widening, fish mouth vertebrae, and avascular necrosis. We present a case series on the various musculoskeletal manifestations of sickle cell disease.

Prenatal diagnosis of hemoglobinopathies: from fetoscopy to coelocentesis

Directory of Open Access Journals (Sweden)

Gianfranca Damiani

2014-09-01

Full Text Available Prenatal diagnosis of hemoglobinopathies involves the study of fetal material from blood, amniocytes, trophoblast coelomatic cells and fetal DNA in maternal circulation. Its first application dates back to the 70s and it involves globin chain synthesis analysis on fetal blood. In the 1980s molecular analysis was introduced as well as amniocentesis and chorionic villi sampling under high-resolution ultrasound imaging. The application of direct sequencing and polymerase chain reactionbased methodologies improved the DNA analysis procedures and reduced the sampling age for invasive prenatal diagnosis from 18 to 16- 11 weeks allowing fetal genotyping within the first trimester of pregnancy. In the last years, fetal material obtained at 7-8 weeks of gestation by coelocentesis and isolation of fetal cells has provided new platforms on which to develop diagnostic capabilities while non-invasive technologies using fetal DNA in maternal circulation are starting to develop.

Finding Order in Randomness: Single-Molecule Studies Reveal Stochastic RNA Processing | Center for Cancer Research

Science.gov (United States)

Producing a functional eukaryotic messenger RNA (mRNA) requires the coordinated activity of several large protein complexes to initiate transcription, elongate nascent transcripts, splice together exons, and cleave and polyadenylate the 3’ end. Kinetic competition between these various processes has been proposed to regulate mRNA maturation, but this model could lead to multiple, randomly determined, or stochastic, pathways or outcomes. Regulatory checkpoints have been suggested as a means of ensuring quality control. However, current methods have been unable to tease apart the contributions of these processes at a single gene or on a time scale that could provide mechanistic insight. To begin to investigate the kinetic relationship between transcription and splicing, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues employed a single-molecule RNA imaging approach to monitor production and processing of a human β-globin reporter gene in living cells.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

Directory of Open Access Journals (Sweden)

V Hallur

2015-01-01

Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Best practices for transfusion for patients with sickle cell disease

Directory of Open Access Journals (Sweden)

Ted Wun

2010-01-01

Full Text Available The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with Sickle Cell Disease (SCD Conference was to review the available published evidence and clinical experience surrounding the use of RBC transfusions for sickle cell disease by a panel of experts. The expert panel developed explicit clinical guidelines for the use of RBC in SCD patients. The panel also made recommendations for further research.  A set of guidelines were produced for dissemination to pertinent stakeholders. If implemented, these clinical pathways have the potential to optimize the use of red blood cell transfusions in SCD.

Best practices for transfusion for patients with sickle cell disease

Science.gov (United States)

Wun, Ted; Hassell, Kathryn

2010-01-01

The β-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with Sickle Cell Disease (SCD) Conference was to review the available published evidence and clinical experience surrounding the use of RBC transfusions for sickle cell disease by a panel of experts. The expert panel developed explicit clinical guidelines for the use of RBC in SCD patients. The panel also made recommendations for further research. A set of guidelines were produced for dissemination to pertinent stakeholders. If implemented, these clinical pathways have the potential to optimize the use of red blood cell transfusions in SCD.

Macular Amyloidosis and Epstein-Barr Virus

Directory of Open Access Journals (Sweden)

Yalda Nahidi

2016-01-01

Full Text Available Background. Amyloidosis is extracellular precipitation of eosinophilic hyaline material of self-origin with special staining features and fibrillar ultrastructure. Macular amyloidosis is limited to the skin, and several factors have been proposed for its pathogenesis. Detection of Epstein-Barr virus (EBV DNA in this lesion suggests that this virus can play a role in pathogenesis of this disease. Objective. EBV DNA detection was done on 30 skin samples with a diagnosis of macular amyloidosis and 31 healthy skin samples in the margin of removed melanocytic nevi by using PCR. Results. In patients positive for beta-globin gene in PCR, BLLF1 gene of EBV virus was positive in 23 patients (8 patients in case and 15 patients in the control group. There was no significant difference in presence of EBV DNA between macular amyloidosis (3.8% and control (23.8% groups (P=0.08. Conclusion. The findings of this study showed that EBV is not involved in pathogenesis of macular amyloidosis.

Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: New evidence for panselective evolution

Directory of Open Access Journals (Sweden)

Carlos Y Valenzuela

2010-01-01

Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.