Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M
1995-01-01
Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927
International Nuclear Information System (INIS)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.
1990-01-01
Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes
In vivo protein-DNA interactions at the β-globin gene locus
International Nuclear Information System (INIS)
Tohru Ikuta; Yuet Wai Kan
1991-01-01
The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells
Directory of Open Access Journals (Sweden)
Mir A Hossain
2016-01-01
Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.
Directory of Open Access Journals (Sweden)
Weiqun Lu
2011-01-01
Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.
Molecular nature of alpha-globin genes in the Saudi population
Directory of Open Access Journals (Sweden)
J. Francis Borgio
2015-11-01
Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.
Asynchronous DNA replication within the human β-globin gene locus
International Nuclear Information System (INIS)
Epner, E.; Forrester, W.C.; Groudine, M.
1988-01-01
The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks
DEFF Research Database (Denmark)
Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S
2008-01-01
Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...
Human γ-globin genes silenced independently of other genes in the β-globin locus.
N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Importance of globin gene order for correct developmental expression.
O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.
Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P
2009-12-01
Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.
International Nuclear Information System (INIS)
Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.
1988-01-01
The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation
Distinctive patterns of evolution of the δ-globin gene (HBD in primates.
Directory of Open Access Journals (Sweden)
Ana Moleirinho
Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates
Raftopoulos, H; Ward, M; Bank, A
1998-06-30
Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.
Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.
Raftopoulos, H; Ward, M; Leboulch, P; Bank, A
1997-11-01
Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.
International Nuclear Information System (INIS)
Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.
1988-01-01
The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells
Liebhaber, S A; Cash, F E; Main, D M
1985-01-01
alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...
Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.
Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein
2016-10-01
β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina
2018-01-01
The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430
Directory of Open Access Journals (Sweden)
Zulema Romero
Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.
Chicken globin gene transcription is cell lineage specific during the time of the switch
International Nuclear Information System (INIS)
Lois, R.; Martinson, H.G.
1989-01-01
Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position
Expression of human gamma-globin genes in human erythroleukemia (K562) cells.
Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A
1987-12-15
K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
Babiss, L E; Friedman, J M; Darnell, J E
1986-01-01
In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...
The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.
E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan
1983-01-01
textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA
International Nuclear Information System (INIS)
Helder, J.; Deisseroth, A.
1987-01-01
The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients
A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.
Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza
2014-07-01
In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)
2018-01-01
textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of
Position-independent high level expression of the human β-globin gene in transgenic mice.
F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)
1987-01-01
textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran
Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye
2017-01-01
Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378
Dominant control region of the human β- like globin gene cluster
Blom van Assendelft, Margaretha van
1989-01-01
The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work
Energy Technology Data Exchange (ETDEWEB)
Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others
1994-09-01
A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.
NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran
2018-05-10
Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.
Nonsense mutations in the human β-globin gene affect mRNA metabolism
International Nuclear Information System (INIS)
Baserga, S.J.; Benz, E.J. Jr.
1988-01-01
A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation
A phylogenomic profile of globins
Directory of Open Access Journals (Sweden)
Dewilde Sylvia
2006-04-01
Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.
International Nuclear Information System (INIS)
Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.
1987-01-01
Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11
Directory of Open Access Journals (Sweden)
Supachai Ekwattanakit
2012-01-01
Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.
A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.
Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques
2016-01-01
We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Geographical distribution of β-globin gene mutations in Syria.
Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A
2018-04-11
Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.
Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P
1986-02-01
A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.
International Nuclear Information System (INIS)
Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.
1987-01-01
The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations
P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)
2012-01-01
textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative
Sox6 directly silences epsilon globin expression in definitive erythropoiesis.
Directory of Open Access Journals (Sweden)
2006-02-01
Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
Directory of Open Access Journals (Sweden)
Giulia Breveglieri
2015-01-01
Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.
Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2015-01-01
Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845
M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan
1995-01-01
textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H
2016-01-01
Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.
Characterization of histone H3K27 modifications in the β-globin locus
International Nuclear Information System (INIS)
Kim, Yea Woon; Kim, AeRi
2011-01-01
Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.
Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K
2017-07-01
In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.
Molecular analysis of the human β-globin locus activation region
International Nuclear Information System (INIS)
Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.
1989-01-01
Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed
Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A
1993-03-01
When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.
Energy Technology Data Exchange (ETDEWEB)
Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.
2000-03-01
Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
Directory of Open Access Journals (Sweden)
Jorge S.B.
2003-01-01
Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.
A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)
1996-01-01
textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly
Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies
Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias
2003-01-01
The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...
Liebhaber, S A; Kan, Y W
1981-01-01
The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...
A membrane-bound vertebrate globin.
Directory of Open Access Journals (Sweden)
Miriam Blank
Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.
Directory of Open Access Journals (Sweden)
Anita Nadkarni
2013-02-01
Full Text Available The clinical presentation of b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and several polymorphisms located in the promoters of g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF in b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.
In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.
Directory of Open Access Journals (Sweden)
Mohammed Alanazi
Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid
the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia
International Nuclear Information System (INIS)
Abass, M.M.E.
2004-01-01
β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group
International Nuclear Information System (INIS)
Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.
1990-08-01
The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)
Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction
Directory of Open Access Journals (Sweden)
Čokić Vladan P.
2014-01-01
Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053
Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies
Directory of Open Access Journals (Sweden)
Rita de Cassia Mousinho-Ribeiro
2003-01-01
Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.
Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi
2005-11-01
Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.
International Nuclear Information System (INIS)
Moon, A.M.; Ley, T.J.
1990-01-01
DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR
The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.
Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel
2012-01-01
Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.
Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells
Czech Academy of Sciences Publication Activity Database
Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav
2004-01-01
Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004
Search for antisense copies of beta-globin mRNA in anemic mouse spleen
Directory of Open Access Journals (Sweden)
Taylor John M
2001-03-01
Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.
Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino
2015-04-01
Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F
2014-06-01
Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.
Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-01-01
Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.
Directory of Open Access Journals (Sweden)
Heesun Shin
Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA
International Nuclear Information System (INIS)
Studencki, A.B.; Wallace, R.B.
1984-01-01
The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence
Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.
Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi
Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.
Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip
2018-03-01
There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.
Investigation of benzo(a)pyrene-globin adducts
Energy Technology Data Exchange (ETDEWEB)
Wallin, H; Jeffre, A M; Santella, R M
1987-05-01
The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
International Nuclear Information System (INIS)
Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.
1991-01-01
The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained
Directory of Open Access Journals (Sweden)
Elza Miyuki Kimura
2015-04-01
Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.
Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice
DEFF Research Database (Denmark)
Runck, Amy M; Weber, Roy E.; Fago, Angela
2010-01-01
exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...
Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila
2015-03-01
Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events
Energy Technology Data Exchange (ETDEWEB)
Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)
1994-05-01
The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.
International Nuclear Information System (INIS)
Somaya, E.T.; Soliman, M.D
2010-01-01
The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C
2011-01-01
Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.
D'Surney, S. J.; Popp, R. A.
1992-01-01
Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
DEFF Research Database (Denmark)
Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y
2009-01-01
Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...
Spectrin interactions with globin chains in the presence of ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.
Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann
2012-01-01
International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.
Van Doorslaer, Sabine; Cuypers, Bert
2018-02-01
At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.
International Nuclear Information System (INIS)
EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.
2008-01-01
The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.
Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T
1983-01-01
We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...
Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks
Directory of Open Access Journals (Sweden)
Marcelo M. Santoro
2010-10-01
Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.
Role of novel and rare nucleotide substitutions of the β-globin gene
Directory of Open Access Journals (Sweden)
Margherita Vinciguerra
2012-11-01
Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。
Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues
International Nuclear Information System (INIS)
Shakin, S.H.; Liebhaber, S.A.
1987-01-01
The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation
Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo
2013-12-01
Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.
Hemoglobin genetics: recent contributions of GWAS and gene editing
Smith, Elenoe C.; Orkin, Stuart H.
2016-01-01
The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.
Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.
2014-01-01
β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Brain alpha- and beta-globin expression after intracerebral hemorrhage
He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua
2010-01-01
Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...
DEFF Research Database (Denmark)
Leffers, H; Navarro, V M; Nielsen, John E
2006-01-01
Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...
Directory of Open Access Journals (Sweden)
Ze Tian
Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.
Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein
International Nuclear Information System (INIS)
Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.
1988-01-01
In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes
Recent trends in the gene therapy of β-thalassemia
Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto
2015-01-01
The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641
Directory of Open Access Journals (Sweden)
Lesley Tilleman
Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.
Gene Therapy Approaches to Hemoglobinopathies.
Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio
2017-10-01
Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Oxygen binding properties of non-mammalian nerve globins
DEFF Research Database (Denmark)
Hundahl, Christian; Fago, Angela; Dewilde, Sylvia
2006-01-01
Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...
alpha-Globin genes: thalassemic and structural alterations in a Brazilian population
Directory of Open Access Journals (Sweden)
M.R.S.C. Wenning
2000-09-01
Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.
Directory of Open Access Journals (Sweden)
Marta Durlak
Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)
1999-01-01
textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch
The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.
Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N
1985-01-01
The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak
2016-01-01
Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Chromatin loops, gene positioning, and gene expression
Holwerda, S.; de Laat, W.
2012-01-01
Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin
LDB1-mediated enhancer looping can be established independent of mediator and cohesin.
Krivega, Ivan; Dean, Ann
2017-08-21
Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen
1993-03-01
We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.
The 3D chromatin structure of the mouse β-haemoglobin gene cluster
M.P.C. van de Corput (Mariëtte); T.A. Knoch (Tobias); E. de Boer (Ernie); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)
2010-01-01
textabstractHere we show a 3D DNA-FISH method to visualizes the 3D structure of the β-globin locus. Geometric size and shape measurements of the 3D rendered signals (128Kb) show that the volume of the β-globin locus decreases almost two fold upon gene activation. A decrease in length and a
International Nuclear Information System (INIS)
Popp, R.A.; Marsh, C.L.; Skow, L.C.
1981-01-01
Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues
Coordinate expression of heme and globin is essential for effective erythropoiesis.
Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L
2015-12-01
Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.
Comparative genomics of neuroglobin reveals its early origins.
Directory of Open Access Journals (Sweden)
Jasmin Dröge
Full Text Available Neuroglobin (Ngb is a hexacoordinated globin expressed mainly in the central and peripheral nervous system of vertebrates. Although several hypotheses have been put forward regarding the role of neuroglobin, its definite function remains uncertain. Ngb appears to have a neuro-protective role enhancing cell viability under hypoxia and other types of oxidative stress. Ngb is phylogenetically ancient and has a substitution rate nearly four times lower than that of other vertebrate globins, e.g. hemoglobin. Despite its high sequence conservation among vertebrates Ngb seems to be elusive in invertebrates.We determined candidate orthologs in invertebrates and identified a globin of the placozoan Trichoplax adhaerens that is most likely orthologous to vertebrate Ngb and confirmed the orthologous relationship of the polymeric globin of the sea urchin Strongylocentrotus purpuratus to Ngb. The putative orthologous globin genes are located next to genes orthologous to vertebrate POMT2 similarly to localization of vertebrate Ngb. The shared syntenic position of the globins from Trichoplax, the sea urchin and of vertebrate Ngb strongly suggests that they are orthologous. A search for conserved transcription factor binding sites (TFBSs in the promoter regions of the Ngb genes of different vertebrates via phylogenetic footprinting revealed several TFBSs, which may contribute to the specific expression of Ngb, whereas a comparative analysis with myoglobin revealed several common TFBSs, suggestive of regulatory mechanisms common to globin genes.Identification of the placozoan and echinoderm genes orthologous to vertebrate neuroglobin strongly supports the hypothesis of the early evolutionary origin of this globin, as it shows that neuroglobin was already present in the placozoan-bilaterian last common ancestor. Computational determination of the transcription factor binding sites repertoire provides on the one hand a set of transcriptional factors that are
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
DEFF Research Database (Denmark)
Troelsen, J T; Mehlum, A; Spodsberg, N
1994-01-01
Adult-type hypolactasia is a genetic condition making approximately one half of the human population intolerant to milk because of abdominal symptoms. The cause is a post-weaning down-regulation of the intestinal-specific enzyme lactase-phlorizin hydrolase (LPH) reducing the intestinal capacity...... to hydrolyze lactose. We here demonstrate that the stretch -17 to -994 in the pig LPH-promoter carries cis-elements which direct a small intestinal-specific expression and a post-weaning decline of a linked rabbit beta-globin gene. These data demonstrate that the post-weaning decline of LPH is mainly due...
Weickert, M J; Pagratis, M; Curry, S R; Blackmore, R
1997-01-01
Accumulation of soluble recombinant hemoglobin (rHb1.1) in Escherichia coli requires proper protein folding, prosthetic group (heme) addition, and subunit assembly. This served as a new model system for the study of the effects of temperature, protein synthesis rates, and protein accumulation rates on protein solubility in E. coli. Fermentation expression of rHb1.1 at 30 degrees C from cultures containing a medium or high globin gene dosage (pBR-based or pUC-based plasmids with rHb1.1 genes under the control of the tac promoter) was compared. A medium gene dosage resulted in rHb1.1 accumulating to approximately 7% of the soluble cell protein, of which 78% was soluble. A high globin gene dosage resulted in a > or = 3-fold increase in total globin to 23 to 24% of the soluble cell protein, but 70% was insoluble. Accumulation of insoluble rHb1.1 began immediately upon induction. The proportion of rHb1.1 from the high globin gene dosage that accumulated as insoluble globin was affected by reducing (i) the inducer concentration and (ii) the temperature. Reducing the inducer concentration reduced globin synthesis up to eightfold but increased the proportion of soluble rHb1.1 to 93%. In contrast, total globin protein synthesis was barely affected by reducing the temperature from 30 to 26 degrees C, while soluble globin accumulation increased > 2-fold to approximately 15% of the soluble cell protein. The contrast between the effects of reducing rates of protein synthesis and accumulation and those of reducing temperature suggests that lower temperature stabilizes one or more folding intermediates. We propose a simplified physical model which integrates protein synthesis, folding, and heme association. This model shows that temperature-dependent apoglobin stability is the most critical factor in soluble rHb1.1 accumulation. PMID:9361418
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data
DEFF Research Database (Denmark)
Kannan, Soumya; Sams, Thomas; Maury, Jérôme
2018-01-01
activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...
Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M
1988-01-01
We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...
Precise regulation of gene expression dynamics favors complex promoter architectures.
Directory of Open Access Journals (Sweden)
Dirk Müller
2009-01-01
Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.
A Family with γ-Thalassemia and High Hb A2 Levels.
Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna
2016-06-01
We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.
Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.
Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe
2010-09-16
The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.
Recent trends in the gene therapy of β-thalassemia
Directory of Open Access Journals (Sweden)
Finotti A
2015-02-01
Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
Viral promoters can initiate expression of toxin genes introduced into Escherichia coli
Directory of Open Access Journals (Sweden)
Jacob Daniela
2005-06-01
Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters
Directory of Open Access Journals (Sweden)
Gagniuc Paul
2012-09-01
Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
International Nuclear Information System (INIS)
Takahashi, Noria; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko
1992-10-01
An analysis of the ATTTT repeat polymorphism located approximately 1,400 base pairs upstream from the β-globin structural gene was carried out by denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes. Genomic or cloned DNAs were digested with restriction enzymes and hybridized with 32 P-labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. A difference in the number of repeat units was recognized by differences in duplex mobility on the DGGE gel. In this study of 81 unrelated Japanese from Hiroshima, a sequence heteromorphism was observed at this site. Alleles with 5 and 6 repeats of the ATTTT unit, which had already been reported, were found in polymorphic proportions. In addition, two unreported alleles, one having 7 repeats and the other having an A-to-G nucleotide substitution in the 5th repeat, were detected. Family study data showed that the segregation of these four types of variants is consistent with an autosomal codominant mode of inheritance. This study also demonstrated that DGGE of RNA:DNA duplexes is a sensitive tool for detecting variations in DNA. (author)
Directory of Open Access Journals (Sweden)
Amanda J Grieco
Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.
Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...
African Journals Online (AJOL)
Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...
Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin
International Nuclear Information System (INIS)
Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.
1989-01-01
The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches
Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios
2012-01-01
Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313
Czech Academy of Sciences Publication Activity Database
Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.
2016-01-01
Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016
Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...
African Journals Online (AJOL)
Dilay Ciglidag Dungul
carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Directory of Open Access Journals (Sweden)
Elza M. Kimura
2009-01-01
Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.
Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...
African Journals Online (AJOL)
Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...
A novel BDNF gene promoter directs expression to skeletal muscle
Directory of Open Access Journals (Sweden)
Heinrich Gerhard
2003-06-01
Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.
Directory of Open Access Journals (Sweden)
Jianqing Pan
Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min
2012-07-15
Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.
Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).
Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H
1987-01-01
An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...
International Nuclear Information System (INIS)
Skroch, P.
1987-05-01
In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de
Chu, L Y; Rhoads, R E
1978-06-13
The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.
Energy Technology Data Exchange (ETDEWEB)
Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others
1995-12-01
T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.
A Survey of ABO, Rhesus (D) Antigen and Haemoglobin Genes ...
African Journals Online (AJOL)
olayemitoyin
transporting the bound oxygen throughout the body where it is used in ... the globin genes that alter the protein composition but not necessarily ... oxygen carrying capacity and hence the rate of aerobic metabolic ... to participate in the exercise.
Directory of Open Access Journals (Sweden)
Andrea Degl'Innocenti
Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings
Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M
1999-06-01
Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)
Directory of Open Access Journals (Sweden)
Gene A Morrill
2016-09-01
Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.
Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca
2015-01-01
β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.
Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...
African Journals Online (AJOL)
Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...
Expression of fully functional tetrameric human hemoglobin in Escherichia coli
International Nuclear Information System (INIS)
Hoffman, S.J.; Looker, D.L.; Roehrich, J.M.; Cozart, P.E.; Durfee, S.L.; Tedesco, J.L.; Stetler, G.L.
1990-01-01
Synthesis genes encoding the human α- and β-globin polypeptides have been expressed from a single operon in Escherichia coli. The α- and β-globin polypeptides associate into soluble tetramers, incorporate heme, and accumulate to >5% of the total cellular protein. Purified recombinant hemoglobin has the correct stoichiometry of α- and β-globin chains and contains a full complement of heme. Each globin chain also contains an additional methionine as an extension to the amino terminus. The recombinant hemoglobin has a C 4 reversed-phase HPLC profile essentially identical to that of human hemoglobin A 0 and comigrates with hemoglobin A 0 on SDS/PAGE. The visible spectrum and oxygen affinity are similar to that of native human hemoglobin A 0 . The authors have also expressed the α- and β-globin genes separately and found that the expression of the α-globin gene alone results in a marked decrease in the accumulation of α-globin in the cell. Separate expression of the β-globin gene results in high levels of insoluble β-globin. These observations suggest that the presence of α- and β-globin in the same cell stabilizes α-globin and aids the correct folding of β-globin. This system provides a simple method for expressing large quantities of recombinant hemoglobin and allows facile manipulation of the genes encoding hemoglobin to produce functionally altered forms of this protein
Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation
International Nuclear Information System (INIS)
Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.
2005-01-01
The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV
Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.
Directory of Open Access Journals (Sweden)
María Berdasco
Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Factor IX gene haplotypes in Amerindians.
Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S
1997-02-01
We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene
International Nuclear Information System (INIS)
Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.
Mapping the transcription termination region of the mouse immunoglobulin kappa gene
International Nuclear Information System (INIS)
Xu, M.; Garrard, W.T.
1986-01-01
To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream
Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina
Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue
2006-12-01
Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.
Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L
2016-05-11
Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.
Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique
2014-01-01
Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
A novel binary T-vector with the GFP reporter gene for promoter characterization.
Directory of Open Access Journals (Sweden)
Shu-Ye Jiang
Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.
Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer
Directory of Open Access Journals (Sweden)
V Shilpa
2014-01-01
Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka
2017-10-01
3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2015-01-01
Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...
Gene therapy for sickle cell disease: An update.
Demirci, Selami; Uchida, Naoya; Tisdale, John F
2018-05-30
Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.
The application of powerful promoters to enhance gene expression in industrial microorganisms.
Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen
2017-02-01
Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.
Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza
2018-04-01
Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.
Altered gene-expression profile in rat plasma and promoted body ...
African Journals Online (AJOL)
Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...
Directory of Open Access Journals (Sweden)
Gentil Claudino de Galiza Neto
2005-10-01
Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.
Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser
2017-03-01
Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
Energy Technology Data Exchange (ETDEWEB)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
1987-10-16
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.
Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina
2017-06-01
Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.
A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli
Directory of Open Access Journals (Sweden)
Li Mingji
2012-02-01
Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Two cloned β thalassemia genes are associated with amber mutations at codon 39
Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur
1981-01-01
Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453
Role of promoter element in c-mpl gene expression induced by TPO.
Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao
2013-01-01
Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.
Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate
International Nuclear Information System (INIS)
Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.
1980-01-01
A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Genes that cooperate with tumor promoters in transformation
International Nuclear Information System (INIS)
Colburn, N.H.; Smith, B.M.
1988-01-01
Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation
TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION
Directory of Open Access Journals (Sweden)
Amit Kumar
2013-06-01
Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of
Directory of Open Access Journals (Sweden)
Laura Breda
Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these
Gene Therapy in Thalassemia and Hemoglobinopathies
Breda, Laura; Gambari, Roberto; Rivella, Stefano
2009-01-01
Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
International Nuclear Information System (INIS)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Energy Technology Data Exchange (ETDEWEB)
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer
Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G
2017-11-26
Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License
The progress of tumor gene-radiotherapy induced by Egr-1 promoter
International Nuclear Information System (INIS)
Guo Rui; Li Biao
2010-01-01
The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)
International Nuclear Information System (INIS)
Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.
1988-01-01
Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).
Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.
2010-01-01
Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.
Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J
2018-05-01
Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.
Directory of Open Access Journals (Sweden)
Alexander Michael Bedford Johns
2016-10-01
Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Cloning and characterization of the human integrin β6 gene promoter.
Directory of Open Access Journals (Sweden)
Mingyan Xu
Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.
N-alkylvaline levels in globin as a new type of biomarker in risk assessment of alkylating agents.
Lewalter, J
1996-01-01
Adducts with the N-terminal valine of erythrocyte globin can serve as individual biomarkers of systemic and cellular exposure to endogenous and exogenous alkylating agents. In contrast to "detoxification markers" of this kind of mecapturic acids derived from alkylation of glutathione, individual N-alkylations of valine in globin reflect the formally "toxifying" part of the stress due to alkylating agents transformed into the ultimate toxicant. Thus, in contrast to the traditional methods of biological monitoring this approach enables a better evaluation of systemic exposure to reactive agents, adapted more sensibly to the exposure situation over the whole life span of erythrocytes, and it can serve as a specific biomarker of exposure for the purpose of health surveillance in occupational medicine. An individual evaluation of exposures in comparison with the range of corresponding background levels is discussed from the point of view of supplementary risk assessment in medical surveillance of occupationally exposed persons.
International Nuclear Information System (INIS)
Depto, A.S.; Stenberg, R.M.
1989-01-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
Directory of Open Access Journals (Sweden)
Xiaolei Li
Full Text Available OBJECTIVES: Hemoglobin (Hgb is the main oxygen and carbon dioxide carrier in cells of erythroid lineage and is responsible for oxygen delivery to the respiring tissues of the body. However, Hgb is also expressed in nonerythroid cells. In the present study, the expression of Hgb in human uterine cervix carcinoma cells and its role in cervical cancer were investigated. METHODOLOGY: The expression level of Hgb in cervical cancer tissues was assessed by quantitative reverse transcriptase-PCR (qRT-PCR. We applied multiple methods, such as RT-PCR, immunoblotting, and immunohistochemical analysis, to confirm Hgb expression in cervical cancer cells. The effects of ectopic expression of Hgb and Hgb mutants on oxidative stress and cell viability were investigated by cellular reactive oxygen species (ROS analysis and lactate dehydrogenase (LDH array, respectively. Both Annexin V staining assay by flow cytometry and caspase-3 activity assay were used, respectively, to evaluate cell apoptosis. RESULTS: qRT-PCR analysis showed that Hgb-α- (HBA1 and Hgb-β-globin (HBB gene expression was significantly higher in cervical carcinoma than in normal cervical tissues, whereas the expression of hematopoietic transcription factors and erythrocyte specific marker genes was not increased. Immunostaining experiments confirmed the expression of Hgb in cancer cells of the uterine cervix. Hgb mRNA and protein were also detected in the human cervical carcinoma cell lines SiHa and CaSki, and Hgb expression was up-regulated by hydrogen peroxide-induced oxidative stress. Importantly, ectopic expression of wild type HBA1/HBB or HBA1, rather than mutants HBA1(H88R/HBB(H93R unable to bind hemo, suppressed oxidative stress and improved cell viability. CONCLUSIONS: The present findings show for the first time that Hgb is expressed in cervical carcinoma cells and may act as an antioxidant, attenuating oxidative stress-induced damage in cervical cancer cells. These data provide a
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Directory of Open Access Journals (Sweden)
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Identification of distal silencing elements in the murine interferon-A11 gene promoter.
Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G
1996-08-01
The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)
2003-01-01
textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Interleukin-10 gene promoter polymorphism as a potential host ...
African Journals Online (AJOL)
10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...
Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang
2015-05-01
The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: a Meta-analysis
Directory of Open Access Journals (Sweden)
Yichang SUN
2014-03-01
Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
The altered promoter methylation of oxytocin receptor gene in autism.
Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak
Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.
NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer
Directory of Open Access Journals (Sweden)
Shen Shourong
2010-04-01
Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.
A cII-dependent promoter is located within the Q gene of bacteriophage lambda.
Hoopes, B C; McClure, W R
1985-01-01
We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...
International Nuclear Information System (INIS)
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Promoter Methylation Analysis of IDH Genes in Human Gliomas
International Nuclear Information System (INIS)
Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.
2012-01-01
Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin
2016-06-01
Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.
Exploring cellular memory molecules marking competent and active transcriptions
Directory of Open Access Journals (Sweden)
Liu De-Pei
2007-05-01
Full Text Available Abstract Background Development in higher eukaryotes involves programmed gene expression. Cell type-specific gene expression is established during this process and is inherited in succeeding cell cycles. Higher eukaryotes have evolved elegant mechanisms by which committed gene-expression states are transmitted through numerous cell divisions. Previous studies have shown that both DNase I-sensitive sites and the basal transcription factor TFIID remain on silenced mitotic chromosomes, suggesting that certain trans-factors might act as bookmarks, maintaining the information and transmitting it to the next generation. Results We used the mouse globin gene clusters as a model system to examine the retention of active information on M-phase chromosomes and its contribution to the persistence of transcriptional competence of these gene clusters in murine erythroleukemia cells. In cells arrested in mitosis, the erythroid-specific activator NF-E2p45 remained associated with its binding sites on the globin gene loci, while the other major erythroid factor, GATA-1, was removed from chromosome. Moreover, despite mitotic chromatin condensation, the distant regulatory regions and promoters of transcriptionally competent globin gene loci are marked by a preserved histone code consisting in active histone modifications such as H3 acetylation, H3-K4 dimethylation and K79 dimethylation. Further analysis showed that other active genes are also locally marked by the preserved active histone code throughout mitotic inactivation of transcription. Conclusion Our results imply that certain kinds of specific protein factors and active histone modifications function as cellular memory markers for both competent and active genes during mitosis, and serve as a reactivated core for the resumption of transcription when the cells exit mitosis.
hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro
International Nuclear Information System (INIS)
Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan
2007-01-01
Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)
Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Directory of Open Access Journals (Sweden)
Victoria Gonzalo
Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant
Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.
Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife
2016-05-01
Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.
Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi
1998-01-01
Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276
Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor
International Nuclear Information System (INIS)
Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.
2006-01-01
The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Directory of Open Access Journals (Sweden)
Tung Shu-Yun
2011-04-01
Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.
Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering
Directory of Open Access Journals (Sweden)
Jared B. Fudge
2018-04-01
Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein
2018-03-01
β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.
Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.
Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S
1999-09-01
Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei
Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.
1990-01-01
The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Directory of Open Access Journals (Sweden)
Rosner William
2009-05-01
Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh
2012-07-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.
2012-01-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
The study on Egr-1 promoter which is radioactive promoter
International Nuclear Information System (INIS)
Zhang Chunzhi; Guo Yang; Lv Zhonghong
2006-01-01
Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
International Nuclear Information System (INIS)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-01-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-07-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2002-10-15
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2003-03-04
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Directory of Open Access Journals (Sweden)
Chun-Nun Chao
Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
International Nuclear Information System (INIS)
Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen
2007-01-01
Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses
Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.
2016-01-01
Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.
Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad
2018-02-01
The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Directory of Open Access Journals (Sweden)
Jackie A Pallister
Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D
2011-01-25
The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Interleukin 10 gene promoter polymorphism and risk of diffuse large ...
African Journals Online (AJOL)
Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-04-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.
Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M
2013-06-01
The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.
Directory of Open Access Journals (Sweden)
Francesca Grespi
2011-03-01
Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Directory of Open Access Journals (Sweden)
Yin Weilun
2010-01-01
Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that
Directory of Open Access Journals (Sweden)
Li Mei-zhi
2010-10-01
Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.
Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring
Directory of Open Access Journals (Sweden)
Liu Zhongjie
2015-11-01
Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.
Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter
International Nuclear Information System (INIS)
Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix
2011-01-01
Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing
Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells
DEFF Research Database (Denmark)
Mortensen, O V; Thomassen, M; Larsen, M B
1999-01-01
were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...
International Nuclear Information System (INIS)
Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua
2011-01-01
Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others
2011-09-09
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis
DEFF Research Database (Denmark)
Xu, Wenming; Zhang, Sizhong; Qiu, Weimin
2009-01-01
reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...
CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.
Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan
2017-07-05
DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20
Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.
Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk
2009-07-01
To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
Directory of Open Access Journals (Sweden)
Oliveira Jorge
2007-07-01
Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.
Sandoval, V.; Barton, K.; Longhurst, A.
2012-12-01
Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.
Mishra, Avinash; Tanna, Bhakti
2017-01-01
Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de
2009-01-01
The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define
Lintas, Carla; Sacco, Roberto; Persico, Antonio M
2016-01-01
Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Olayan, Rawan S.
2012-01-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Olayan, Rawan S.
2012-12-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters
Directory of Open Access Journals (Sweden)
Avinash Mishra
2017-05-01
Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Rivella, Stefano
2015-04-01
β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.
α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea
Directory of Open Access Journals (Sweden)
Abbas Najjari
2014-05-01
Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
CAGE-defined promoter regions of the genes implicated in Rett Syndrome
DEFF Research Database (Denmark)
Vitezic, Morana; Bertin, Nicolas; Andersson, Robin
2014-01-01
BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Energy Technology Data Exchange (ETDEWEB)
Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)
2013-10-11
Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.
Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid
2017-01-01
The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of MLH1 promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig.
Ryan, Marion T; Hamill, Ruth M; O'Halloran, Aisling M; Davey, Grace C; McBryan, Jean; Mullen, Anne M; McGee, Chris; Gispert, Marina; Southwood, Olwen I; Sweeney, Torres
2012-07-25
The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK), a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs) in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP) and intramuscular fat (IMF) in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G) characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98), Duroc (n = 99) and Pietrain (n = 98) purebreds. Four major haplotypes including promoter SNP's g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL) and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT), pH at 45 min in LTL (pH(45)LT) and pH at 45 min in the M. semimembranosus muscle (pH(45)SM). HAP3 was associated with driploss%, pHULT pH(45)LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2, HAP3 and HAP4) in the Duroc breed. The
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig
Directory of Open Access Journals (Sweden)
Ryan Marion T
2012-07-01
Full Text Available Abstract Background The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK, a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. Results PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP and intramuscular fat (IMF in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98, Duroc (n = 99 and Pietrain (n = 98 purebreds. Four major haplotypes including promoter SNP’s g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT, pH at 45 min in LTL (pH45LT and pH at 45 min in the M. semimembranosus muscle (pH45SM. HAP3 was associated with driploss%, pHULT pH45LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
DEFF Research Database (Denmark)
Rohlin, A; Engwall, Y; Fritzell, K
2011-01-01
inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...
Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K
1996-09-01
To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad
2014-12-01
One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.
c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells
International Nuclear Information System (INIS)
Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I
2011-01-01
The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.
Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun
α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter
International Nuclear Information System (INIS)
Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi
2006-01-01
The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype
Directory of Open Access Journals (Sweden)
Türker Bilgen
2011-09-01
Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Glucose metabolism in pigs expressing human genes under an insulin promoter.
Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David
2015-01-01
Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Lincoln Matthew R
2008-07-01
Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.
Eissa, Sanaa; Zohny, Samir F; Shehata, Hanan Hussien; Hegazy, Marwa G A; Salem, Ahmed M; Esmat, Mohamed
2012-04-01
We evaluated the significance of urinary retinoic acid receptor-β2 (RAR-β2) gene promoter methylation and hyaluronidase activity in comparison with voided urine cytology (VUC) in diagnosis of bladder cancer. This study included 100 patients diagnosed with bladder cancer, 65 patients with benign urological disorders and 51 healthy volunteers. Urine supernatant was used for determining hyaluronidase activity by zymography while urine sediment was used for cytology and detection of methylated RAR-β2 gene promoter by methylation specific nested PCR. The sensitivity and specificity were 53% and 90.5% for VUC, 65% and 89.7% for percent methylation fraction of RAR-β2 gene promoter, and 89% and 90.5% for hyaluronidase activity; combination of the three parameters increased sensitivity to 95%. A significant association was observed between investigated markers and advanced grade tumor. Combined use of RAR-β2 gene promoter methylation, hyaluronidase activity and VUC is promising non-invasive tool for bladder cancer detection. Copyright © 2012. Published by Elsevier Inc.
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)
DEFF Research Database (Denmark)
Juul, Maja Bech; Vestergaard, Hanne; Petersen, Jesper
2012-01-01
Hb Taybe is a highly unstable hemoglobin (Hb) variant caused by a 3 bp deletion at codons 38/39 (-ACC) on the α1-globin gene. We report for the first time, a patient with a compound heterozygosity for Hb Taybe and a 5 bp deletion at the splice donor site of IVS-I on the α2-globin gene and ischemic...
Energy Technology Data Exchange (ETDEWEB)
Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)
2010-07-30
Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.
Genomic organization and promoter cloning of the human X11α gene APBA1.
LENUS (Irish Health Repository)
Chai, Ka-Ho
2012-05-01
X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.
Directory of Open Access Journals (Sweden)
Mario Iorio
2004-01-01
Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes
DEFF Research Database (Denmark)
Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard
2009-01-01
with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters
Energy Technology Data Exchange (ETDEWEB)
Shin, Ilchung [Ames Laboratory; Ray, Judhajeet [Ames Laboratory; Gupta, Vinayak [Iowa State University; Ilgu, Muslum [Ames Laboratory; Beasley, Jonathan [Iowa State University; Bendickson, Lee [Ames Laboratory; Mehanovic, Samir [Molecular Express; Kraus, George A. [Iowa State University; Nilsen-Hamilton, Marit [Ames Laboratory
2014-04-20
We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.
Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.
2010-01-01
Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Yin, Xian; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Liu, Long; Chen, Jian
2017-03-15
The dynamic control of gene expression is important for adjusting fluxes in order to obtain desired products and achieve appropriate cell growth, particularly when the synthesis of a desired product drains metabolites required for cell growth. For dynamic gene expression, a promoter responsive to a particular environmental stressor is vital. Here, we report a low-pH-inducible promoter, P gas , which promotes minimal gene expression at pH values above 5.0 but functions efficiently at low pHs, such as pH 2.0. First, we performed a transcriptional analysis of Aspergillus niger , an excellent platform for the production of organic acids, and we found that the promoter P gas may act efficiently at low pH. Then, a gene for synthetic green fluorescent protein ( sGFP ) was successfully expressed by P gas at pH 2.0, verifying the results of the transcriptional analysis. Next, P gas was used to express the cis -aconitate decarboxylase ( cad ) gene of Aspergillus terreus in A. niger , allowing the production of itaconic acid at a titer of 4.92 g/liter. Finally, we found that P gas strength was independent of acid type and acid ion concentration, showing dependence on pH only. IMPORTANCE The promoter P gas can be used for the dynamic control of gene expression in A. niger for metabolic engineering to produce organic acids. This promoter may also be a candidate tool for genetic engineering. Copyright © 2017 American Society for Microbiology.
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
Energy Technology Data Exchange (ETDEWEB)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; Jin, Lu; Gohil, Suresh; Sandström, Corine; Olsson, Helena; Persson, Cecilia; Höglund, Anna-Stina; Fransson, Gunnel; Ruan, Ying; Åman, Per; Jansson, Christer; Liu, Chunlin; Andersson, Roger; Sun, Chuanxin
2017-12-01
Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.
Love, Dona C; Ghosh, Salil; Mondoux, Michelle A; Fukushige, Tetsunari; Wang, Peng; Wilson, Mark A; Iser, Wendy B; Wolkow, Catherine A; Krause, Michael W; Hanover, John A
2010-04-20
Nutrient-driven O-GlcNAcylation of key components of the transcription machinery may epigenetically modulate gene expression in metazoans. The global effects of GlcNAcylation on transcription can be addressed directly in C. elegans because knockouts of the O-GlcNAc cycling enzymes are viable and fertile. Using anti-O-GlcNAc ChIP-on-chip whole-genome tiling arrays on wild-type and mutant strains, we detected over 800 promoters where O-GlcNAc cycling occurs, including microRNA loci and multigene operons. Intriguingly, O-GlcNAc-marked promoters are biased toward genes associated with PIP3 signaling, hexosamine biosynthesis, and lipid/carbohydrate metabolism. These marked genes are linked to insulin-like signaling, metabolism, aging, stress, and pathogen-response pathways in C. elegans. Whole-genome transcriptional profiling of the O-GlcNAc cycling mutants confirmed dramatic deregulation of genes in these key pathways. As predicted, the O-GlcNAc cycling mutants show altered lifespan and UV stress susceptibility phenotypes. We propose that O-GlcNAc cycling at promoters participates in a molecular program impacting nutrient-responsive pathways in C. elegans, including stress, pathogen response, and adult lifespan. The observed impact of O-GlcNAc cycling on both signaling and transcription in C. elegans has important implications for human diseases of aging, including diabetes and neurodegeneration.
Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L
1999-09-24
To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Directory of Open Access Journals (Sweden)
Xian-E Peng
Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
Differences in Hematological Traits between High- and Low-Altitude Lizards (Genus Phrynocephalus.
Directory of Open Access Journals (Sweden)
Songsong Lu
Full Text Available Phrynocephalus erythrurus (Lacertilia: Agamidae is considered to be the highest living reptile in the world (about 4500-5000 m above sea level, whereas Phrynocephalus przewalskii inhabits low altitudes (about 1000-1500 m above sea level. Here, we report the differences in hematological traits between these two different Phrynocephalus species. Compared with P. przewalskii, the results indicated that P. erythrurus own higher oxygen carrying capacity by increasing red blood cell count (RBC, hemoglobin concentration ([Hb] and hematocrit (Hct and these elevations could promote oxygen carrying capacity without disadvantage of high viscosity. The lower partial pressure of oxygen in arterial blood (PaO2 of P. erythrurus did not cause the secondary alkalosis, which may be attributed to an efficient pulmonary system for oxygen (O2 loading. The elevated blood-O2 affinity in P. erythrurus may be achieved by increasing intrinsic O2 affinity of isoHbs and balancing the independent effects of potential heterotropic ligands. We detected one α-globin gene and three β-globin genes with 1 and 33 amino acid substitutions between these two species, respectively. Molecular dynamics simulation results showed that amino acids substitutions in β-globin chains could lead to the elimination of hydrogen bonds in T-state Hb models of P. erythrurus. Based on the present data, we suggest that P. erythrurus have evolved an efficient oxygen transport system under the unremitting hypobaric hypoxia.
International Nuclear Information System (INIS)
Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran
2012-01-01
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC
Zhuang, Fengfeng; Nguyen, Manuel P; Shuler, Charles; Liu, Yi-Hsin
2009-04-03
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent transactivation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and heat shock factors may play a contributing role.
Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling
2018-04-07
HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.
Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V
2015-01-01
Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (pmastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.
Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan
To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells
International Nuclear Information System (INIS)
Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella
2011-01-01
Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.
Directory of Open Access Journals (Sweden)
Raheleh Farahzadi
Full Text Available The use of mesenchymal stem cells (MSCs for cell therapy and regenerative medicine has received widespread attention over the past few years, but their application can be complicated by factors such as reduction in proliferation potential, the senescent tendency of the MSCs upon expansion and their age-dependent decline in number and function. It was shown that all the mentioned features were accompanied by a reduction in telomerase activity and telomere shortening. Furthermore, the role of epigenetic changes in aging, especially changes in promoter methylation, was reported. In this study, MSCs were isolated from the adipose tissue with enzymatic digestion. In addition, immunocytochemistry staining and flow cytometric analysis were performed to investigate the cell-surface markers. In addition, alizarin red-S, sudan III, toluidine blue, and cresyl violet staining were performed to evaluate the multi-lineage differentiation of hADSCs. In order to improve the effective application of MSCs, these cells were treated with 1.5 × 10-8 and 2.99 × 10-10 M of ZnSO4 for 48 hours. The length of the absolute telomere, human telomerase reverse transcriptase (hTERT gene expression, telomerase activity, the investigation of methylation status of the hTERT gene promoter and the percentage of senescent cells were analyzed with quantitative real-time PCR, PCR-ELISA TRAP assay, methylation specific PCR (MSP, and beta-galactosidase (SA-β-gal staining, respectively. The results showed that the telomere length, the hTERT gene expression, and the telomerase activity had significantly increased. In addition, the percentage of senescent cells had significantly decreased and changes in the methylation status of the CpG islands in the hTERT promoter region under treatment with ZnSO4 were seen. In conclusion, it seems that ZnSO4 as a proper antioxidant could improve the aging-related features due to lengthening of the telomeres, increasing the telomerase gene expression
International Nuclear Information System (INIS)
Putintseva, O.V.; Artykhov, V.G.; Kalaeva, E.A.
2000-01-01
The contribution of hem and globin components of electrophoretic fractions of UV-irradiated human carboxyhemoglobin to photo destruction of the protein was studied. The changes observed are the result of summation of some processes unequal in intensity and direction that take place in microgeterogenous media of photo modified protein. Photo sensitivity of hemoproteid in electrophoretic fraction depends on apoprotein condition, whereas the hem photo resistance cannot be the evidence of the photo stability of the whole molecule [ru
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro
2007-06-01
To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.
International Nuclear Information System (INIS)
Spink, Barbara C.; Bloom, Michael S.; Wu, Susan; Sell, Stewart; Schneider, Erasmus; Ding, Xinxin; Spink, David C.
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC) n , located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC) 2 alleles were observed; however, in western gorilla, (GGGGC) n alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC) n was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC) n alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC) 2 was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC) n short tandem repeats are inherited, and that the (GGGGC) 2 allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC) n , where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC) n microsatellite instability • AHR promoter activity of a construct with (GGGGC) 2 was lower than that of (GGGGC) 4 • The frequency of (GGGGC) 2 in lung cancer patients was 8-fold higher than in neonates • The
International Nuclear Information System (INIS)
Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert
2014-01-01
In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang
2017-12-19
WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.
Directory of Open Access Journals (Sweden)
Ramesh
2015-06-01
Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.
Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Correlation between the methylation of APC gene promoter and colon cancer.
Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua
2017-08-01
The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang
2016-09-01
β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.
Zhuang, Fengfeng; Nguyen, Manuel P.; Shuler, Charles; Liu, Yi-Hsin
2009-01-01
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent trans-activation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in probing Msx-dependent mechanisms of gene activation. We showed that Msx protein activates Hspa1b promoter via its C-terminal domain. The activation absolutely depends on the HSEs and physical interactions between Msx proteins and Heat shock factors may play a contributing role. PMID:19338779
Directory of Open Access Journals (Sweden)
Mika Masumoto
Full Text Available Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively; however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.
M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis
1992-01-01
textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin
Fu, Chunli; Xing, Yingqi; Song, Xiaonan
2011-04-01
To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
Hb TAYBE: clinical and morphological findings IN 43 patients.
Koren, Ariel; Levin, Carina; Zalman, Luci; Palmor, Haya; Filon, Dvora; Chubar, Evgeny; Resnitzky, Peretz; Bennett, Michael
2016-08-01
Hereditary sequence variants in globin genes are usually silent and are rarer in α-globin chains than β-globin chains. Some may lead to an unstable protein with a hemolytic or thalassemic phenotype. Hb Taybe is an unstable α-chain hemoglobin variant caused by the deletion of a threonine residue at codon 38 or 39 of the α1 globin gene. This deletion results in a structural abnormality that affects the α1 β2 contact and the α1 β1 interface, producing a highly unstable Hb. We describe the clinical, laboratory, and morphological characteristics of 43 patients with Hb Taybe, sixteen of whom are heterozygous, eight are homozygous, and nineteen are double heterozygous for Hb Taybe and other α-gene mutations or deletions. The clinical presentation is very variable from a mild hemolytic anemia to the need for red cell transfusion. Morphological characteristics include erythroid hyperplasia, defective hemoglobin production, and dyserythropoietic features. On electron microscopy dyserythropoiesis and cytoplasmic precipitation of globin compatible optical dense material is seen. This is the largest report of Hb Taybe patients. Previous reported cohorts are not related to these cases. We conclude that patients carrying Hb Taybe have a unique hematological and clinical phenotype distinct from other hemoglobinopathies and from congenital dyserythropoietic anemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Shian-Ying Sung
Full Text Available Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.
Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro
2016-09-01
Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.
Directory of Open Access Journals (Sweden)
Wellington dos Santos Silva
2010-01-01
Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.
MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
Directory of Open Access Journals (Sweden)
Skiriute Daina
2012-06-01
Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.
Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu
2009-09-01
We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.
Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence
International Nuclear Information System (INIS)
Xiao Yi; Huang Yanzhao
2004-01-01
DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W
2017-09-01
The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.
Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.
Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten
2016-02-01
During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
Zhuang, Fengfeng; Nguyen, Manuel P.; Shuler, Charles; Liu, Yi-Hsin
2009-01-01
Previous studies have shown that Msx proteins control gene transcription predominantly through repression mechanisms. However, gene expression studies using either the gain-of-function or the loss-of-function mutants revealed many gene targets whose expression require functional Msx proteins. To date, investigations into the mechanisms of Msx-dependent trans-activation have been hindered by the lack of a responsive promoter. Here, we demonstrated the usefulness of the mouse Hspa1b promoter in...
Directory of Open Access Journals (Sweden)
Naoko Minatani
Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.
Synthetic review on the different anthropological aspects of ...
African Journals Online (AJOL)
Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
DEFF Research Database (Denmark)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
2013-01-01
, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Weterings, K; Schrauwen, J; Wullems, G; Twell, D
1995-07-01
Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell
ΔNp73 enhances promoter activity of TGF-β induced genes.
Directory of Open Access Journals (Sweden)
Maarten Niemantsverdriet
Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z
2018-04-01
To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells
Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X
2009-01-01
Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...
Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo
2018-02-01
Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
CSIR Research Space (South Africa)
Crampton, Michael C
2010-07-01
Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...
Directory of Open Access Journals (Sweden)
Marwa H. Saied
2018-04-01
Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Directory of Open Access Journals (Sweden)
Casart Yveth
2008-03-01
Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.
Directory of Open Access Journals (Sweden)
Ruixi Liu
2012-01-01
Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.
Arroyo-Jousse, Viviana; Garcia-Diaz, Diego F; Codner, Ethel; Pérez-Bravo, Francisco
2016-12-01
TNF-α is a pro-inflammatory cytokine that is involved in type 1 diabetes (T1D) pathogenesis. The TNFa gene is subject of epigenetic regulation in which folate and homocysteine are important molecules because they participate in the methionine cycle where the most important methyl group donor (S-adenosylmethionine) is formed. We investigated whether TNFa gene promoter methylation status in T1D patients was related to blood folate, homocysteine and TNF-α in a transversal case-control study. We studied T1D patients (n 25, mean=13·7 years) and healthy control subjects (n 25, mean=31·1 years), without T1D and/or other autoimmune diseases or direct family history of these diseases. A blood sample was obtained for determination of serum folate, plasma homocysteine and TNF-α concentrations. Whole blood was used for the extraction of DNA to determine the percentage of methylation by real-time PCR and melting-curve analysis. Results are expressed as means and standard deviations for parametric variables and as median (interquartile range) for non-parametric variables. T1D patients showed a higher TNFa gene promoter methylation (39·2 (sd 19·5) %) when compared with control subjects (25·4 (sd 13·7) %) (P=0·008). TNFa gene promoter methylation was positively associated only with homocysteine levels in T1D patients (r 0·55, P=0·007), but not in control subjects (r -0·122, P=0·872). To our knowledge, this is the first work that reports the methylation status of the TNFa gene promoter and its relationship with homocysteine metabolism in Chilean T1D patients without disease complications.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4
Directory of Open Access Journals (Sweden)
Zhijing Liu
2015-01-01
Full Text Available Shortage of red blood cells (RBCs, erythrocytes can have potentially life-threatening consequences for rare or unusual blood type patients with massive blood loss resulting from various conditions. Erythrocytes have been derived from human pluripotent stem cells (PSCs, but the risk of potential tumorigenicity cannot be ignored, and a majority of these cells produced from PSCs express embryonic ε- and fetal γ-globins with little or no adult β-globin and remain nucleated. Here we report a method to generate erythrocytes from human hair follicle mesenchymal stem cells (hHFMSCs by enforcing OCT4 gene expression and cytokine stimulation. Cells generated from hHFMSCs expressed mainly the adult β-globin chain with minimum level of the fetal γ-globin chain. Furthermore, these cells also underwent multiple maturation events and formed enucleated erythrocytes with a biconcave disc shape. Gene expression analyses showed that OCT4 regulated the expression of genes associated with both pluripotency and erythroid development during hHFMSC transdifferentiation toward erythroid cells. These findings show that mature erythrocytes can be generated from adult somatic cells, which may serve as an alternative source of RBCs for potential autologous transfusion.
Hb Presbyterian (HBB: c.327C>G) in a Nicaraguan Family.
Pernudy-Ubau, Allan; Salinas-Molina, Jaslyn; Requenez, Yaneris; Ortiz-Lopez, Marianela; Puller, Ann-Christin; García-Rosales, Kenia; Rodríguez-Estrada, Anaishelle; Rodríguez-Romero, Walter; Mejía-Baltodano, Gerardo; Luo, Hong-Yuan; Chui, David H K
2017-01-01
Hemoglobin (Hb) is the protein responsible for oxygen transportation. It is a tetrameric protein comprising two α- and two β-globin subunits. In the literature, a large number of mutations in the α- and β-globin genes have been documented. Among these mutations, Hb Presbyterian (HBB: c.327 C>G), is a naturally occurring mutant exerting low oxygen affinity. The C to G exchange (AAC>AAG) at codon 108 of the β-globin gene results in the substitution of asparagine by lysine. Here, we document the identification of HBB: c.327 C>G in a 6-year-old female patient and her father from Nicaragua and Cuba, respectively. The presence of the abnormal Hb was confirmed by cellulose acetate electrophoresis, high performance liquid chromatography (HPLC) and genomic DNA sequencing. The β-globin gene sequences for both, father and daughter, disclosed the heterozygous mutation at codon 108 to be Hb Presbyterian or HBB: c.327 C>G. The mutant Hb was previously reported in four families from North America, Germany, Japan and Spain, respectively. This is the fifth family carrying HBB: c.327 C>G described to date and the first report from Latin America.
Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi
2016-06-01
Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.
Energy Technology Data Exchange (ETDEWEB)
Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-04-15
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging
International Nuclear Information System (INIS)
Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-01-01
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2007-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls
Energy Technology Data Exchange (ETDEWEB)
Spink, Barbara C. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Bloom, Michael S. [Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Wu, Susan [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Sell, Stewart; Schneider, Erasmus [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Ding, Xinxin [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Spink, David C., E-mail: spink@wadsworth.org [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States)
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2} in lung
Reactivation of fetal hemoglobin in thalassemia and sickle cell disease
Directory of Open Access Journals (Sweden)
Sandro Eridani
2014-09-01
Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the
Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.
2001-01-01
Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and
Contribution of long-range interactions to the secondary structure of an unfolded globin.
Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia
2010-09-08
This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.
1989-01-01
The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
Directory of Open Access Journals (Sweden)
Nina Milutin Gašperov
Full Text Available Change in the host and/or human papillomavirus (HPV DNA methylation profile is probably one of the main factors responsible for the malignant progression of cervical lesions to cancer. To investigate those changes we studied 173 cervical samples with different grades of cervical lesion, from normal to cervical cancer. The methylation status of nine cellular gene promoters, CCNA1, CDH1, C13ORF18, DAPK1, HIC1, RARβ2, hTERT1, hTERT2 and TWIST1, was investigated by Methylation Specific Polymerase Chain Reaction (MSP. The methylation of HPV18 L1-gene was also investigated by MSP, while the methylated cytosines within four regions, L1, 5'LCR, enhancer, and promoter of the HPV16 genome covering 19 CpG sites were evaluated by bisulfite sequencing. Statistically significant methylation biomarkers distinguishing between cervical precursor lesions from normal cervix were primarily C13ORF18 and secondly CCNA1, and those distinguishing cervical cancer from normal or cervical precursor lesions were CCNA1, C13ORF18, hTERT1, hTERT2 and TWIST1. In addition, the methylation analysis of individual CpG sites of the HPV16 genome in different sample groups, notably the 7455 and 7694 sites, proved to be more important than the overall methylation frequency. The majority of HPV18 positive samples contained both methylated and unmethylated L1 gene, and samples with L1-gene methylated forms alone had better prognosis when correlated with the host cell gene promoters' methylation profiles. In conclusion, both cellular and viral methylation biomarkers should be used for monitoring cervical lesion progression to prevent invasive cervical cancer.
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
International Nuclear Information System (INIS)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn
2013-01-01
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Directory of Open Access Journals (Sweden)
Sweeney Torres
2010-12-01
Full Text Available Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF/juiciness or tenderness in a genome-assisted selection framework.
The effect of histone deacetylase inhibitors on AHSP expression.
Directory of Open Access Journals (Sweden)
Mohammad Ali Okhovat
Full Text Available Alpha-hemoglobin stabilizing protein (AHSP is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms, γ-globin genes (HBG1/2, and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05, except for the expression of BCL11A, which was down-regulated (p < 0.05 in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005 on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies.
Directory of Open Access Journals (Sweden)
Xiaoyan Wang
Full Text Available Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1 gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13 and Gossypium arboreum L. genome (A-genome, n = 13 databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26. Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319 exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses.
Directory of Open Access Journals (Sweden)
Mason Philip J
2004-06-01
Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
DEFF Research Database (Denmark)
Sandvej, K; Andresen, B S; Zhou, X G
2000-01-01
AIMS: To study the distribution of Epstein-Barr virus (EBV) variants containing mutations in the latent membrane protein 1 (LMP-1) oncogene and promoter in EBV associated Hodgkin's disease and infectious mononucleosis compared with previous findings in asymptomatic EBV carriers. METHODS: Sequence...... analysis of the EBV LMP-1 promoter and gene in isolates from Danish patients with Hodgkin's disease (n = 61) and infectious mononucleosis (n = 10). RESULTS: Viruses (previously designated group D) that contain two mutations in the activating transcription factor/cAMP response element (ATF/CRE) in the LMP-1...... promoter, which are known to decrease promoter activity greatly, were significantly less frequent in Hodgkin's disease than in both infectious mononucleosis (p = 0.0081) and asymptomatic EBV carriers (p = 0.0084). In some cases, the LMP-1 gene contained mutations in a recently identified cytotoxic T cell...
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...