WorldWideScience

Sample records for global tuberculosis tb

  1. Tuberculosis (TB): Treatment

    Science.gov (United States)

    ... Education & Training Home Conditions Tuberculosis (TB) Tuberculosis: Treatment Tuberculosis: Treatment Make an Appointment Refer a Patient Ask ... or bones is treated longer. NEXT: Preventive Treatment Tuberculosis: Diagnosis Tuberculosis: History Clinical Trials For more than ...

  2. Tuberculosis (TB)

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Tuberculosis Go to Information for Researchers ► Credit: NIAID Scanning ... are drug resistant. Why Is the Study of Tuberculosis a Priority for NIAID? Tuberculosis is one of ...

  3. Global Tuberculosis Report 2016

    Science.gov (United States)

    ... Alt+0 Navigation Alt+1 Content Alt+2 Tuberculosis (TB) Menu Tuberculosis Data and statistics Regional Framework Resources Meetings and events Global tuberculosis report 2017 WHO has published a global TB ...

  4. Tuberculosis Facts - Exposure to TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Exposure to TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  5. Tuberculosis Facts - Testing for TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Testing for TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  6. HIV and Tuberculosis (TB)

    Science.gov (United States)

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Tuberculosis (TB) Last Reviewed: June 14, 2018 ...

  7. Tuberculosis Facts - TB and HIV/AIDS

    Science.gov (United States)

    Tuberculosis (TB) Facts TB and HIV/AIDS What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  8. Tuberculosis Facts - You Can Prevent TB

    Science.gov (United States)

    Tuberculosis (TB) Facts You Can Prevent TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination TB Facts: You Can Prevent TB What ...

  9. Tuberculosis Facts - TB Can Be Treated

    Science.gov (United States)

    Tuberculosis (TB) Facts TB Can Be Treated What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination Page 1 of 2 TB Facts: TB ...

  10. A Data-Driven Evaluation of the Stop TB Global Partnership Strategy of Targeting Key Populations at Greater Risk for Tuberculosis.

    Science.gov (United States)

    McLaren, Zoë M; Schnippel, Kathryn; Sharp, Alana

    2016-01-01

    Identifying those infected with tuberculosis (TB) is an important component of any strategy for reducing TB transmission and population prevalence. The Stop TB Global Partnership recently launched an initiative with a focus on key populations at greater risk for TB infection or poor clinical outcomes, due to housing and working conditions, incarceration, low household income, malnutrition, co-morbidities, exposure to tobacco and silica dust, or barriers to accessing medical care. To achieve operational targets, the global health community needs effective, low cost, and large-scale strategies for identifying key populations. Using South Africa as a test case, we assess the feasibility and effectiveness of targeting active case finding to populations with TB risk factors identified from regularly collected sources of data. Our approach is applicable to all countries with TB testing and census data. It allows countries to tailor their outreach activities to the particular risk factors of greatest significance in their national context. We use a national database of TB test results to estimate municipality-level TB infection prevalence, and link it to Census data to measure population risk factors for TB including rates of urban households, informal settlements, household income, unemployment, and mobile phone ownership. To examine the relationship between TB prevalence and risk factors, we perform linear regression analysis and plot the set of population characteristics against TB prevalence and TB testing rate by municipality. We overlay lines of best fit and smoothed curves of best fit from locally weighted scatter plot smoothing. Higher TB prevalence is statistically significantly associated with more urban municipalities (slope coefficient β1 = 0.129, p informal settlement households (β1 = 0.021, p = 0.136, R2 = 0.014). These analyses reveal that the set of characteristics identified by the Global Plan as defining key populations do not adequately predict

  11. A Data-Driven Evaluation of the Stop TB Global Partnership Strategy of Targeting Key Populations at Greater Risk for Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Zoë M McLaren

    Full Text Available Identifying those infected with tuberculosis (TB is an important component of any strategy for reducing TB transmission and population prevalence. The Stop TB Global Partnership recently launched an initiative with a focus on key populations at greater risk for TB infection or poor clinical outcomes, due to housing and working conditions, incarceration, low household income, malnutrition, co-morbidities, exposure to tobacco and silica dust, or barriers to accessing medical care. To achieve operational targets, the global health community needs effective, low cost, and large-scale strategies for identifying key populations. Using South Africa as a test case, we assess the feasibility and effectiveness of targeting active case finding to populations with TB risk factors identified from regularly collected sources of data. Our approach is applicable to all countries with TB testing and census data. It allows countries to tailor their outreach activities to the particular risk factors of greatest significance in their national context.We use a national database of TB test results to estimate municipality-level TB infection prevalence, and link it to Census data to measure population risk factors for TB including rates of urban households, informal settlements, household income, unemployment, and mobile phone ownership. To examine the relationship between TB prevalence and risk factors, we perform linear regression analysis and plot the set of population characteristics against TB prevalence and TB testing rate by municipality. We overlay lines of best fit and smoothed curves of best fit from locally weighted scatter plot smoothing.Higher TB prevalence is statistically significantly associated with more urban municipalities (slope coefficient β1 = 0.129, p < 0.0001, R2 = 0.133, lower mobile phone access (β1 = -0.053, p < 0.001, R2 = 0.089, lower unemployment rates (β1 = -0.020, p = 0.003, R2 = 0.048, and a lower proportion of low-income households

  12. Tuberculosis: Learn the Signs and Symptoms of TB Disease

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Tuberculosis (TB) Disease: Symptoms and Risk Factors Language: English ( ... Español (Spanish) Recommend on Facebook Tweet Share Compartir Tuberculosis (TB) is a disease caused by bacteria that ...

  13. WHO GLOBAL TUBERCULOSIS REPORTS: COMPILATION AND INTERPRETATION

    Directory of Open Access Journals (Sweden)

    I. A. Vаsilyevа

    2017-01-01

    Full Text Available The purpose of the article is to inform national specialists involved in tuberculosis control about methods for compilation of WHO global tuberculosis statistics, which are used when developing strategies and programmes for tuberculosis control and evaluation of their efficiency.  The article explains in detail the notions of main WHO epidemiological rates, used in the international publications on tuberculosis along with the data on their registered values, new approaches to making the list of country with the highest burden of tuberculosis, drug resistant tuberculosis and tuberculosis with concurrent HIV infection. The article compares the rates in the Russian Federation with global data as well as data from countries within WHO European Regions and countries with highest TB burden. It presents materials on the achievement of Global goals in tuberculosis control and main provisions of WHO End TB Strategy for 2015-2035 adopted as a part of UNO Sustainable Development Goals.  

  14. Economic support to patients in HIV and TB grants in rounds 7 and 10 from the global fund to fight AIDS, tuberculosis and malaria.

    Directory of Open Access Journals (Sweden)

    Linda M Richter

    Full Text Available People with TB and/or HIV frequently experience severe economic barriers to health care, including out-of-pocket expenses related to diagnosis and treatment, as well as indirect costs due to loss of income. These barriers can both aggravate economic hardship and prevent or delay diagnosis, treatment and successful outcome, leading to increased transmission, morbidity and mortality. WHO, UNAIDS and the ILO argue that economic support of various kinds is essential to enable vulnerable people to protect themselves from infection, avoid delayed diagnosis and treatment, overcome barriers to adherence, and avert destitution. This paper analyses successful country proposals to the Global Fund to Fight AIDS, Tuberculosis and Malaria that include economic support in Rounds 7 and 10; 36 and 20 HIV and TB grants in Round 7 and 32 and 26, respectively, in Round 10. Of these, up to 84 percent included direct or indirect economic support for beneficiaries, although the amount constituted a very small proportion of the total grant. In TB grants, the objectives of economic support were generally clearly stated, and focused on mechanisms to improve treatment uptake and adherence, and the case was most clearly made for MDR-TB patients. In HIV grants, the objectives were much broader in scope, including mitigation of adverse economic and social effects of HIV and its treatment on both patients and families. The analysis shows that economic support is on the radar for countries developing Global Fund proposals, and a wide range of economic support activities are in place. In order to move forward in this area, the wealth of country experience that exists needs to be collated, assessed and disseminated. In addition to trials, operational research and programme evaluations, more precise guidance to countries is needed to inform evidence-based decision about activities that are cost-effective, affordable and feasible.

  15. TIME Impact - a new user-friendly tuberculosis (TB) model to inform TB policy decisions.

    Science.gov (United States)

    Houben, R M G J; Lalli, M; Sumner, T; Hamilton, M; Pedrazzoli, D; Bonsu, F; Hippner, P; Pillay, Y; Kimerling, M; Ahmedov, S; Pretorius, C; White, R G

    2016-03-24

    Tuberculosis (TB) is the leading cause of death from infectious disease worldwide, predominantly affecting low- and middle-income countries (LMICs), where resources are limited. As such, countries need to be able to choose the most efficient interventions for their respective setting. Mathematical models can be valuable tools to inform rational policy decisions and improve resource allocation, but are often unavailable or inaccessible for LMICs, particularly in TB. We developed TIME Impact, a user-friendly TB model that enables local capacity building and strengthens country-specific policy discussions to inform support funding applications at the (sub-)national level (e.g. Ministry of Finance) or to international donors (e.g. the Global Fund to Fight AIDS, Tuberculosis and Malaria).TIME Impact is an epidemiological transmission model nested in TIME, a set of TB modelling tools available for free download within the widely-used Spectrum software. The TIME Impact model reflects key aspects of the natural history of TB, with additional structure for HIV/ART, drug resistance, treatment history and age. TIME Impact enables national TB programmes (NTPs) and other TB policymakers to better understand their own TB epidemic, plan their response, apply for funding and evaluate the implementation of the response.The explicit aim of TIME Impact's user-friendly interface is to enable training of local and international TB experts towards independent use. During application of TIME Impact, close involvement of the NTPs and other local partners also builds critical understanding of the modelling methods, assumptions and limitations inherent to modelling. This is essential to generate broad country-level ownership of the modelling data inputs and results. In turn, it stimulates discussions and a review of the current evidence and assumptions, strengthening the decision-making process in general.TIME Impact has been effectively applied in a variety of settings. In South Africa, it

  16. The social determinants of tuberculosis and their association with TB ...

    African Journals Online (AJOL)

    Progress made in TB control through the implementation of the DOTS strategy, has been retarded by factors such as poverty, the HIV pandemic and the advent of multidrug resistant tuberculosis. There is currently an increasing shift in TB control ...

  17. Technology and tuberculosis control: the OUT-TB Web experience.

    Science.gov (United States)

    Guthrie, Jennifer L; Alexander, David C; Marchand-Austin, Alex; Lam, Karen; Whelan, Michael; Lee, Brenda; Furness, Colin; Rea, Elizabeth; Stuart, Rebecca; Lechner, Julia; Varia, Monali; McLean, Jennifer; Jamieson, Frances B

    2017-04-01

    Develop a tool to disseminate integrated laboratory, clinical, and demographic case data necessary for improved contact tracing and outbreak detection of tuberculosis (TB). In 2007, the Public Health Ontario Laboratories implemented a universal genotyping program to monitor the spread of TB strains within Ontario. Ontario Universal Typing of TB (OUT-TB) Web utilizes geographic information system (GIS) technology with a relational database platform, allowing TB control staff to visualize genotyping matches and microbiological data within the context of relevant epidemiological and demographic data. OUT-TB Web is currently available to the 8 health units responsible for >85% of Ontario's TB cases and is a valuable tool for TB case investigation. Users identified key features to implement for application enhancements, including an e-mail alert function, customizable heat maps for visualizing TB and drug-resistant cases, socioeconomic map layers, a dashboard providing TB surveillance metrics, and a feature for animating the geographic spread of strains over time. OUT-TB Web has proven to be an award-winning application and a useful tool. Developed and enhanced using regular user feedback, future versions will include additional data sources, enhanced map and line-list filter capabilities, and development of a mobile app. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  18. Clinical implications of molecular drug resistance testing for Mycobacterium tuberculosis: a TBNET/RESIST-TB consensus statement

    NARCIS (Netherlands)

    Domínguez, J.; Boettger, E. C.; Cirillo, D.; Cobelens, F.; Eisenach, K. D.; Gagneux, S.; Hillemann, D.; Horsburgh, R.; Molina-Moya, B.; Niemann, S.; Tortoli, E.; Whitelaw, A.; Lange, C.

    2016-01-01

    The emergence of drug-resistant strains of Mycobacterium tuberculosis is a challenge to global tuberculosis (TB) control. Although culture-based methods have been regarded as the gold standard for drug susceptibility testing (DST), molecular methods provide rapid information on mutations in the M.

  19. Extensively Drug-Resistant Tuberculosis (XDR TB)

    Science.gov (United States)

    ... TB Reference Laboratory Network, the National TB Surveillance System in the United States, the national reference laboratory of South Korea, and ... capacity in the U.S. and abroad; and Developing education, risk, and media communications ... – United States, 1993–2006 CDC. CDC’s Role in Preventing XDR ...

  20. The association between alcohol use, alcohol use disorders and tuberculosis (TB. A systematic review

    Directory of Open Access Journals (Sweden)

    Room Robin

    2009-12-01

    Full Text Available Abstract Background In 2004, tuberculosis (TB was responsible for 2.5% of global mortality (among men 3.1%; among women 1.8% and 2.2% of global burden of disease (men 2.7%; women 1.7%. The present work portrays accumulated evidence on the association between alcohol consumption and TB with the aim to clarify the nature of the relationship. Methods A systematic review of existing scientific data on the association between alcohol consumption and TB, and on studies relevant for clarification of causality was undertaken. Results There is a strong association between heavy alcohol use/alcohol use disorders (AUD and TB. A meta-analysis on the risk of TB for these factors yielded a pooled relative risk of 2.94 (95% CI: 1.89-4.59. Numerous studies show pathogenic impact of alcohol on the immune system causing susceptibility to TB among heavy drinkers. In addition, there are potential social pathways linking AUD and TB. Heavy alcohol use strongly influences both the incidence and the outcome of the disease and was found to be linked to altered pharmacokinetics of medicines used in treatment of TB, social marginalization and drift, higher rate of re-infection, higher rate of treatment defaults and development of drug-resistant forms of TB. Based on the available data, about 10% of the TB cases globally were estimated to be attributable to alcohol. Conclusion The epidemiological and other evidence presented indicates that heavy alcohol use/AUD constitute a risk factor for incidence and re-infection of TB. Consequences for prevention and clinical interventions are discussed.

  1. Application Values of T-SPOT.TB in Clinical Rapid Diagnosis of Tuberculosis.

    Science.gov (United States)

    Zhu, Feng; Ou, Qinfang; Zheng, Jian

    2018-01-01

    This paper aims to explore the application value of tuberculosis-specific enzyme-linked immunospot assay (T-SPOT.TB) in the diagnosis of tuberculosis. Fifty one patients with tuberculosis (TB) admitted to Wuxi No.5 People's Hospital, Wuxi, China from June 2015 to June 2017 were selected as the TB group, and 40 patients without tuberculosis admitted in the same period were randomly selected as the non-TB group. Patients in the two groups received T-SPOT.TB, TB antibody (TB-Ab) test and mycobacterium TB deoxyribonucleic acid (TB-DNA) test, and the results were compared. Comparisons of the sensitivity of the three methods showed that the sensitivity of T-SPOT.TB was the highest, followed by TB-DNA from sputum samples, and that of TB-Ab was the lowest. The specificity of TB-Ab was the highest, followed by T-SPOT.TB, and that of TB-DNA from sputum samples was the lowest. In the receiver operating characteristic (ROC) curve analysis, the area under curve (AUC) of T-SPOT.TB (0.896) was the highest, followed by TB-DNA from sputum samples (0.772), and that of sputum smears (0.698) was the lowest. T-SPOT.TB can quickly and accurately determine the presence of tuberculosis infection, and it is a non-invasive examination, which can further assist in the diagnosis and guide the treatment.

  2. Global stability of two models with incomplete treatment for tuberculosis

    International Nuclear Information System (INIS)

    Yang Yali; Li Jianquan; Ma Zhien; Liu Luju

    2010-01-01

    Research highlights: → Two tuberculosis models with incomplete treatment. → Intuitive epidemiological interpretations for the basic reproduction numbers. → Global dynamics of the two models. → Strategies to control the spread of tuberculosis. - Abstract: Two tuberculosis (TB) models with incomplete treatment are investigated. It is assumed that the treated individuals may enter either the latent compartment due to the remainder of Mycobacterium tuberculosis or the infectious compartment due to the treatment failure. The first model is a simple one with treatment failure reflecting the current TB treatment fact in most countries with high tuberculosis incidence. The second model refines the simple one by dividing the latent compartment into slow and fast two kinds of progresses. This improvement can be used to describe the case that the latent TB individuals have been infected with some other chronic diseases (such as HIV and diabetes) which may weaken the immunity of infected individuals and shorten the latent period of TB. Both of the two models assume mass action incidence and exponential distributions of transfers between different compartments. The basic reproduction numbers of the two models are derived and their intuitive epidemiological interpretations are given. The global dynamics of two models are all proved by using Liapunov functions. At last, some strategies to control the spread of tuberculosis are discussed.

  3. PolyTB: A genomic variation map for Mycobacterium tuberculosis

    KAUST Repository

    Coll, Francesc

    2014-02-15

    Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) is the second major cause of death from an infectious disease worldwide. Recent advances in DNA sequencing are leading to the ability to generate whole genome information in clinical isolates of M. tuberculosis complex (MTBC). The identification of informative genetic variants such as phylogenetic markers and those associated with drug resistance or virulence will help barcode Mtb in the context of epidemiological, diagnostic and clinical studies. Mtb genomic datasets are increasingly available as raw sequences, which are potentially difficult and computer intensive to process, and compare across studies. Here we have processed the raw sequence data (>1500 isolates, eight studies) to compile a catalogue of SNPs (n = 74,039, 63% non-synonymous, 51.1% in more than one isolate, i.e. non-private), small indels (n = 4810) and larger structural variants (n = 800). We have developed the PolyTB web-based tool (http://pathogenseq.lshtm.ac.uk/polytb) to visualise the resulting variation and important meta-data (e.g. in silico inferred strain-types, location) within geographical map and phylogenetic views. This resource will allow researchers to identify polymorphisms within candidate genes of interest, as well as examine the genomic diversity and distribution of strains. PolyTB source code is freely available to researchers wishing to develop similar tools for their pathogen of interest. 2014 Elsevier Ltd. All rights reserved.

  4. Burden of tuberculosis in indigenous peoples globally: a systematic review.

    Science.gov (United States)

    Tollefson, D; Bloss, E; Fanning, A; Redd, J T; Barker, K; McCray, E

    2013-09-01

    The burden of tuberculosis (TB) in the estimated 370 million indigenous peoples worldwide is unknown. To conduct a literature review to summarize the TB burden in indigenous peoples, identify gaps in current knowledge, and provide the foundation for a research agenda prioritizing indigenous health within TB control. A systematic literature review identified articles published between January 1990 and November 2011 quantifying TB disease burden in indigenous populations worldwide. Among the 91 articles from 19 countries included in the review, only 56 were from outside Australia, Canada, New Zealand and the United States. The majority of the studies showed higher TB rates among indigenous groups than non-indigenous groups. Studies from the Amazon generally reported the highest TB prevalence and incidence, but select populations from South-East Asia and Africa were found to have similarly high rates of TB. In North America, the Inuit had the highest reported TB incidence (156/100000), whereas the Metis of Canada and American Indians/Alaska Natives experienced rates of indigenous groups. Where data exist, indigenous peoples were generally found to have higher rates of TB disease than non-indigenous peoples; however, this burden varied greatly. The paucity of published information on TB burden among indigenous peoples highlights the need to implement and improve TB surveillance to better measure and understand global disparities in TB rates.

  5. A tuberculosis biomarker database: the key to novel TB diagnostics

    Directory of Open Access Journals (Sweden)

    Seda Yerlikaya

    2017-03-01

    Full Text Available New diagnostic innovations for tuberculosis (TB, including point-of-care solutions, are critical to reach the goals of the End TB Strategy. However, despite decades of research, numerous reports on new biomarker candidates, and significant investment, no well-performing, simple and rapid TB diagnostic test is yet available on the market, and the search for accurate, non-DNA biomarkers remains a priority. To help overcome this ‘biomarker pipeline problem’, FIND and partners are working on the development of a well-curated and user-friendly TB biomarker database. The web-based database will enable the dynamic tracking of evidence surrounding biomarker candidates in relation to target product profiles (TPPs for needed TB diagnostics. It will be able to accommodate raw datasets and facilitate the verification of promising biomarker candidates and the identification of novel biomarker combinations. As such, the database will simplify data and knowledge sharing, empower collaboration, help in the coordination of efforts and allocation of resources, streamline the verification and validation of biomarker candidates, and ultimately lead to an accelerated translation into clinically useful tools.

  6. TB epidemiology: where are the young women? Know your tuberculosis epidemic, know your response.

    Science.gov (United States)

    Perumal, Rubeshan; Naidoo, Kogieleum; Padayatchi, Nesri

    2018-03-27

    The global predominance of tuberculosis in men has received significant attention. However, epidemiological studies now demonstrate that there is an increased representation of young women with tuberculosis, especially in high HIV burden settings where young women bear a disproportionate burden of HIV. The role of the HIV epidemic, as well as changes in behavioural, biological, and structural risk factors are explored as potential explanations for the increasing burden of tuberculosis in young women. As young women are particularly vulnerable to HIV infection in sub-Saharan Africa, it is unsurprising that the TB epidemic in this setting has become increasingly feminised. This age-sex trend of TB in South Africa is similar to WHO estimates for other countries with a high HIV prevalence where there are more female than male cases notified up to the age of 25 years. The high prevalence of anaemia of chronic disease in young women with HIV is an additional potential reason for their increased TB risk. The widespread use of injectable medroxyprogesterone acetate contraception, which has been shown to possess selective glucocorticoid effect and oestrogen suppression, in young women may be an important emerging biological risk factor for tuberculosis in young women. Behavioural factors such as alcohol use and tobacco smoking patterns are further factors which may be responsible for the narrowing of the sex gap in TB epidemiology. In comparison to the significantly higher alcohol consumption rates in men globally, there is a narrowing gap in alcohol consumption between the sexes in South Africa with alarming rates of alcohol abuse in young women. There is a similar narrowing of the tobacco smoking gap between the sexes in South Africa, with increasing smoking prevalence in young women. With nearly 70% of all TB patients being co-infected with HIV in our setting, it is not surprising that the age and sex distribution of TB is increasingly resembling the distribution of HIV

  7. Global evidence directing regional preventive strategies in Southeast Asia for fighting TB/HIV.

    Science.gov (United States)

    Aung, Myo Nyein; Moolphate, Saiyud; Paudel, Damodar; Jayathunge Ph, Mangalasiri; Duangrithi, Duangjai; Wangdi, Kinley; Aung, Thin Nyein Nyein; Lorga, Thaworn; Higuchi, Kazue

    2013-03-14

    Tuberculosis (TB) and human immunodeficiency virus (HIV) co-epidemics form a huge burden of disease in the Southeast Asia region. Five out of eleven nations in this region are high TB/HIV burden countries: Myanmar, Thailand, India, Indonesia and Nepal. The trends of TB incidence in these countries have been rising in recent years, in contrast to a falling global trend. Experts in the field of TB control and health service providers have been perplexed by the association of TB and HIV infections which causes a mosaic clinical presentation, a unique course with poor treatment outcomes including death. We conducted a review of contemporary evidence relating to TB/HIV control with the aims of assisting integrated health system responses in Southeast Asia and demystifying current evidence to facilitate translating it into practice.

  8. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  9. Prevalence of pulmonary TB and spoligotype pattern of Mycobacterium tuberculosis among TB suspects in a rural community in Southwest Ethiopia

    Directory of Open Access Journals (Sweden)

    Deribew Amare

    2012-03-01

    Full Text Available Abstract Background In Ethiopia where there is no strong surveillance system and state of the art diagnostic facilities are limited, the real burden of tuberculosis (TB is not well known. We conducted a community based survey to estimate the prevalence of pulmonary TB and spoligotype pattern of the Mycobacterium tuberculosis isolates in Southwest Ethiopia. Methods A total of 30040 adults in 10882 households were screened for pulmonary TB in Gilgel Gibe field research centre in Southwest Ethiopia. A total of 482 TB suspects were identified and smear microscopy and culture was done for 428 TB suspects. Counseling and testing for HIV/AIDS was done for all TB suspects. Spoligotyping was done to characterize the Mycobacterium tuberculosis isolates. Results Majority of the TB suspects were females (60.7% and non-literates (83.6%. Using smear microscopy, a total of 5 new and 4 old cases of pulmonary TB cases were identified making the prevalence of TB 30 per 100,000. However, using the culture method, we identified 17 new cases with a prevalence of 76.1 per 100,000. There were 4.3 undiagnosed pulmonary TB cases for every TB case who was diagnosed through the passive case detection mechanism in the health facility. Eleven isolates (64.7% belonged to the six previously known spoligotypes: T, Haarlem and Central-Asian (CAS. Six new spoligotype patterns of Mycobacterium tuberculosis, not present in the international database (SpolDB4 were identified. None of the rural residents was HIV infected and only 5 (5.5% of the urban TB suspects were positive for HIV. Conclusion The prevalence of TB in the rural community of Southwest Ethiopia is low. There are large numbers of undiagnosed TB cases in the community. However, the number of sputum smear-positive cases was very low and therefore the risk of transmitting the infection to others may be limited. Active case finding through health extension workers in the community can improve the low case detection rate

  10. [Multidrug-resistant tuberculosis: challenges of a global emergence].

    Science.gov (United States)

    Comolet, T

    2015-10-01

    Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

  11. Index-TB Guidelines: Guidelines on extrapulmonary tuberculosis for India

    Science.gov (United States)

    Sharma, Surendra K.; Ryan, H.; Khaparde, Sunil; Sachdeva, K. S.; Singh, Achintya D.; Mohan, Alladi; Sarin, Rohit; Paramasivan, C N; Kumar, Prahlad; Nischal, Neeraj; Khatiwada, Saurav; Garner, Paul; Tharyan, Prathap

    2017-01-01

    Extrapulmonary tuberculosis (EPTB) is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i) use of Xpert MTB/RIF in diagnosis, (ii) use of adjunct corticosteroids in treatment, and (iii) duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research. PMID:28862176

  12. Index-TB guidelines: Guidelines on extrapulmonary tuberculosis for India

    Directory of Open Access Journals (Sweden)

    Surendra K Sharma

    2017-01-01

    Full Text Available Extrapulmonary tuberculosis (EPTB is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i use of Xpert MTB/RIF in diagnosis, (ii use of adjunct corticosteroids in treatment, and (iii duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research.

  13. TB treatment initiation and adherence in a South African community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Møller Valerie

    2010-02-01

    Full Text Available Abstract Background Tuberculosis (TB is a global health concern. Inadequate case finding and case holding has been cited as major barrier to the control of TB. The TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. The Eastern Cape is known as a province with high TB incidence, prevalence and with one of the worst cure rates of South Africa. Its inhabitants can be considered lay experts when it comes to TB. Therefore, we investigated knowledge, perceptions of (access to TB treatment and adherence to treatment among an Eastern Cape population. Methods An area-stratified sampling design was applied. A total of 1020 households were selected randomly in proportion to the total number of households in each neighbourhood. Results TB knowledge can be considered fairly good among this community. Respondents' perceptions suggest that stigma may influence TB patients' decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Regression analyses revealed that in this population young and old, men and women and the lower and higher educated share the same attitudes and perceptions. Our findings are therefore likely to reflect the actual situation of TB patients in this population. Conclusions The lay experts' perceptions suggests that stigma appears to effect case holding and case finding. Future interventions should be directed at improving attitudes and perceptions to potentially reduce stigma. This requires a patient-centered approach to empower TB patients and active involvement in the development and implementation of stigma reduction programs.

  14. QuantiFERON® TB GOLD’ s applications in the tuberculosis disease

    Directory of Open Access Journals (Sweden)

    Maria Saladino

    2014-06-01

    Full Text Available Background. Tuberculosis is the most frequent cause of death from a single infectious agent in humans and remains a serious global health problem. The latent tuberculosis (LTBI treatment can prevent progression to active disease. People infected with LTBI are a dangerous reservoir, since any immunosuppressive factor can cause a reactivation of Mycobacterium leading to overt disease. Recent production and introduction into the healthcare system, on the other hand, are the IGRAs (Interferon-Gamma Release Assay. Materials and Methods. The QuantiFERON-TB Gold test is an ELISA assay of IFN-γ produced by sensitized lymphocytes that allows to overcome some limitations of Mantoux test, being an in vitro test with specific antigens for M. tuberculosis. In the present study we examined a population of 150 patients tested with the Mantoux test and the QuantiFERON-TB Gold test. The patients were divided into categories (contacts of the case, immigrants, health care personnel, and immunocompromised subjects in biological therapy. Results. The analysis of the obtained results from the comparison of the two tests showed a good concordance rate (47.3% in the case of double positivity and detected the highest percentage of discrepancy in the profile QuantiFERON negative/Mantoux positive. Conclusions. Our results allow to state that remains valid and effective use of the QuantiFERON test, provided it is flanked by the Mantoux test and a medical history of patients.

  15. Implications of the global increase of diabetes for tuberculosis control and patient care.

    NARCIS (Netherlands)

    Ruslami, R.; Aarnoutse, R.E.; Alisjahbana, B.; Ven, A.J.A.M. van der; Crevel, R. van

    2010-01-01

    OBJECTIVES: To review the current knowledge about tuberculosis (TB) and diabetes, assessing the implication of the global increase of diabetes for TB control and patient care. METHODS: Systematic literature review. RESULTS: Using public databases, it can be estimated that 12.6% (95% CI 9.2-17.3%) of

  16. State of affairs of tuberculosis in prison facilities: a systematic review of screening practices and recommendations for best TB control

    NARCIS (Netherlands)

    Vinkeles Melchers, Natalie V. S.; van Elsland, Sabine L.; Lange, Joep M. A.; Borgdorff, Martien W.; van den Hombergh, Jan

    2013-01-01

    Prisoners are at high risk of developing tuberculosis (TB), causing morbidity and mortality. Prison facilities encounter many challenges in TB screening procedures and TB control. This review explores screening practices for detection of TB and describes limitations of TB control in prison

  17. HGV&TB: a comprehensive online resource on human genes and genetic variants associated with tuberculosis

    OpenAIRE

    Sahajpal, Ruchika; Kandoi, Gaurav; Dhiman, Heena; Raj, Sweety; Scaria, Vinod; Bhartiya, Deeksha; Hasija, Yasha

    2014-01-01

    Abstract Tuberculosis (TB) is an infectious disease caused by fastidious pathogen Mycobacterium tuberculosis. TB has emerged as one of the major causes of mortality in the developing world. Role of host genetic factors that modulate disease susceptibility have not been studied widely. Recent studies have reported few genetic loci that provide impetus to this area of research. The availability of tools has enabled genome-wide scans for disease susceptibility loci associated with infectious dis...

  18. Oxidative Stress Markers in Tuberculosis and HIV/TB Co-Infection.

    Science.gov (United States)

    Rajopadhye, Shreewardhan Haribhau; Mukherjee, Sandeepan R; Chowdhary, Abhay S; Dandekar, Sucheta P

    2017-08-01

    Dysfunction of redox homeostasis has been implicated in many pathological conditions. An imbalance of pro- and anti-oxidants have been observed in Tuberculosis (TB) and its co-morbidities especially HIV/AIDS. The pro inflammatory milieu in either condition aggravates the physiological balance of the redox mechanisms. The present study therefore focuses on assessing the redox status of patients suffering from TB and HIV-TB co-infection. To assess the oxidative stress markers in the HIV-TB and TB study cohort. The current prospective study was conducted in Haffkine Institute, Parel, Maharashtra, India, during January 2013 to December 2015. Blood samples from 50 patients each suffering from active TB and HIV-TB co-infection were collected from Seth G.S.Medical College and KEM Hospital Mumbai and Group of Tuberculosis Hospital, Sewree Mumbai. Samples were processed and the experiments were carried out at the Department of Biochemistry, Haffkine Institute. Samples from 50 healthy volunteers were used as controls. Serum was assessed for pro-oxidant markers such as Nitric Oxide (NO), Thiobarbituric Acid Reactive Species (TBARS), C-Reactive Protein (CRP), superoxide anion. Antioxidant markers such as catalase and Superoxide Dismutase (SOD) were assessed. Total serum protein, was also assessed. Among the pro-oxidants, serum NO levels were decreased in TB group while no change was seen in HIV-TB group. TBARS and CRP levels showed significant increase in both groups; superoxide anion increased significantly in HIV-TB group. Catalase levels showed decreased activities in TB group. SOD activity significantly increased in HIV-TB but not in TB group. The total serum proteins were significantly increased in HIV-TB and TB groups. The values of Control cohort were with the normal reference ranges. In the present study, we found the presence of oxidative stress to be profound in the TB and HIV-TB co-infection population.

  19. Risk factors for bovine tuberculosis (bTB) in cattle in Ethiopia

    NARCIS (Netherlands)

    Dejene, Sintayehu W.; Heitkonig, Ignas; Prins, Herbert H.T.; Lemma, Fitsum A.; Mekonnen, Daniel A.; Alemu, Zelalem E.; Kelkay, Tessema Z.; Boer, de Fred

    2016-01-01

    Bovine tuberculosis (bTB) infection is generally correlated with individual cattle's age, sex, body condition, and with husbandry practices such as herd composition, cattle movement, herd size, production system and proximity to wildlife - including bTB maintenance hosts. We tested the

  20. Investing to end epidemics: the role of the Global Fund to control TB by 2030.

    Science.gov (United States)

    Kunii, Osamu; Yassin, Mohammed A; Wandwalo, Eliud

    2016-03-01

    The Global Fund to fight AIDS, Tuberculosis and Malaria provides over three-quarters of all international financing towards TB programs with US$4.7 billion disbursed, supporting provision of treatment for 13.2 million patients with smear-positive TB and 210 000 patients with multidrug-resistant TB in over 100 countries since 2002. In 2013, the Global Fund launched a new funding model that, among others, is advancing strategic investments to maximize impact, addressing 'missing' TB cases, enhancing a synergistic response to TB/HIV dual epidemics, and building resilient and sustainable systems for health. A new Global Fund Strategy is under development through consultation with various stakeholders, with which the Global Fund will work to play a more catalytic role and foster innovations to end the TB epidemic. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. FEATURES OF ADOLESCENTS TUBERCULOSIS AT A REFERRAL TB'S HOSPITAL IN TEHRAN, IRAN

    Directory of Open Access Journals (Sweden)

    Ferial Lotfian

    2016-01-01

    Full Text Available Abstract OBJECTIVE: To identify the pattern of the clinical, radiological, diagnostic procedures and loss to follow -up of the diagnosed cases of active tuberculosis (TB adolescents. METHODS: This study was a retrospective analysis of the medical records of 143 adolescents aged 10 to 18 years with tuberculosis who were admitted TB wards of National Research Institute of Tuberculosis and Lung Disease (NRITLD in Tehran, Iran, between March 2006 and March2011. RESULTS: Of the 143 patients identified, 62.9% were females. Median age of the patients was 16 years. The contact source was identified in 47.5%.The most common presenting symptom was cough (86%.Isolated pulmonary TB (PTB was detected in 113 patients (79%, 21 patients (14.7% had extrapulmonary TB(EPTB, and 9 patients (6.3% had PTB and EP TB .The most common site of  EPTB was pleural (14% .The most common radiographic finding was infiltration (61%.Positive acid fast smears were seen in 67.8%.Positive cultures for Mycobacterium tuberculosis(M. TB were seen in 31.6%. Positive PCR results were seen in 60%.The adolescents aged 15 to 18 years were more likely to lose weight (p=0.001, smear positive (p=0.002and have positive PCR results (p=0.009. The type of TB (p=0.017 was a significant factor influencing loss to follow-up. CONCLUSIONS: Adolescents with the high rate of positive sputum smear results and the high treatment default rate are more likely to increase risk for TB transmission to the community. The TB control programs should pay more attention to prevention and treatment of TB in adolescents.     Key words: adolescents, tuberculosis, Lost to follow-up, prevention

  2. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  3. Use of bactec 460 TB system in the diagnosis of tuberculosis

    Directory of Open Access Journals (Sweden)

    Rodrigues C

    2007-01-01

    Full Text Available Purpose : To evaluate, the efficacy of BACTEC 460 TB system for the diagnosis of tuberculosis in a tertiary care hospital in Mumbai, India. Methods : We compared 12,726 clinical specimens using BACTEC 460 TB system and conventional method for detection of Mycobacterium tuberculosis over a period of six years. Result: The overall recovery rate was 39% by BACTEC technique and 29% using Lowenstein-Jensen (LJ medium. An average detection time for B actec0 460 TB system was found to be 13.3 days and 15.3 days as against 31.2 days and 35.3 days by LJ method for respiratory and nonrespiratory specimens respectively. The average reporting time for drug susceptibility results ranged from 6-10 days for the BACTEC 460 TB system. Conclusions: The BACTEC system is a good system for level II laboratories, especially in the diagnosis of extrapulmonary and smear negative tuberculosis.

  4. Association between passive smoking and Mycobacterium tuberculosis infection in children with household TB contact

    Directory of Open Access Journals (Sweden)

    Novaily Zuliartha

    2015-03-01

    Full Text Available Background Tuberculosis (TB and cigarette consumption are relatively high in Indonesia. Passive smoking may increase the risk of infection and disease in adults and children exposed to TB. An association between passive smoking and Mycobacterium tuberculosis infection in children has not been well documented. Objective To assess for an association between passive smoking and M. tuberculosis infection in children who had household contact with a TB patient. Methods This cross-sectional study was conducted in February and March 2011. Children aged 5 to 18 years who had household contact with a TB patient underwent tuberculin testing for M. tuberculosis infection. Subjects were divided into two groups: those exposed to passive smoke and those not exposed to passive smoke. Chi-square test was used to assess for an association between passive smoking and M. tuberculosis infection. Results There were 140 children enrolled in this study, with 70 exposed to passive smoke and 70 not exposed to passive smoke. Prevalence of M. tuberculosis infection was significantly higher in the passive smoking group than in those not exposed to passive smoke [81.4% and 52.9%, respectively, (P= 0.0001]. In the passive smoking group there were significant associations between nutritional state, paternal and maternal education, and M. tuberculosis infection. But no associations were found between M. tuberculosis infection and familial income or BCG vaccination. Conclusion Among children who had household contact with a TB patient, they who exposed to passive smoke are more likely to have M. tuberculosis infection compared to they who not exposed to passive smoke.

  5. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  6. Tuberculosis: The Connection between TB and HIV (the AIDS Virus)

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  7. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  8. TB truths : Patients’ experience with tuberculosis and healthcare in sub-Saharan Africa

    NARCIS (Netherlands)

    Cremers, A.L.

    2018-01-01

    TB remains one of the most alarming global health threats of this age. Despite the often available TB medication for free, rates are not being significantly reduced or in some areas even going up. TB epidemiology have become more complex, due to the HIV epidemic and development of drug-resistance.

  9. Global Fund financing of public-private mix approaches for delivery of tuberculosis care.

    Science.gov (United States)

    Lal, S S; Uplekar, Mukund; Katz, Itamar; Lonnroth, Knut; Komatsu, Ryuichi; Yesudian Dias, Hannah Monica; Atun, Rifat

    2011-06-01

    To map the extent and scope of public-private mix (PPM) interventions in tuberculosis (TB) control programmes supported by the Global Fund. We reviewed the Global Fund's official documents and data to analyse the distribution, characteristics and budgets of PPM approaches within Global Fund supported TB grants in recipient countries between 2003 and 2008. We supplemented this analysis with data on contribution of PPM to TB case notifications in 14 countries reported to World Health Organization in 2009, for the preparation of the global TB control report. Fifty-eight of 93 countries and multi-country recipients of Global Fund-supported TB grants had PPM activities in 2008. Engagement with 'for-profit' private sector was more prevalent in South Asia while involvement of prison health services has been common in Eastern Europe and central Asia. In the Middle East and North Africa, involving non-governmental organizations seemed to be the focus. Average and median spending on PPM within grants was 10% and 5% respectively, ranging from 0.03% to 69% of the total grant budget. In China, India, Nigeria and the Philippines, PPM contributed to detecting more than 25% TB cases while maintaining high treatment success rates. In spite of evidence of cost-effectiveness, PPM constitutes only a modest part of overall TB control activities. Scaling up PPM across countries could contribute to expanding access to TB care, increasing case detection, improving treatment outcomes and help achieve the global TB control targets. © 2011 Blackwell Publishing Ltd.

  10. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  11. Resistance to first-line anti-TB drugs is associated with reduced nitric oxide susceptibility in Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Idh, Jonna; Mekonnen, Mekidim; Abate, Ebba

    2012-01-01

    The relative contribution of nitric oxide (NO) to the killing of Mycobacterium tuberculosis in human tuberculosis (TB) is controversial, although this has been firmly established in rodents. Studies have demonstrated that clinical strains of M. tuberculosis differ in susceptibility to NO, but how...

  12. Predictors of tuberculosis (TB) and antiretroviral (ARV) medication non-adherence in public primary care patients in South Africa: a cross sectional study.

    Science.gov (United States)

    Naidoo, Pamela; Peltzer, Karl; Louw, Julia; Matseke, Gladys; McHunu, Gugu; Tutshana, Bomkazi

    2013-04-26

    Despite the downward trend in the absolute number of tuberculosis (TB) cases since 2006 and the fall in the incidence rates since 2001, the burden of disease caused by TB remains a global health challenge. The co-infection between TB and HIV adds to this disease burden. TB is completely curable through the intake of a strict anti-TB drug treatment regimen which requires an extremely high and consistent level of adherence.The aim of this study was to investigate factors associated with adherence to anti-TB and HIV treatment drugs. A cross-sectional survey method was used. Three study districts (14 primary health care facilities in each) were selected on the basis of the highest TB caseload per clinic. All new TB and new TB retreatment patients were consecutively screened within one month of anti-tuberculosis treatment. The sample comprised of 3107 TB patients who had been on treatment for at least three weeks and a sub-sample of the total sample were on both anti-TB treatment and anti-retro-viral therapy(ART) (N = 757). Data collection tools included: a Socio-Demographic Questionnaire; a Post-Traumatic-Stress-Disorder (PTSD) Screen; a Psychological Distress Scale; the Alcohol Use Disorder Identification Test (AUDIT); and self-report measures of tobacco use, perceived health status and adherence to anti-TB drugs and ART. The majority of the participants (N = 3107) were new TB cases with a 55.9% HIV co-infection rate in this adult male and female sample 18 years and older. Significant predictors of non-adherence common to both anti-TB drugs and to dual therapy (ART and anti-TB drugs) included poverty, having one or more co-morbid health condition, being a high risk for alcohol mis-use and a partner who is HIV positive. An additional predictor for non-adherence to anti-TB drugs was tobacco use. A comprehensive treatment programme addressing poverty, alcohol mis-use, tobacco use and psycho-social counseling is indicated for TB patients (with and without HIV

  13. Difference in TB10.4 T-cell epitope recognition following immunization with recombinant TB10.4, BCG or infection with Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Billeskov, Rolf; Grandal, Michael V; Poulsen, Christian

    2010-01-01

    vaccine Ag, TB10.4, in a recombinant form, or when expressed by the pathogen Mycobacterium tuberculosis (M.tb), or by the current anti-tuberculosis vaccine, Mycobacterium bovis BCG. We showed that BCG and M.tb induced a similar CD4(+) T-cell specific TB10.4 epitope-pattern, which differed completely from...... that induced by recombinant TB10.4. This difference was not due to post-translational modifications of TB10.4 or because TB10.4 is secreted from BCG and M.tb as a complex with Rv0287. In addition, BCG and TB10.4/CAF01 were both taken up by DC and macrophages in vivo, and in vitro uptake experiments revealed...... that both TB10.4 and BCG were transported to Lamp(+)-compartments. BCG and TB10.4 however, were directed to different types of Lamp(+)-compartments in the same APC, which may lead to different epitope recognition patterns. In conclusion, we show that different vectors can induce completely different...

  14. Diagnosis of tuberculosis in a high TB-HIV environment using ...

    African Journals Online (AJOL)

    There is growing concern about the high transmission of tuberculosis (TB) in prisons posing a risk to the outside community. There are high levels of overcrowding in the Uganda Prisons Service (UPS) with some prisons accommodating 4 times above their designed capacities. Our objective was to determine the prevalence ...

  15. diagnosis of tuberculosis in a high tb-hiv environment using ...

    African Journals Online (AJOL)

    PUBLICATIONS1

    ABSTRACT. There is growing concern about the high transmission of tuberculosis (TB) in prisons posing a risk to the outside community. There are high levels of overcrowding in the Uganda Prisons Ser- vice (UPS) with some prisons accommodating 4 times above their designed capacities. Our ob- jective was to determine ...

  16. Eco-epidemiology of Bovine Tuberculosis (bTB) in an African savanna

    NARCIS (Netherlands)

    Dejene, Sintayehu Workeneh

    2017-01-01

    Bovine tuberculosis (bTB) is a zoonotic disease, and remains a cause of concern for livestock, wildlife and human health, especially in Ethiopia. It is a contagious disease, so close contact between animals or sharing of feed between infected and non-infected animals are major risk factors for

  17. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  18. Patient satisfaction with TB care clinical consultations in Kampala: a ...

    African Journals Online (AJOL)

    ... on treatment outcome. Keywords: Patient satisfaction, TB care clinical consultations, cross sectional study. ... Background: Tuberculosis (TB) remains a major global ... Measurement of outcome: Variables considered were; how long the ... Key: ART= Antiretroviral Therapy. Characteristic. Parameter n (%). Sex. Female.

  19. Pulmonary tuberculosis

    Science.gov (United States)

    TB; Tuberculosis - pulmonary; Mycobacterium - pulmonary ... Pulmonary TB is caused by the bacterium Mycobacterium tuberculosis (M tuberculosis) . TB is contagious. This means the bacteria is easily spread from an infected person ...

  20. Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

    Directory of Open Access Journals (Sweden)

    Kryzhanovsky D.G.

    2014-11-01

    Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

  1. Efficacy Testing of H56 cDNA Tattoo Immunization against Tuberculosis in a Mouse Model

    NARCIS (Netherlands)

    Platteel, Anouk C M; Nieuwenhuizen, Natalie E; Domaszewska, Teresa; Schürer, Stefanie; Zedler, Ulrike; Brinkmann, Volker; Sijts, Alice; Kaufmann, Stefan H E

    2017-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), remains a global threat. The only approved vaccine against TB, Mycobacterium bovis bacillus Calmette-Guérin (BCG), provides insufficient protection and, being a live vaccine, can cause disseminated disease in immunocompromised

  2. The risk factor of false-negative and false-positive for T-SPOT.TB in active tuberculosis.

    Science.gov (United States)

    Di, Li; Li, Yan

    2018-02-01

    T-SPOT.TB is a promising diagnosis tool to identify both pulmonary tuberculosis and extrapulmonary tuberculosis, as well as latent tuberculosis; however, the factors that affect the results of T-SPOT.TB remains unclear. In this study, we aim to figure out the risk factor of T-SPOT.TB for active TB. A total of 349 patients were recruited between January 1st, 2016 and January 22st, 2017 at Renmin Hospital of Wuhan University, including 98 subjects with TB and 251 subjects with non-TB disease, and received T-SPOT.TB (Oxford Immunotec Ltd). Statistics were analyzed by SPSS 19.0 using logistic regression. The overall specificity and sensitivity of the T-SPOT.TB was 92.83% (233/251; 95%CI 0.8872-0.9557) and 83.67% (82/98; 95%CI 0.7454-0.9010), respectively. Patients with tuberculous meningitis were more likely to have false-negative results (OR 17.4, 95%CI 3.068-98.671; P.05). Tuberculous meningitis was a risk factor of false-negative for T-SPOT.TB, while cured TB was a risk factor of false-positive. © 2017 Wiley Periodicals, Inc.

  3. Systematic review on tuberculosis transmission on aircraft and update of the European Centre for Disease Prevention and Control risk assessment guidelines for tuberculosis transmitted on aircraft (RAGIDA-TB).

    Science.gov (United States)

    Kotila, Saara M; Payne Hallström, Lara; Jansen, Niesje; Helbling, Peter; Abubakar, Ibrahim

    2016-01-01

    As a setting for potential tuberculosis (TB) transmission and contact tracing, aircraft pose specific challenges. Evidence-based guidelines are needed to support the related-risk assessment and contact-tracing efforts. In this study evidence of TB transmission on aircraft was identified to update the Risk Assessment Guidelines for TB Transmitted on Aircraft (RAGIDA-TB) of the European Centre for Disease Prevention and Control (ECDC). Electronic searches were undertaken from Medline (Pubmed), Embase and Cochrane Library until 19 July 2013. Eligible records were identified by a two-stage screening process and data on flight and index case characteristics as well as contact tracing strategies extracted. The systematic literature review retrieved 21 records. Ten of these records were available only after the previous version of the RAGIDA guidelines (2009) and World Health Organization guidelines on TB and air travel (2008) were published. Seven of the 21 records presented some evidence of possible in-flight transmission, but only one record provided substantial evidence of TB transmission on an aircraft. The data indicate that overall risk of TB transmission on aircraft is very low. The updated ECDC guidelines for TB transmission on aircraft have global implications due to inevitable need for international collaboration in contract tracing and risk assessment.

  4. Tuberculosis Screening on a Health Science Campus: Use of QuantiFERON-TB Gold Test for Students and Employees

    Science.gov (United States)

    Veeser, Peggy Ingram; Smith, Phillip Karl; Handy, Barry; Martin, Sharon R.

    2007-01-01

    Detecting and managing "Mycobacterium tuberculosis" (TB) infection in a health-science center population is a clinical dilemma. Tuberculin skin tests are still the preferred method for detecting present or past infection of TB. The authors discuss the performance of whole blood interferon gamma release assay test commercially known as…

  5. The Risk of Depressive Disorder Among Contacts of Tuberculosis Patients in a TB-endemic Area

    Science.gov (United States)

    Pan, Sheng-Wei; Yen, Yung-Feng; Feng, Jia-Yih; Su, Vincent Yi-Fong; Kou, Yu Ru; Su, Wei-Juin

    2015-01-01

    Abstract Tuberculosis (TB) disease may be transmitted to close contacts of index cases, causing physical illness. No studies have investigated the risk of developing depressive disorder among TB contacts in a TB-endemic area. Adult participants with a new diagnosis of TB contact (ICD-9-CM codes V01.1 plus chest radiographic order) since January 1, 2008, were identified from the National Health Insurance Research Database in Taiwan. A control cohort matched for age (±5 y), sex, enrolled years, and income level was selected. These 2 cohorts were followed until December 31, 2012, and observed for the development of depressive disorder. The Kaplan-Meier method and the log-rank test were used to examine the difference in cumulative incidences of depressive disorder between groups. Cox proportional-hazard models were used to calculate adjusted hazard ratios (aHRs) for depressive disorder. The TB contact cohort consisted of 9046 patients and matched controls of 36,184 ones. The mean age of TB contacts was 44.7 years, and 56.0% of them were women. During a mean follow-up period of 2.5 years, 127 (1.40%) TB contacts and 521 (1.44%) matched controls developed depressive disorder. TB exposure was found to be an independent risk factor of depressive disorder in women (aHR 1.34, 95% confidence interval [CI] 1.07–1.68), but not in men (aHR 0.71, 95% CI 0.48–1.06) after adjusting for age, comorbidities, and income levels. The risk of depression was significantly higher for female TB contacts than for matched controls in the first and second years (aHR 1.49, 95% CI 1.03–2.14; and aHR 1.53, 95% CI 1.05–2.23, respectively), but not thereafter. Of note, 67 (0.74%) TB contacts and 88 (0.24%) matched controls developed active TB, but none of them had subsequent depressive disorder during follow-up periods. Female TB contacts had an increased risk of depression within the first 2 years after exposure. Clinicians should consider conducting depression evaluations in addition to

  6. Viral hepatitis and HIV-associated tuberculosis: Risk factors and TB treatment outcomes in Thailand

    Directory of Open Access Journals (Sweden)

    Likanonsakul Sirirat

    2008-07-01

    Full Text Available Abstract Background The occurrence of tuberculosis (TB, human immunodeficiency virus (HIV, and viral hepatitis infections in the same patient poses unique clinical and public health challenges, because medications to treat TB and HIV are hepatotoxic. We conducted an observational study to evaluate risk factors for HBsAg and/or anti-HCV reactivity and to assess differences in adverse events and TB treatment outcomes among HIV-infected TB patients. Methods Patients were evaluated at the beginning, during, and at the end of TB treatment. Blood samples were tested for aspartate aminotransferase (AST, alanine aminotransferase (ALT, total bilirubin (BR, complete blood count, and CD4+ T lymphocyte cell count. TB treatment outcomes were assessed at the end of TB treatment according to international guidelines. Results Of 769 enrolled patients, 752 (98% had serologic testing performed for viral hepatitis: 70 (9% were reactive for HBsAg, 237 (31% for anti-HCV, and 472 (63% non-reactive for both markers. At the beginning of TB treatment, 18 (26% patients with HBsAg reactivity had elevated liver function tests compared with 69 (15% patients non-reactive to any viral marker (p = 0.02. At the end of TB treatment, 493 (64% were successfully treated. Factors independently associated with HBsAg reactivity included being a man who had sex with men (adjusted odds ratio [AOR], 2.1; 95% confidence interval [CI], 1.1–4.3 and having low TB knowledge (AOR, 1.8; CI, 1.0–3.0. Factors most strongly associated with anti-HCV reactivity were having injection drug use history (AOR, 12.8; CI, 7.0–23.2 and living in Bangkok (AOR, 15.8; CI, 9.4–26.5. The rate of clinical hepatitis and death during TB treatment was similar in patients HBsAg reactive, anti-HCV reactive, both HBsAg and anti-HCV reactive, and non-reactive to any viral marker. Conclusion Among HIV-infected TB patients living in Thailand, markers of viral hepatitis infection, particularly hepatitis C virus

  7. The global dynamics of diabetes and tuberculosis: the impact of migration and policy implications

    Directory of Open Access Journals (Sweden)

    Enrico Girardi

    2017-03-01

    Full Text Available The convergence between tuberculosis (TB and diabetes mellitus (DM will represent a major public health challenge in the near future. DM increases the risk of developing TB by two to three times and also increases the risk of TB treatment failure, relapse, and death. The global prevalence of DM is predicted to rise significantly in the next two decades, particularly in some of the low- and middle-income countries with the highest TB burden. Migration may add further complexity to the effort to control the impact on TB of the growing DM pandemic. Migration may increase the risk of DM, although the magnitude of this association varies according to country of origin and ethnic group, due to genetic factors and lifestyle differences. Migrants with TB may have an increased prevalence of DM compared to the native population, and the risk of TB among persons with DM may be higher in migrants than in autochthonous populations. Screening for DM among migrants, screening migrants with DM for active and latent TB, and improving access to DM care, could contribute to mitigate the effects of DM on TB.

  8. Association between smoking, tuberculosis and diabetes-TB: an analysis on Indian TB patients

    Directory of Open Access Journals (Sweden)

    Ashok Bhardwaj

    2018-03-01

    400 (100 P value Non Smoker 20 (10.5 170 (89.5 190 (100 0.03 Current 17 (12.5 119 (87.5 136 (100 Ex -Smoker 17 (33.0 57 (77.0 74 (100 Median duration of smoking (IQR in years 20 (30 0.5 (25 3 (65 0.03 [Prevalence of Smoking with TB DM

  9. Pulmonary Immune-Compartment-Specific Interferon Gamma Responses in HIV-Infected Individuals with Active Tuberculosis (TB in an Area of High TB Prevalence

    Directory of Open Access Journals (Sweden)

    S. Buldeo

    2012-01-01

    Full Text Available There is a paucity of data on the pulmonary immune-compartment interferon gamma (IFNγ response to M. tuberculosis, particularly in settings of high tuberculosis (TB prevalence and in HIV-coinfected individuals. This data is necessary to understand the diagnostic potential of commercially available interferon gamma release assays (IGRAs in both the pulmonary immune-compartment and peripheral blood. We used intracellular cytokine staining by flow cytometry to assess the IFNγ response to purified protein derivative (PPD and early secretory antigen 6 (ESAT6 in induced sputa (ISp and blood samples from HIV-infected, smear-negative, TB suspects. We found that individuals with active TB disease produced significantly less IFNγ in response to PPD in their induced sputa samples than individuals with non-active TB (control group. This difference was not reflected in the peripheral blood, even within the CD27− CD4+ memory T lymphocyte population. These findings suggest that progression to active TB disease may be associated with the loss of IFNγ secretion at the site of primary infection. Our findings highlight the importance of studying pulmonary immune-compartment M. tuberculosis specific responses to elucidate IFNγ secretion across the spectrum of TB disease.

  10. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  11. The Ontario Universal Typing of Tuberculosis (OUT-TB Surveillance Program – What It Means to You

    Directory of Open Access Journals (Sweden)

    Shelly Bolotin

    2010-01-01

    Full Text Available BACKGROUND: Tuberculosis (TB is a serious disease that is transmitted primarily by the airborne route. Effective disease control and outbreak management requires the timely diagnosis, isolation and treatment of infected individuals with active disease; contact tracing to identify secondary cases likely to benefit from treatment of latent infection; and laboratory identification or confirmation of epidemiologically linked cases. TB genotyping enables the comparison of Mycobacterium tuberculosis complex (MTBC strains and the identification of cases that may or may not be linked. The increased availability of molecular methods for genotyping has allowed for greater discrimination of MTBC strains and greatly enhanced understanding of TB transmission patterns.

  12. Rights and Responsibilities of Tuberculosis Patients, and the Global Fund: A Qualitative Study.

    Science.gov (United States)

    Atif, Muhammad; Javaid, Sareema; Farooqui, Maryam; Sarwar, Muhammad Rehan

    2016-01-01

    Implementation of the Charter to protect patients' rights is an important criterion to achieve patient-centered approach and receive financial support from the Global Fund. Our study aims to explore the knowledge of tuberculosis (TB) patients about their rights and responsibilities at the Chest Disease Unit of the Bahawal Victoria Hospital, Bahawalpur, Pakistan. This was a qualitative study. The data from purposefully selected TB patients was collected by in-depth interviews. Eligibility criteria included confirmed diagnosis of TB and enrollment in the TB program. A pilot tested interview protocol was based upon the objectives of the study, and was used uniformly in each interview to maintain the consistency. The sample size was limited by applying the saturation criteria. All interviews were audiotaped and transcribed verbatim. Inductive thematic content analysis was applied to analyze the data and draw conclusions. Out of the total 16 patients, four were female, and seven were illiterate. Eight patients were known cases of multi-drug resistant TB. Analysis of the data yielded seven themes; tuberculosis care services, moral support and stigmatization, dignity and privacy, complaints, fear of losing job, information sharing and compliance to the treatment plan, and contribution to eradicate TB. First five represented the rights section while latter two were related to the responsibilities section of the Charter. Discriminatory access to TB care services and the right to privacy were two major concerns identified in this study. However, the respondents recognized their responsibilities as a TB patient. To ensure uninterrupted investment from the Global Fund, there is a need to implement fair TB care policies which support human rights-based approach.

  13. Rights and Responsibilities of Tuberculosis Patients, and the Global Fund: A Qualitative Study.

    Directory of Open Access Journals (Sweden)

    Muhammad Atif

    Full Text Available Implementation of the Charter to protect patients' rights is an important criterion to achieve patient-centered approach and receive financial support from the Global Fund. Our study aims to explore the knowledge of tuberculosis (TB patients about their rights and responsibilities at the Chest Disease Unit of the Bahawal Victoria Hospital, Bahawalpur, Pakistan.This was a qualitative study. The data from purposefully selected TB patients was collected by in-depth interviews. Eligibility criteria included confirmed diagnosis of TB and enrollment in the TB program. A pilot tested interview protocol was based upon the objectives of the study, and was used uniformly in each interview to maintain the consistency. The sample size was limited by applying the saturation criteria. All interviews were audiotaped and transcribed verbatim. Inductive thematic content analysis was applied to analyze the data and draw conclusions.Out of the total 16 patients, four were female, and seven were illiterate. Eight patients were known cases of multi-drug resistant TB. Analysis of the data yielded seven themes; tuberculosis care services, moral support and stigmatization, dignity and privacy, complaints, fear of losing job, information sharing and compliance to the treatment plan, and contribution to eradicate TB. First five represented the rights section while latter two were related to the responsibilities section of the Charter.Discriminatory access to TB care services and the right to privacy were two major concerns identified in this study. However, the respondents recognized their responsibilities as a TB patient. To ensure uninterrupted investment from the Global Fund, there is a need to implement fair TB care policies which support human rights-based approach.

  14. Antiretroviral Treatment Scale-Up and Tuberculosis Mortality in High TB/HIV Burden Countries: An Econometric Analysis.

    Science.gov (United States)

    Yan, Isabel; Bendavid, Eran; Korenromp, Eline L

    2016-01-01

    Antiretroviral therapy (ART) reduces mortality in patients with active tuberculosis (TB), but the population-level relationship between ART coverage and TB mortality is untested. We estimated the reduction in population-level TB mortality that can be attributed to increasing ART coverage across 41 high HIV-TB burden countries. We compiled TB mortality trends between 1996 and 2011 from two sources: (1) national program-reported TB death notifications, adjusted for annual TB case detection rates, and (2) WHO TB mortality estimates. National coverage with ART, as proportion of HIV-infected people in need, was obtained from UNAIDS. We applied panel linear regressions controlling for HIV prevalence (5-year lagged), coverage of TB interventions (estimated by WHO and UNAIDS), gross domestic product per capita, health spending from domestic sources, urbanization, and country fixed effects. Models suggest that that increasing ART coverage was followed by reduced TB mortality, across multiple specifications. For death notifications at 2 to 5 years following a given ART scale-up, a 1% increase in ART coverage predicted 0.95% faster mortality rate decline (p = 0.002); resulting in 27% fewer TB deaths in 2011 alone than would have occurred without ART. Based on WHO death estimates, a 1% increase in ART predicted a 1.0% reduced TB death rate (peconometric analysis supports a substantial impact of ART on population-level TB mortality realized already within the first decade of ART scale-up, that is apparent despite variable-quality mortality data.

  15. Utility of urine lipoarabinomannan (LAM) in diagnosing tuberculosis and predicting mortality with and without HIV: prospective TB cohort from the Thailand Big City TB Research Network.

    Science.gov (United States)

    Suwanpimolkul, Gompol; Kawkitinarong, Kamon; Manosuthi, Weerawat; Sophonphan, Jiratchaya; Gatechompol, Sivaporn; Ohata, Pirapon June; Ubolyam, Sasiwimol; Iampornsin, Thatri; Katerattanakul, Pairaj; Avihingsanon, Anchalee; Ruxrungtham, Kiat

    2017-06-01

    To evaluate the applicability and accuracy of the urine lipoarabinomannan (LAM) test in tuberculosis (TB)/HIV co-infected patients and HIV-negative patients with disseminated TB. Frozen urine samples obtained at baseline from patients in the TB research cohort with proven culture-positive TB were selected for blinded urine LAM testing. One hundred and nine patients were categorized into four groups: (1) HIV-positive patients with TB; (2) HIV-negative patients with disseminated TB; (3) HIV-negative immunocompromised patients with TB; and (4) patients with diseases other than TB. The sensitivity of urine LAM testing for culture-positive TB, specificity of urine LAM testing for patients without TB, positive predictive value (PPV), and negative predictive value (NPV) were assessed. The sensitivity of the urine LAM test in group 1 patients with a CD4 T-cell count of >100, ≤100, and ≤50 cells/mm 3 was 38.5%, 40.6%, and 45%, respectively. The specificity and PPV of the urine LAM test were >80%. The sensitivity of the test was 20% in group 2 and 12.5% in group 3, and the specificity and PPV were 100% for both groups. A positive urine LAM test result was significantly associated with death. This promising diagnostic tool could increase the yield of TB diagnosis and may predict the mortality rate of TB infection, particularly in TB/HIV co-infected patients. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  16. Risk Factors for Bovine Tuberculosis (bTB in Cattle in Ethiopia.

    Directory of Open Access Journals (Sweden)

    Sintayehu W Dejene

    Full Text Available Bovine tuberculosis (bTB infection is generally correlated with individual cattle's age, sex, body condition, and with husbandry practices such as herd composition, cattle movement, herd size, production system and proximity to wildlife-including bTB maintenance hosts. We tested the correlation between those factors and the prevalence of bTB, which is endemic in Ethiopia's highland cattle, in the Afar Region and Awash National Park between November 2013 and April 2015. A total of 2550 cattle from 102 herds were tested for bTB presence using the comparative intradermal tuberculin test (CITT. Data on herd structure, herd movement, management and production system, livestock transfer, and contact with wildlife were collected using semi-structured interviews with cattle herders and herd owners. The individual overall prevalence of cattle bTB was 5.5%, with a herd prevalence of 46%. Generalized Linear Mixed Models with a random herd-effect were used to analyse risk factors of cattle reactors within each herd. The older the age of the cattle and the lower the body condition the higher the chance of a positive bTB test result, but sex, lactation status and reproductive status were not correlated with bTB status. At herd level, General Linear Models showed that pastoral production systems with transhumant herds had a higher bTB prevalence than sedentary herds. A model averaging analysis identified herd size, contact with wildlife, and the interaction of herd size and contact with wildlife as significant risk factors for bTB prevalence in cattle. A subsequent Structural Equation Model showed that the probability of contact with wildlife was influenced by herd size, through herd movement. Larger herds moved more and grazed in larger areas, hence the probability of grazing in an area with wildlife and contact with either infected cattle or infected wildlife hosts increased, enhancing the chances for bTB infection. Therefore, future bTB control strategies

  17. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  18. Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Mubashir Zafar

    2013-01-01

    Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

  19. Treating tuberculosis with high doses of anti-TB drugs: mechanisms and outcomes.

    Science.gov (United States)

    Xu, Yuhui; Wu, Jianan; Liao, Sha; Sun, Zhaogang

    2017-10-03

    Tuberculosis (TB) is considered as one of the most serious threats to public health in many parts of the world. The threat is even more severe in the developing countries where there is a lack of advanced medical amenities and contemporary anti-TB drugs. In such situations, dosage optimization of existing medication regimens seems to be the only viable option. Therapeutic drug monitoring study results suggest that high-dose treatment regimens can compensate the low serum concentration of anti-TB drugs and shorten the therapy duration. The article presents a critical review on the possible changes that occur in the host and the pathogen upon the administration of standard and high-dose regimens. Some of the most common factors that are responsible for low anti-TB drug concentrations in the serum are differences in hosts' body weight, metabolic processing of the drug, malabsorption and/or drug-drug interaction. Furthermore, failure to reach the cavitary pulmonary and extrapulmonary tissues also contributes to the therapeutic inefficiency of the drugs. In such conditions, administration of higher doses can help in compensating the pathogenic outcomes of enhancement of the pathogen's physical barriers, efflux pumps and genetic mutations. The present article also presents a summary of the recorded treatment outcomes of clinical trials that were conducted to test the efficacy of administration of high dose of anti-tuberculosis drugs. This review will help physicians across the globe to understand the underlying pathophysiological changes (including side effects) that dictate the clinical outcomes in patients administered with standard and/or high dose anti-TB drugs.

  20. Tuberculosis

    NARCIS (Netherlands)

    Ankrah, Alfred O; Glaudemans, Andor W J M; Maes, Alex; Van de Wiele, Christophe; Dierckx, Rudi A J O; Vorster, Mariza; Sathekge, Mike M

    Tuberculosis (TB) is currently the world's leading cause of infectious mortality. Imaging plays an important role in the management of this disease. The complex immune response of the human body to Mycobacterium tuberculosis results in a wide array of clinical manifestations, making clinical and

  1. Tuberculosis: General Information

    Science.gov (United States)

    TB Elimination Tuberculosis: General Information What is TB? Tuberculosis (TB) is a disease caused by germs that are spread from person ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination CS227840_A What Does a Positive Test ...

  2. QuantiFERON®-TB gold in-tube performance for diagnosing active tuberculosis in children and adults in a high burden setting

    DEFF Research Database (Denmark)

    Rose, Michala Vaaben; Kimaro, Godfather; Nissen, Thomas N

    2012-01-01

    To determine whether QuantiFERON®-TB Gold In-Tube (QFT) can contribute to the diagnosis of active tuberculosis (TB) in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST) in a prospective cohort of TB suspect children compared to adults with confi......To determine whether QuantiFERON®-TB Gold In-Tube (QFT) can contribute to the diagnosis of active tuberculosis (TB) in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST) in a prospective cohort of TB suspect children compared to adults...

  3. Mycobacterium tuberculosis strains potentially involved in the TB epidemic in Sweden a century ago.

    Directory of Open Access Journals (Sweden)

    Ramona Groenheit

    Full Text Available UNLABELLED: A hundred years ago the prevalence of tuberculosis (TB in Sweden was one of the highest in the world. In this study we conducted a population-based search for distinct strains of Mycobacterium tuberculosis complex isolated from patients born in Sweden before 1945. Many of these isolates represent the M. tuberculosis complex population that fueled the TB epidemic in Sweden during the first half of the 20(th century. METHODS: Genetic relationships between strains that caused the epidemic and present day strains were studied by spoligotyping and restriction fragment length polymorphism. RESULTS: The majority of the isolates from the elderly population were evolutionary recent Principal Genetic Group (PGG2/3 strains (363/409 or 88.8%, and only a low proportion were ancient PGG1 strains (24/409 or 5.9%. Twenty-two were undefined. The isolates demonstrated a population where the Euro-American superlineage dominated; in particular with Haarlem (41.1% and T (37.7% spoligotypes and only 21.2% belonged to other spoligotype families. Isolates from the elderly population clustered much less frequently than did isolates from a young control group population. CONCLUSIONS: A closely knit pool of PGG2/3 strains restricted to Sweden and its immediate neighbours appears to have played a role in the epidemic, while PGG1 strains are usually linked to migrants in todaýs Sweden. Further studies of these outbreak strains may give indications of why the epidemic waned.

  4. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  5. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  6. [Analysis of tuberculosis infection among foreigners using QuantiFeron TB-2G test].

    Science.gov (United States)

    Higuchi, Kazue; Harada, Nobuyuki; Nagasaka, Yuji; Mori, Toru

    2007-06-01

    The purpose of this study was to investigate contacts of a tuberculosis patient among foreigners using QuantiFERON TB-2G (QFT-2G) test. Three index cases in this study were all foreigners. Contacts, who were mostly foreigners and some Japanese, were investigated by a chest X-ray examination, tuberculin skin test (TST) and QFT-2G, and all data were compared. Among 48 subjects (30 Vietnamese and 18 Japanese) in case 1, 8 Vietnamese and 2 Japanese were QFT-2G positive. One contacts among 3 most close contacts who lived in the same room with the index case was QFT-2G positive. In case 2, three Chinese among 22 contacts were QFT-2G positive, and a very close contact who lived in the next door to the index case was QFT-2G negative. Seven QFT-2G positive Chinese were identified among 24 contacts in case 3. However, four very close contacts among them were QFT-2G negative. Although it was unclear whether QFT-2G positives in cases 1 and 2 were infected with M. tuberculosis through the index cases, it is possible to speculate that these QFT-2G positives were already infected with M. tuberculosis while they live in their own country based on the prevalence of TB in their countries and the fact that many very close contacts were QFT-2G negative. Also, it was suggested that QFT-2G positives in case 3 may not be infected through the index case, but infected in their country, since all close contacts were QFT-2G negative. The results of this study suggested that using the QFT-2G test for foreigners prior to or soon after their entry to Japan and recommending chemoprophylaxis for those who are QFT-2G positive would be a very efficient control measures against immigrant foreigners with TB infection.

  7. Evaluation of the performance of two tuberculosis interferon gamma release assays (IGRA-ELISA and T-SPOT.TB) for diagnosing Mycobacterium tuberculosis infection.

    Science.gov (United States)

    Wang, Linchuan; Tian, Xu-Dong; Yu, Yan; Chen, Wei

    2018-04-01

    The IGRA-ELISA and T-SPOT.TB are widely used in China. The aim of the study was to evaluate the performance of the two assays in diagnosis Mycobacterium tuberculosis infection. Of the 3727 patients in the study, 204 underwent testing using both the T-SPOT.TB and IGRA-ELISA, 1794 were tested using the T-SPOT.TB only, and 1729 were tested using the IGRA-ELISA only. The positive rate and consistency of the two assays were analyzed, and their sensitivity and specificity for diagnosing active tuberculosis were compared. There were no significant differences in the positive rate between the T-SPOT.TB test (25.8%) and IGRA-ELISA (28.6%), p = .065. The two assays were highly consistent, with a kappa value of 0.852 (p SPOT.TB test were 82.9% (107/129) and 78.6% (1309/1665), respectively, and those of IGRA-ELISA were 81.7% (94/115) and 75.2% (1214/1614), respectively. There were no significant differences in sensitivity (p > .05), but the specificity of the T-SPOT.TB test was slightly higher than that of IGRA-ELISA (p = .023). Both in terms of diagnosing M. tuberculosis infection and ruling out active tuberculosis, the performance of the IGRA-ELISA-a simple, almost labor-free assay that allows simultaneous processing of a very large number of samples-was well-matched with that of T-SPOT.TB test. However, IGRAs cannot be used as the only test to diagnose active tuberculosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Financing tuberculosis control: the role of a global financial monitoring system.

    Science.gov (United States)

    Floyd, Katherine; Pantoja, Andrea; Dye, Christopher

    2007-05-01

    Control of tuberculosis (TB), like health care in general, costs money. To sustain TB control at current levels, and to make further progress so that global targets can be achieved, information about funding needs, sources of funding, funding gaps and expenditures is important at global, regional, national and sub-national levels. Such data can be used for resource mobilization efforts; to document how funding requirements and gaps are changing over time; to assess whether increases in funding can be translated into increased expenditures and whether increases in expenditure are producing improvements in programme performance; and to identify which countries or regions have the greatest needs and funding gaps. In this paper, we discuss a global system for financial monitoring of TB control that was established in WHO in 2002. By early 2007, this system had accounted for actual or planned expenditures of more than US$ 7 billion and was systematically reporting financial data for countries that carry more than 90% of the global burden of TB. We illustrate the value of this system by presenting major findings that have been produced for the period 2002-2007, including results that are relevant to the achievement of global targets for TB control set for 2005 and 2015. We also analyse the strengths and limitations of the system and its relevance to other health-care programmes.

  9. TB or not TB?’ Problems of differential diagnosis of cutaneous mycobacteriosis and tuberculosis – A Case Study and interdisciplinary discussion

    Directory of Open Access Journals (Sweden)

    Katarzyna Szmygin-Milanowska

    2015-12-01

    Full Text Available The diagnosis of cutaneous tuberculosis poses a serious challenge due to many skin diseases of different etiology resembling the lesions caused by the TB (tuberculosis bacillus, and difficulties in confirming the disease. The presented case concerns skin lesions in a hobby aquarist stung in the finger of the left hand by a fish. The resulting inflammatory infiltration was to be cutaneous tuberculosis or mycobacteriosis caused by MOTT (Mycobacterium other than tuberculosis. Laboratory, pathomorphologic, genetic and microbiologic tests of samples obtained from the patient, fish and water in the aquarium gave ambiguous results. A multidisciplinary discussion is presented on the difficulties in the differential diagnosis, problems with a clear interpretation of the results of various conducted tests, and possible ways of transmission of the infection, relevant to the described example.

  10. Living with Tuberculosis

    Science.gov (United States)

    ... Diseases > Lung Disease Lookup > Tuberculosis (TB) Living With Tuberculosis What to Expect You will need regular checkups ... XML file."); } }); } } --> Blank Section Header Lung Disease Lookup Tuberculosis (TB) Learn About Tuberculosis Tuberculosis Symptoms, Causes & Risk ...

  11. Patient reported delays in seeking treatment for Tuberculosis (TB among adult and pediatric TB patients and TB patients co-infected with HIV in Lima, Peru: a qualitative study

    Directory of Open Access Journals (Sweden)

    Valerie A Paz-Soldan

    2014-12-01

    Full Text Available Abstract: Tuberculosis (TB remains a significant public health challenge worldwide, and particularly in Peru with one of the highest incidence rates in Latin America. TB patient behavior has a direct influence on whether a patient will receive timely diagnosis and successful treatment of their illness. Objectives: The objective was to understand the complex factors that can impact TB patient health seeking behavior. Methods: In-depth interviews were conducted with adult and parents of pediatric patients receiving TB treatment (n=43, within that group a sub-group was also co-infected with HIV (n=11. Results: Almost all of the study participants recognized delays in seeking either their child’s or their own diagnosis of their TB symptoms. The principal reasons for treatment-seeking delays were lack of knowledge and confusion of tuberculosis symptoms, fear and embarrassment of receiving a TB diagnosis, and a patient tendency to self-medicate prior to seeking formal medical attention.Conclusions: Health promotion activities that target patient delays have the potential to improve individual patient outcomes and mitigate the spread of TB at a community level.

  12. Lessons from Africa: developing a global human rights framework for tuberculosis control and prevention.

    Science.gov (United States)

    Slagle, Tracy; Ben Youssef, Mehdi; Calonge, Golda; Ben Amor, Yanis

    2014-12-03

    Tuberculosis is a highly contagious disease, and there has been a rise in recent years of drug-resistant cases no longer responding to standard treatment. In order to address this threat and contain possible transmission of drug-resistant cases, some countries have taken strong action, including the compulsory detention of non-adherent drug-resistant patients. These measures have been strongly criticized by human rights advocates, and they raise the question of how to legally protect both citizens and the community. Following discussions with National Tuberculosis Programs in Africa (the continent with the highest incidence rates of tuberculosis worldwide), we show that of all the countries surveyed, all but one (Swaziland) had either no specific policy addressing tuberculosis, or only general policies regarding public health applicable to tuberculosis. Six countries also reported having policies that address non-adherence to treatment with containment (isolation in health facilities or incarceration), but laws are not adequately enforced. If the international community wants to effectively respond to the threat of tuberculosis transmission, there is a need to go beyond national tuberculosis policies and to implement an international framework for tuberculosis control, inspired by the Framework Convention on Tobacco Control, a key model for future public health treaties that address global burdens of disease. The framework, for which we clarify the conditions and procedures in this piece, would define the rights and responsibilities of the different stakeholders involved: patients, doctors, pharmaceutical firms and public authorities. To facilitate the governance of the national obligations under the Convention, a coordinating body should be set up, under the leadership of the World Health Organization and the Stop TB Partnership. Successfully implementing policies for tuberculosis that simultaneously address patients' rights and communities' wellbeing will have

  13. Alto a la tuberculosis en mi generación: Un llamado a un mundo libre de tuberculosis. Podcast del Día Mundial de la Tuberculosis del 2013 (Stop TB in My Lifetime: A Call for a World Free of TB World TB Day 2013)

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    En este podcast el doctor Kenneth Castro, Director de la División de Eliminación de la Tuberculosis, habla sobre el Día Mundial de la Tuberculosis, así como del tema y eslogan de este año.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/13/2012.

  14. The high burden of tuberculosis (TB) and human immunodeficiency virus (HIV) in a large Zambian prison: a public health alert.

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M; Hatwiinda, Sisa; Maggard, Katie R; Phiri, Winifreda; Harris, Jennifer B; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E

    2013-01-01

    Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required.

  15. State of affairs of tuberculosis in prison facilities: a systematic review of screening practices and recommendations for best TB control.

    Directory of Open Access Journals (Sweden)

    Natalie V S Vinkeles Melchers

    Full Text Available BACKGROUND: Prisoners are at high risk of developing tuberculosis (TB, causing morbidity and mortality. Prison facilities encounter many challenges in TB screening procedures and TB control. This review explores screening practices for detection of TB and describes limitations of TB control in prison facilities worldwide. METHODS: A systematic search of online databases (e.g., PubMed and Embase and conference abstracts was carried out. Research papers describing screening and diagnostic practices among prisoners were included. A total of 52 articles met the inclusion criteria. A meta-analysis of TB prevalence in prison facilities by screening and diagnostic tools was performed. RESULTS: The most common screening tool was symptom questionnaires (63·5%, mostly reporting presence of cough. Microscopy of sputum with Ziehl-Neelsen staining and solid culture were the most frequently combined diagnostic methods (21·2%. Chest X-ray and tuberculin skin tests were used by 73·1% and 50%, respectively, as either a screening and/or diagnostic tool. Median TB prevalence among prisoners of all included studies was 1,913 cases of TB per 100,000 prisoners (interquartile range [IQR]: 332-3,517. The overall annual median TB incidence was 7·0 cases per 1000 person-years (IQR: 2·7-30·0. Major limitations for successful TB control were inaccuracy of diagnostic algorithms and the lack of adequate laboratory facilities reported by 61·5% of studies. The most frequent recommendation for improving TB control and case detection was to increase screening frequency (73·1%. DISCUSSION: TB screening algorithms differ by income area and should be adapted to local contexts. In order to control TB, prison facilities must improve laboratory capacity and frequent use of effective screening and diagnostic tools. Sustainable political will and funding are critical to achieve this.

  16. The High Burden of Tuberculosis (TB) and Human Immunodeficiency Virus (HIV) in a Large Zambian Prison: A Public Health Alert

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M.; Hatwiinda, Sisa; Maggard, Katie R.; Phiri, Winifreda; Harris, Jennifer B.; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E.

    2013-01-01

    Background Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Methods Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. Results A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Conclusion Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required. PMID

  17. Comparison of TST and IGRA in Diagnosis of Latent Tuberculosis Infection in a High TB-Burden Setting.

    Science.gov (United States)

    Sharma, Surendra K; Vashishtha, Richa; Chauhan, L S; Sreenivas, V; Seth, Divya

    2017-01-01

    There are currently two tests for diagnosing latent tuberculosis infection (LTBI); TST and IGRA. However, it is still unclear that which one of these tests performs better in high TB-burden settings. 1511 household contacts of pulmonary TB patients were enrolled to compare the performance of TST and IGRA for LTBI. At baseline all participant underwent testing for IGRA [QuantiFERON-TB® Gold In-tube (QFT-GIT) assay] and TST [2 tuberculin unit (TU), purified protein derivative (PPD), RT23, Staten Serum Institute (SSI), Copenhagen, Denmark]. All the household contacts were followed-up for two years for incident TB cases. Active TB was diagnosed in 76 household contacts at an incidence rate of 2.14 per 1000 person-years. Both, TST [Hazard Ratio (HR): 1.14, 95% confidence interval (CI): 0.72-1.79, p = 0.57], as well as QFT-GIT assay (HR: 1.66, 95% CI: 0.97-2.84, p = 0.06) results at baseline were not significantly associated with subsequent development of active TB among household contacts of pulmonary TB patients. Neither TST nor IGRA predicted subsequent development of active TB among household contacts of pulmonary TB patients during follow-up. However, keeping in view the cost, and other logistics, TST remains the most preferred method for LTBI diagnosis in resource-limited, high TB-burden settings.

  18. Limitations of the QuantiFERON-TB Gold test in detecting Mycobacterium tuberculosis infection in immunocompromised patients

    DEFF Research Database (Denmark)

    Hornum, M.; Mortensen, K.L.; Kamper, Anne-Lise

    2008-01-01

    Four cases are presented, immunosuppressed by at least three different mechanisms: one HIV-positive patient with a CD4 count of 0.29 x 10(6)/ml, one malnourished patient, and two kidney-transplanted patients. All patients had a negative interferon (IFN)-gamma test for suspected tuberculosis (TB),...

  19. Limitations of the QuantiFERON-TB Gold test in detecting Mycobacterium tuberculosis infection in immunocompromised patients

    DEFF Research Database (Denmark)

    Hornum, Mads; Mortensen, Klaus Leth; Kamper, Anne-Lise

    2008-01-01

    Four cases are presented, immunosuppressed by at least three different mechanisms: one HIV-positive patient with a CD4 count of 0.29 x 10(6)/ml, one malnourished patient, and two kidney-transplanted patients. All patients had a negative interferon (IFN)-gamma test for suspected tuberculosis (TB...

  20. Global fund financing of tuberculosis services delivery in prisons.

    Science.gov (United States)

    Lee, Donna; Lal, S S; Komatsu, Ryuichi; Zumla, Alimuddin; Atun, Rifat

    2012-05-15

    Despite concerted efforts to scale up tuberculosis control with large amounts of international financing in the last 2 decades, tuberculosis continues to be a social issue affecting the world's most marginalized and disadvantaged communities. This includes prisoners, estimated at about 10 million globally, for whom tuberculosis is a leading cause of mortality and morbidity. The Global Fund to Fight AIDS, Tuberculosis and Malaria has emerged as the single largest international donor for tuberculosis control, including funding support in delivering tuberculosis treatment for the confined population. The Global Fund grants database, with an aggregate approved investment of $21.7 billion in 150 countries by the end of 2010, was reviewed to identify tuberculosis and human immunodeficiency virus/tuberculosis grants and activities that monitored the delivery of tuberculosis treatment and support activities in penitentiary settings. The distribution and trend of number of countries with tuberculosis prison support was mapped by year, geographic region, tuberculosis or multidrug-resistant tuberculosis burden, and prison population rate. We examined the types of grant recipients managing program delivery, their performance, and the nature and range of services provided. Fifty-three of the 105 countries (50%) with Global Fund-supported tuberculosis programs delivered services within prison settings. Thirty-two percent (73 of 228) of tuberculosis grants, representing $558 million of all disbursements of Global Fund tuberculosis support by the end of 2010, included output indicators related to tuberculosis services delivered in prisons. Nearly two-thirds (64%) of these grants were implemented by governments, with the remaining by civil society and other partners. In terms of services, half (36 of 73) of grants provided diagnosis and treatment and an additional 27% provided screening and monitoring of tuberculosis for prisoners. The range of services tracked was limited in scope

  1. Analysis of Factors Influencing Diagnostic Accuracy of T-SPOT.TB for Active Tuberculosis in Clinical Practice.

    Science.gov (United States)

    Zhang, Lifan; Shi, Xiaochun; Zhang, Yueqiu; Zhang, Yao; Huo, Feifei; Zhou, Baotong; Deng, Guohua; Liu, Xiaoqing

    2017-08-10

    T-SPOT.TB didn't perform a perfect diagnosis for active tuberculosis (ATB), and some factors may influence the results. We did this study to evaluate possible factors associated with the sensitivity and specificity of T-SPOT.TB, and the diagnostic parameters under varied conditions. Patients with suspected ATB were enrolled prospectively. Influencing factors of the sensitivity and specificity of T-SPOT.TB were evaluated using logistic regression models. Sensitivity, specificity, predictive values (PV), and likelihood ratios (LR) were calculated with consideration of relevant factors. Of the 865 participants, 205 (23.7%) had ATB, including 58 (28.3%) microbiologically confirmed TB and 147 (71.7%) clinically diagnosed TB. 615 (71.7%) were non-TB. 45 (5.2%) cases were clinically indeterminate and excluded from the final analysis. In multivariate analysis, serous effusion was the only independent risk factor related to lower sensitivity (OR = 0.39, 95% CI: 0.18-0.81) among patients with ATB. Among non-TB patients, age, TB history, immunosuppressive agents/glucocorticoid treatment and lymphocyte count were the independent risk factors related to specificity of T-SPOT.TB. Sensitivity, specificity, PV+, PV-, LR+ and LR- of T-SPOT.TB for diagnosis of ATB were 78.5%, 74.1%, 50.3%, 91.2%, 3.0 and 0.3, respectively. This study suggests that influencing factors of sensitivity and specificity of T-SPOT.TB should be considered for interpretation of T-SPOT.TB results.

  2. The Global Burden of Latent Tuberculosis Infection: A Re-estimation Using Mathematical Modelling.

    Directory of Open Access Journals (Sweden)

    Rein M G J Houben

    2016-10-01

    data, and limited evidence to inform on potential clearance of LTBI.We estimate that approximately 1.7 billion individuals were latently infected with Mycobacterium tuberculosis (M.tb globally in 2014, just under a quarter of the global population. Investment in new tools to improve diagnosis and treatment of those with LTBI at risk of progressing to disease is urgently needed to address this latent reservoir if the 2050 target of eliminating TB is to be reached.

  3. Analysis of host responses to Mycobacterium tuberculosis antigens in a multi-site study of subjects with different TB and HIV infection states in sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Jayne S Sutherland

    Full Text Available Tuberculosis (TB remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb, which are relevant to protective immunity in high-endemic areas.We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda. We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens together with novel resuscitation-promoting factors (rpf, reactivation proteins, latency (Mtb DosR regulon-encoded antigens, starvation-induced antigens and secreted antigens.There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST(- and TST(+ contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737 and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC, PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST(+ contacts (LTBI compared to TB and TST(- contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen.Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may be useful for vaccine

  4. Comparison of PPD test in household contacts of smear-positive and -negative tuberculosis (TB

    Directory of Open Access Journals (Sweden)

    Zohreh Azarkar

    2015-01-01

    Conclusions: The most important way to prevent TB is omission of the disease transmission sources (TB patients by anti-TB treatment. Extensive studies are needed to ensure that contacts of patients with pulmonary TB are identified and appropriately screened.

  5. Use of anti-retroviral therapy in tuberculosis patients on second-line anti-TB regimens: a systematic review.

    Directory of Open Access Journals (Sweden)

    Matthew Arentz

    Full Text Available Use of antiretroviral therapy (ART during treatment of drug susceptible tuberculosis (TB improves survival. However, data from HIV infected individuals with drug resistant TB are lacking. Second line TB drugs when combined with ART may increase drug interactions and lead to higher rates of toxicity and greater noncompliance. This systematic review sought to determine the benefit of ART in the setting of second line drug therapy for drug resistant TB.We included individual patient data from studies that evaluated treatment of drug-resistant tuberculosis in HIV-1 infected individuals published between January 1980 and December of 2009. We evaluated the effect of ART on treatment outcomes, time to smear and culture conversion, and adverse events.Ten observational studies, including data from 217 subjects, were analyzed. Patients using ART during TB treatment had increased likelihood of cure (hazard ratio (HR 3.4, 95% CI 1.6-7.4 and decreased likelihood of death (HR 0.4, 95% CI 0.3-0.6 during treatment for drug resistant TB. These associations remained significant in patients with a CD4 less than 200 cells/mm(3 and less than 50 cells/mm(3, and when correcting for drug resistance pattern.We identified only observational studies from which individual patient data could be drawn. Limitations in study design, and heterogeneity in a number of the outcomes of interest had the potential to introduce bias.While there are insufficient data to determine if ART use increases adverse drug interactions when used with second line TB drugs, ART use during treatment of drug resistant TB appears to improve cure rates and decrease risk of death. All individuals with HIV appear to benefit from ART use during treatment for TB.

  6. "The Impact of Mycobacterium tuberculosis Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" - Meeting report.

    Science.gov (United States)

    Boggiano, Cesar; Eichelberg, Katrin; Ramachandra, Lakshmi; Shea, Jaqueline; Ramakrishnan, Lalita; Behar, Samuel; Ernst, Joel D; Porcelli, Steven A; Maeurer, Markus; Kornfeld, Hardy

    2017-06-14

    Tuberculosis (TB) is the major cause of death from infectious diseases around the world, particularly in HIV infected individuals. TB vaccine design and development have been focused on improving Bacille Calmette-Guérin (BCG) and evaluating recombinant and viral vector expressed Mycobacterium tuberculosis (Mtb) proteins, for boosting BCG-primed immunity, but these approaches have not yet yielded significant improvements over the modest effects of BCG in protecting against infection or disease. On March 7-8, 2016, the National Institute of Allergy and Infectious Diseases (NIAID) convened a workshop on "The Impact of Mtb Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" with the goal of defining immune mechanisms that could be targeted through novel research approaches, to inform vaccine design and immune therapeutic interventions for prevention of TB. The workshop addressed early infection events, the impact of Mtb evolution on the development and maintenance of an adaptive immune response, and the factors that influence protection against and progression to active disease. Scientific gaps and areas of study to revitalize and accelerate TB vaccine design were discussed and prioritized. These included a comprehensive evaluation of innate and Mtb-specific adaptive immune responses in the lung at different stages of disease; determining the role of B cells and antibodies (Abs) during Mtb infection; development of better assays to measure Mtb burden following exposure, infection, during latency and after treatment, and approaches to improving current animal models to study Mtb immunogenicity, TB disease and transmission. Copyright © 2017.

  7. Comparison of fastsure tb dna and mgit 960 for the detection of mycobacterium tuberculosis complex in clinical specimens

    International Nuclear Information System (INIS)

    Hussain, A.; Mirza, I.A.; Abbasi, S.A.; Ali, S.; Zia, F.; Ahmed, Z.

    2013-01-01

    Objective: To compare the efficacy of Fastsure TB DNA with fully automated MGIT 960 method for detection of Mycobacterium tuberculosis complex (MTB) in clinical specimens. Study Design: Comparative cross sectional study. Methodology: After decontamination procedure, the clinical specimens were subjected to DNA extraction and amplification. Extracted DNA was separated in a separate tube provided with fastsure TB DNA kit and was then inserted into the cartridge provided and results were observed within 30 minutes. For Processing in MGIT 960, OADC and PANTA were added to the clinical specimens after decontamination and then the tubes were processed in MGIT 960. Results: A total of 80 specimens were tested by both MGIT 960 and fastsure TB DNA. On MGIT 960 system, 57 specimens showed growth of MTB while 23 were negative. On Fastsure TB DNA, 47 Specimens were tested as positive and 33 specimens showed negative result. Sensitivity and specificity of Fastsure TB DNA method was calculated to be 82.45 % and 100 % respectively, while positive and negative predictive values were 100 % and 69.69 % respectively. Conclusion: Fast sure TB DNA is a rapid and accurate method for the detection of Mycobacterium tuberculosis complex (MTB) from clinical specimens. (author)

  8. Abandono do tratamento de tuberculose em co-infectados TB/HIV Abandono del tratamiento de la tuberculosis en coinfectados TB/HIV Abandonment of tuberculosis treatment among patinets co-infected with TB/HIV

    Directory of Open Access Journals (Sweden)

    Ivaneide Leal Ataide Rodrigues

    2010-06-01

    ísica, organización del proceso de trabajo y acceso mostraron relevancia para la no adhesión. Los resultados apuntan a la necesidad de alterar las prácticas desarrolladas en los Servicios.This study aimed at analyzing the reasons that patients co-infected with tuberculosis and HIV leave the treatment of tuberculosis and to know the conduct of the health team toward that abandonment. The study, using a qualitative approach, performed semi-structured interviews on 45 professionals working at a referral health center in Pará state. Two units emerged based on the thematic analysis: patient-associated factors that make TB treatment adherence difficult; and service-associated factors that contribute to treatment abandonment. It was found that, in terms of the patients, that their low socioeconomic condition was the most common factor that led to abandonment. Other factors that led to this outcome included the adverse drug effects, the use of illegal drugs, and poor personal motivation. Regarding the service, issues related to the physical structure, working process organization and accessibility were also relevant to their non-adherence. Results show there is a need to change the practices performed at the health care services.

  9. Tuberculosis Treatment and Pregnancy

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Tuberculosis (TB) Note: Javascript is disabled or is not ... message, please visit this page: About CDC.gov . Tuberculosis Basic TB Facts How TB Spreads Latent TB ...

  10. Liver toxicity associated with tuberculosis chemotherapy in the REMoxTB study.

    Science.gov (United States)

    Tweed, Conor Duncan; Wills, Genevieve Helen; Crook, Angela M; Dawson, Rodney; Diacon, Andreas H; Louw, Cheryl E; McHugh, Timothy D; Mendel, Carl; Meredith, Sarah; Mohapi, Lerato; Murphy, Michael E; Murray, Stephen; Murthy, Sara; Nunn, Andrew J; Phillips, Patrick P J; Singh, Kasha; Spigelman, M; Gillespie, S H

    2018-03-28

    Drug-induced liver injury (DILI) is a common complication of tuberculosis treatment. We utilised data from the REMoxTB clinical trial to describe the incidence of predisposing factors and the natural history in patients with liver enzyme levels elevated in response to tuberculosis treatment. Patients received either standard tuberculosis treatment (2EHRZ/4HR), or a 4-month regimen in which moxifloxacin replaced either ethambutol (isoniazid arm, 2MHRZ/2MHR) or isoniazid (ethambutol arm, 2EMRZ/2MR). Hepatic enzymes were measured at 0, 2, 4, 8, 12 and 17 weeks and as clinically indicated during reported adverse events. Patients included were those receiving at least one dose of drug and with two or more hepatic enzyme measurements. A total of 1928 patients were included (639 2EHRZ/4HR, 654 2MHRZ/2MHR and 635 2EMRZ/2MR). DILI was defined as peak alanine aminotransferase (ALT) ≥ 5 times the upper limit of normal (5 × ULN) or ALT ≥ 3 × ULN with total bilirubin > 2 × ULN. DILI was identified in 58 of the 1928 (3.0%) patients at a median time of 28 days (interquartile range IQR 14-56). Of 639 (6.4%) patients taking standard tuberculosis therapy, 41 experienced clinically significant enzyme elevations (peak ALT ≥ 3 × ULN). On standard therapy, 21.1% of patients aged >55 years developed a peak ALT/aspartate aminotransferase (AST) ≥ 3 × ULN (p = 0.01) and 15% of HIV-positive patients experienced a peak ALT/AST ≥ 3 × ULN compared to 9% of HIV-negative patients (p = 0.160). The median peak ALT/AST was higher in isoniazid-containing regimens vs no-isoniazid regimens (p tuberculosis patients on standard treatment. Older patients on standard therapy, HIV-positive patients, Asian patients and those receiving isoniazid were at higher risk of elevated enzyme levels. Monitoring hepatic enzymes during the first 2 months of standard therapy detected approximately 75% of patients with a peak enzyme elevation ≥3 × ULN, suggesting this should be a standard of care. These

  11. Pathway to care for drug resistant tuberculosis cases identified during a retrospective study conducted in high TB burden wards in Mumbai.

    Science.gov (United States)

    Lobo, Eunice; Shah, Shimoni; Rangan, Sheela; Dholakia, Yatin; Mistry, Nerges

    2018-05-10

    Background: Mumbai is witnessing a rising incidence of all forms of drug resistant tuberculosis (DR-TB). Methods: A population-based, retrospective study was conducted between April and July 2014, in 15 high TB burden wards in Mumbai, to capture the patient pathways to TB care. A total of 23 DR-TB patients were identified and their pathways to access DR-TB care were recorded using semi-structured interviews. Results: The total DR-TB pathway time of new patients (who did not report any past episode of TB) (180 days; IQR 123,346) was found to be more than twice that of retreatment patients (who reported a past episode of TB) (69 days; IQR 42,128). Conclusions: The unacceptable delay for diagnosis and treatment of DR-TB in Mumbai advocates for consistent implementation of early screening of patients using rapid gene-based technologies.

  12. [Evaluation of T-SPOT.TB assay in the diagnosis of pulmonary tuberculosis within different age groups].

    Science.gov (United States)

    Pan, Liping; Jia, Hongyan; Liu, Fei; Gao, Mengqiu; Sun, Huishan; Du, Boping; Sun, Qi; Xing, Aiying; Wei, Rongrong; Zhang, Zongde

    2015-12-01

    To evaluate the value of T-SPOT.TB assay in the diagnosis of pulmonary tuberculosis within different age groups. We analyzed 1 518 suspected pulmonary tuberculosis (PTB) patients who were admitted to the Beijing Chest Hospital from November 2012 to February 2014 and had valid T-SPOT.TB tests before anti-tuberculosis therapy. The 599 microbiologically and/or histopathologically-confirmed PTB patients (16-89 years old, 388 males and 211 females) and 235 non-TB patients (14-85 years old, 144 males and 91 females) were enrolled for the analysis of diagnostic performance of T-SPOT.TB, while patients with uncertain diagnosis or diagnosis based on clinical impression (n=684) were excluded from the analysis. The sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood ratio, and negative likelihood ratio of the T-SPOT.TB were analyzed according to the final diagnosis. Furthermore, the diagnostic performance of T-SPOT.TB assay in the younger patients (14-59 years old) and elderly patients (60-89 years old) were also analyzed respectively. Categorical variables were compared by Pearson's Chi-square test, while continuous variables were compared by the Mann-Whitney U-test. The sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood ratio, and negative likelihood ratio of the T-SPOT.TB in diagnosis of PTB were 90.1% (540/599), 65.5% (154/235), 86.9% (540/621), 72.3% (154/213), 2.61, and 0.15, respectively. The sensitivity and specificity of T-SPOT.TB assay were 92.6% (375/405) and 75.6% (99/131), respectively in the younger patients, and 85.0% (165/194), 52.9% (55/104) respectively in the elderly patients. The sensitivity and specificity of T-SPOT.TB assay in the younger patients were significantly higher than those in the elderly patients (Pspot forming cells in the younger PTB patients were significantly higher than in the elderly PTB patients [300 (126, 666)/10(6) PBMCs vs. 258 (79, 621

  13. Learn About Tuberculosis

    Science.gov (United States)

    ... Diseases > Lung Disease Lookup > Tuberculosis (TB) Learn About Tuberculosis Tuberculosis (TB) is an airborne bacterial infection caused by the organism Mycobacterium tuberculosis that primarily affects the lungs, although other organs ...

  14. Prevalence of post-traumatic stress symptoms and associated factors in tuberculosis (TB), TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa.

    Science.gov (United States)

    Peltzer, Karl; Naidoo, Pamela; Matseke, Gladys; Louw, Julia; McHunu, Gugu; Tutshana, Bomkazi

    2013-01-01

    High rates of tuberculosis (TB) and TB/HIV co-infection is often linked with mental health issues such as post-traumatic stress disorder (PTSD) symptoms, which is further associated with poor health outcomes. In a country such as South Africa where rates of these infectious diseases are high, it is concerning that there is limited/no data on prevalence rates of mental disorders such as PTSD and its associated factors. Therefore, the aim of this study was to establish the prevalence of PTSD symptoms and associated factors in TB, TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa. Brief screening self-report tools were used to measure: PTSD symptoms, psychological distress (anxiety and depression) and alcohol misuse. Other relevant measures, such as adherence to medication, stressful life events and sexual risk-taking behaviours, were obtained through structured questions. A total of 4900 public primary care adult patients from clinics in high TB burden districts from three provinces in South Africa participated. All the patients screened positive for TB (either new or retreatment cases). The prevalence of PTSD symptoms was 29.6%. Patients who screened positive for PTSD symptoms and psychological distress were more likely to be on antidepressant medication. Factors that predicted PTSD symptoms were poverty, residing in an urban area, psychological distress, suicide attempt, alcohol and/or drug use before sex, unprotected sex, TB-HIV co-infected and the number of other chronic conditions. Health-care systems should be strengthened to improve delivery of mental health care, by focusing on existing programmes and activities, such as those which address the prevention and treatment of TB and HIV.

  15. Emergence of Extensively Drug Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.

  16. Comparison of sensitivity of quantiferon-tb gold test and tuberculin skin test in active pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Khalil, K.F.; Ambreen, A.; Butt, T.

    2013-01-01

    Objective: To compare the sensitivity of tuberculin skin test (TST) and quantiFERON-TB gold test (QFT-G) in active pulmonary tuberculosis. Study Design: Analytical study. Place and Duration of Study: Department of Pulmonology, Fauji Foundation Hospital, Rawalpindi, from July 2011 to January 2012. Methodology: QuantiFERON-TB gold test (QFT-G) was evaluated and compared it with tuberculin skin test (TST) in 50 cases of active pulmonary tuberculosis, in whom tuberculous infection was suspected on clinical, radiological and microbiological grounds. Sensitivity was determined against positive growth for Mycobacterium tuberculosis. Results: Out of 50 cases, 43 were females and 7 were males. The mean age was 41.84 A+- 19.03 years. Sensitivity of QFT-G was 80% while that of TST was 28%. Conclusion: QFT-G has much higher sensitivity than TST for active pulmonary tuberculosis. It is unaffected by prior BCG administration and prior exposure to atypical mycobacteria. A positive QFT-G result can be an adjunct to diagnosis in patients having clinical and radiological data compatible with pulmonary tuberculosis. (author)

  17. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  18. Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

    OpenAIRE

    Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

    2018-01-01

    Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

  19. Infection control, genetic assessment of drug resistance and drug susceptibility testing in the current management of multidrug/extensively-resistant tuberculosis (M/XDR-TB) in Europe

    DEFF Research Database (Denmark)

    Bothamley, Graham H.; Lange, Christoph; Albrecht, Dirk

    2017-01-01

    AIM: Europe has the highest documented caseload and greatest increase in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB) of all World Health Organization (WHO) regions. This survey examines how recommendations for M/XDR-TB management are being implemented. METHODS: TBNET is a pan...

  20. Diagnostic accuracy of the rapid urine lipoarabinomannan test for pulmonary tuberculosis among HIV-infected adults in Ghana-findings from the DETECT HIV-TB study

    DEFF Research Database (Denmark)

    Bjerrum, Stephanie; Kenu, Ernest; Lartey, Margaret

    2015-01-01

    BACKGROUND: Rapid diagnostic tests are urgently needed to mitigate HIV-associated tuberculosis (TB) mortality. We evaluated diagnostic accuracy of the rapid urine lipoarabinomannan (LAM) test for pulmonary TB and assessed the effect of a two-sample strategy. METHODS: HIV-infected adults eligible...

  1. Evaluation of the Sensititre MycoTB plate for susceptibility testing of the Mycobacterium tuberculosis complex against first- and second-line agents.

    Science.gov (United States)

    Hall, Leslie; Jude, Kurt P; Clark, Shirley L; Dionne, Kim; Merson, Ryan; Boyer, Ana; Parrish, Nicole M; Wengenack, Nancy L

    2012-11-01

    The Sensititre MycoTB plate (TREK Diagnostic Systems, Cleveland, OH) uses a microtiter plate MIC format for susceptibility testing of Mycobacterium tuberculosis complex isolates against first- and second-line antituberculosis agents. Categorical agreement versus the agar proportion method for 122 M. tuberculosis complex isolates was 94% to 100%.

  2. Diagnosis of Latent Tuberculosis in Patients with Systemic Lupus Erythematosus: T.SPOT.TB versus Tuberculin Skin Test

    Directory of Open Access Journals (Sweden)

    Maria Del Mar Arenas Miras

    2014-01-01

    Full Text Available Early studies in patients with systemic lupus erythematosus (SLE reported increased incidence of tuberculosis. The tuberculin skin test (TST is the technique of choice to detect latent tuberculosis infection (LTBI but has several limitations. Objectives. We compared TST and the newer T.SPOT.TB test to diagnose LTBI in SLE patients. Methods. In this observational cohort study conducted between August 2009 and February 2012, we recruited 92 patients from those attending the SLE clinic of our university hospital. Data recorded were epidemiological and sociodemographic characteristics. Laboratory analyses included TST and T.SPOT.TB tests. Results. Of the patients studied, 92% were women with an average age of 42.7 years. Overall, the degree of correlation between the two tests was low (Kappa index = 0.324 but was better in patients not receiving corticosteroids (CTC/immunosuppressive (IS therapy (Kappa = 0.436 and in those receiving hydroxychloroquine (Kappa = 0.473. While TST results were adversely affected by those receiving CTC and/or IS drugs (P=0.021, the T.SPOT.TB results were not. Conclusion. Although the TST test remains a useful tool for diagnosing LTBI in SLE patients, the T.SPOT.TB test is perhaps better employed when the patient is receiving CTC and/or IS drugs.

  3. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients

    Directory of Open Access Journals (Sweden)

    Daniel Eklund

    2013-01-01

    Full Text Available The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB, the bacterium responsible for tuberculosis (TB, has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth.

  4. Back to the future: Rethinking global control of tuberculosis.

    Science.gov (United States)

    Bloom, Barry R; Atun, Rifat

    2016-03-09

    If the ultimate goal of controlling an infectious disease is to interrupt transmission, the current global tuberculosis strategy is not succeeding. Copyright © 2016, American Association for the Advancement of Science.

  5. Sensitivity and specificity of QuantiFERON-TB Gold Plus compared with QuantiFERON-TB Gold In-Tube and T-SPOT.TB on active tuberculosis in Japan.

    Science.gov (United States)

    Takasaki, Jin; Manabe, Toshie; Morino, Eriko; Muto, Yoshikazu; Hashimoto, Masao; Iikura, Motoyasu; Izumi, Shinyu; Sugiyama, Haruhito; Kudo, Koichiro

    2018-03-01

    The QuantiFERON-TB Gold Plus (QFT-Plus) was introduced in 2015 as a new generation of interferon-gamma release assays (IGRAs) designed to detect Mycobacterium tuberculosis infection (TB). Examination of its diagnostic accuracy is crucial before it is launched in Japan. We examined 99 patients with laboratory-confirmed active TB (patients) and 117 healthy volunteers with no risk of TB infection (controls) at a medical center in Tokyo, Japan. Blood samples were collected from both the patients and controls and tested using three types of IGRAs: the QFT-Plus, the QuantiFERON-TB Gold In-Tube (QFT-GIT), and the T-SPOT.TB (T-SPOT). The sensitivity and specificity of each IGRA were examined and compared. The sensitivity of the QFT-Plus was 98.9% (95% confidence interval [CI], 0.934-0.998) and similar to that of the QFT-GIT (97.9%; 95% CI, 0.929-0.998) and T-SPOT (96.9%; 95% CI, 0.914-0.994). The specificity of the QFT-Plus was the same as that of the QFT-GIT and T-SPOT (98.1%; 95% CI, 0.934-0.998). One patient with uncontrolled diabetes mellitus showed negative results on all three IGRAs. The QFT-Plus showed a high degree of agreement with the QFT-GIT and T-SPOT, with high sensitivity and specificity. Severe diabetes mellitus may influence the results of IGRAs. Larger studies are needed to validate the accuracy of the GFT-Plus and determine whether it can contribute as adjunctive method for the early diagnosis of active TB in Japan. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  6. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras.

    Science.gov (United States)

    Alvarez-Corrales, Nancy; Ahmed, Raija K; Rodriguez, Carol A; Balaji, Kithiganahalli N; Rivera, Rebeca; Sompallae, Ramakrishna; Vudattu, Nalini K; Hoffner, Sven E; Zumla, Alimuddin; Pineda-Garcia, Lelany; Maeurer, Markus

    2013-03-06

    A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras.

  7. Association between diabetes mellitus and multi-drug-resistant tuberculosis : a protocol for a systematic review and meta-analysis

    NARCIS (Netherlands)

    Tegegne, Balewgizie Sileshi; Habtewold, Tesfa Dejenie; Mengesha, Melkamu Merid; Burgerhof, Johannes G M

    2017-01-01

    INTRODUCTION: Multi-drug-resistant tuberculosis (MDR-TB) has emerged as a challenge to global tuberculosis (TB) control and remains a major public health concern in many countries. Diabetes mellitus (DM) is an increasingly recognized comorbidity that can both accelerate TB disease and complicate its

  8. Usefulness of the mycobacterium tuberculosis direct assay in early diagnosis of extrapulmonary TB

    Directory of Open Access Journals (Sweden)

    Zhang Hui-Zhang

    2014-01-01

    Full Text Available The aim of this study was to evaluate the in situ detection of living mycobacterium TB rRNA by the mycobacterium TB direct assay (MTD and its clinical significance in the early diagnosis of extrapulmonary TB. Eighty-six patients were recruited from the Shanghai Public Health Clinical Center from June to November in 2010, having been diagnosed with extrapulmonary TB, including tuberculous peritonitis (n=22, lymphatic TB (n=21, tuberculous meningitis (n=15, HIV-associated TB (n=13, nephroTB (n=9, spinal TB (n=2, cutaneous TB (n=13, parotid TB (n=1, chest wall TB (n=1, intestinal TB (n=1. One hundred and five extrapulmonary specimens, including CSF, puncture fluid, drainage, pleural fluid, urine, secretion, ascites, lymphatic tissue and marrow were collected from the patients. The samples were examined using acid-fast stain, solid culture, liquid culture and MTD in parallel. In MTD, the target segments of MTB rRNA in either cultures or clinical specimens were amplified prior to being qualitatively detected with the hybridization protection assay (HPA. The sensitivities of MTD and acid-fast staining in liquid and solid cultures were 48.6%, 41.9%, 20.0% and 14.3%, respectively. MTD sensitivity was higher than that of the others and its specificity was 100%. We concluded that MTD rRNA detection is an effective, rapid, convenient, sensitive and reliable method for the early diagnosis of extrapulmonary TB.

  9. The socioeconomic impact of multidrug resistant tuberculosis on patients: results from Ethiopia, Indonesia and Kazakhstan

    NARCIS (Netherlands)

    van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine

    2016-01-01

    One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,

  10. Genomics of Human Pulmonary Tuberculosis: from Genes to Pathways

    DEFF Research Database (Denmark)

    Stein, Catherine M.; Sausville, Lindsay; Wejse, Christian

    2017-01-01

    Purpose of Review Tuberculosis (TB), caused by Mycobacterium tuberculosis (MTB), remains a major public health threat globally. Several lines of evidence support a role for host genetic factors in resistance/susceptibility to TB disease and MTB infection. However, results across candidate gene...

  11. The impact of social protection and poverty elimination on global tuberculosis incidence: a statistical modelling analysis of Sustainable Development Goal 1

    Directory of Open Access Journals (Sweden)

    Daniel J Carter, MSc

    2018-05-01

    Full Text Available Summary: Background: The End TB Strategy and the Sustainable Development Goals (SDGs are intimately linked by their common targets and approaches. SDG 1 aims to end extreme poverty and expand social protection coverage by 2030. Achievement of SDG 1 is likely to affect the tuberculosis epidemic through a range of pathways. We estimate the reduction in global tuberculosis incidence that could be obtained by reaching SDG 1. Methods: We developed a conceptual framework linking key indicators of SDG 1 progress to tuberculosis incidence via well described risk factor pathways and populated it with data from the SDG data repository and the WHO tuberculosis database for 192 countries. Correlations and mediation analyses informed the strength of the association between the SDG 1 subtargets and tuberculosis incidence, resulting in a simplified framework for modelling. The simplified framework linked key indicators for SDG 1 directly to tuberculosis incidence. We applied an exponential decay model based on linear associations between SDG 1 indicators and tuberculosis incidence to estimate tuberculosis incidence in 2035. Findings: Ending extreme poverty resulted in a reduction in global incidence of tuberculosis of 33·4% (95% credible interval 15·5–44·5 by 2035 and expanding social protection coverage resulted in a reduction in incidence of 76·1% (45·2–89·9 by 2035; both pathways together resulted in a reduction in incidence of 84·3% (54·7–94·9. Interpretation: Full achievement of SDG 1 could have a substantial effect on the global burden of tuberculosis. Cross-sectoral approaches that promote poverty reduction and social protection expansion will be crucial complements to health interventions, accelerating progress towards the End TB targets. Funding: World Health Organization.

  12. The impact of social protection and poverty elimination on global tuberculosis incidence: a statistical modelling analysis of Sustainable Development Goal 1.

    Science.gov (United States)

    Carter, Daniel J; Glaziou, Philippe; Lönnroth, Knut; Siroka, Andrew; Floyd, Katherine; Weil, Diana; Raviglione, Mario; Houben, Rein M G J; Boccia, Delia

    2018-05-01

    The End TB Strategy and the Sustainable Development Goals (SDGs) are intimately linked by their common targets and approaches. SDG 1 aims to end extreme poverty and expand social protection coverage by 2030. Achievement of SDG 1 is likely to affect the tuberculosis epidemic through a range of pathways. We estimate the reduction in global tuberculosis incidence that could be obtained by reaching SDG 1. We developed a conceptual framework linking key indicators of SDG 1 progress to tuberculosis incidence via well described risk factor pathways and populated it with data from the SDG data repository and the WHO tuberculosis database for 192 countries. Correlations and mediation analyses informed the strength of the association between the SDG 1 subtargets and tuberculosis incidence, resulting in a simplified framework for modelling. The simplified framework linked key indicators for SDG 1 directly to tuberculosis incidence. We applied an exponential decay model based on linear associations between SDG 1 indicators and tuberculosis incidence to estimate tuberculosis incidence in 2035. Ending extreme poverty resulted in a reduction in global incidence of tuberculosis of 33·4% (95% credible interval 15·5-44·5) by 2035 and expanding social protection coverage resulted in a reduction in incidence of 76·1% (45·2-89·9) by 2035; both pathways together resulted in a reduction in incidence of 84·3% (54·7-94·9). Full achievement of SDG 1 could have a substantial effect on the global burden of tuberculosis. Cross-sectoral approaches that promote poverty reduction and social protection expansion will be crucial complements to health interventions, accelerating progress towards the End TB targets. World Health Organization. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.

  13. Tuberculosis and Diabetes

    Science.gov (United States)

    TUBERCULOSIS www.who.int/tb & DIABETES THE DUAL EPIDEMIC OF TB AND DIABETES DEADLY LINKAGES  People with ... higher risk of progressing from latent to active tuberculosis.  Diabetes triples a person’s risk of developing TB. ...

  14. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  15. Sputum is a surrogate for bronchoalveolar lavage for monitoring Mycobacterium tuberculosis transcriptional profiles in TB patients.

    Science.gov (United States)

    Garcia, Benjamin J; Loxton, Andre G; Dolganov, Gregory M; Van, Tran T; Davis, J Lucian; de Jong, Bouke C; Voskuil, Martin I; Leach, Sonia M; Schoolnik, Gary K; Walzl, Gerhard; Strong, Michael; Walter, Nicholas D

    2016-09-01

    Pathogen-targeted transcriptional profiling in human sputum may elucidate the physiologic state of Mycobacterium tuberculosis (M. tuberculosis) during infection and treatment. However, whether M. tuberculosis transcription in sputum recapitulates transcription in the lung is uncertain. We therefore compared M. tuberculosis transcription in human sputum and bronchoalveolar lavage (BAL) samples from 11 HIV-negative South African patients with pulmonary tuberculosis. We additionally compared these clinical samples with in vitro log phase aerobic growth and hypoxic non-replicating persistence (NRP-2). Of 2179 M. tuberculosis transcripts assayed in sputum and BAL via multiplex RT-PCR, 194 (8.9%) had a p-value <0.05, but none were significant after correction for multiple testing. Categorical enrichment analysis indicated that expression of the hypoxia-responsive DosR regulon was higher in BAL than in sputum. M. tuberculosis transcription in BAL and sputum was distinct from both aerobic growth and NRP-2, with a range of 396-1020 transcripts significantly differentially expressed after multiple testing correction. Collectively, our results indicate that M. tuberculosis transcription in sputum approximates M. tuberculosis transcription in the lung. Minor differences between M. tuberculosis transcription in BAL and sputum suggested lower oxygen concentrations or higher nitric oxide concentrations in BAL. M. tuberculosis-targeted transcriptional profiling of sputa may be a powerful tool for understanding M. tuberculosis pathogenesis and monitoring treatment responses in vivo. Published by Elsevier Ltd.

  16. Implementing the global plan to stop TB, 2011-2015 - optimizing allocations and the global fund's contribution: A scenario projections study

    NARCIS (Netherlands)

    E.L. Korenromp (Eline); P. Glaziou (Philippe); C. Fitzpatrick (Christopher); K. Floyd (Katherine); M. Hosseini (Mehran); M.C. Raviglione (Mario); R. Atun (Rifat); B. Williams (Brian)

    2012-01-01

    textabstractBackground: The Global Plan to Stop TB estimates funding required in low- and middle-income countries to achieve TB control targets set by the Stop TB Partnership within the context of the Millennium Development Goals. We estimate the contribution and impact of Global Fund investments

  17. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients.

    Science.gov (United States)

    Eklund, Daniel; Persson, Hans Lennart; Larsson, Marie; Welin, Amanda; Idh, Jonna; Paues, Jakob; Fransson, Sven-Göran; Stendahl, Olle; Schön, Thomas; Lerm, Maria

    2013-03-01

    The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB), the bacterium responsible for tuberculosis (TB), has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs) from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL)-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha) and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth. Copyright © 2013 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  18. Epidemia de tuberculosis multidrogo resistente y extensivamente resistente a drogas (TB MDR/XDR en el Perú: situación y propuestas para su control

    Directory of Open Access Journals (Sweden)

    Hernán Del Castillo

    2009-07-01

    Full Text Available En este artículo se describe el estado actual de las epidemias de tuberculosis multidrogo resitente (TB MDR y tuberculosis extensivamente resistente a drogas (TB XDR en el Perú. Se realiza un análisis de nuestra situación con respecto al resto de Latinoamérica, y de la distribución temporo espacial de los casos de TB XDR en Lima. También presentamos nuestra reflexión de lo que está pasando y debe cambiar; lo que se resume en darle la importancia debida a un problema que nos está rebasando y anteponer a nuestros propios intereses, los intereses de la humanidad; por consiguiente no podemos callar, y debemos declarar a la tuberculosis como emergencia sanitaria nacional. Eso constituye una respuesta, esperamos, aún viable para el Perú.

  19. Double Standards in Global Health: Medicine, Human Rights Law and Multidrug-Resistant TB Treatment Policy.

    Science.gov (United States)

    Nicholson, Thomas; Admay, Catherine; Shakow, Aaron; Keshavjee, Salmaan

    2016-06-01

    The human rights arguments that underpinned the fight against HIV over the last three decades were poised, but ultimately failed, to provide a similar foundation for success against multidrug-resistant TB (MDR-TB) and other diseases of the poor. With more than 1.5 million deaths since 2000 attributed to strains of MDR-TB, and with half a million new, and mostly untreated, MDR-TB cases in the world each year, the stakes could not be higher. The World Health Organization (WHO), whose mandate is to champion the attainment by all peoples of the highest possible level of health, recommended unsound medical treatment for MDR-TB patients in resource-poor settings from 1993-2002. Citing cost considerations, WHO did not recommend the available standard of care that had been successfully used to contain and defeat MDR-TB in rich countries. By acting as a strategic gatekeeper in its technical advisory role to donor agencies and countries, it also facilitated the global implementation of a double standard for TB care in low- and middle-income countries (LMICs), upending important legal and scientific priorities. This raises serious questions about whether the organization violated international human rights standards and those established in its own constitution. While calling for additional analysis and discussion on this topic, the authors propose that policymakers should reject double standards of this kind and instead embrace the challenge of implementing the highest standard of care on a global level.

  20. Updates on antibody functions in Mycobacterium tuberculosis infection and their relevance for developing a vaccine against tuberculosis.

    Science.gov (United States)

    Achkar, Jacqueline M; Prados-Rosales, Rafael

    2018-04-12

    A more effective vaccine to control tuberculosis (TB), a major global public health problem, is urgently needed. Current vaccine candidates focus predominantly on eliciting cell-mediated immunity but other arms of the immune system also contribute to protection against TB. We review here recent studies that enhance our current knowledge of antibody-mediated functions against Mycobacterium tuberculosis. These findings, which contribute to the increasing evidence that antibodies have a protective role against TB, include demonstrations that firstly distinct human antibody Fc glycosylation patterns, found in latent M. tuberculosis infection but not in active TB, influence the efficacy of the host to control M. tuberculosis infection, secondly antibody isotype influences human antibody functions, and thirdly that antibodies targeting M. tuberculosis surface antigens are protective. We discuss these findings in the context of TB vaccine development and highlight the need for further research on antibody-mediated immunity in M. tuberculosis infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. 'Team up against TB': promoting involvement in Thibela TB, a trial of community-wide tuberculosis preventive therapy.

    Science.gov (United States)

    Grant, Alison D; Coetzee, Leonie; Fielding, Katherine L; Lewis, James J; Ntshele, Smanga; Luttig, Mariëtha M; Mngadi, Kathryn T; Muller, Dorothy; Popane, Flora; Mdluli, John; Mngadi, Nkosinathi; Sefuthi, Clement; Clark, David A; Churchyard, Gavin

    2010-11-01

    To describe a programme of community education and mobilization to promote uptake in a cluster-randomized trial of tuberculosis preventive therapy offered to all members of intervention clusters. Gold mines in South Africa, where tuberculosis incidence is extremely high, despite conventional control measures. All employees in intervention clusters (mine shaft and associated hostel) were invited to enrol. Cumulative enrolment in the study in intervention clusters. Key steps in communicating information relevant to the study included extensive consultation with key stakeholders; working with a communication company to develop a project 'brand'; developing a communication strategy tailored to each intervention site; and involving actors from a popular television comedy series to help inform communities about the study. One-to-one communications used peer educators along with study staff, and participant advisory groups facilitated two-way communication between study staff and participants. By contrast, treatment 'buddies' and text messaging to promote adherence proved less successful. Mean cumulative enrolment in the first four intervention clusters was 61.9%, increasing to 83.0% in the final four clusters. A tailored communication strategy can facilitate a high level of enrolment in a community health intervention.

  2. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigão, João

    2018-03-18

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  3. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigã o, Joã o; Silva, Carla; Diniz, Jaciara; Pereira, Catarina; Machado, Diana; Ramos, Jorge; Silva, Hugo; Abilleira, Fernanda; Brum, Clarice; Reis, Ana J.; Macedo, Maí ra; Scaini, Joã o L.; Silva, Ana B.; Esteves, Leonardo; Macedo, Rita; Maltez, Fernando; Clemente, Sofia; Coelho, Elizabeth; Viegas, Sofia; Rabna, Paulo; Rodrigues, Amabé lia; Taveira, Nuno; Jordao, Luí sa; Kritski, Afrâ nio; e Silva, José Lapa; Mokrousov, Igor; Couvin, David; Rastogi, Nalin; Couto, Isabel; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; von Groll, Andrea; Dalla-Costa, Elis R.; Rossetti, Maria Lú cia; da Silva, Pedro E.A.; Viveiros, Miguel; Portugal, Isabel

    2018-01-01

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  4. Current integration of tuberculosis (TB and HIV services in South Africa, 2011.

    Directory of Open Access Journals (Sweden)

    Joel C Chehab

    Full Text Available SETTING: Public Health Facilities in South Africa. OBJECTIVE: To assess the current integration of TB and HIV services in South Africa, 2011. DESIGN: Cross-sectional study of 49 randomly selected health facilities in South Africa. Trained interviewers administered a standardized questionnaire to one staff member responsible for TB and HIV in each facility on aspects of TB/HIV policy, integration and recording and reporting. We calculated and compared descriptive statistics by province and facility type. RESULTS: Of the 49 health facilities 35 (71% provided isoniazid preventive therapy (IPT and 35 (71% offered antiretroviral therapy (ART. Among assessed sites in February 2011, 2,512 patients were newly diagnosed with HIV infection, of whom 1,913 (76% were screened for TB symptoms, and 616 of 1,332 (46% of those screened negative for TB were initiated on IPT. Of 1,072 patients newly registered with TB in February 2011, 144 (13% were already on ART prior to Tb clinical diagnosis, and 451 (42% were newly diagnosed with HIV infection. Of those, 84 (19% were initiated on ART. Primary health clinics were less likely to offer ART compared to district hospitals or community health centers (p<0.001. CONCLUSION: As of February 2011, integration of TB and HIV services is taking place in public medical facilities in South Africa. Among these services, IPT in people living with HIV and ART in TB patients are the least available.

  5. Influence of HIV and other risk factors on tuberculosis

    African Journals Online (AJOL)

    TB has a negative impact on HIV, increasing the risk of HIV-related morbidity ... Objectives. To describe the sociodemographic and outcome characteristics of TB patients, and to identify risk factors associated with TB ..... Cunningham J, Perkins M. Diagnostics for tuberculosis: Global demand and market potential. 2006.

  6. Emerging drugs and alternative possibilities in the treatment of tuberculosis

    NARCIS (Netherlands)

    Hofman, S.; Segers, M.M.; Ghimire, S.; Bolhuis, M.S.; Sturkenboom, M.G.; Soolingen, D. van; Alffenaar, J.W.

    2016-01-01

    INTRODUCTION: Tuberculosis (TB) remains a global health problem. Drug resistance, treatment duration, complexity, and adverse drug reactions associated with anti-TB regimens are associated with treatment failure, prolonged infectiousness and relapse. With the current set of anti-TB drugs the goal to

  7. Emerging drugs and alternative possibilities in the treatment of tuberculosis

    NARCIS (Netherlands)

    Hofman, S.; Segers, M. M.; Ghimire, S.; Bolhuis, M. S.; Sturkenboom, M. G. G.; Van Soolingen, D.; Alffenaar, J. W. C.

    2016-01-01

    Introduction: Tuberculosis (TB) remains a global health problem. Drug resistance, treatment duration, complexity, and adverse drug reactions associated with anti-TB regimens are associated with treatment failure, prolonged infectiousness and relapse. With the current set of anti-TB drugs the goal to

  8. Anti-tuberculosis activities of the crude methanolic extract and ...

    African Journals Online (AJOL)

    Summary: Tuberculosis (TB) is of great public health burden globally especially in developing countries of Africa and Asia . Current TB regimen involves multiple therapies and of long duration leading to poor patient adherence. There is also the challenge of multidrug resistant TB. Hence, there is a need for discovery of new ...

  9. HIV Testing among Canadian Tuberculosis Cases from 1997 to 1998

    Directory of Open Access Journals (Sweden)

    Tara Harris

    2006-01-01

    Full Text Available BACKGROUND: Recent evidence suggests a global rise in adult tuberculosis (TB cases associated with HIV/AIDS. The World Health Organization, the United States Centers for Disease Control and Prevention, and the Public Health Agency of Canada advocate universal screening of all TB cases for HIV. The contribution of HIV to the TB burden in Canada remains unclear.

  10. Tuberculosis elimination in the post Millennium Development Goals era

    DEFF Research Database (Denmark)

    Wejse, Christian

    2015-01-01

    The Millennium Development Goal for tuberculosis (TB) is to stop the increase in incidence and halve the mortality of TB between 1990 and 2015. This goal has now been reached on a global scale, although not in the most affected region of Africa. The new target is TB elimination, defined as one case...

  11. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  12. Density equalizing mapping of the global tuberculosis research architecture.

    Science.gov (United States)

    Groneberg, David A; Weber, Esther; Gerber, Alexander; Fischer, Axel; Klingelhoefer, Doris; Brueggmann, Doerthe

    2015-07-01

    Tuberculosis belongs to the lung infectious diseases with the highest impact on global burden of disease. Yet there is no concise scientometric study about tuberculosis research. Therefore, the NewQiS project elected this subject as focus of an in depth analysis to perform density equalizing mapping in combination with scientometrics. In this retrospective study all publications related to tuberculosis research listed in the Web of Science database between 1900 and 2012 were identified, analyzed and submitted to density equalizing mapping procedures. In total 58,319 entries on TBC were identified with the USA being the most productive country with 11,788 publications, followed by the United Kingdom (4202), India (3456), France (2541), South Africa (1840), Germany (1747) and China (1427). Concerning the citations rate Denmark leads with 43.7 citations per article, followed by Latvia (39.1), Gambia (38.3), Senegal (34.9), and the Netherlands (31.4). Chart techniques demonstrates a widely ramified international network with a focus the joint work of USA, the UK and South Africa. This is the first density equalizing and scientometric study that addresses tuberculosis research over a period of 112 years. It illustrates global tuberculosis research architecture and stresses the need for strengthening global research efforts and funding program. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Comparative Mycobacteriology of the Mycobacterium tuberculosis complex

    OpenAIRE

    Gordon, Stephen V.; Behr, Marcel A.

    2015-01-01

    The Mycobacterium tuberculosis complex (MTBC) is a group of highly genetically related pathogens that cause tuberculosis (TB) in mammalian species. However, the very name of the complex underlines the fact that our knowledge of these pathogens is dominated by studies on the human pathogen, M. tuberculosis. Of course this is entirely justified; M. tuberculosis is a major global pathogen that exacts a horrendous burden in terms of mortality and morbidity so it is appropriate that it is...

  14. Scaling up towards international targets for AIDS, tuberculosis, and malaria: contribution of global fund-supported programs in 2011-2015.

    Directory of Open Access Journals (Sweden)

    Itamar Katz

    Full Text Available OBJECTIVE: The paper projects the contribution to 2011-2015 international targets of three major pandemics by programs in 140 countries funded by the Global Fund to Fight AIDS, Tuberculosis and Malaria, the largest external financier of tuberculosis and malaria programs and a major external funder of HIV programs in low and middle income countries. DESIGN: Estimates, using past trends, for the period 2011-2015 of the number of persons receiving antiretroviral (ARV treatment, tuberculosis case detection using the internationally approved DOTS strategy, and insecticide-treated nets (ITNs to be delivered by programs in low and middle income countries supported by the Global Fund compared to international targets established by UNAIDS, Stop TB Partnership, Roll Back Malaria Partnership and the World Health Organisation. RESULTS: Global Fund-supported programs are projected to provide ARV treatment to 5.5-5.8 million people, providing 30%-31% of the 2015 international target. Investments in tuberculosis and malaria control will enable reaching in 2015 60%-63% of the international target for tuberculosis case detection and 30%-35% of the ITN distribution target in sub-Saharan Africa. CONCLUSION: Global Fund investments will substantially contribute to the achievement by 2015 of international targets for HIV, TB and malaria. However, additional large scale international and domestic financing is needed if these targets are to be reached by 2015.

  15. User experience analysis of e-TB Manager, a nationwide electronic tuberculosis recording and reporting system in Ukraine

    Directory of Open Access Journals (Sweden)

    Niranjan Konduri

    2017-05-01

    Full Text Available Ukraine has successfully implemented e-TB Manager nationwide as its mandatory national tuberculosis registry after first introducing it in 2009. Our objective was to perform an end-of-programme evaluation after formal handover of the registry administration to Ukraine's Centre for Disease Control in 2015. We conducted a nationwide, cross-sectional, anonymous, 18-point user experience survey, and stratified the registry's transaction statistics to demonstrate usability. Contrary to initial implementation experience, older users (aged >50 years, often with limited or no computer proficiency prior to using the registry, had significantly better user experience scores for at least six of the 12 measures compared to younger users (aged 18–29 years. Using the registry for >3 years was associated with significantly higher scores for having capacity, adequacy of training received and satisfaction with the registry. Of the 5.9 million transactions over a 4-year period, nine out of 24 oblasts (regions and Kiev city accounted for 62.5% of all transactions, and corresponded to 59% of Ukraine's tuberculosis burden. There were 437 unique active users in 486 rayons (districts of Ukraine, demonstrating extensive reach. Our key findings complement the World Health Organization and European Respiratory Society's agenda for action on digital health to help implement the End TB Strategy.

  16. Cloning and expression of pab gene of M. tuberculosis isolated from pulmonary TB patient in E.coli DH5α

    Directory of Open Access Journals (Sweden)

    Tri Y. M. Raras

    2011-11-01

    Full Text Available Background: Mycobacterium tuberculosis antigen38 is a potent serodiagnostic agent containing two M. tuberculosisspecific B-cell epitopes. The high price of imported diagnostic agents hinders realization of fast clinical TB diagnosis in developing countries. Therefore, we produced recombinant antigen38 (recAg38M from M. tuberculosis local strain, which might be used to produce economical tuberculosis serodiagnostic kit.Methods: Pab gene that was isolated from pulmonary TB patient in Malang was cloned into a plasmid vector (pGEMTeasy to construct pMB38. The E.coli DH5α clone carrying pMb38 was selected on X-gal medium. The expression of pab was mediated using pPRoExHTc under the control of Trc promoter and E.coli DH5α as host.Results: Alignment of the pab sequence from the white E.coli DH5α clones with that of M. tuberculosis H37Rv showed 98% homology. The recombinant protein in which the signal peptide has been deleted to prevent the protein being secreted into medium was found in the cytoplasm.Conclusion: pab gene of M. tuberculosis isolated from a TB patient could be expressed in heterologous system in E.coliDH5α. (Med J Indones 2011; 20:247-54Keywords: Mycobacterium tuberculosis, Pab gene expression, recombinant antigen38

  17. Multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    McNerney Ruth

    2008-01-01

    Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

  18. Repurposing and Revival of the Drugs: A New Approach to Combat the Drug Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Divakar Sharma

    2017-12-01

    Full Text Available Emergence of drug resistant tuberculosis like multi drug resistant tuberculosis (MDR-TB, extensively drug-resistant tuberculosis (XDR-TB and totally drug resistant tuberculosis (TDR-TB has created a new challenge to fight against these bad bugs of Mycobacterium tuberculosis. Repurposing and revival of the drugs are the new trends/options to combat these worsen situations of tuberculosis in the antibiotics resistance era or in the situation of global emergency. Bactericidal and synergistic effect of repurposed/revived drugs along with the latest drugs bedaquiline and delamanid used in the treatment of MDR-TB, XDR-TB, and TDR-TB might be the choice for future promising combinatorial chemotherapy against these bad bugs.

  19. Clinical presentation, demographics and outcome of Tuberculosis (TB in a low incidence area: a 4-year study in Geneva, Switzerland

    Directory of Open Access Journals (Sweden)

    Rochat Thierry

    2009-12-01

    Full Text Available Abstract Background The incidence of tuberculosis (TB in developed countries has decreased since the 1990s, reflecting worldwide efforts to identify and treat TB according to WHO recommendations. However TB remains an important public health problem in industrialized countries with a high proportion of cases occurring among subjects originating from high prevalence countries. The aim of this study was to describe clinical and social characteristics of patients with TB and their outcome in a low incidence area with a high immigration rate. Methods Four-year retrospective study based on a computerized database and subsequent review of medical records of all patients with TB followed at the outpatient section of the Division of Pulmonary Diseases, Geneva University Hospital, Switzerland. Results 252 patients (84% foreigners, 25% asylum seekers aged 38 ± 19 yrs were studied (11% co-infected with HIV. TB was intrapulmonary (TBP in 158 cases (63%, extrapulmonary (TBE in 137 (54%, and both in 43 cases (17%. TBP was smear (S+/culture (C+ in 59%, S-/C+ in 37%, S-/C- in 4%. Smoking was significantly associated with cavitary disease. Time from onset of symptoms to diagnosis was 2.1 ± 3.1 months. Initially, 10% were asymptomatic; 35% had no general symptoms. Despite systematic sputum analysis (induced or spontaneous, TBP was confirmed only by bronchoscopy in 38 subjects (24% of TBP. Side effects requiring changes in treatment occurred in 38 cases (11%. Treatment was completed in 210 (83% patients. In 42 cases, follow up was unsuccessful; causes were: failure (n = 2; 0.8%, defaulters (n = 8; 3%, transfer out (n = 28; 11% and death (n = 4; 1.6%. Relapse rate was 0.24 per 100 patient-years. Considering S+ TBP only, success rate was 87%. Conclusion TB in our area is predominantly a disease of young foreign-born subjects. Smoking appears as a possible risk factor for cavitary TBP. Time to diagnosis remains long. Compliance to treatment is satisfactory. Success

  20. Survey on medicinal plants traditionally used in Senegal for the treatment of tuberculosis (TB) and assessment of their antimycobacterial activity.

    Science.gov (United States)

    Diop, ElHadji Assane; Queiroz, Emerson Ferreira; Kicka, Sébastien; Rudaz, Serge; Diop, Tahir; Soldati, Thierry; Wolfender, Jean-Luc

    2018-04-24

    In West Africa, populations are used to taking traditional medicine as a first aid against common health problems. In this aspect, many plants are claimed to be effective in the treatment of Tuberculosis (TB), which according to the World Health Organization (WHO) remains one of the world's deadliest communicable diseases. The main aim of this study was to identify plants used to treat TB-symptoms by the population of Senegal and to evaluate their possible concomitant use with clinically approved TB-drugs. This approach allowed the selection of plants effectively used in traditional medicine. In order to verify if the usage of some of these plants can be rationalized, the activity of their traditional preparations was assessed with both an intracellular and extracellular antimycobacterial host-pathogen assays. An ethnopharmacological survey conducted on 117 TB-patients and 30 healers in Senegal from March to May 2014. The questionnaires were focused on the use of medicinal plants to treat common TB -symptoms (cough longer than 2 weeks, fever, night sweats, weight loss and bloody sputum). Local plant names, utilized organs (herbal drugs) and traditional formulations of the plants were recorded. Extracts were prepared by mimicking the traditional decoction in boiling water and screened for their antimycobacterial activity using Mycobacterium marinum, as a validated TB surrogate, and an Acanthamoeba castellanii - M. marinum whole-cell based host-pathogen assay, to detect anti-infective activities. By the end of the survey, nearly 30 plants were cited and the 12 most cited herbal drugs were collected and their usage documented by extensive literature search. Extracts of the chosen herbs were screened with the described assays; with a main focus on traditional formulas (mainly herbal decoctions). Two of the water extracts from Combretum aculeatum and Guiera senegalensis showed significant antimycobacterial activities when compared to the positive control drug (rifampin

  1. CD4 cell levels during treatment for tuberculosis (TB in Ethiopian adults and clinical markers associated with CD4 lymphocytopenia.

    Directory of Open Access Journals (Sweden)

    Sten Skogmar

    Full Text Available BACKGROUND: The clinical correlations and significance of subnormal CD4 levels in HIV-negative patients with TB are unclear. We have determined CD4 cell levels longitudinally during anti-tuberculosis treatment (ATT in patients, with and without HIV co-infection, and their associations with clinical variables. METHOD: Adults diagnosed with TB (maximum duration of ATT for 2 weeks, and with no history of antiretroviral therapy (ART in HIV-positive subjects were included consecutively in eight out-patient clinics in Ethiopia. Healthy individuals were recruited for comparison at one of the study health centers. Data on patient characteristics and physical findings were collected by trained nurses following a structured questionnaire at inclusion and on follow-up visits at 2 and 6 months. In parallel, peripheral blood CD4 cell levels were determined. The evolution of CD4 cell levels during ATT was assessed, and the association between clinical characteristics and low CD4 cell levels at baseline was investigated using regression analysis. RESULTS: In total, 1116 TB patients were included (307 HIV-infected. Among 809 HIV-negative patients, 200 (25% had subnormal CD4 cell counts (<500 cells/mm(3, with <350 cells/mm(3 in 82 (10% individuals. CD4 cell levels increased significantly during the course of ATT in both HIV+ and HIV- TB-patients, but did not reach the levels in healthy subjects (median 896 cells/mm(3. Sputum smear status, signs of wasting (low mid upper arm circumference (MUAC, and bedridden state were significantly associated with low CD4 cell counts. CONCLUSION: A high proportion of Ethiopian TB patients have subnormal CD4 cell counts before starting treatment. Low CD4 cell levels are associated with smear positive disease and signs of wasting. The continuous increase of CD4 cell counts during the course of ATT suggest a reversible impact of active TB on CD4 cell homeostasis, which may be considered in interpretation of CD4 cell counts in HIV/TB

  2. The epidemiology of tuberculosis in recent years:

    Directory of Open Access Journals (Sweden)

    Maliheh Metanat

    2012-02-01

    Full Text Available Background: Tuberculosis (TB is one of the most important health issues in developing countries. Understanding the epidemiology of tuberculosis is critical for effective disease control. The global burden of tuberculosis, risk factors for transmission, and the epidemiology of tuberculosis will be reviewed in this article.Materials and Method: We used Scopus, Embase, PubMed, World Health Organization (WHO and scientific Iranian journals from 2000 to 2011; and the last reports from Iranian ministry of health, for extracting data. Key words such as tuberculosis, epidemiology, Iran and Sistan- Balouchestan were used.Results: Descending trend of TB incidence was observed over the last 45 years in Iran. Pulmonary TB is the most prevalent kind of TB in Iran in which 53% were sputum smear positive. Extra-pulmonary TB consists 28% of TB patients. Sistan-Balouchestan and Golestan had the highest incidence and prevalence of TB among all provinces in Iran. According to the latest data from Iranian ministry of health, the incidence of TB in Zabol and Zahedan were reported 109.7 and 36.6 per 100000 populations, respectively. Conclusion: More than 80% of TB patients still belong to developing countries. Sistan-Balouchestan and Golestan had the highest incidence of TB and for achieving the goals of WHO, control and prevention of the disease should be followed seriously

  3. Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

    Directory of Open Access Journals (Sweden)

    Figen KAYSERİLİ ORHAN

    2018-03-01

    Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.

  4. Globalization of pediatric transplantation: The risk of tuberculosis or not tuberculosis.

    Science.gov (United States)

    McCulloch, Mignon; Lin, Philana Ling

    2017-05-01

    The risk of TB among pediatric SOT recipients increases as the globalization of medical care continues to broaden. Unlike adults, children and especially infants are more susceptible to TB as a complication after transplantation. Little data exist regarding the true incidence of TB and the optimal risk-based management of this very vulnerable population. Here, we highlight the theoretical and practical issues that complicate the management of these patients and pose some questions that should be addressed when managing these patients. More data are needed to provide optimal guidance of the best diagnostic and management practices to this unique population. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Global gene transcriptome analysis in vaccinated cattle revealed a dominant role of IL-22 for protection against bovine tuberculosis.

    Directory of Open Access Journals (Sweden)

    Sabin Bhuju

    2012-12-01

    Full Text Available Bovine tuberculosis (bTB is a chronic disease of cattle caused by Mycobacterium bovis, a member of the Mycobacterium tuberculosis complex group of bacteria. Vaccination of cattle might offer a long-term solution for controlling the disease and priority has been given to the development of a cattle vaccine against bTB. Identification of biomarkers in tuberculosis research remains elusive and the goal is to identify host correlates of protection. We hypothesized that by studying global gene expression we could identify in vitro predictors of protection that could help to facilitate vaccine development. Calves were vaccinated with BCG or with a heterologous BCG prime adenovirally vectored subunit boosting protocol. Protective efficacy was determined after M. bovis challenge. RNA was prepared from PPD-stimulated PBMC prepared from vaccinated-protected, vaccinated-unprotected and unvaccinated control cattle prior to M. bovis challenge and global gene expression determined by RNA-seq. 668 genes were differentially expressed in vaccinated-protected cattle compared with vaccinated-unprotected and unvaccinated control cattle. Cytokine-cytokine receptor interaction was the most significant pathway related to this dataset with IL-22 expression identified as the dominant surrogate of protection besides INF-γ. Finally, the expression of these candidate genes identified by RNA-seq was evaluated by RT-qPCR in an independent set of PBMC samples from BCG vaccinated and unvaccinated calves. This experiment confirmed the importance of IL-22 as predictor of vaccine efficacy.

  6. Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

    Directory of Open Access Journals (Sweden)

    Biao Xu

    2015-01-01

    Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

  7. Specificity of the Tuberculin Skin Test and the T-SPOT."TB" Assay among Students in a Low-Tuberculosis Incidence Setting

    Science.gov (United States)

    Talbot, Elizabeth A.; Harland, Dawn; Wieland-Alter, Wendy; Burrer, Sherry; Adams, Lisa V.

    2012-01-01

    Objective: Interferon-[gamma] release assays (IGRAs) are an important tool for detecting latent "Mycobacterium tuberculosis" infection (LTBI). Insufficient data exist about IGRA specificity in college health centers, most of which screen students for LTBI using the tuberculin skin test (TST). Participants: Students at a low-TB incidence college…

  8. Migration to middle-income countries and tuberculosis-global policies for global economies.

    Science.gov (United States)

    Pescarini, Julia Moreira; Rodrigues, Laura Cunha; Gomes, M Gabriela M; Waldman, Eliseu Alves

    2017-03-15

    International migration to middle-income countries is increasing and its health consequences, in particular increasing transmission rates of tuberculosis (TB), deserve consideration. Migration and TB are a matter of concern in high-income countries and targeted screening of migrants for active and latent TB infection is a main strategy to manage risk and minimize transmission. In this paper, we discuss some aspects of TB control and migration in the context of middle-income countries, together with the prospect of responding with equitable and comprehensive policies. TB rates in middle-income countries remain disproportionally high among the poorest and most vulnerable groups in large cities where most migrant populations are concentrated. Policies that tackle migrant TB in high-income countries may be inadequate for middle-income countries because of their different socio-economic and cultural scenarios. Strategies to control TB in these settings must take into account the characteristics of middle-income countries and the complexity of TB as a disease of poverty. Intersectoral policies of social protection such as cash-transfer programs help reducing poverty and improving health in vulnerable populations. We address the development of new approaches to improve well-established strategies including contact tracing and active and latent TB screening as an 'add on' to the existing health care guidelines of conditional cash transfer programs. In addition, we discuss how it might improve health and welfare among both poor migrants and locally-born populations. Authorities from middle-income countries should recognise that migrants are a vulnerable social group and promote cooperation efforts between sending and receiving countries for mitigation of poverty and prevention of disease in this group. Middle-income countries have long sent migrants overseas. However, the influx of large migrant populations into their societies is relatively new and a growing phenomenon and

  9. Integration of childhood TB into guidelines for the management of acute malnutrition in high burden countries.

    Science.gov (United States)

    Patel, L N; Detjen, A K

    2017-06-21

    Introduction: Childhood tuberculosis (TB) and undernutrition are major global public health challenges. In 2015, although an estimated 1 million children aged malnutrition from 17 high TB burden countries were reviewed to gather information on TB symptom screening, exposure history, and treatment. Results: Seven (41%) countries recommend routine TB screening among children with acute malnutrition, and six (35%) recommend obtaining a TB exposure history. Conclusion: TB screening is not consistently included in guidelines for acute malnutrition in high TB burden countries. Routine TB risk assessment, especially history of TB exposure, among acutely malnourished children, combined with improved linkages with TB services, would help increase TB case finding and could impact outcomes. Operational research on how best to integrate services at different levels of the health care system is needed.

  10. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Science.gov (United States)

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  11. Duodenal tuberculosis

    International Nuclear Information System (INIS)

    Mirza, M.R.; Sarwar, M.

    2004-01-01

    Tuberculosis is a world wide communicable disease caused by tubercle bacilli discovered by Robert Kock in 1882. In 1993 WHO declared TB as a global emergency due to its world wide resurgence. It can involve any organ of the body. Abdomen is the fourth commonest site of involvement in the extra pulmonary tuberculosis after the lymph-nodes, skeletal and Genito urinary variants. In the gastro intestinal tract tuberculosis can affect any part from the mouth to the anus but ileocaecal area is a favourite location. Duodenal involvement is uncommon and accounts for only 2.5% of tuberculous enteritis. Major pathogens are Mycobacterium Tuberculosis and bovis and the usual route of entry is by direct penetration of the intestinal mucosa by swallowed organisms. (author)

  12. TUBERCULOSIS: EPIDEMIOLOGY AND CONTROL

    Directory of Open Access Journals (Sweden)

    Giorgia Sulis

    2014-10-01

    Full Text Available Tuberculosis (TB is a major public health concern worldwide: despite a regular, although slow, decline in incidence over the last decade, as many as 8.6 million new cases and 1.3 million deaths were estimated to have occurred in 2012. TB is by all means a poverty-related disease, mainly affecting the most vulnerable populations in the poorest countries. The presence of multidrug-resistant strains of M. tuberculosis in most countries, with some where prevalence is high, is among the major challenges for TB control, which may hinder recent achievements especially in some settings. Early TB case detection especially in resource-constrained settings and in marginalized groups remains a challenge, and about 3 million people are estimated to remain undiagnosed or not notified and untreated. The World Health Organization (WHO has recently launched the new global TB strategy for the “post-2015 era” aimed at “ending the global TB epidemic” by 2035, based on the three pillars that emphasize patient-centred TB care and prevention, bold policies and supportive systems, and intensified research and innovation. This paper aims to provide an overview of the global TB epidemiology as well as of the main challenges that must be faced to eliminate the disease as a public health problem everywhere.

  13. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  14. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D; Coll, Francesc; Furnham, Nick; McNerney, Ruth; Glynn, Judith R; Campino, Susana; Pain, Arnab; Mohareb, Fady R; Clark, Taane G

    2015-01-01

    Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights

  15. Patho-TB test for the rapid diagnosis of pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Roya Alavi-Naini

    2009-09-01

    Full Text Available

    • BACKGROUND: Despite recent technologic improvements in identifying mycobacterium tuberculosis, we are still facing problems in rapid diagnosis of tuberculosis. The objective of this study is to determine the diagnostic value of a new rapid screening test (Patho-TB™ for diagnosis of pulmonary tuberculosis.
    • METHODS: Between September 2006 to August 2007, 178 patients were enrolled in the study who were finally classified into two groups; a group of documented pulmonary tuberculosis (n = 67 and a group of non-tuberculous pulmonary infection (n = 111. Patho-TB™ test, Ziehl-Neelsen staining and culture were done on all specimens.
    • RESULTS: Of all, 43 patients with pulmonary tuberculosis were sputum smear positive for acid fast bacilli and the rest were smear negative. Mean age of the patients was 59.8 ± 16.1 years and 44% of them were men. The results of Patho- TB™ test were positive in 40 of smear positive and 20 of smear negative tuberculous patients and 33 cases of nontuberculous control group. The sensitivity, specificity, positive and negative predictive values and accuracy of Patho- TB™ test were estimated 89.5%, 70.2%, 64.5%, 91.7% and 77.5%, respectively.
    • CONCLUSIONS: According to the present study it would be suggested that Patho-TB™ test could be a rapid and inexpensive method for diagnosis of pulmonary tuberculosis, given by its high sensitivity and negative predictive value. Concerning the high number of false positive results, using a confirmatory diagnostic procedure is mandatory.
    • KEYWORDS: Pulmonary Tuberculosis, Rapid Diagnosis, Mycobacterium Tuberculosis Antigens, Iran

  16. Evaluation of tuberculosis control programme in Khartoum State for the year 2006

    DEFF Research Database (Denmark)

    Ahmed Suleiman, M M; Aro, Arja R.; Sodemann, M

    2009-01-01

    BACKGROUND: Tuberculosis (TB) is among the top ten causes of global mortality. Sudan is among the countries with high TB prevalence; with an estimated incidence of 90/100,000 smear-positive cases. In 1993, the Khartoum State tuberculosis control programme was established. Since its establishment,...

  17. New-Onset Psychosis in a Multi-Drug Resistant Tuberculosis Patient ...

    African Journals Online (AJOL)

    Drug-resistant tuberculosis poses a serious challenge to global control of TB. These forms of TB do not respond to the standard six-month treatment; it can take two years or more to treat with category IV drugs that are less potent, more toxic and much more expensive. Treatment of multi-drug resistant tuberculosis is still ...

  18. Dihydrolipoamide dehydrogenase-Lpd (Rv0462)-specific T cell recall responses are higher in healthy household contacts of TB: a novel immunodominant antigen from M. tuberculosis.

    Science.gov (United States)

    Devasundaram, Santhi; Raja, Alamelu

    2017-07-01

    The partial effectiveness against pulmonary tuberculosis (PTB), displayed by the existing tuberculosis (TB) vaccine, bacillus Calmette-Guérin (BCG), highlights the need for novel vaccines to replace or improve BCG. In TB immunology, antigen-specific cellular immune response is frequently considered indispensable. Latency-associated antigens are intriguing as targets for TB vaccine development. The mycobacterial protein, dihydrolipoamide dehydrogenase (Lpd; Rv0462), the third enzyme of the pyruvate dehydrogenase (PDH) complex, facilitates Mycobacterium tuberculosis to resist host reactive nitrogen intermediates. Multicolor flow cytometry analysis of whole-blood cultures showed higher Lpd-specific Th1 recall response (IFN-γ, TNF-α, and IL-2; P = 0.0006) and memory CD4 + and CD8 + T cells (CCR7 + CD45RA - and CCR7 - CD45RA - ) in healthy household contacts (HHC) of TB ( P < 0.0001), which is comparable with or higher than the standard antigens, ESAT-6 and CFP-10. The frequency of Lpd-specific multifunctional T cells was higher in HHC compared with PTB patients. However, there is no significant statistical correlation. Regulatory T cell (T reg ) analysis of HHCs and active TB patients demonstrated very low Lpd-specific CD4 + T regs relative to ESAT-6 and CFP-10. Our study demonstrates that the Lpd antigen induces a strong cellular immune response in healthy mycobacteria-infected individuals. In consideration of this population having demonstrated immunologic protection against active TB disease development, our data are encouraging about the possible use of Lpd as a target for further TB subunit vaccine development. © Society for Leukocyte Biology.

  19. Emergence of Extensively Drug Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    2007-03-01

    Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.  Created: 3/1/2007 by Emerging Infectious Diseases.   Date Released: 3/26/2007.

  20. Outbreak of pulmonary tuberculosis in which tuberculosis developed from QuantiFERON-TB second generation (QFT-2G) test negative persons

    International Nuclear Information System (INIS)

    Yamaguchi, Junichi; Ooba, Yuko; Kaneda, Mie; Uchida, Kiyomi; Ishikawa, Yo; Suzuki, Kiminori; Yagi, Takenori; Sasaki, Yuka; Yamagishi, Fumio

    2007-01-01

    The purpose of this study was to clarify the points to be considered when QuantiFERON-TB second generation (QFT-2G) tests are used in the contacts examination by public health center. We analyzed the results of contacts examination on 43 workplace colleagues (39 y/o and younger) of a pulmonary tuberculosis patient (bII2, Gaffky 9, cough for 1.5 months). After two months of the last contact with the index case, tuberculin skin tests, QFT-2G tests and chest X-rays were undertaken. After 6 months, chest X-rays were taken, and after 9 months, QFT-2G tests and chest CT scans were also undertaken. The tuberculin skin tests after two months showed a bimodal distribution, and 10 were QFT-2G positive and 2 showed doubtful reaction. The latter 12 persons underwent chemoprophylaxis. After 6 months, however, out of 31 QFT-2G negative persons, 2 developed pulmonary tuberculosis. Moreover, after 9 months, chest CT scans revealed 5 pulmonary tuberculosis patients. Three out of 7 new patients showed positive or doubtful reactions in QFT-2G tests undertaken after 9 months. The sensitivity of QFT-2G tests is reported to be 80 to 90%, and the possibility of false negative is not negligible. We propose measures for public health center to conduct the contacts examination as follows; In case of high QFT-2G positive (including doubtful reaction) rate and/or a bimodal distribution of tuberculin skin test result, many infected persons are likely to be included in the group; and the following measures are recommended; Necessity of chemoprophylaxis should be judged considering both tuberculin skin test results and the situation of contact with the index case, and not only by QFT-2G test results. QFT-2G negative persons also need to be followed with chest X-rays. (author)

  1. [Tuberculosis screening program for undocumented immigrant teenagers using the QuantiFERON(®)-TB Gold In-Tube test].

    Science.gov (United States)

    Salinas, Carlos; Ballaz, Aitor; Díez, Rosa; Aguirre, Urko; Antón, Ane; Altube, Lander

    2015-07-06

    The aim of this study was to determine the prevalence of tuberculosis infection in undocumented immigrant teenagers using a tuberculin skin test (TST) for initial screening and QuantiFERON(®)-TB Gold In-Tube (QFT-GIT) as a confirmatory test. From 2007 to 2012, under 19 year-old immigrant teenagers from 2 accommodation centers of the Basque Country (Spain) were included in the study. The TST was done in all of them and the QFT-GIT was done in selected patients with a TST≥5mm. Eight hundred and forty-five immigrants were included, most of them from Africa (99.5%). Fifty-one percent of immigrants with TST ≥ 5 mm has a positive QFT-GIT. We found 2 cases of active tuberculosis (2/845: 0.24%). The concordance between TST (≥ 10 mm) and QFT-GIT was 63%, with 57% of positive concordance cases and 96% of negative concordances. There were 246 cases with TST ≥ 10 mm (29%), with significant differences between Magrebis (21.5%) and Subsaharians (67%) (Ptuberculosis infection in Subsaharian immigrants, we recommend implementing screening programs in this population. Using QFT-GIT, the number of candidates for chemoprophylaxis was reduced to 43% compared with TST alone (≥ 10 mm). Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  2. Non‑Adherence of New Pulmonary Tuberculosis Patients to Anti ...

    African Journals Online (AJOL)

    South East Asia Region carries about 40% of the global TB burden. India is the ... DOTS strategy, India's revised national tuberculosis control program (RNTCP) ... such as socio‑cultural, economic background, perceived health benefits and ...

  3. Operational research within a Global Fund supported tuberculosis project in India: why, how and its contribution towards change in policy and practice

    Science.gov (United States)

    Sagili, Karuna D; Satyanarayana, Srinath; Chadha, Sarabjit S; Wilson, Nevin C; Kumar, Ajay M V; Oeltmann, John E; Chadha, Vineet K; Nagaraja, Sharath Burugina; Ghosh, Smita; Q Lo, Terrence; Volkmann, Tyson; Willis, Matthew; Shringarpure, Kalpita; Reddy, Ravichandra Chinnappa; Kumar, Prahlad; Nair, Sreenivas A; Rao, Raghuram; Yassin, Mohammed; Mwangala, Perry; Zachariah, Rony; Tonsing, Jamhoih; Harries, Anthony D; Khaparde, Sunil

    2018-01-01

    ABSTRACT Background: The Global Fund encourages operational research (OR) in all its grants; however very few reports describe this aspect. In India, Project Axshya was supported by a Global Fund grant to improve the reach and visibility of the government Tuberculosis (TB) services among marginalised and vulnerable communities. OR was incorporated to build research capacity of professionals working with the national TB programme and to generate evidence to inform policies and practices. Objectives: To describe how Project Axshya facilitated building OR capacity within the country, helped in addressing several TB control priority research questions, documented project activities and their outcomes, and influenced policy and practice. Methods: From September 2010 to September 2016, three key OR-related activities were implemented. First, practical output-oriented modular training courses were conducted (n = 3) to build research capacity of personnel involved in the TB programme, co-facilitated by The Union, in collaboration with the national TB programme, WHO country office and CDC, Atlanta. Second, two large-scale Knowledge, Attitude and Practice (KAP) surveys were conducted at baseline and mid-project to assess the changes pertaining to TB knowledge, attitudes and practices among the general population, TB patients and health care providers over the project period. Third, studies were conducted to describe the project’s core activities and outcomes. Results: In the training courses, 44 participant teams were supported to develop research protocols on topics of national priority, resulting in 28 peer-reviewed scientific publications. The KAP surveys and description of project activities resulted in 14 peer-reviewed publications. Of the published papers at least 12 have influenced change in policy or practice. Conclusions: OR within a Global Fund supported TB project has resulted in building OR capacity, facilitating research in areas of national priority and

  4. Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

    NARCIS (Netherlands)

    Sagwa, Evans

    2017-01-01

    Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

  5. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  6. THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

    Directory of Open Access Journals (Sweden)

    I. A. Vasilyeva

    2017-01-01

    Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

  7. QuantiFERON®-TB gold in-tube performance for diagnosing active tuberculosis in children and adults in a high burden setting.

    Directory of Open Access Journals (Sweden)

    Michala V Rose

    Full Text Available AIM: To determine whether QuantiFERON®-TB Gold In-Tube (QFT can contribute to the diagnosis of active tuberculosis (TB in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST in a prospective cohort of TB suspect children compared to adults with confirmed TB in Tanzania. METHODS: Sensitivity and specificity of QFT and TST for diagnosing active TB as well as indeterminate QFT rates and IFN-γ levels were assessed in 211 TB suspect children in a Tanzanian district hospital and contrasted in 90 adults with confirmed pulmonary TB. RESULTS: Sensitivity of QFT and TST in children with confirmed TB was 19% (5/27 and 6% (2/31 respectively. In adults sensitivity of QFT and TST was 84% (73/87 and 85% (63/74. The QFT indeterminate rate in children and adults was 27% and 3%. Median levels of IFN-γ were lower in children than adults, particularly children <2 years and HIV infected. An indeterminate result was associated with age <2 years but not malnutrition or HIV status. Overall childhood mortality was 19% and associated with an indeterminate QFT result at baseline. CONCLUSION: QFT and TST showed poor performance and a surprisingly low sensitivity in children. In contrast the performance in Tanzanian adults was good and comparable to performance in high-income countries. Indeterminate results in children were associated with young age and increased mortality. Neither test can be recommended for diagnosing active TB in children with immature or impaired immunity in a high-burden setting.

  8. Prophylactic effect of a therapeutic vaccine against TB based on fragments of Mycobacterium tuberculosis.

    Science.gov (United States)

    Vilaplana, Cristina; Gil, Olga; Cáceres, Neus; Pinto, Sergio; Díaz, Jorge; Cardona, Pere-Joan

    2011-01-01

    The prophylactic capacity of the RUTI® vaccine, based on fragmented cells of Mycobacterium tuberculosis, has been evaluated in respect to aerosol challenge with virulent bacilli. Subcutaneous vaccination significantly reduced viable bacterial counts in both lungs and spleens of C57Bl mice, when challenged 4 weeks after vaccination. RUTI® protected the spleen less than BCG. Following a 9 month vaccination-challenge interval, protection was observed for the lungs, but not for the spleen. Survival of infected guinea pigs was prolonged by vaccination given 5 weeks before challenge. Inoculations of RUTI® shortly after infection significantly reduced the viable bacterial counts in the lungs, when compared with infected control mice. Thus, vaccination by RUTI® has potential for both the prophylaxis and immunotherapy of tuberculosis.

  9. The Risk of Depressive Disorder Among Contacts of Tuberculosis Patients in a TB-endemic Area: A Population-based Cohort Study.

    Science.gov (United States)

    Pan, Sheng-Wei; Yen, Yung-Feng; Feng, Jia-Yih; Su, Vincent Yi-Fong; Kou, Yu Ru; Su, Wei-Juin

    2015-10-01

    Tuberculosis (TB) disease may be transmitted to close contacts of index cases, causing physical illness. No studies have investigated the risk of developing depressive disorder among TB contacts in a TB-endemic area.Adult participants with a new diagnosis of TB contact (ICD-9-CM codes V01.1 plus chest radiographic order) since January 1, 2008, were identified from the National Health Insurance Research Database in Taiwan. A control cohort matched for age (±5 y), sex, enrolled years, and income level was selected. These 2 cohorts were followed until December 31, 2012, and observed for the development of depressive disorder. The Kaplan-Meier method and the log-rank test were used to examine the difference in cumulative incidences of depressive disorder between groups. Cox proportional-hazard models were used to calculate adjusted hazard ratios (aHRs) for depressive disorder.The TB contact cohort consisted of 9046 patients and matched controls of 36,184 ones. The mean age of TB contacts was 44.7 years, and 56.0% of them were women. During a mean follow-up period of 2.5 years, 127 (1.40%) TB contacts and 521 (1.44%) matched controls developed depressive disorder. TB exposure was found to be an independent risk factor of depressive disorder in women (aHR 1.34, 95% confidence interval [CI] 1.07-1.68), but not in men (aHR 0.71, 95% CI 0.48-1.06) after adjusting for age, comorbidities, and income levels. The risk of depression was significantly higher for female TB contacts than for matched controls in the first and second years (aHR 1.49, 95% CI 1.03-2.14; and aHR 1.53, 95% CI 1.05-2.23, respectively), but not thereafter. Of note, 67 (0.74%) TB contacts and 88 (0.24%) matched controls developed active TB, but none of them had subsequent depressive disorder during follow-up periods.Female TB contacts had an increased risk of depression within the first 2 years after exposure. Clinicians should consider conducting depression evaluations in addition to routine TB contact

  10. Information needs of rural health professionals: A case study of the tuberculosis and leprosy referral center (tb/l), Eku, Delta State

    OpenAIRE

    Esoswo Francisca Ogbomo

    2012-01-01

    In developing countries, many rural health professionals have little or no access to basic practical information. The "information poverty" of health professionals in rural area is exacerbating what is clearly a public health emergency on a massive scale. It is against this background that the researcher is investigating the information needs of rural health professionals in the tuberculosis and leprosy referral centre (TB/L), Eku, Nigeria. The study employed the ex-post facto research metho...

  11. [Comparative study of concordance and costs between tuberculin skin test and QuantiFERON(®)-TB Gold In-Tube in the diagnosis of latent tuberculosis infection among contacts of patients with pulmonary tuberculosis].

    Science.gov (United States)

    Martinez Lacasa, Xavier; Canals Font, Roser; Jaen Manzanera, Angels; Cuchi Burgos, Eva; Lite Lite, Josep

    2015-11-20

    Recently diagnosis of latent tuberculosis infection (LTBI) can be made using the tuberculin skin test (TST) or by techniques known as interferon-γ release assays (IGRAS), being QuantiFERON(®)-TB Gold In-Tube (QF-G-IT) the most used. The IGRAS avoid some drawbacks of the TST, especially cross-reaction with bacillus Calmette-Guérin (BCG) vaccine, but also present some problems such as those arising from cost and the need of having an adequate infrastructure and experience. There is no clear consensus on which technique should be preferentially used for the diagnosis of LTBI. This is a comparative study between the TST and QT-G-IT in a cohort of contacts of patients with pulmonary tuberculosis during the study period. An analysis of global agreement and groups was performed according to whether the contacts were vaccinated with BCG or not. A study of costs of both techniques and diagnostic strategies based on these techniques was performed. The agreement between TST and QF-G-IT was acceptable in the whole sample yet it was very good in the unvaccinated group. Few cases of indeterminate values were recorded. The cost study showed that TST was cheaper than QF-G-IT; however when we analyzed the cost of the strategies according to each technique, the QF-G-IT showed a better cost-benefit. We suggest considering QF-G-IT as the only preferred technique for the diagnosis of LTBI in household contacts, based on good overall agreement between the 2 techniques (even if we eliminate the effect of the vaccine) and a cost analysis favorable to QF-G-IT. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  12. Find TB. Treat TB. Working together to eliminate TB.

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    In this podcast, Dr. Sundari Mase, Medical Team Lead in the Field Services and Evaluation Branch in the Division of Tuberculosis Elimination, discusses World TB Day and the 2014 theme.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  13. Performance of QuantiFERON TB Gold test in detecting latent tuberculosis infection in brain-dead organ donors in Iran: a brief report.

    Science.gov (United States)

    Tabarsi, Payam; Yousefzadeh, Amir; Najafizadeh, Katayoun; Droudinia, Atousa; Bayati, Rouzbeh; Marjani, Majid; Shafaghi, Shadi; Farokhzad, Banafsheh; Javanmard, Pedram; Velayati, Ali Akbar

    2014-11-01

    With regard to the significant morbidity and mortality due to tuberculosis in lung transplant recipients, the identification of brain-dead organ donors with latent tuberculosis by use of the QuantiFERON TB Gold (QFT-G) test may be of help to reduce the risk of TB reactivation and mortality in lung recipients. This study was conducted in the National Research Institute of Tuber-culosis and Lung Diseases (NRITLD) in Iran, from January to March 2013. A total of 38 conse-cutive brain-dead donors, not currently infected with active tuberculosis, were recruited. The medi-cal records of all the study enrollees were reviewed. A whole-blood IFN- release assay (IGRA) in reaction to early secreted antigenic target 6 (ESAT-6), culture filtrate protein 10 (CFP-10), and TB7.7 antigens, was performed and the released Interferon- was measured via enzyme-linked immunosorbent assay (ELISA). The data was analyzed with QFT-G software which was provided by the company. The demographic, characteristics and other variables were entered into SPSS version 11.5. The QFT-G test results of three donors (7.9%) turned out to be positive, negative for 24 donors (63.1%), and indeterminate for 11 cases (28.9%). Our study revealed the potential advantages of QFT-G in lowering the incidence of donor-derived post-transplant tuberculosis among lung recipients. However, a high rate of indeterminate results restricted the performance of QFT-G in this study.

  14. Performance of QuantiFERON TB Gold test in detecting latent tuberculosis infection in brain-dead organ donors in Iran: A brief report

    Directory of Open Access Journals (Sweden)

    Payam Tabarsi

    2014-01-01

    Full Text Available With regard to the significant morbidity and mortality due to tuberculosis in lung transplant recipients, the identification of brain-dead organ donors with latent tuberculosis by use of the QuantiFERON TB Gold (QFT-G test may be of help to reduce the risk of TB reactivation and mortality in lung recipients. This study was conducted in the National Research Institute of Tuber-culosis and Lung Diseases (NRITLD in Iran, from January to March 2013. A total of 38 conse-cutive brain-dead donors, not currently infected with active tuberculosis, were recruited. The medi-cal records of all the study enrollees were reviewed. A whole-blood IFN- release assay (IGRA in reaction to early secreted antigenic target 6 (ESAT-6, culture filtrate protein 10 (CFP-10, and TB7.7 antigens, was performed and the released Interferon- was measured via enzyme-linked immunosorbent assay (ELISA. The data was analyzed with QFT-G software which was provided by the company. The demographic, characteristics and other variables were entered into SPSS version 11.5. The QFT-G test results of three donors (7.9% turned out to be positive, negative for 24 donors (63.1%, and indeterminate for 11 cases (28.9%. Our study revealed the potential advantages of QFT-G in lowering the incidence of donor-derived post-transplant tuberculosis among lung recipients. However, a high rate of indeterminate results restricted the performance of QFT-G in this study.

  15. Conjugation of the CRM197-inulin conjugate significantly increases the immunogenicity of Mycobacterium tuberculosis CFP10-TB10.4 fusion protein.

    Science.gov (United States)

    Hu, Shun; Yu, Weili; Hu, Chunyang; Wei, Dong; Shen, Lijuan; Hu, Tao; Yi, Youjin

    2017-11-01

    Mycobacterium tuberculosis (Mtb) is a serious fatal pathogen that causes tuberculosis (TB). Effective vaccination is urgently needed to deal with the serious threat from TB. Mtb-secreted protein antigens are important virulence determinants of Mtb with poor immunogenicity. Adjuvants and antigen delivery systems are thus highly desired to improve the immunogenicity of protein antigens. Inulin is a biocompatible polysaccharide (PS) adjuvant that can stimulate a strong cellular and humoral immunity. Bacterial capsular PS and haptens have been conjugated with cross-reacting material 197 (CRM 197 ) to improve their immunogenicity. CFP10 and TB10.4 were two Mtb-secreted immunodominant protein antigens. A CFP10-TB10.4 fusion protein (CT) was used as the antigen for covalent conjugation with the CRM 197 -inulin conjugate (CRM-inu). The resultant conjugate (CT-CRM-inu) elicited high CT-specific IgG titers, stimulated splenocyte proliferation and provoked the secretion of Th1-type and Th2-type cytokines. Conjugation with CRM-inu significantly prolonged the systemic circulation of CT and exposure to the immune system. Moreover, CT-CRM-inu showed no apparent toxicity to cardiac, hepatic and renal functions. Thus, conjugation of CT with CRM-inu provided an effective strategy for development of protein-based vaccines against Mtb infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. A pivotal registration phase III, multicenter, randomized tuberculosis controlled trial: design issues and lessons learnt from the Gatifloxacin for TB (OFLOTUB project

    Directory of Open Access Journals (Sweden)

    Merle Corinne SC

    2012-05-01

    Full Text Available Abstract Background There have been no major advances in tuberculosis (TB drug development since the first East African/British Medical Research Council short course chemotherapy trial 35 years ago. Since then, the landscape for conducting TB clinical trials has profoundly changed with the emergence of HIV infection, the spread of resistant TB bacilli strains, recent advances in mycobacteriological capacity, and drug discovery. As a consequence questions have arisen on the most appropriate approach to design and conduct current TB trials. To highlight key issues discussed: Is a superiority, equivalence, or non-inferiority design most appropriate? What should be the primary efficacy outcome? How to consider re-infections in the definition of the outcome? What is the optimal length of patient follow-up? Is blinding appropriate when treatment duration in test arm is shorter? What are the appropriate assumptions for sample size calculation? Methods Various drugs are currently in the development pipeline. We are presenting in this paper the design of the most recently completed phase III TB trial, the OFLOTUB project, which is the pivotal trial of a registration portfolio for a gatifloxacin-containing TB regimen. It is a randomized, open-label, multicenter, controlled trial aiming to evaluate the efficacy and safety of a gatifloxacin-containing 4-month regimen (trial registration: ClinicalTrial.gov database: NCT00216385. Results In the light of the recent scientific and regulatory discussions, we discuss some of the design issues in TB clinical trials and more specifically the reasons that guided our choices, in order to best answer the trial objectives, while at the same time satisfying regulatory authority requirements. Conclusion When shortening TB treatment, we are advocating for a non-inferiority, non-blinded design, with a composite unfavorable endpoint assessed 12 months post treatment completion, and added trial procedures specifically

  17. Toward a Generation Free of Tuberculosis: TB Disease and Infection in Individuals of College Age in the United States

    Science.gov (United States)

    Shah, N. S.; Flood-Bryzman, A.; Jeffries, C.; Scott, J.

    2018-01-01

    Objectives: To assess the magnitude of active TB disease and latent TB infection (LTBI) in young adults of college age. Participants: Individuals who were aged 18-24 years in 2011 were used as a proxy for college students. Methods: Active TB cases reported to the 2011 US National TB Surveillance System (NTSS) were included. LTBI prevalence was…

  18. Review: New Vaccine Against Tuberculosis: Current Developments and Future Challenges

    Science.gov (United States)

    Liu, Jun

    2009-04-01

    Tuberculosis (TB) continues to be a global health threat. BCG was developed as an attenuated live vaccine for tuberculosis control nearly a century ago. Despite being the most widely used vaccine in human history, BCG is not an ideal vaccine and has two major limitations: its poor efficacy against adult pulmonary TB and its disconcerting safety in immunocompromised individuals. A safer and more effective TB vaccine is urgently needed. This review article discusses current strategies to develop the next generation of TB vaccines to replace BCG. While some progresses have been made in the past decade, significant challenges lie ahead.

  19. [Tuberculosis and malaria global prophylaxis in the light of decisions of the Big Eight].

    Science.gov (United States)

    Onishchenko, G G

    2008-01-01

    At the present time about two million people, one third of the Earth's population, are carriers of tuberculosis agent. Though tuberculosis is curable disease, it continues to take away lives of about 4400 persons; most of them are young and are in the most productive age. The most active incidence rate of tuberculosis occurs in the countries of Africa to the south of Sahara (29% of all cases of tuberculosis per head); half of new cases of tuberculosis fall on Asian countries: Bangladesh, China, India, Indonesia, Pakistan, Philippines. The governments of Big Eight maintain activities that have stabilized morbidity of tuberculosis on a world scale. Over 11 years (1995 - 2006) World Health Organization (WHO) implemented the DOTS strategy (Directly Observed Treatment with Short course of chemotherapy) in 183 countries and tested it on 26 millions patients with tuberculosis. Global data acquisition in 2005 found out morbidity of tuberculosis in 59% (the aim is 70%) and successful cure in 84% cases (the aim is 85 %). In 2006 WHO started realization of the Global Plan "Stop tuberculosis" (2006 - 2012). At the present time Global Fund use about 17% its resources to finance programs against tuberculosis. These funds help to reveal 5 millions extra cases of tuberculosis and cure 3 millions patients in the network of DOTS.

  20. Funding for tuberculosis research—an urgent crisis of political will, human rights, and global solidarity

    Directory of Open Access Journals (Sweden)

    Mike Frick

    2017-03-01

    Full Text Available Tuberculosis (TB killed more people in 2015 than any other single infectious agent, but funding for research to develop better prevention, diagnosis, and treatment methods for TB declined to its lowest level in 7 years. TB research and development (R&D is woefully underfunded, a situation best viewed as a crisis of political will and a failure on the part of governments to see unmet innovation needs in the TB response as a human rights issue requiring immediate action. Over 60% of available money for TB R&D comes from public sources, and 67% of public money comes from a single country: the USA. The election of Donald Trump to the US presidency in November 2016 has introduced great uncertainty into the support that science generally, and TB research in particular, will receive in the coming years. Advocacy on the part of all actors—from civil society to TB-affected communities to scientists themselves—is urgently needed to increase US government support for TB research moving forward.

  1. Funding for tuberculosis research-an urgent crisis of political will, human rights, and global solidarity.

    Science.gov (United States)

    Frick, Mike

    2017-03-01

    Tuberculosis (TB) killed more people in 2015 than any other single infectious agent, but funding for research to develop better prevention, diagnosis, and treatment methods for TB declined to its lowest level in 7 years. TB research and development (R&D) is woefully underfunded, a situation best viewed as a crisis of political will and a failure on the part of governments to see unmet innovation needs in the TB response as a human rights issue requiring immediate action. Over 60% of available money for TB R&D comes from public sources, and 67% of public money comes from a single country: the USA. The election of Donald Trump to the US presidency in November 2016 has introduced great uncertainty into the support that science generally, and TB research in particular, will receive in the coming years. Advocacy on the part of all actors-from civil society to TB-affected communities to scientists themselves-is urgently needed to increase US government support for TB research moving forward. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  2. A diagnostic pitfall: pancreatic tuberculosis, not pancreatic cancer

    International Nuclear Information System (INIS)

    Samuel, D.O.; Mukhtar, A.A.M.; Philip, I.O.

    2013-01-01

    Abdominal tuberculosis (TB) is one of the most common forms of extra-pulmonary tuberculosis and is responsible for considerable morbidity and mortality globally. Tuberculosis can involve any part of the gastrointestinal tract from mouth to anus, the peritoneum, liver, spleen and the pancreatobiliary system. The occurrence of abdominal TB is independent of pulmonary disease in most patients, with a reported incidence of co-existing pulmonary disease varying from 6 to 38% worldwide. We report a case of pancreatic tuberculosis also involving the vertebrae, which was initially treated as a case of pancreatic cancer. (author)

  3. Tuberculosis

    International Nuclear Information System (INIS)

    Aleksandrova, A.V.

    1983-01-01

    Classification of clinical forms of tuberculosis of respiratory organs is m ade. It is shown, that diagnosis, determination of the clinical form of pulmona ry tuberculosis, extent and phase of the process are mainly based on the data of roentgenologic studies and in certain cases tomography is preferable. Roentgenologic picture of primary tuberculosis, tuberculosis of intrathoracis l ymp nodes, dissemenated tuberculosis, focal and infiltrative tuberculosis of lungs, tuberculomas of lungs, cavernous and fibrocavernous form of pulmonary tub erculosis, cirrhotic tuberculosis of lungs, tuberculosis of upper respiratory tracks, tuberculous pleurite and tuberculosis of respiratory organs, combined wi th dust occupational diseases, has been described

  4. Listening to Those at the Frontline: Patient and Healthcare Personnel Perspectives on Tuberculosis Treatment Barriers and Facilitators in High TB Burden Regions of Argentina

    Directory of Open Access Journals (Sweden)

    Sarah J. Iribarren

    2014-01-01

    Full Text Available Purpose. In Argentina, tuberculosis (TB control measures have not achieved key treatment targets. The purpose of this study was to identify modes of treatment delivery and explore patient and healthcare personnel perceptions of barriers and facilitators to treatment success. Methods. We used semistructured group and individual interviews for this descriptive qualitative study. Eight high burden municipalities were purposively selected. Patients in treatment for active TB (n=16, multidisciplinary TB team members (n=26, and TB program directors (n=12 at local, municipal, regional, and national levels were interviewed. Interviews were recorded, transcribed verbatim, and analyzed using thematic analysis. Results. Modes of treatment delivery varied across municipalities and types of healthcare facility and were highly negotiated with patients. Self-administration of treatment was common in hospital-based and some community clinics. Barriers to TB treatment success were concentrated at the system level. This level relied heavily on individual personal commitment, and many system facilitators were operating in isolation or in limited settings. Conclusions. We outline experiences and perspectives of the facilitating and challenging factors at the individual, structural, social, and organizational levels. Establishing strong patient-healthcare personnel relationships, responding to patient needs, capitalizing on community resources, and maximizing established decentralized system could mitigate some of the barriers.

  5. Achievements and challenges of the World Bank Loan/Department for International Development grant-assisted Tuberculosis Control Project in China.

    Science.gov (United States)

    Kong, Peng; Jiang, Xu; Zhang, Ben; Jiang, Shi-wen; Liu, Bo

    2011-07-01

    In March 2002, the government of China launched the World Bank Loan/ Department for International Development-supported Tuberculosis (TB) Control Project to reduce the prevalence and mortality of TB. The project generated promising results in policy development, strengthening of TB control systems, patient treatment success, funds management, and the introduction of legislation. In light of the global TB epidemic and control environment, it is useful to review the TB control priorities of the project, summarize the achievements and experiences around its implementation.

  6. A field evaluation of the Hardy TB MODS Kit™ for the rapid phenotypic diagnosis of tuberculosis and multi-drug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Laura Martin

    Full Text Available Even though the WHO-endorsed, non-commercial MODS assay offers rapid, reliable TB liquid culture and phenotypic drug susceptibility testing (DST at lower cost than any other diagnostic, uptake has been patchy. In part this reflects misperceptions about in-house assay quality assurance, but user convenience of one-stop procurement is also important. A commercial MODS kit was developed by Hardy Diagnostics (Santa Maria, CA, USA with PATH (Seattle, WA, USA to facilitate procurement, simplify procedures through readymade media, and enhance safety with a sealing silicone plate lid. Here we report the results from a large-scale field evaluation of the MODS kit in a government service laboratory.2446 sputum samples were cultured in parallel in Lowenstein-Jensen (LJ, conventional MODS and in the MODS kit. MODS kit DST was compared with conventional MODS (direct DST and proportion method (indirect DST. 778 samples (31.8% were Mycobacterium tuberculosis culture-positive. Compared to conventional MODS the sensitivity, specificity, positive, and negative predictive values (95% confidence intervals of the MODS Kit were 99.3% (98.3-99.8%, 98.3% (97.5-98.8%, 95.8% (94.0-97.1%, and 99.7% (99.3-99.9%. Median (interquartile ranges time to culture-positivity (and rifampicin and isoniazid DST was 10 (9-13 days for conventional MODS and 8.5 (7-11 for MODS Kit (p<0.01. Direct rifampicin and isoniazid DST in MODS kit was almost universally concordant with conventional MODS (97.9% agreement, 665/679 evaluable samples and reference indirect DST (97.9% agreement, 687/702 evaluable samples.MODS kit delivers performance indistinguishable from conventional MODS and offers a convenient, affordable alternative with enhanced safety from the sealing silicone lid. The availability in the marketplace of this platform, which conforms to European standards (CE-marked, readily repurposed for second-line DST in the near future, provides a fresh opportunity for improving equity of

  7. Cost of Care Among Patients With Pulmonary Tuberculosis in Lagos ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is a global health challenge. Currently it is the 7th leading cause of death worldwide, and Nigeria ranks fourth amongst 22 high-burden countries for the disease. This study sought to appraise the direct and indirect costs borne by TB patients attending the Chest Clinics at the Lagos State University ...

  8. Tuberculosis Treatment

    African Journals Online (AJOL)

    Tuberculosis Treatment, Lusaka, Zambia. 1. 2. 2. 3. 3 ... TB treatment has contributed to the steady rise of TB incidence in ... respondents (89.4%) had positive attitude towards TB treatment ..... respondents described feelings of depression, anger and apathy .... Journal of Personality and Social Psychology,. 1979, 37:1-11.

  9. Radiological and clinical pattern of pulmonary Tuberculosis in selected TB clinics in Khartoum

    Energy Technology Data Exchange (ETDEWEB)

    Dongola, Nagwa Ali Mohammad [Faculty of Medicine, University of Khartoum, Khartoum (Sudan)

    1998-12-31

    160 adult tuberculous patients were selected randomly from Al shaab and Abu Anja hospital, to (1) study the clino-radiological pattern of the disease, (2) to determine the percentage of radiologically-positive patients and (3) to study the frequency of the initial presenting symptoms and to correlate them with their x-ray findings. A flow-sheet was filled and proper clinical examination was conducted for each patient. Tuberclin test, 3 sputa examinations, ESR and chest x-ray were done for every patient. Three quarters of the patients were males in the young age group and most of the patients were of low socioeconomic status. The main presenting symptoms were productive cough, chest pain, dysnoea, fever, weight loss and malaise. Patients presented rather late, with a mean period of four months. 57 % of patients were sputum positive, 80% Tuberclin-positive and 98% had a high erythrocyte sedimentation rate (ESR). 15% of patients had radiological features of primary diseases of which hilar lymph-adenopathy was the commonest, while consolidation was the commonest parenchymal lesion. In post-primary disease fibrocavitory type was the commonest and together with exudative lesions constituted 98% of parenchymal lesions. 90% of patients had typical upper or middle zone infiltrates and 10% had lower lung field tuberculosis. 14% of patients had pleural effusion. 60% of patients had moderate disease extent in the chest, 30% far-advanced and 10% minimal lesions in their chest x-ray.(Author) 134 ref. , 17 tabs. , 23 fig.

  10. Radiological and clinical pattern of pulmonary Tuberculosis in selected TB clinics in Khartoum

    International Nuclear Information System (INIS)

    Dongola, Nagwa Ali Mohammad

    1997-01-01

    160 adult tuberculous patients were selected randomly from Al shaab and Abu Anja hospital, to (1) study the clino-radiological pattern of the disease, (2) to determine the percentage of radiologically-positive patients and (3) to study the frequency of the initial presenting symptoms and to correlate them with their x-ray findings. A flow-sheet was filled and proper clinical examination was conducted for each patient. Tuberclin test, 3 sputa examinations, ESR and chest x-ray were done for every patient. Three quarters of the patients were males in the young age group and most of the patients were of low socioeconomic status. The main presenting symptoms were productive cough, chest pain, dysnoea, fever, weight loss and malaise. Patients presented rather late, with a mean period of four months. 57 % of patients were sputum positive, 80% Tuberclin-positive and 98% had a high erythrocyte sedimentation rate (ESR). 15% of patients had radiological features of primary diseases of which hilar lymph-adenopathy was the commonest, while consolidation was the commonest parenchymal lesion. In post-primary disease fibrocavitory type was the commonest and together with exudative lesions constituted 98% of parenchymal lesions. 90% of patients had typical upper or middle zone infiltrates and 10% had lower lung field tuberculosis. 14% of patients had pleural effusion. 60% of patients had moderate disease extent in the chest, 30% far-advanced and 10% minimal lesions in their chest x-ray.(Author)

  11. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Directory of Open Access Journals (Sweden)

    Ephrem Mekonnen

    Full Text Available The human FMO2 (flavin-containing monooxygenase 2 gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB, via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2 that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1. This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292 from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A, p = 3.15E-07, OR = 4.644 and chr1:171165749(T, p = 3.32E-06, OR = 6.825] while multiple SNPs (22 showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB

  12. Congenital tuberculosis

    African Journals Online (AJOL)

    Prof Ezechukwu

    2012-06-20

    Jun 20, 2012 ... Key words: Congenital tuberculo- sis, case report, miliary tuberculosis. Introduction. Congenital tuberculosis defines tuberculosis in infants of .... tary TB and otitis media, resulting in seizures, deafness, and death. It is therefore not surprising that the index case who presented at twelve weeks of age, had ...

  13. Bovine tuberculosis

    Science.gov (United States)

    Tuberculosis (TB) in animals and humans may result from exposure to bacilli within the Mycobacterium tuberculosis complex (i.e., M. tuberculosis, M. bovis, M. africanum, M. pinnipedii, M. microti, M. caprae, or M. canetti) . Mycobacterium bovis is the species most often isolated from tuberculous cat...

  14. Implementing the global plan to stop TB, 2011-2015--optimizing allocations and the Global Fund's contribution: a scenario projections study.

    Directory of Open Access Journals (Sweden)

    Eline L Korenromp

    Full Text Available BACKGROUND: The Global Plan to Stop TB estimates funding required in low- and middle-income countries to achieve TB control targets set by the Stop TB Partnership within the context of the Millennium Development Goals. We estimate the contribution and impact of Global Fund investments under various scenarios of allocations across interventions and regions. METHODOLOGY/PRINCIPAL FINDINGS: Using Global Plan assumptions on expected cases and mortality, we estimate treatment costs and mortality impact for diagnosis and treatment for drug-sensitive and multidrug-resistant TB (MDR-TB, including antiretroviral treatment (ART during DOTS for HIV-co-infected patients, for four country groups, overall and for the Global Fund investments. In 2015, China and India account for 24% of funding need, Eastern Europe and Central Asia (EECA for 33%, sub-Saharan Africa (SSA for 20%, and other low- and middle-income countries for 24%. Scale-up of MDR-TB treatment, especially in EECA, drives an increasing global TB funding need--an essential investment to contain the mortality burden associated with MDR-TB and future disease costs. Funding needs rise fastest in SSA, reflecting increasing coverage need of improved TB/HIV management, which saves most lives per dollar spent in the short term. The Global Fund is expected to finance 8-12% of Global Plan implementation costs annually. Lives saved through Global Fund TB support within the available funding envelope could increase 37% if allocations shifted from current regional demand patterns to a prioritized scale-up of improved TB/HIV treatment and secondly DOTS, both mainly in Africa--with EECA region, which has disproportionately high per-patient costs, funded from alternative resources. CONCLUSIONS/SIGNIFICANCE: These findings, alongside country funding gaps, domestic funding and implementation capacity and equity considerations, should inform strategies and policies for international donors, national governments and

  15. RESEARCH ON NATURAL REMEDIES OF TUBERCULOSIS AND IDENITIFY NEW SYMPTOMS, TREATMENT REGIMENS, DIAGNOSTIC EVALUATION

    OpenAIRE

    MYLE AKSHAY KIRAN; Dr. Gangadhar Rao; Dr. Ashok Kumar

    2016-01-01

    Tuberculosis is caused by the Mycobacterium tuberculosis is an infection deadly disease and the treatment of which is one of the most important severe challenges at the global level currently more than a 20 chemicals medications are described for the treatment of tuberculosis. Regardless of availability of several drugs to treat TB. The cause agent Mycobacterium tuberculosis is now a days getting resistant towards the convenient drugs and leading to condition known as the multi drugs resistan...

  16. [CLINICAL UTILITY OF T-SPOT.TB ASSAY WITH T-Cell Xtend REAGENT FOR ACTIVE TUBERCULOSIS DIAGNOSIS IN THE FIELD TEST AT OUR HOSPITAL].

    Science.gov (United States)

    Nemoto, Kenji; Oh-ishi, Shuji; Taguchi, Masato; Hyodo, Kentaro; Kanazawa, Jun; Miura, Yukiko; Takaku, Takio; Usui, Shingo; Hayashihara, Kenji; Saito, Takefumi

    2016-04-01

    T-SPOT.TB (T-SPOT), an interferon-gamma release assay, has shown promise as a diagnostic tool for active tuberculosis (TB), and its use is expanding. Addition of the T-Cell Xtend (TCX) reagent may allow delayed processing, and this characteristic is important for using this test in the field. However, limited data is available on the usefulness of T-SPOT with TCX as a field test for diagnosing active TB. To investigate the clinical utility of T-SPOT with TCX and the risk factors for a false-negative result in patients with active TB. A total of 57 patients with active TB who underwent the T-SPOT test with TCX prior to treatment were enrolled between May 2013 and May 2015. One patient with an indeterminate result for T-SPOT was excluded; therefore, the data of 56 patients were eventually included in the final analysis. The basic characteristics and clinical findings were compared between the true-positive and false-negative T-SPOT groups. Of the 56 patients, 40 (71.4%), 13 (23.2%), 3 (5.4%) had true-positive, false-negative, and borderline T-SPOT results, respectively. This study did not reveal any significant risk factors for a false-negative T-SPOT result. In this clinical study, the proportion of patients with a false-negative result for T-SPOT with TCX for active TB was higher than that reported previously. Therefore, careful interpretation of a negative result for T-SPOT with TCX is necessary, regardless of the patient's background.

  17. Animal Models for Tuberculosis in Translational and Precision Medicine

    Directory of Open Access Journals (Sweden)

    Lingjun Zhan

    2017-05-01

    Full Text Available Tuberculosis (TB is a health threat to the global population. Anti-TB drugs and vaccines are key approaches for TB prevention and control. TB animal models are basic tools for developing biomarkers of diagnosis, drugs for therapy, vaccines for prevention and researching pathogenic mechanisms for identification of targets; thus, they serve as the cornerstone of comparative medicine, translational medicine, and precision medicine. In this review, we discuss the current use of TB animal models and their problems, as well as offering perspectives on the future of these models.

  18. THE ANTI-TB DRUG SENSITIVITY OF MYCOBACTERIUM TUBERCULOSIS FROM CEREBROSPINAL FLUID AND BONE TISSUE BIOPSY SPECIMENS OF PATIENTS SUSPECTED TUBERCULOUS MENINGITIS AND SPINAL TB IN DR SOETOMO HOSPITAL INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Made Mertaniasih

    2014-09-01

    Full Text Available Tuberculous meningitis (TBM is an infection of meningens which potentially life threatening with significant morbidity and mortality. Spinal TB has the same problem with TBM, infection in bone and joint, the delayed diagnosis worsens the prognosis. The rapid and accurate diagnosis plus promt adequate treatment is essential for the good outcome. The aim of this research is to study the first line drug sensitivity of Mycobacterium tuberculosis isolated from specimens of cerebrospinal fluid from suspected tuberculous meningitis patients and bone tissue biopsy from suspected spinal TB patients. The method of this research is TB Laboratory examination in Department of Clinical Microbiology – Dr. Soetomo General Hospital, Indonesia, using the gold standard liquid culture method MGIT 960 System (Becton Dickinson and solid culture method with Lowenstein-Jensen medium. The specimens CSF from 50 TBM patients at January 2013 until May 2014. Positive isolate detection of Mycobacterium tuberculosis complex were 11 isolates (22%, which sensitivity 100% (11/11 isolates to Rifampin (R, Pyrazinamide (Z, Ethambutol (E, and Streptomycin (S; one isolate resistant to Isoniazid, sensitivity to Isoniazid 90,90% (10/11; and received 21 specimens of bone tissue biopsy which positive 5 isolates (23%, all isolates sensitive 100% (5/5 isolates to Rifampin and Pyrazinamide, and 1 isolates resistant to Isoniazid, Ethambutol, and Streptomycin, in which sensitivity 80% (4/5 isolates to Isoniazid, Ethambutol, and Streptomycin. The conclusion of this research is positivity detection 22% of CSF specimens, and 23% of bone tissue biopsy were low. All isolates sensitive 100% to Rifampin and Pyrazinamide, and 80-90% sensitive to Isoniazid.

  19. Safety and efficacy of the C-Tb skin test to diagnose Mycobacterium tuberculosis infection, compared with an interferon γ release assay and the tuberculin skin test: a phase 3, double-blind, randomised, controlled trial.

    Science.gov (United States)

    Ruhwald, Morten; Aggerbeck, Henrik; Gallardo, Rafael Vázquez; Hoff, Søren T; Villate, José I; Borregaard, Bettine; Martinez, José A; Kromann, Ingrid; Penas, Antón; Anibarro, Luis L; de Souza-Galvão, Maria Luiza; Sánchez, Francisca; Rodrigo-Pendás, Jose Ángel; Noguera-Julian, Antoni; Martínez-Lacasa, Xavier; Tuñez, Maria Victoria; Fernández, Virginia Leiro; Millet, Joan P; Moreno, Antonio; Cobos, Nazaret; Miró, José M; Roldan, Llanos; Orcau, Angels; Andersen, Peter; Caylá, Joan A

    2017-04-01

    Targeted screening and treatment of Mycobacterium tuberculosis infection substantially reduces the risk of developing active tuberculosis. C-Tb (Statens Serum Institute, Copenhagen, Denmark) is a novel specific skin test based on ESAT-6 and CFP10 antigens. We investigated the safety and diagnostic potential of C-Tb compared with established tests in the contact-tracing setting. Negative controls, close contacts, occasional contacts, and patients with active pulmonary tuberculosis were enrolled at 13 centres in Spain. We compared C-Tb with the QuantiFERON-TB Gold In-Tube ([QFT] Qiagen, Hilden, Germany) interferon γ release assay (IGRA) and the purified protein derivative (PPD) RT 23 tuberculin skin test ([TST] Statens Serum Institute). All participants older than 5 years were tested with QFT. Some participants in the negative control group received C-Tb without the TST to test for potential interactions between C-Tb and PPD RT 23. The rest were randomly assigned in blocks of ten and tested with both C-Tb and TST, with five in each block receiving injection of C-Tb in the right arm and the TST in the left arm and five vice versa. The primary and safety analyses were done in all participants randomly assigned to a group who received any test. This trial is registered with ClinicalTrials.gov, number NCT01631266, and with EudraCT, number 2011-005617-36. From July 24, 2012, to Oct 2, 2014, 979 participants were enrolled, of whom 263 were negative controls, 299 were occasional contacts, 316 were close contacts, and 101 were patients with tuberculosis. 970 (99%) participants completed the trial. Induration sizes were similar for C-Tb and TST, but TST positivity was affected by BCG vaccination status. We found a strong positive trend towards C-Tb test positivity with increasing risk of infection, from 3% in negative controls to 16% in occasional contacts, to 43% in close contacts. C-Tb and QFT results were concordant in 785 (94%) of 834 participants aged 5 years and older

  20. Socio-demographic and AIDS-related factors associated with tuberculosis stigma in southern Thailand: a quantitative, cross-sectional study of stigma among patients with TB and healthy community members

    Directory of Open Access Journals (Sweden)

    Strauss Ronald P

    2011-08-01

    Full Text Available Abstract Background Tuberculosis (TB remains one of the most important infectious diseases worldwide. A comprehensive approach towards disease control that addresses social factors including stigma is now advocated. Patients with TB report fears of isolation and rejection that may lead to delays in seeking care and could affect treatment adherence. Qualitative studies have identified socio-demographic, TB knowledge, and clinical determinants of TB stigma, but only one prior study has quantified these associations using formally developed and validated stigma scales. The purpose of this study was to measure TB stigma and identify factors associated with TB stigma among patients and healthy community members. Methods A cross-sectional study was performed in southern Thailand among two different groups of participants: 480 patients with TB and 300 healthy community members. Data were collected on socio-demographic characteristics, TB knowledge, and clinical factors. Scales measuring perceived TB stigma, experienced/felt TB stigma, and perceived AIDS stigma were administered to patients with TB. Community members responded to a community TB stigma and community AIDS stigma scale, which contained the same items as the perceived stigma scales given to patients. Stigma scores could range from zero to 30, 33, or 36 depending on the scale. Three separate multivariable linear regressions were performed among patients with TB (perceived and experience/felt stigma and community members (community stigma to determine which factors were associated with higher mean TB stigma scores. Results Only low level of education, belief that TB increases the chance of getting AIDS, and AIDS stigma were associated with higher TB stigma scores in all three analyses. Co-infection with HIV was associated with higher TB stigma among patients. All differences in mean stigma scores between index and referent levels of each factor were less than two points, except for

  1. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  2. QuantiFERON-TB Gold In-Tube as a Confirmatory Test for Tuberculin Skin Test in Tuberculosis Contact Tracing: A Noninferiority Clinical Trial.

    Science.gov (United States)

    Muñoz, Laura; Santin, Miguel; Alcaide, Fernando; Ruíz-Serrano, Maria Jesús; Gijón, Paloma; Bermúdez, Elena; Domínguez-Castellano, Angel; Navarro, María Dolores; Ramírez, Encarnación; Pérez-Escolano, Elvira; López-Prieto, María Dolores; Gutiérrez-Rodriguez, José; Anibarro, Luis; Calviño, Laura; Trigo, Matilde; Cifuentes, Carmen; García-Gasalla, Mercedes; Payeras, Antoni; Gasch, Oriol; Espasa, Mateu; Agüero, Ramon; Ferrer, Diego; Casas, Xavier; González-Cuevas, Araceli; García-Zamalloa, Alberto; Bikuña, Edurne; Lecuona, María; Galindo, Rosa; Ramírez-Lapausa, Marta; Carrillo, Raquel

    2018-01-18

    Screening strategies based on interferon-γ release assays in tuberculosis contact tracing may reduce the need for preventive therapy without increasing subsequent active disease. We conducted an open-label, randomized trial to test the noninferiority of a 2-step strategy with the tuberculin skin test (TST) followed by QuantiFERON-TB Gold In-Tube (QFT-GIT) as a confirmatory test (the TST/QFT arm) to the standard TST-alone strategy (TST arm) for targeting preventive therapy in household contacts of patients with tuberculosis. Participants were followed for 24 months after randomization. The primary endpoint was the development of tuberculosis, with a noninferiority margin of 1.5 percentage points. A total of 871 contacts were randomized. Four contacts in the TST arm and 2 in the TST/QFT arm developed tuberculosis. In the modified intention-to-treat analysis, this accounted for 0.99% in the TST arm and 0.51% in the TST/QFT arm (-0.48% difference; 97.5% confidence interval [CI], -1.86% to 0.90%); in the per-protocol analysis, the corresponding rates were 1.67% and 0.82% in the TST and TST/QFT arms, respectively (-0.85% difference; 97.5% CI, -3.14% to 1.43%). Of the 792 contacts analyzed, 65.3% in the TST arm and 42.2% in the TST/QFT arm were diagnosed with tuberculosis infection (23.1% difference; 95% CI, 16.4% to 30.0%). In low-incidence settings, screening household contacts with the TST and using QFT-GIT as a confirmatory test is not inferior to TST-alone for preventing active tuberculosis, allowing a safe reduction of preventive treatments. NCT01223534. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  3. Factors that influence current tuberculosis epidemiology.

    Science.gov (United States)

    Millet, Juan-Pablo; Moreno, Antonio; Fina, Laia; del Baño, Lucía; Orcau, Angels; de Olalla, Patricia García; Caylà, Joan A

    2013-06-01

    According to WHO estimates, in 2010 there were 8.8 million new cases of tuberculosis (TB) and 1.5 million deaths. TB has been classically associated with poverty, overcrowding and malnutrition. Low income countries and deprived areas, within big cities in developed countries, present the highest TB incidences and TB mortality rates. These are the settings where immigration, important social inequalities, HIV infection and drug or alcohol abuse may coexist, all factors strongly associated with TB. In spite of the political, economical, research and community efforts, TB remains a major global health problem worldwide. Moreover, in this new century, new challenges such as multidrug-resistance extension, migration to big cities and the new treatments with anti-tumour necrosis alpha factor for inflammatory diseases have emerged and threaten the decreasing trend in the global number of TB cases in the last years. We must also be aware about the impact that smoking and diabetes pandemics may be having on the incidence of TB. The existence of a good TB Prevention and Control Program is essential to fight against TB. The coordination among clinicians, microbiologists, epidemiologists and others, and the link between surveillance, control and research should always be a priority for a TB Program. Each city and country should define their needs according to the epidemiological situation. Local TB control programs will have to adapt to any new challenge that arises in order to respond to the needs of their population.

  4. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health chal- lenge, with an estimated 1.4 .... completed treatment and who is smear negative at the end of 6th or 7th month of treat- ..... the course of management of the dual disease entity. Conclusion. This study ...

  5. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health challenge, with an estimated 1.4 million patients worldwide. Co-infection with HIV leads to challenges in the diagnosis and treatment of patients. Objectives: The aim of this study was to assess treatment ...

  6. Hysterosalpingographic Appearances of Female Genital Tract Tuberculosis: Part II: Uterus

    OpenAIRE

    Ahmadi, Firoozeh; Zafarani, Fatemeh; Shahrzad, Gholam Shahrzad

    2014-01-01

    Female genital tuberculosis remains as a major cause of tubal obstruction leading to infertility, especially in developing countries. The global prevalence of genital tuberculosis has increased during the past two decades due to increasing acquired immunodeficiency syndrome. Genital tuberculosis (TB) is commonly asymptomatic and it is diagnosed during infertility investigations. Despite of recent advances in imaging tools such as computed tomography (CT) scan, magnetic resonanc...

  7. The effect of HIV coinfection, HAART and TB treatment on cytokine/chemokine responses to Mycobacterium tuberculosis (Mtb) antigens in active TB patients and latently Mtb infected individuals

    NARCIS (Netherlands)

    Kassa, Desta; de Jager, Wilco; Gebremichael, Gebremedhin; Alemayehu, Yodit; Ran, Leonie; Fransen, Justin; Wolday, Dawit; Messele, Tsehaynesh; Tegbaru, Belete; Ottenhoff, Tom H M; van Baarle, Debbie

    2016-01-01

    Identification of Mtb specific induced cytokine/chemokine host biomarkers could assist in developing novel diagnostic, prognostic and therapeutic tools for TB. Levels of IFN-γ, IL-2, IL-17, IL-10, IP-10 and MIP-1α were measured in supernatants of whole blood stimulated with Mtb specific fusion

  8. Prejudice and misconceptions about tuberculosis and HIV in rural and urban communities in Ethiopia: a challenge for the TB/HIV control program

    Science.gov (United States)

    2010-01-01

    Background In Ethiopia, where HIV and tuberculosis (TB) are very common, little is known about the prejudice and misconceptions of rural communities towards People living with HIV/AIDS (PLHA) and TB. Methods We conducted a cross sectional study in Gilgel Gibe Field Research area (GGFRA) in southwest Ethiopia to assess the prejudice and misconceptions of rural and urban communities towards PLHA and TB. The study population consisted of 862 randomly selected adults in GGFRA. Data were collected by trained personnel using a pretested structured questionnaire. To triangulate the findings, 8 focus group discussions among women and men were done. Results Of the 862 selected study participants, 750(87%) accepted to be interviewed. The mean age of the respondents was 31.2 (SD ± 11.0). Of the total interviewed individuals, 58% of them were females. More than half of the respondents did not know the possibility of transmission of HIV from a mother to a child or by breast feeding. For fear of contagion of HIV, most people do not want to eat, drink, and share utensils or clothes with a person living with HIV/AIDS. A higher proportion of females [OR = 1.5, (95% CI: 1.0, 2.2)], non-literate individuals [OR = 2.3, (95%CI: 1.4, 3.6)], rural residents [OR = 3.8, (95%CI: 2.2, 6.6)], and individuals who had poor knowledge of HIV/AIDS [OR = 2.8, (95%CI: 1.8, 2.2)] were more likely to have high prejudice towards PLHA than respectively males, literates, urban residents and individuals with good knowledge. Exposure to cold air was implicated as a major cause of TB. Literates had a much better knowledge about the cause and methods of transmission and prevention of TB than non-literates. More than half of the individuals (56%) had high prejudice towards a patient with TB. A larger proportion of females [OR = 1.3, (95% CI: 1.0, 1.9)] and non-literate individuals [OR = 1.4, (95% CI: 1.1, 2.0)] had high prejudice towards patients with TB than males and literate individuals. Conclusion TB

  9. Tobacco use prevalence, knowledge, and attitudes among newly diagnosed tuberculosis patients in Penang State and Wilayah Persekutuan Kuala Lumpur, Malaysia

    OpenAIRE

    Awaisu, Ahmed; Nik Mohamed, Mohamad Haniki; Abd Aziz, Noorizan; Syed Sulaiman, Syed Azhar; Mohamad Noordin, Noorliza; Muttalif, Abdul Razak; Ahmad Mahayiddin, Aziah

    2010-01-01

    Abstract Background There is sufficient evidence to conclude that tobacco smoking is strongly linked to tuberculosis (TB) and a large proportion of TB patients may be active smokers. In addition, a previous analysis has suggested that a considerable proportion of the global burden of TB may be attributable to smoking. However, there is paucity of information on the prevalence of tobacco smoking among TB patients in Malaysia. Moreover, the tobacco-related knowledge, attitudes, and behaviors of...

  10. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras

    Science.gov (United States)

    2013-01-01

    Background A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Methods Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). Results M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. Conclusions The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras. PMID:23497342

  11. Diagnostic Challenges of Female Genital Tuberculosis

    Directory of Open Access Journals (Sweden)

    Chaudhary Vigi

    2017-02-01

    Full Text Available Background: India accounts for one fifth of the global incidence of tuberculosis (TB annually. Genital tract TB is one of the extra pulmonary presentations of TB leading to infertility among Indian women. Genital TB is a chronic disease and often asymptomatic with very few specific complaints. Infertility is the most common clinical presentation of genital TB. Herein, we report a case of 32-year-old female patient suffering from abdominal pain and infertility for the last 8 months. Methods: Hysterosalpingography (HSG and ultrasonography (USG did not reveal characteristic radiological appearances of TB although USG detected the presence of a large fibroid in the right uterine wall. Histology, microscopy for acid fast bacilli, liquid culture and nucleic acid amplification assay targeting 64kDa protein encoding gene, the IS6110 element of endometrium biopsy were negative for tubercle bacilli. Results: Since the diagnosis of genital TB is elusive, antitubercular treatment (ATT using isoniazid, pyrazinamide, rifampicin, and ethambutol was prescribed for two months followed by maintenance therapy with isoniazid and rifampicin for four months without any pregnancy outcome. Conclusion: However, the patient conceived spontaneously after surgical removal of fibroid. Relating infertility to female genital tuberculosis due to high prevalence of TB in the country and ignoring the presence of uterine fibroid might not have been the right decision taken by the gynaecologist. This suggests the urgent need for an accurate method intended for diagnosis of female genital tuberculosis.

  12. Comparative Tuberculosis (TB) Prevention Effectiveness in Children of Bacillus Calmette-Guérin (BCG) Vaccines from Different Sources, Kazakhstan

    Science.gov (United States)

    Favorov, Michael; Ali, Mohammad; Tursunbayeva, Aigul; Aitmagambetova, Indira; Kilgore, Paul; Ismailov, Shakhimurat; Chorba, Terence

    2012-01-01

    Background Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG) in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia) or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. Methods/Findings We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan), the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. Limitations Potential limitations included considerations that 1) the methodology used was retrospective, 2) multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3) most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4) small variations in reported population TB burden could have affected relative risk of exposure for cohorts. Conclusions/Significance All three BCG vaccines evaluated were protective against TB, and prevention effectiveness varied by

  13. Comparative tuberculosis (TB prevention effectiveness in children of Bacillus Calmette-Guérin (BCG vaccines from different sources, Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Michael Favorov

    Full Text Available BACKGROUND: Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. METHODS/FINDINGS: We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan, the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. LIMITATIONS: Potential limitations included considerations that 1 the methodology used was retrospective, 2 multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3 most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4 small variations in reported population TB burden could have affected relative risk of exposure for cohorts. CONCLUSIONS/SIGNIFICANCE: All three BCG vaccines evaluated were protective against TB, and prevention effectiveness

  14. Comparative tuberculosis (TB) prevention effectiveness in children of Bacillus Calmette-Guérin (BCG) vaccines from different sources, Kazakhstan.

    Science.gov (United States)

    Favorov, Michael; Ali, Mohammad; Tursunbayeva, Aigul; Aitmagambetova, Indira; Kilgore, Paul; Ismailov, Shakhimurat; Chorba, Terence

    2012-01-01

    Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG) in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia) or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan), the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. Potential limitations included considerations that 1) the methodology used was retrospective, 2) multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3) most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4) small variations in reported population TB burden could have affected relative risk of exposure for cohorts. All three BCG vaccines evaluated were protective against TB, and prevention effectiveness varied by manufacturer. When setting national immunization policy, consideration

  15. Tuberculosis

    OpenAIRE

    C. Robert Horsburgh, Jr

    2014-01-01

    This article reviews the published literature on tuberculosis from September 2012 to August 2013 and describes important advances in tuberculosis epidemiology, microbiology, pathology, clinical pharmacology, genetics, treatment and prevention.

  16. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana

    NARCIS (Netherlands)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-01-01

    OBJECTIVE/BACKGROUND: Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays

  17. Turning the tide against tuberculosis.

    Science.gov (United States)

    Padayatchi, Nesri; Naidu, Naressa; Friedland, Gerald; Naidoo, Kasavan; Conradie, Francesca; Naidoo, Kogieleum; O'Donnell, Max Roe

    2017-03-01

    Despite affecting men, women, and children for millennia, tuberculosis (TB) is the most neglected disease. In contrast, the global response to HIV has reached a defining moment. By uniting efforts, promptly integrating major scientific findings for both treatment and prevention, and scaling up services, the once inconceivable end to the HIV epidemic may no longer be an illusion. "The world has made defeating AIDS a top priority. This is a blessing. But TB remains ignored" - Nelson Mandela. While there is no doubt that revolutionary diagnostics and new and repurposed drugs have provided some hope in the fight against TB, it is evident that scientific advances on their own are inadequate to achieve the World Health Organization's ambitious goal to end TB by 2035. In this article, the consequences of a myopic and conventional biomedical approach to TB, which has ultimately permeated to the level of individual patient care, are highlighted. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Tuberculosis

    OpenAIRE

    Mochammad, Hatta

    2008-01-01

    This book chapter for medical students and researcher Tuberculosis is still one of the leading causes of death by infectious diseases with 2 million deaths per year and 9.2 million new cases of tuberculosis disease annually [1-3]. Besides, more than 2 milliard people are infected with latent tuberculosis infection (LTBI) [1-3]. Despite continuous effort in the prevention, monitoring and treatment of tuberculosis, the disease remains a major health problem in many countries [4-6...

  19. Factors associated with negative T-SPOT.TB results among smear-negative tuberculosis patients in China.

    Science.gov (United States)

    Kang, Wanli; Wu, Meiying; Yang, Kunyun; Ertai, A; Wu, Shucai; Geng, Shujun; Li, Zhihui; Li, Mingwu; Pang, Yu; Tang, Shenjie

    2018-03-09

    We compared the positive rates of T-SPOT.TB and bacterial culture in the smear-negative PTB, and analyzed the factors affecting the results of negative T-SPOT.TB and bacterial culture. Retrospective evaluation of data from smear-negative PTB patients who underwent T-SPOT.TB and bacterial culture were done. The agreement and concordance were analyzed between T-SPOT.TB and bacterial culture. Multivariable logistic regression analysis was used to explore the factors associated with positive results of T-SPOT.TB and bacterial culture in smear-negative PTB. 858 eligible smear-negative PTB patients were included in the study. The agreement rate was 25.6% (22.7~28.5%) between T-SPOT.TB and bacterial culture in smear- negative PTB patients. The positive rate of T-SPOT.TB was higher than that of bacterial culture in smear-negative PTB patients (p SPOT.TB and bacterial culture (p > 0.05). Using multivariable logistic regression analysis we found that older age ≥ 60 years (OR = 0.469, 95% CI: 0.287-0.768) and decreased albumin (OR = 0.614, 95% CI: 0.380-0.992) were associated with negative diagnostic results of T-SPOT.TB in smear-negative PTB patients. Female (OR = 0.654, 95% CI: 0.431-0.992) were associated with negative diagnostic results of bacteria culture in smear-negative PTB patients. Our results indicated that the older age and decreased albumin were independently associated with negative T-SPOT.TB responses.

  20. Accuracy of the QuantiFERON-TB Gold in Tube for diagnosing tuberculosis in a young pediatric population previously vaccinated with Bacille Calmette-Guerin

    Directory of Open Access Journals (Sweden)

    Marcelo Genofre Vallada

    2014-03-01

    Full Text Available Objective: To evaluate the accuracy of an interferongamma release assay (QuantiFERON-TB Gold in Tube for diagnosing Mycobacterium tuberculosis infection in a young pediatric population. Methods: 195 children previously vaccinated with BCG were evaluated, being 184 healthy individuals with no clinical or epidemiological evidence of mycobacterial infection, and 11 with Mycobacterium tuberculosis infection, according to clinical, radiological, and laboratory parameters. A blood sample was obtained from each child and processed according to the manufacturer's instructions. The assay performance was evaluated by a Receiver Operating Characteristic (ROC curve. Results: In the group of 184 non-infected children, 130 (70.6% were under the age of four years (mean age of 35 months. In this group, 177 children (96.2% had negative test results, six (3.2% had indeterminate results, and one (0.5% had a positive result. In the group of 11 infected children, the mean age was 58.5 months, and two of them (18% had negative results. The ROC curve had an area under the curve of 0.88 (95%CI 0.82-0.92; p<0.001, disclosing a predictive positive value of 81.8% for the test (95%CI 46.3-97.4. The assay sensitivity was 81.8% (95%CI 48.2-97.2 and the specificity was 98.8% (95%CI 96-99.8. Conclusions: In the present study, the QuantiFERON-TB Gold in Tube performance for diagnosing M. tuberculosis infection was appropriate in a young pediatric population.

  1. Tuberculosis

    International Nuclear Information System (INIS)

    Latorre Tortello, Pablo

    1998-01-01

    The tuberculosis is an infection bacterial chronicle of world distribution. Three organisms of the family of the mycobacterium, the m. tuberculosis, the m. bovis and m. africanum, phenotypic and genetically similar, produce it, but only the m. tuberculosis has importance; the others rarely produce illness in the human. By definition, the lung tuberculosis is the localization of the m. tuberculosis in the breathing tract, the most common and main form in the affection and the only able to contaminate to other people. The koch bacillus, transmits the illness directly person to person. The paper Includes topics like pathogenesis, natural history, epidemiology, diagnose, symptomatology and treatment

  2. Hysterosalpingographic Appearances of Female Genital Tract Tuberculosis: Part I. Fallopian Tube

    OpenAIRE

    Ahmadi, Firoozeh; Zafarani, Fatemeh; Shahrzad, Gholam

    2013-01-01

    Female genital tuberculosis (TB) remains as a major cause of tubal obstruction leading to infertility, especially in developing countries. The global prevalence of genital tuberculosis has increased during the past two decades due to increasing acquired immunodeficiency syndrome (AIDS). Genital TB is commonly asymptomatic, and it is diagnosed during infertility investigations. Despite of recent advances in imaging tools, such as computerized tomography (CT) scan, magnetic reson...

  3. A matched case-control study to identify risk determinants of tuberculosis in Bangladesh

    NARCIS (Netherlands)

    Sarker, M.; Homayra, F.; Latif, A.H.M.; Barua, M.; Saha, A.; Paul, S.; Akter, R.; Islam, S.; Islam, A.

    2017-01-01

    According to the estimates of 2015, the global incidence rate for tuberculosis (TB) is 142 per 100,000 population [1]. In Bangladesh, the prevalence rate of TB is 382 per 100,000 population and incidence rate is 225 per 100,000 population [1], [2]. Over the years researchers primarily focused on

  4. Drug-Resistant Tuberculosis: A Genetic Analysis Using Online Bioinformatics Tools

    Science.gov (United States)

    Taylor, Jessica M.; Davidson, Rebecca M.; Strong, Michael

    2014-01-01

    Tuberculosis (TB) continues to be a serious global health problem, resulting in >1.4 million deaths each year. Of increasing concern is the evolution of antibiotic resistant strains of the bacterium that causes TB. Using this real-world scenario, we created a 90-minute activity for high school or undergraduate students to use online…

  5. Evaluation of Active Case Finding (ACF of Tuberculosis in Slums Population in North of Iran

    Directory of Open Access Journals (Sweden)

    Reza Hoseinpoor

    2017-05-01

    Full Text Available Background At present of the limitation of the current case finding strategies and the global urgency to improve tuberculosis (TB case finding, a renewed interest in active case finding (ACF has risen. World Health Organization (WHO calls for research on TB screening among low-income countries because of the limitation of the passive case finding strategies. We aimed to evaluated Active Case Finding strategy for TB among the slums population in North of Iran (Gorgan city and comprise this procedure to Passive Case Finding. Materials and Methods We conducted a house-to-house survey from April 2016 to July 2016 by trained health volunteers for TB in ten urban slums of Gorgan. Individuals with TB symptoms were identified through targeted screening using a standardized questionnaire and investigated further for TB. Descriptive analyses were performed using Stata-12. Results During study period, of 22,741 individuals screened for TB, 112 (0.49% were identified as TB suspects; 95 suspects were evaluated for TB. TB was diagnosed in four individuals, representing 4.2% of those evaluated for TB as suspected cases. The incidence rate of tuberculosis was 17.5 in 100.000 people in slums population of Gorgan. Of the four detected cases, three individuals had pulmonary TB that among them two cases had new smear-positive TB. Conclusion ACF could supplement current strategies to yield additional TB cases, lead to early diagnosis and better treatment.

  6. HIV-associated TB syndemic: A growing clinical challenge worldwide

    Directory of Open Access Journals (Sweden)

    Maria Theresa Montales

    2015-12-01

    Full Text Available The association of tuberculosis (TB with human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS over the past several years has become an emerging syndemic. Approximately 10% of people living with HIV (PLHIV with latent TB infection will develop active TB disease each year. In this review, we highlight that this phenomenon is not limited to high endemic regions like Afro-Asian nations, but globalization/migration is causing increased case detection even in developed nations such as the United States (US. Active screening should be performed for tuberculosis in PLHIV. A high degree of clinical suspicion for tuberculosis is warranted in PLHIV presenting with fever, cough and unintentional weight loss. HIV-Mycobacterium tuberculosis (MTB coinfection is often paucibacillary, precluding diagnosis by conventional diagnostics and/or smear-microscopy/culture. Improved detection of pulmonary and extrapulmonary tuberculosis is now possible by incorporation of the GeneXPERT MTB/RIF assay (Cepheid Inc, Sunnyvale, USA. The World Health Organization (WHO recommends instituting immediate therapy for Mycobacterium tuberculosis, in conjunction with ongoing or newly introduced antiretroviral therapy (ART. Vigilance is required to detect drug-induced organ injuries, and early-treatment induced immune reconstitution inflammatory syndrome (IRIS. Collaborating MTB and HIV activities in concentrated HIV epidemic settings should become a high public health priority.

  7. Utility of QuantiFERON-TB Gold In-Tube assay in adult, pulmonary and extrapulmonary, active tuberculosis diagnosis

    Directory of Open Access Journals (Sweden)

    Mohammed Azghay

    2016-03-01

    Conclusion: On its own, QFT-GIT is an insufficient tool to confirm the diagnosis of TB disease. However, it may form part of an ensemble of tools in combination with clinical, biological, and radiological assessments.

  8. Phenotypic assays for Mycobacterium tuberculosis infection.

    Science.gov (United States)

    Song, Ok-Ryul; Deboosere, Nathalie; Delorme, Vincent; Queval, Christophe J; Deloison, Gaspard; Werkmeister, Elisabeth; Lafont, Frank; Baulard, Alain; Iantomasi, Raffaella; Brodin, Priscille

    2017-10-01

    Tuberculosis (TB) is still a major global threat, killing more than one million persons each year. With the constant increase of Mycobacterium tuberculosis strains resistant to first- and second-line drugs, there is an urgent need for the development of new drugs to control the propagation of TB. Although screenings of small molecules on axenic M. tuberculosis cultures were successful for the identification of novel putative anti-TB drugs, new drugs in the development pipeline remains scarce. Host-directed therapy may represent an alternative for drug development against TB. Indeed, M. tuberculosis has multiple specific interactions within host phagocytes, which may be targeted by small molecules. In order to enable drug discovery strategies against microbes residing within host macrophages, we developed multiple fluorescence-based HT/CS phenotypic assays monitoring the intracellular replication of M. tuberculosis as well as its intracellular trafficking. What we propose here is a population-based, multi-parametric analysis pipeline that can be used to monitor the intracellular fate of M. tuberculosis and the dynamics of cellular events such as phagosomal maturation (acidification and permeabilization), zinc poisoning system or lipid body accumulation. Such analysis allows the quantification of biological events considering the host-pathogen interplay and may thus be derived to other intracellular pathogens. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

  9. Determination of circulating Mycobacterium tuberculosis strains and transmission patterns among TB patients in Iran, using 15 loci MIRU-VNTR

    Directory of Open Access Journals (Sweden)

    S Zamani

    2015-01-01

    Conclusions: MIRU-VNTR typing showed a high genetic diversity and suggests the possibility of transmission from Sistan–Baluchestan to other provinces of Iran. This method could be considered a suitable tool for studying the transmission routes of TB and leading to more appropriate measures for TB control. MIRU-VNTR typing leads to a much better understanding of the bacterial population structure and phylogenetic relationships between strains of MTB in different regions of Iran.

  10. Adenovirus type 35-vectored tuberculosis vaccine has an acceptable safety and tolerability profile in healthy, BCG-vaccinated, QuantiFERON(®)-TB Gold (+) Kenyan adults without evidence of tuberculosis.

    Science.gov (United States)

    Walsh, Douglas S; Owira, Victorine; Polhemus, Mark; Otieno, Lucas; Andagalu, Ben; Ogutu, Bernhards; Waitumbi, John; Hawkridge, Anthony; Shepherd, Barbara; Pau, Maria Grazia; Sadoff, Jerald; Douoguih, Macaya; McClain, J Bruce

    2016-05-05

    In a Phase 1 trial, we evaluated the safety of AERAS-402, an adenovirus 35-vectored TB vaccine candidate expressing 3 Mycobacterium tuberculosis (Mtb) immunodominant antigens, in subjects with and without latent Mtb infection. HIV-negative, BCG-vaccinated Kenyan adults without evidence of tuberculosis, 10 QuantiFERON(®)-TB Gold In-Tube test (QFT-G)(-) and 10 QFT-G(+), were randomized 4:1 to receive AERAS-402 or placebo as two doses, on Days 0 and 56, with follow up to Day 182. There were no deaths, serious adverse events or withdrawals. For 1 AERAS-402 QFT-G(-) and 1 AERAS-402 QFT-G(+) subject, there were 3 self-limiting severe AEs of injection site pain: 1 after the first vaccination and 1 after each vaccination, respectively. Two additional severe AEs considered vaccine-related were reported after the first vaccination in AERAS-402 QFT-G(+) subjects: elevated blood creatine phosphokinase and neutropenia, the latter slowly improving but remaining abnormal until study end. AERAS-402 was not detected in urine or throat cultures for any subject. In intracellular cytokine staining studies, curtailed by technical issues, we saw modest CD4+ and CD8+ T cell responses to Mtb Ag85A/b peptide pools among both QFT-G(-) and (+) subjects, with trends in the CD4+ T cells suggestive of boosting after the second vaccine dose, slightly more so in QFT-G(+) subjects. CD4+ and CD8+ responses to Mtb antigen TB10.4 were minimal. Increases in Adenovirus 35 neutralizing antibodies from screening to end of study, seen in 50% of AERAS-402 recipients, were mostly minimal. This small study confirms acceptable safety and tolerability profiles for AERAS-402, in line with other Phase 1 studies of AERAS-402, now to include QFT-G(+) subjects. Published by Elsevier Ltd.

  11. Surveillance, Evaluation of Programmatic Management of Drug Resistant Tuberculosis (PMDT at DR-TB Centre, NITRD, New Delhi

    Directory of Open Access Journals (Sweden)

    Preeti Padda

    2018-03-01

    Full Text Available Background: PMDT was launched in 2007 in our country but drug resistant TB remains to be a public health problem. Effective surveillance is the backbone for success of any programme and true stands for PMDT. Aim & Objectives: To identify the strengths and constraints of the surveillance evaluation system. Material & Methods: A cross sectional study was conducted in January 2015 at DR-TB Centre of NITRD, New Delhi which caters to a population of 29 lacs. PMDT surveillance system was evaluated using attributes like simplicity, data quality, acceptability, positive predictive value, representativeness and timeliness defined by CDC, USA guidelines. Relevant information was collected using data abstraction form and interview with stakeholders. Data was analysed using EpiInfo 07 version. Results: Nodal officer and District TB officer are responsible for surveillance system activities of PMDT at DR-TB centre and district level, respectively. All the reports (100% were submitted on time and all the districts were reporting to DR-TB centre. 75% of TB-HIV coordinators found reporting formats to be simple but all the quarterly reports were found to be complete. Data quality was not found to be optimal. Conclusion: Private sector needs to be taken on board as they have no to minimal involvement in PMDT. For data quality improvement time to time training of medical officers and health workers should be organized.

  12. Defining the research agenda to measure and reduce tuberculosis stigmas.

    Science.gov (United States)

    Macintyre, K; Bakker, M I; Bergson, S; Bhavaraju, R; Bond, V; Chikovore, J; Colvin, C; Craig, G M; Cremers, A L; Daftary, A; Engel, N; France, N Ferris; Jaramillo, E; Kimerling, M; Kipp, A; Krishnaratne, S; Mergenthaler, C; Ngicho, M; Redwood, L; Rood, E J J; Sommerland, N; Stangl, A; van Rie, A; van Brakel, W; Wouters, E; Zwerling, A; Mitchell, E M H

    2017-11-01

    Crucial to finding and treating the 4 million tuberculosis (TB) patients currently missed by national TB programmes, TB stigma is receiving well-deserved and long-delayed attention at the global level. However, the ability to measure and evaluate the success of TB stigma-reduction efforts is limited by the need for additional tools. At a 2016 TB stigma-measurement meeting held in The Hague, The Netherlands, stigma experts discussed and proposed a research agenda around four themes: 1) drivers: what are the main drivers and domains of TB stigma(s)?; 2) consequences: how consequential are TB stigmas and how are negative impacts most felt?; 3) burden: what is the global prevalence and distribution of TB stigma(s) and what explains any variation? 4): intervention: what can be done to reduce the extent and impact of TB stigma(s)? Each theme was further subdivided into research topics to be addressed to move the agenda forward. These include greater clarity on what causes TB stigmas to emerge and thrive, the difficulty of measuring the complexity of stigma, and the improbability of a universal stigma 'cure'. Nevertheless, these challenges should not hinder investments in the measurement and reduction of TB stigma. We believe it is time to focus on how, and not whether, the global community should measure and reduce TB stigma.

  13. Dr Mario Raviglione, director of the Stop TB Department World Health Organization. Interview by Christo Hall.

    Science.gov (United States)

    Raviglione, Mario

    2012-03-01

    Tuberculosis (TB) is a very global disease; there are over 9 million new incidences of TB every year with the vast majority of cases emerging in the developing world. As one of three major diseases associated with poverty it affects the areas where poverty is most prevalent, notably Asia and Africa. While the incidence rate has been slowly declining in the developed world it continues to pose a major health threat to even the most developed nations. To demonstrate the global, and persistent, nature of TB we asked Dr Mario Raviglione, Director of the World Health Organization's Stop TB Department to provide an analysis on the current TB situation in the United Kingdom and comment on what measures should be taken to alleviate the issue of TB in one of the world's richest countries.

  14. Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.

    OpenAIRE

    Merker Matthias; Blin Camille; Mona Stefano; Duforet-Frebourg Nicolas; Lecher Sophie; Willery Eve; Blum Michael G B; Rüsch-Gerdes Sabine; Mokrousov Igor; Aleksic Eman; Allix-Béguec Caroline; Antierens Annick; Augustynowicz-Kopec Ewa; Ballif Marie; Barletta Francesca

    2015-01-01

    International audience; Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiat...

  15. TUBERCULOSIS

    OpenAIRE

    Tarik Bajrović; Mahmud Nurkić; Šukrija Zvizdić

    2013-01-01

    Tuberculosis, known as the "White Plague" in the early 19th century, is the infectious disease, which is being researched today even in some of the most developed countries in the world. Epidemiological- epizootiological research points to the importance of pasteurizing milk as well as the transmission in aerosolized droplets in humans and animals. Mycobacterium tuberculosis (Mtb), M. bovis, M. africanum and M. microti are the mycobacteria that cause tuberculosis. Other mycobacteria cause dis...

  16. Culture and drug susceptibility testing among previously treated tuberculosis patients in the Dominican Republic, 2014

    Directory of Open Access Journals (Sweden)

    Katia J. Romero Mercado

    Full Text Available ABSTRACT Multidrug-resistant tuberculosis (MDR-TB is a major public health concern that threatens global progress toward effective TB control. The risk of MDR-TB is increased in patients who have received previous TB treatment. This article describes the performance of culture and drug susceptibility testing (DST in patients registered as previously treated TB patients in the Dominican Republic in 2014, based on operational research that followed a retrospective cohort design and used routine program data. Under the current system of TB culturing and DST, the majority of patients with previously treated TB do not undergo DST, and those who do often experience considerable delay in obtaining their results. The lack of DST and delay in receiving DST results leads to underestimation of the number of MDR-TB cases and hinders the timely initiation of MDR-TB treatment.

  17. Spatial distribution of extensively drug-resistant tuberculosis (XDR TB patients in KwaZulu-Natal, South Africa.

    Directory of Open Access Journals (Sweden)

    Thandi Kapwata

    Full Text Available KwaZulu-Natal province, South Africa, has among the highest burden of XDR TB worldwide with the majority of cases occurring due to transmission. Poor access to health facilities can be a barrier to timely diagnosis and treatment of TB, which can contribute to ongoing transmission. We sought to determine the geographic distribution of XDR TB patients and proximity to health facilities in KwaZulu-Natal.We recruited adults and children with XDR TB diagnosed in KwaZulu-Natal. We calculated distance and time from participants' home to the closest hospital or clinic, as well as to the actual facility that diagnosed XDR TB, using tools within ArcGIS Network analyst. Speed of travel was assigned to road classes based on Department of Transport regulations. Results were compared to guidelines for the provision of social facilities in South Africa: 5km to a clinic and 30km to a hospital.During 2011-2014, 1027 new XDR TB cases were diagnosed throughout all 11 districts of KwaZulu-Natal, of whom 404 (39% were enrolled and had geospatial data collected. Participants would have had to travel a mean distance of 2.9 km (CI 95%: 1.8-4.1 to the nearest clinic and 17.6 km (CI 95%: 11.4-23.8 to the nearest hospital. Actual distances that participants travelled to the health facility that diagnosed XDR TB ranged from 50 km (n = 109, 27%, with a mean of 69 km. The majority (77% of participants travelled farther than the recommended distance to a clinic (5 km and 39% travelled farther than the recommended distance to a hospital (30 km. Nearly half (46% of participants were diagnosed at a health facility in eThekwini district, of whom, 36% resided outside the Durban metropolitan area.XDR TB cases are widely distributed throughout KwaZulu-Natal province with a denser focus in eThekwini district. Patients travelled long distances to the health facility where they were diagnosed with XDR TB, suggesting a potential role for migration or transportation in the XDR TB

  18. T Cell Reactivity against Mycolyl Transferase Antigen 85 of M. tuberculosis in HIV-TB Coinfected Subjects and in AIDS Patients Suffering from Tuberculosis and Nontuberculous Mycobacterial Infections

    Directory of Open Access Journals (Sweden)

    Pascal Launois

    2011-01-01

    Full Text Available The mycolyl transferase antigen 85 complex is a major secreted protein family from mycobacterial culture filtrate, demonstrating powerful T cell stimulatory properties in most HIV-negative, tuberculin-positive volunteers with latent M.tuberculosis infection and only weak responses in HIV-negative tuberculosis patients. Here, we have analyzed T cell reactivity against PPD and Ag85 in HIV-infected individuals, without or with clinical symptoms of tuberculosis, and in AIDS patients with disease caused by nontuberculous mycobacteria. Whereas responses to PPD were not significantly different in HIV-negative and HIV-positive tuberculin-positive volunteers, responses to Ag85 were significantly decreased in the HIV-positive (CDC-A and CDC-B group. Tuberculosis patients demonstrated low T cell reactivity against Ag85, irrespective of HIV infection, and finally AIDS patients suffering from NTM infections were completely nonreactive to Ag85. A one-year follow-up of twelve HIV-positive tuberculin-positive individuals indicated a decreased reactivity against Ag85 in patients developing clinical tuberculosis, highlighting the protective potential of this antigen.

  19. Global, regional, and national incidence and mortality for HIV, tuberculosis, and malaria during 1990-2013

    DEFF Research Database (Denmark)

    Murray, Christopher J L; Ortblad, Katrina F; Guinovart, Caterina

    2014-01-01

    BACKGROUND: The Millennium Declaration in 2000 brought special global attention to HIV, tuberculosis, and malaria through the formulation of Millennium Development Goal (MDG) 6. The Global Burden of Disease 2013 study provides a consistent and comprehensive approach to disease estimation for betw...

  20. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  1. Tuberculosis risk factors among tuberculosis patients in Kampala, Uganda: implications for tuberculosis control

    NARCIS (Netherlands)

    Kirenga, Bruce J.; Ssengooba, Willy; Muwonge, Catherine; Nakiyingi, Lydia; Kyaligonza, Stephen; Kasozi, Samuel; Mugabe, Frank; Boeree, Martin; Joloba, Moses; Okwera, Alphonse

    2015-01-01

    Slow decline in the incidence of tuberculosis (TB) has been observed in most high TB burden countries. Knowledge of the prevalence of different TB risk factors can help expand TB control strategies. However with the exception of Human Immunodeficiency Virus (HIV) the prevalence of the other TB risk

  2. Tuberculosis

    Science.gov (United States)

    Friend, Milton

    1999-01-01

    Avian tuberculosis is usually caused by the bacterium Mycobacterium avium. At least 20 different types of M. avium have been identified, only three of which are known to cause disease in birds. Other types of Mycobacterium rarely cause tuberculosis in most avian species; however, parrots, macaws, and other large perching birds are susceptible to human and bovine types of tuberculosis bacilli. Avian tuberculosis generally is transmitted by direct contact with infected birds, ingestion of contaminated feed and water, or contact with a contaminated environment. Inhalation of the bacterium can cause respiratory tract infections. Wild bird studies in the Netherlands disclosed tuberculosis-infected puncture-type injuries in birds of prey that fight at the nest site (kestrels) or on the ground (buteo-type buzzards), but tuberculosisinfected injuries were not found in accipiters (falco

  3. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  4. Vitamin D: Immuno-modulation and tuberculosis treatment.

    Science.gov (United States)

    Selvaraj, Paramasivam; Harishankar, Murugesan; Afsal, Kolloli

    2015-05-01

    Tuberculosis (TB) is a major global health problem and often coincides with vitamin D deficiency. High doses of vitamin D were widely used to treat TB during the pre-antibiotic era. Vitamin D exerts its action through vitamin D receptor (VDR), and VDR gene polymorphisms are associated with susceptibility or resistance to tuberculosis as well as sputum smear and culture conversion during anti-TB treatment. In-vitro studies have revealed that 1,25-dihydroxyvitamin D3 enhances innate immunity by increased expression of various antimicrobial peptides, including cathelicidin, and induction of autophagy of the infected cells thus restricts the intracellular growth of Mycobacterium tuberculosis in macrophages. On the other hand, vitamin D has been shown to suppress the pro-inflammatory cytokine response and enhance the anti-inflammatory response. Supplementation with vitamin D in concert with treatment for TB may be beneficial with respect to minimizing the excessive tissue damage that occurs during the active stage of tuberculosis disease. Several clinical trials have evaluated vitamin D supplementation as an adjunct therapy in the treatment for tuberculosis. However, results are conflicting, owing to variations in dose regimens and outcomes. Further investigations are needed to find the optimal concentration of vitamin D for supplementation with standard anti-TB drugs to optimize treatment, which could help to effectively manage both drug-sensitive and drug-resistant tuberculosis.

  5. Developing a customised approach for strengthening tuberculosis laboratory quality management systems toward accreditation

    Directory of Open Access Journals (Sweden)

    Heidi Albert

    2017-03-01

    Full Text Available Background: Quality-assured tuberculosis laboratory services are critical to achieve global and national goals for tuberculosis prevention and care. Implementation of a quality management system (QMS in laboratories leads to improved quality of diagnostic tests and better patient care. The Strengthening Laboratory Management Toward Accreditation (SLMTA programme has led to measurable improvements in the QMS of clinical laboratories. However, progress in tuberculosis laboratories has been slower, which may be attributed to the need for a structured tuberculosis-specific approach to implementing QMS. We describe the development and early implementation of the Strengthening Tuberculosis Laboratory Management Toward Accreditation (TB SLMTA programme. Development: The TB SLMTA curriculum was developed by customizing the SLMTA curriculum to include specific tools, job aids and supplementary materials specific to the tuberculosis laboratory. The TB SLMTA Harmonized Checklist was developed from the World Health Organisation Regional Office for Africa Stepwise Laboratory Quality Improvement Process Towards Accreditation checklist, and incorporated tuberculosis-specific requirements from the Global Laboratory Initiative Stepwise Process Towards Tuberculosis Laboratory Accreditation online tool. Implementation: Four regional training-of-trainers workshops have been conducted since 2013. The TB SLMTA programme has been rolled out in 37 tuberculosis laboratories in 10 countries using the Workshop approach in 32 laboratories in five countries and the Facility based approach in five tuberculosis laboratories in five countries. Conclusion: Lessons learnt from early implementation of TB SLMTA suggest that a structured training and mentoring programme can build a foundation towards further quality improvement in tuberculosis laboratories. Structured mentoring, and institutionalisation of QMS into country programmes, is needed to support tuberculosis laboratories

  6. Tuberculosis.

    Science.gov (United States)

    Tabbara, Khalid F

    2007-11-01

    The purpose of this report is to present an update on the manifestations and management of ocular tuberculosis. Tuberculosis affects one-third of the world's population. The incidence of tuberculosis has increased with the increase in the HIV infected population. Following a resurgence of the disease in the US, the incidence has recently declined. Patients may develop scleritis that can be focal, nodular or diffuse with or without keratitis. Anterior granulomatous uveitis may occur. The posterior segment reveals vitritis, choroiditis, and can mimic serpiginous choroiditis and other entities. Patients who are immunosuppressed or HIV infected may develop active mycobacterial disease in the eye leading to rapid destruction of the ocular structures. The diagnosis of ocular tuberculosis is made by isolation of Mycobacterium tuberculosis on Löwestein-Jensen medium or by PCR. The diagnosis is supported by the clinical findings, imaging techniques including optical coherence tomography, fluorescein angiography, indocyanine green and ultrasonography. Tuberculin skin test helps to confirm the diagnosis. Ocular tuberculosis may occur in the absence of pulmonary disease. Patients present with a spectrum of clinical signs. The disease may mimic several clinical entities. Early diagnosis and prompt treatment of ocular tuberculosis may prevent ocular morbidity and blindness.

  7. Dedicated health systems strengthening of the Global Fund to Fight AIDS, Tuberculosis, and Malaria: an analysis of grants.

    Science.gov (United States)

    Fan, Victoria Y; Tsai, Feng-Jen J; Shroff, Zubin C; Nakahara, Branden; Vargha, Nabil; Weathers, Scott

    2017-01-01

    This study aims to understand the determinants of the Global Fund to Fight AIDS, Tuberculosis, and Malaria's dedicated channel for health systems strengthening (HSS) funding across countries and to analyze their health system priorities expressed in budgets and performance indicators. We obtained publicly available data for disease-specific and HSS grants from the Global Fund over 2004-2013 prior to the new funding model. Regression analysis was employed to assess the determinants of dedicated HSS funding across 111 countries. Documents for 27 dedicated HSS grants including budgets and performance indicators were collected, and activities were analyzed by health system functions. HSS funding per capita is significantly associated with TB and HIV funding per capita, but not per capita income and health worker density. Of 27 dedicated HSS grants, 11 had line-item budgets publicly available, in which health workforce and medical products form the majority (89% or US$132 million of US$148 million) of funds. Yet these areas accounted for 41.7% (215) of total 516 performance indicators. Health worker densities were not correlated with HSS funding, despite the emphasis on health workforce in budgets and performance indicators. Priorities in health systems in line-item budgets differ from the numbers of indicators used. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Drug resistant tuberculosis in Saudi Arabia: an analysis of surveillance data 2014-2015.

    Science.gov (United States)

    Al Ammari, Maha; Al Turaiki, Abdulrahman; Al Essa, Mohammed; Kashkary, Abdulhameed M; Eltigani, Sara A; Ahmed, Anwar E

    2018-01-01

    There is limited data that investigates the national rates of drug-resistant tuberculosis (TB) in Saudi Arabia.This study aimed to estimate the rates of multi-drug-resistant tuberculosis (MDR-TB), rifampicin-resistant tuberculosis (RR-TB), and monoresistance (MR) in Saudi Arabia. A retrospective cohort study was conducted on all TB cases reported to the National TB Control and Prevention Program (NTCPP) registry at the Saudi Ministry of Health between January 1, 2014 and December 31, 2015. A total of 2098 TB patients with positive TB cultures were included in the study. Subgroup analyses and multivariate binary logistic regression models were performed with IBM SPSS 23.0. Of the total TB cases, 4.4% (95% CI: 3.59%-5.40%) were found to have MDR-TB. The rates of MR were 3.8% (95% CI: 2.99%-4.67%) for ethambutol, 5.4% (95% CI: 4.50%-6.49%) for pyrazinamide, 10.2% (95% CI: 5.89%-11.52%) for isoniazid, 11% (95% CI: 9.70%-12.43%) for streptomycin, and 5.9% (95% CI: 4.90%-6.96%) for rifampicin. The high rates of MDR and RR-TB were found among the younger age group, female gender, and those who had a previous history of TB. We also discovered that renal failure tends to increase the risk of rifampicin resistance. National TB data in Saudi Arabia shows that the rate of MDR-TB was similar to the global rate reported by the World Health Organization (WHO). It is a relatively high rate as compared to Western countries. The proportion of MDR/RR-TB patients tends to be higher in the younger age group, female gender, and in patients with a previous history of TB treatment. Effective strategies for prevention of all multi-drug-resistant TB cases are warranted.

  9. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  10. Global, regional, and national incidence and mortality for HIV, tuberculosis, and malaria during 1990-2013: a systematic analysis for the Global Burden of Disease Study 2013

    NARCIS (Netherlands)

    C.J.L. Murray (Christopher); K.F. Ortblad (Katrina F); C. Guinovart (Caterina); S.S. Lim (Stephen); T.M. Wolock (Timothy M); D.A. Roberts (D Allen); E.A. Dansereau (Emily A); N. Graetz (Nicholas); R.M. Barber (Ryan); J.C. Brown (Jonathan C); H. Wang (Haidong); H.C. Duber (Herbert C); M. Naghavi (Morteza); D. Dicker (Daniel); L. Dandona (Lalit); J.A. Salomon (Joshua); K.R. Heuton (Kyle R); K. Foreman (Kyle); D.E. Phillips (David E); T.D. Fleming (Thomas D); A.D. Flaxman (Abraham D); B.K. Phillips (Bryan K); E.M. Johnson (Elizabeth); M.S. Coggeshall (Megan S); F. Abd-Allah (Foad); S.F. Abera (Semaw Ferede); J.P. Abraham (Jerry); I. Abubakar (Ibrahim); L.J. Abu-Raddad (Laith J); N.M. Abu-Rmeileh (Niveen Me); T. Achoki (Tom); A. Adeyemo (Adebowale); A.K. Adou (Arsène Kouablan); J.C. Adsuar (José C); E.E. Agardh (Emilie Elisabet); D. Akena (Dickens); M.J. Al Kahbouri (Mazin J); D. Alasfoor (Deena); M.I. Albittar (Mohammed I); G. Alcalá-Cerra (Gabriel); M.A. Alegretti (Miguel Angel); G. Alemu (Getnet ); R. Alfonso-Cristancho (Rafael); S. Alhabib (Samia); R. Ali (Raghib); F. Alla (Francois); P.J. Allen (Peter); U. Alsharif (Ubai); E. Alvarez (Elena); N. Alvis-Guzman (Nelson); A.A. Amankwaa (Adansi A); A.T. Amare (Azmeraw T); H. Amini (Hassan); K.A. Ammar; B.O. Anderson (Benjamin); C.A.T. Antonio (Carl Abelardo T); P. Anwari (Palwasha); J. Ärnlöv (Johan); V.S.A. Arsenijevic (Valentina S Arsic); A. Artaman (Ali); R.J. Asghar (Rana J); R. Assadi (Reza); L.S. Atkins (Lydia S); A.F. Badawi (Alaa); A. Banerjee (Amitava); S. Basu (Saonli); J. Beardsley (Justin); T. Bekele (Tolesa); M.L. Bell (Michelle Lee); E. Bernabe (Eduardo); T.J. Beyene (Tariku Jibat); N. Bhala (Neeraj); P.L. Bhalla (Pankaj); Z.A. Bhutta (Zulfiqar A); A.B. Abdulhak (Aref Bin); A. Binagwaho (Agnes); J.D. Blore (Jed D); D. Bose (Dipan); M. Brainin (Michael); N. Breitborde (Nicholas); C.A. Castañeda-Orjuela (Carlos A); F. Catalá-López (Ferrán); D. Chadha; J.-C. Chang (Jung-Chen); Y.T. Chiang; T.-W. Chuang (Ting-Wu); M. Colomar (Mercedes); L.T. Cooper Jr. (Leslie Trumbull); C. Cooper (Charles); K.J. Courville (Karen J); M.R. Cowie (Martin R.); M. Criqui (Michael); R. Dandona (Rakhi); A. Dayama (Anand); D. de Leo (Diego); F. Degenhardt; B. Del Pozo-Cruz (Borja); K. Deribe (Kebede); D.C. Des Jarlais (Don C); M. Dessalegn (Muluken); S.D. Dharmaratne (Samath D); U. Dilmen (Uǧur); E.L. Ding (Eric); J.M. Driscoll; Z. Durrani; R.G. Ellenbogen (Richard G); S. Ermakov (Sergey); A. Esteghamati (Alireza); E.J.A. Faraon (Emerito Jose A); F. Farzadfar (Farshad); S.-M. Fereshtehnejad (Seyed-Mohammad); D.O. Fijabi (Daniel Obadare); M.H. Forouzanfar (Mohammad H); U. Fra.Paleo (Urbano); L. Gaffikin (Lynne); A. Gamkrelidze (Amiran); F.G. Gankpé (Fortuné Gbètoho); J.M. Geleijnse (Marianne); B.D. Gessner (Bradford D); K.B. Gibney (Katherine B); I.A.M. Ginawi (Ibrahim Abdelmageem Mohamed); E.L. Glaser (Elizabeth L); P. Gona (Philimon); A. Goto (Akimoto); H.N. Gouda (Hebe N); H.C. Gugnani (Harish Chander); R. Gupta (Rajeev); R. Gupta (Rajeev); N. Hafezi-Nejad (Nima); R.R. Hamadeh (Randah Ribhi); M. Hammami (Mouhanad); G.J. Hankey (Graeme); H.L. Harb (Hilda L); J.M. Haro (Josep Maria); R. Havmoeller (Rasmus); S.I. Hay (Simon I); M.T. Hedayati (Mohammad T); I.B.H. Pi (Ileana B Heredia); H.W. Hoek (Hans); J.C. Hornberger (John C); H.D. Hosgood (H Dean); P.J. Hotez (Peter); D.G. Hoy (Damian G); J. Huang (Jian); K.M. Iburg (Kim M); B.T. Idrisov (Bulat T); K. Innos (Kaire); K.H. Jacobsen (Kathryn H); P. Jeemon (Panniyammakal); P.N. Jensen (Paul N); V. Jha (Vivekanand); G. Jiang (Guohong); J.B. Jonas; K. Juel (Knud); H. Kan (Haidong); I. Kankindi (Ida); V. Karam (Vincent); F. Karch (Francois); C.K. Karema (Corine Kakizi); A. Kaul (Anil); N. Kawakami (Norito); D.S. Kazi (Dhruv S); A.H. Kemp (Andrew H); A.P. Kengne (Andre Pascal); A. Keren (Andre); M. Kereselidze (Maia); Y.S. Khader (Yousef Saleh); S.E.A.H. Khalifa (Shams Eldin Ali Hassan); E.A. Khan (Ejaz Ahmed); Y.-H. Khang (Young-Ho); I. Khonelidze (Irma); Y. Kinfu (Yohannes); J.M. Kinge (Jonas M); L. Knibbs (Luke); Y. Kokubo (Yoshihiro); S. Kosen (Soewarta); B.K. Defo (Barthelemy Kuate); V.S. Kulkarni (Veena S); C. Kulkarni (Chanda); K. Kumar (Kuldeep); R.B. Kumar (Ravi B); G.A. Kumar (G Anil); G.F. Kwan (Gene F); T. Lai (Taavi); A.L. Balaji (Arjun Lakshmana); H. Lam (Hilton); Q. Lan (Qing); V.C. Lansingh (Van C); H.J. Larson (Heidi J); A. Larsson (Anders); J.-T. Lee (Jong-Tae); P.N. Leigh (Nigel); M. Leinsalu (Mall); R. Leung (Ricky); Y. Li (Yichong); Y. Li (Yongmei); G.M.F. de Lima (Graça Maria Ferreira); H.-H. Lin (Hsien-Ho); S.E. Lipshultz (Steven); S. Liu (Simin); Y. Liu (Yang); B.K. Lloyd (Belinda K); P.A. Lotufo (Paulo A); V.M.P. Machado (Vasco Manuel Pedro); J.H. Maclachlan (Jennifer H); C. Magis-Rodriguez (Carlos); M. Majdan (Marek); C.C. Mapoma (Christopher Chabila); W. Marcenes (Wagner); M.B. Marzan (Melvin Barrientos); J.R. Masci (Joseph R); R. Mashal; A.J. Mason-Jones (Amanda J); B.M. Mayosi (Bongani); T.T. Mazorodze (Tasara T); M.J. Mckay (Michael); M.J. Meaney; M.M. Mehndiratta (Man Mohan); F. Mejia-Rodriguez (Fabiola); Y.A. Melaku (Yohannes Adama); Z.A. Memish (Ziad); W. Mendoza (Walter); T.R. Miller (Ted R); E.J. Mills (Edward J); K.A. Mohammad (Karzan Abdulmuhsin); A.H. Mokdad (Ali H); G.L. Mola (Glen Liddell); L. Monasta (Lorenzo); M. Montico (Marcella); A.R. Moore (Ami R); R. Mori (Riccardo); W.N. Moturi (Wilkister Nyaora); M. Mukaigawara (Mitsuru); A.C. Murthy (Adeline C.); A. Naheed (Aliya); K.S. Naidoo (Kovin S); L. Naldi; M. Nangia (Monika); K.M.V. Narayan (Venkat); J.H.E. Nash (John); C. Nejjari (Chakib); R.D. Nelson (Robert); S.P. Neupane (Sudan Prasad); C. Newton (Cameron); M. Ng (Marie); M.I. Nisar (Muhammad Imran); S. Nolte (Sandra); O.F. Norheim (Ole F); V. Nowaseb (Vincent); L. Nyakarahuka (Luke); I.-H. Oh (In-Hwan); T. Ohkubo (Takayoshi); B.O. Olusanya (Bolajoko O); S.B. Omer (Saad B); J.N. Opio (John Nelson); O.E. Orisakwe (Orish Ebere); N.G. Pandian (Natesa); C. Papachristou; M.S. Caicedo (Marco); J. Patten; V.K. Paul (Vinod K); B.I. Pavlin (Boris Igor); N. Pearce (Neil); D.M. Pereira (David M); Z. Pervaiz (Zahid); K. Pesudovs (Konrad); M. Petzold (Max); F. Pourmalek (Farshad); D. Qato (Dima); A.D. Quezada (Amado D); D.A. Quistberg (D Alex); A. Rafay (Anwar); K. Rahimi (Kazem); V. Rahimi-Movaghar (Vafa); S.U. Rahman (Sajjad Ur); M. Raju (Murugesan); S.M. Rana (Saleem M); H. Razavi (Homie); R.Q. Reilly (Robert Quentin); G. Remuzzi (Giuseppe); J.H. Richardus (Jan Hendrik); L. Ronfani (Luca); N. van Roy (Nadine); M.L. Sabin (Miriam Lewis); M.Y. Saeedi (Mohammad Yahya); M.A. Sahraian (Mohammad Ali); G.M.J. Samonte (Genesis May J); M.S. Sawhney (Monika); I.J.C. Schneider (Ione J C); D.C. Schwebel (David C); S. Seedat (Soraya); S.G. Sepanlou (Sadaf G); E.E. Servan-Mori (Edson E); S. Sheikhbahaei (Sara); K. Shibuya (Kenji); H.H. Shin (Hwashin Hyun); I. Shiue (Ivy); R. Shivakoti (Rupak); I.D. Sigfusdottir (Inga Dora); D.H. Silberberg (Donald H); A.P. Silva (Andrea P); J. Simard (Jacques); J.A. Singh (Jasvinder); V. Skirbekk (Vegard); K. Sliwa (Karen); S. Soneji (Samir); S.S. Soshnikov (Sergey S); C.T. Sreeramareddy (Chandrashekhar T); V.K. Stathopoulou (Vasiliki Kalliopi); K. Stroumpoulis (Konstantinos); S. Swaminathan; B.C. Sykes (Bryan); K.M. Tabb (Karen M); R.T. Talongwa (Roberto Tchio); E.Y. Tenkorang (Eric Yeboah); A.S. Terkawi (Abdullah Sulieman); A.J. Thomson (Alan J); A.L. Thorne-Lyman (Andrew L); J.A. Towbin (Jeffrey A); J. Traebert (Jefferson); B.X. Tran (Bach X); Z.T. Dimbuene (Zacharie Tsala); M. Tsilimbaris (Miltiadis); U.S. Uchendu (Uche S); K.N. Ukwaja (Kingsley N); S.R. Vallely (Stephen); T.J. Vasankari (Tommi J); N. Venketasubramanian (Narayanaswamy); F.S. Violante (Francesco S); V.V. Vlassov (Vasiliy Victorovich); P. Waller (Patrick); M.T. Wallin (Mitchell T); L. Wang (Linhong); S.X. Wang; Y. Wang (Yanping); S. Weichenthal (Scott); E. Weiderpass (Elisabete); R.G. Weintraub (Robert G); R. Westerman (Ronny); R.G. White (Richard); J.D. Wilkinson (James D); T.N. Williams (Thomas Neil); S.M. Woldeyohannes (Solomon Meseret); J.B. Wong (John); G. Xu (Gelin); Y.C. Yang (Yang C); K.-I. Yano; P. Yip (Paul); N. Yonemoto (Naohiro); S.-J. Yoon (Seok-Jun); M. Younis (Mustafa); C. Yu (Chuanhua); K.Y. Jin (Kim Yun); M. El Sayed Zaki (Maysaa); Y. Zhao (Yong); Y. Zheng (Yuhui); K. Balakrishnan (Kalpana); M. Zhou (Ming); J. Zhu (Jun); X.N. Zou (Xiao Nong); A.D. Lopez (Alan D); T. Vos (Theo)

    2014-01-01

    markdownabstract__Abstract__ Background: The Millennium Declaration in 2000 brought special global attention to HIV, tuberculosis, and malaria through the formulation of Millennium Development Goal (MDG) 6. The Global Burden of Disease 2013 study provides a consistent and comprehensive approach

  11. TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    Tarik Bajrović

    2013-10-01

    Full Text Available Tuberculosis, known as the "White Plague" in the early 19th century, is the infectious disease, which is being researched today even in some of the most developed countries in the world. Epidemiological- epizootiological research points to the importance of pasteurizing milk as well as the transmission in aerosolized droplets in humans and animals. Mycobacterium tuberculosis (Mtb, M. bovis, M. africanum and M. microti are the mycobacteria that cause tuberculosis. Other mycobacteria cause diseases commonly known as mycobacteriosae. Pathogenesis of tuberculosis includes both host- related and mycobacterium-related factors (virulence. Mtb acts through the expression of various genes and their proteins that are detectable in the serums of the diseased only, proving these proteins are formed in the course of the disease. In humans, a diagnosis is established by the detection of antigens (and antibodies, and in animals, with the allergy tests. As far as the bovine tuberculosis is concerned, the combination of skin tuberculin and blood gamma interferon test is recommended. Sequential genome (Mtb analysis has given the basis for further research of the new vaccines.Key words: Tuberculosis, pathogenesis, immunity

  12. Tuberculosis

    Directory of Open Access Journals (Sweden)

    Elena Morán López

    2001-04-01

    Full Text Available En la actualidad la incidencia de la tuberculosis ha aumentado. El Mycobacterium tuberculosis infecta frecuentemente a las personas con SIDA, debido a que en estos pacientes hay una reducción de la resistencia mediada por células T, lo que propicia que este bacilo pueda desarrollar la enfermedad con una frecuencia superior a la de las personas sanas. La transmisión de la enfermedad puede ser por vía directa, de un individuo afectado a otro, fundamentalmente por las gotitas de saliva que contengan a este microorganismo, o por vía indirecta por la inhalación del bacilo que se puede encontrar por meses en los objetos de uso diario, debido a su gran resistencia. Las micobacterias que producen tuberculosis en el hombre inmunocompetente son la Mycobacterium tuberculosis y la bovis, otros tipos pueden provocar tuberculosis en individuos inmunocomprometidos. La patogenicidad de este bacilo está relacionada con su capacidad para escapar de la destrucción inducida por los macrófagos y para provocar hipersensibilidad de tipo retardado. Esta enfermedad tiene muy pocas manifestaciones bucales, lo que se observa generalmente es una úlcera que toma como asiento fundamental el dorso de la lengua. La tuberculosis amenaza con convertirse en una enfermedad incurable por la deficiente administración de los programas contra ésta, por lo que la OMS plantea para su detección y tratamiento el DOTS (tratamiento observado directamente, de corta duración que comienza a tener resultados satisfactorios, aunque en el último quinquenio, el 88 % de los pacientes que se estimaban como infectados por tuberculosis no recibieron DOTS.At present, the incidence of tuberculosis is on the rise. Mycobacterium tuberculosis often infests AIDS patients due to the fact that these persons´T-cell mediated resistance is reduced, which favors the development of the disease at a higher rate than in healthy people. The disease can be transmitted directly, that is , from an

  13. Latent M. tuberculosis infection--pathogenesis, diagnosis, treatment and prevention strategies.

    Science.gov (United States)

    Druszczyńska, Magdalena; Kowalewicz-Kulbat, Magdalena; Fol, Marek; Włodarczyk, Marcin; Rudnicka, Wiesława

    2012-01-01

    One third of the earths population is infected with Mycobacterium tuberculosis (Mtb), but only 5-10% of the infected individuals develop active tuberculosis (TB) over their lifetime. The remaining 90-95% stay healthy and are called latently infected individuals. They are the biggest reservoir of the tubercle bacilli and identifying the cases of latent TB is a part of the global plan of TB control. From the clinical point of view detection of latent TB infections (LTBI) in individuals with the highest active TB risk including cases of HIV infection, autoimmune inflammatory diseases or cancer, is a priority. This review summarizes the recent findings in the pathogenesis of latent TB, its diagnosis, treatment and prevention.

  14. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  15. Convergence of a diabetes mellitus, protein energy malnutrition, and TB epidemic: the neglected elderly population.

    Science.gov (United States)

    Menon, Sonia; Rossi, Rodolfo; Nshimyumukiza, Leon; Wusiman, Aibibula; Zdraveska, Natasha; Eldin, Manal Shams

    2016-07-26

    On a global scale, nearly two billion persons are infected with Mycobacterium tuberculosis. From this vast reservoir of latent tuberculosis (TB) infection, a substantial number will develop active TB during their lifetime, with some being able to transmit TB or Multi-drug- resistant (MDR) TB to others. There is clinical evidence pointing to a higher prevalence of infectious diseases including TB among individuals with Diabetes Mellitus (DM). Furthermore, ageing and diabetes mellitus may further aggravate protein-energy malnutrition (PEM), which in turn impairs T-lymphocyte mediated immunologic defenses, thereby increasing the risk of developing active TB and compromising TB treatment. This article aims to a) highlight synergistic mechanisms associated with immunosenescence, DM and PEM in relation to the development of active TB and b) identify nutritional, clinical and epidemiological research gaps. To explore the synergistic relationship between ageing, DM, tuberculosis and PEM, a comprehensive review was undertaken. The MEDLINE and the Google Scholar databases were searched for articles published from 1990 to March 2015, using different MESH keywords in various combinations. Ageing and DM act synergistically to reduce levels of interferon gamma (IFN- γ), thereby increasing susceptibility to TB, for which cell mediated immunity (CMI) plays an instrumental role. These processes can set in motion a vicious nutritional cycle which can predispose to PEM, further impairing the CMI and consequently limiting host defenses. This ultimately transforms the latent TB infection into active disease. A clinical diagnostic algorithm and clinical guidelines need to be established for this population. Given the increase in ageing population with DM and PEM, especially in resource-poor settings, these synergistic tripartite interactions must be examined if a burgeoning TB epidemic is to be averted. Implementation of a comprehensive, all-encompassing approach to curb transmission

  16. Spinal tuberculosis.

    Science.gov (United States)

    Dunn, R N; Ben Husien, M

    2018-04-01

    Tuberculosis (TB) remains endemic in many parts of the developing world and is increasingly seen in the developed world due to migration. A total of 1.3 million people die annually from the disease. Spinal TB is the most common musculoskeletal manifestation, affecting about 1 to 2% of all cases of TB. The coexistence of HIV, which is endemic in some regions, adds to the burden and the complexity of management. This review discusses the epidemiology, clinical presentation, diagnosis, impact of HIV and both the medical and surgical options in the management of spinal TB. Cite this article: Bone Joint J 2018;100-B:425-31.

  17. Challenges and solutions for a rational vaccine design for TB-endemic regions.

    Science.gov (United States)

    Gowthaman, Uthaman; Mushtaq, Khurram; Tan, Amabel C; Rai, Pradeep K; Jackson, David C; Agrewala, Javed N

    2015-01-01

    Vaccines have been successful for global eradication or control of dreaded diseases such as smallpox, diphtheria, tetanus, yellow fever, whooping cough, polio, and measles. Unfortunately, this success has not been achieved for controlling tuberculosis (TB) worldwide. Bacillus Calmette Guérin (BCG) is the only available vaccine against TB. Paradoxically, BCG has deciphered success in the Western world but has failed in TB-endemic areas. In this article, we highlight and discuss the aspects of immunity responsible for controlling Mycobacterium tuberculosis infection and factors responsible for the failure of BCG in TB-endemic countries. In addition, we also suggest strategies that contribute toward the development of successful vaccine in protecting populations where BCG has failed.

  18. Global health diplomacy in Iraq: international relations outcomes of multilateral tuberculosis programmes.

    Science.gov (United States)

    Kevany, Sebastian; Jaf, Payman; Workneh, Nibretie Gobezie; Abu Dalod, Mohammad; Tabena, Mohammed; Rashid, Sara; Al Hilfi, Thamer Kadum Yousif

    2014-01-01

    International development programmes, including global health interventions, have the capacity to make important implicit and explicit benefits to diplomatic and international relations outcomes. Conversely, in the absence of awareness of these implications, such programmes may generate associated threats. Due to heightened international tensions in conflict and post-conflict settings, greater attention to diplomatic outcomes may therefore be necessary. We examine related 'collateral' effects of Global Fund-supported tuberculosis programmes in Iraq. During site visits to Iraq conducted during 2012 and 2013 on behalf of the Global Fund to Fight AIDS, Tuberculosis and Malaria, on-site service delivery evaluations, unstructured interviews with clinical and operational staff, and programme documentary review of Global Fund-supported tuberculosis treatment and care programmes were conducted. During this process, a range of possible external or collateral international relations and diplomatic effects of global health programmes were assessed according to predetermined criteria. A range of positive diplomatic and international relations effects of Global Fund-supported programmes were observed in the Iraq setting. These included (1) geo-strategic accessibility and coverage; (2) provisions for programme sustainability and alignment; (3) contributions to nation-building and peace-keeping initiatives; (4) consistent observation of social, cultural and religious norms in intervention selection; and (5) selection of the most effective and cost-effective tuberculosis treatment and care interventions. Investments in global health programmes have valuable diplomatic, as well as health-related, outcomes, associated with their potential to prevent, mitigate or reverse international tension and hostility in conflict and post-conflict settings, provided that they adhere to appropriate criteria. The associated international presence in such regions may also contribute to peace

  19. Latent Tuberculosis Infection in an Urban Cohort: Screening and Treatment for Latent TB in an Urban Setting

    Science.gov (United States)

    Morano, Jamie P.; Walton, Mary R.; Zelenev, Alexei; Bruce, R. Douglas; Altice, Frederick L.

    2013-01-01

    Background Despite its benefit for treating active tuberculosis, directly observed therapy (DOT) for latent tuberculosis infection (LTBI) has been largely understudied among challenging inner city populations. Methods Utilizing questionnaire data from a comprehensive mobile healthcare clinic in New Haven, CT from 2003 to July 2011, a total of 2523 completed tuberculin skin tests (TST’s) resulted in 357 new LTBIs. Multivariate logistic regression correlated covariates of the two outcomes 1) initiation of isoniazid preventative therapy (IPT) and 2) completion of 9-months IPT. Results Of 357 new LTBIs, 86.3% (n=308) completed screening CXRs: 90.3% (n=278) were normal and 0.3% (n=1) with active tuberculosis. Of those completing CXR screening, 44.0% (n=135) agreed to IPT: 69.6% (n=94) selected DOT, and 30.4% (n=41) selected SAT. Initiating IPT was correlated with undocumented status (AOR=3.43; pmodels for LTBI treatment resulted in similar outcomes, yet outcomes were hampered by differential measurement bias between DOT and SAT participants. PMID:23728822

  20. Impact of tuberculosis treatment on CD4 cell count, HIV RNA, and p24 antigen in patients with HIV and tuberculosis

    DEFF Research Database (Denmark)

    Wejse, Christian; Furtado, A.; Camara, C.

    2013-01-01

    To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment.......To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment....

  1. The Changing Face of the Epidemiology of Tuberculosis due to Molecular Strain Typing: A Review

    Directory of Open Access Journals (Sweden)

    Philip N Suffys

    1997-05-01

    Full Text Available About one third of the world population is infected with tubercle bacilli, causing eight million new cases of tuberculosis (TB and three million deaths each year. After years of lack of interest in the disease, World Health Organization recently declared TB a global emergency and it is clear that there is need for more efficient national TB programs and newly defined research priorities. A more complete epidemiology of tuberculosis will lead to a better identification of index cases and to a more efficient treatment of the disease. Recently, new molecular tools became available for the identification of strains of Mycobacterium tuberculosis (M. tuberculosis, allowing a better recognition of transmission routes of defined strains. Both a standardized restriction-fragment-length-polymorphism-based methodology for epidemiological studies on a large scale and deoxyribonucleic acids (DNA amplification-based methods that allow rapid detection of outbreaks with multidrug-resistant (MDR strains, often characterized by high mortality rates, have been developed. This review comments on the existing methods of DNA-based recognition of M. tuberculosis strains and their peculiarities. It also summarizes literature data on the application of molecular fingerprinting for detection of outbreaks of M. tuberculosis, for identification of index cases, for study of interaction between TB and infection with the human immunodeficiency virus, for analysis of the behavior of MDR strains, for a better understanding of risk factors for transmission of TB within communities and for population-based studies of TB transmission within and between countries

  2. Modulation of the immune response to Mycobacterium tuberculosis during malaria/M. tuberculosis co‐infection

    Science.gov (United States)

    Onyenekwe, C. C.; Martinez‐Pomares, L.; Flynn, R.; Singh, S.; Amilo, G. I.; Agbakoba, N. R.; Okoye, J. O.

    2016-01-01

    Summary Tuberculosis (TB) causes significant morbidity and mortality on a global scale. The African region has 24% of the world's TB cases. TB overlaps with other infectious diseases such as malaria and HIV, which are also highly prevalent in the African region. TB is a leading cause of death among HIV‐positive patients and co‐infection with HIV and TB has been described as a syndemic. In view of the overlapping epidemiology of these diseases, it is important to understand the dynamics of the immune response to TB in the context of co‐infection. We investigated the cytokine response to purified protein derivative (PPD) in peripheral blood mononuclear cells from TB patients co‐infected with HIV or malaria and compared it to that of malaria‐ and HIV‐free TB patients. A total of 231 subjects were recruited for this study and classified into six groups; untreated TB‐positive, TB positive subjects on TB drugs, TB‐ and HIV‐positive, TB‐ and malaria‐positive, latent TB and apparently healthy control subjects. Our results demonstrate maintenance of interferon (IFN)‐γ production in HIV and malaria co‐infected TB patients in spite of lower CD4 counts in the HIV‐infected cohort. Malaria co‐infection caused an increase in the production of the T helper type 2 (Th2)‐associated cytokine interleukin (IL)‐4 and the anti‐inflammatory cytokine IL‐10 in PPD‐stimulated cultures. These results suggest that malaria co‐infection diverts immune response against M. tuberculosis towards a Th‐2/anti‐inflammatory response which might have important consequences for disease progression. PMID:27577087

  3. Automatic detection of mycobacterium tuberculosis using artificial intelligence

    Science.gov (United States)

    Xiong, Yan; Ba, Xiaojun; Hou, Ao; Zhang, Kaiwen; Chen, Longsen

    2018-01-01

    Background Tuberculosis (TB) is a global issue that seriously endangers public health. Pathology is one of the most important means for diagnosing TB in clinical practice. To confirm TB as the diagnosis, finding specially stained TB bacilli under a microscope is critical. Because of the very small size and number of bacilli, it is a time-consuming and strenuous work even for experienced pathologists, and this strenuosity often leads to low detection rate and false diagnoses. We investigated the clinical efficacy of an artificial intelligence (AI)-assisted detection method for acid-fast stained TB bacillus. Methods We built a convolutional neural networks (CNN) model, named tuberculosis AI (TB-AI), specifically to recognize TB bacillus. The training set contains 45 samples, including 30 positive cases and 15 negative cases, where bacilli are labeled by human pathologists. Upon training the neural network model, 201 samples (108 positive cases and 93 negative cases) were collected as test set and used to examine TB-AI. We compared the diagnosis of TB-AI to the ground truth result provided by human pathologists, analyzed inconsistencies between AI and human, and adjusted the protocol accordingly. Trained TB-AI were run on the test data twice. Results Examined against the double confirmed diagnosis by pathologists both via microscopes and digital slides, TB-AI achieved 97.94% sensitivity and 83.65% specificity. Conclusions TB-AI can be a promising support system to detect stained TB bacilli and help make clinical decisions. It holds the potential to relieve the heavy workload of pathologists and decrease chances of missed diagnosis. Samples labeled as positive by TB-AI must be confirmed by pathologists, and those labeled as negative should be reviewed to make sure that the digital slides are qualified. PMID:29707349

  4. Automatic detection of mycobacterium tuberculosis using artificial intelligence.

    Science.gov (United States)

    Xiong, Yan; Ba, Xiaojun; Hou, Ao; Zhang, Kaiwen; Chen, Longsen; Li, Ting

    2018-03-01

    Tuberculosis (TB) is a global issue that seriously endangers public health. Pathology is one of the most important means for diagnosing TB in clinical practice. To confirm TB as the diagnosis, finding specially stained TB bacilli under a microscope is critical. Because of the very small size and number of bacilli, it is a time-consuming and strenuous work even for experienced pathologists, and this strenuosity often leads to low detection rate and false diagnoses. We investigated the clinical efficacy of an artificial intelligence (AI)-assisted detection method for acid-fast stained TB bacillus. We built a convolutional neural networks (CNN) model, named tuberculosis AI (TB-AI), specifically to recognize TB bacillus. The training set contains 45 samples, including 30 positive cases and 15 negative cases, where bacilli are labeled by human pathologists. Upon training the neural network model, 201 samples (108 positive cases and 93 negative cases) were collected as test set and used to examine TB-AI. We compared the diagnosis of TB-AI to the ground truth result provided by human pathologists, analyzed inconsistencies between AI and human, and adjusted the protocol accordingly. Trained TB-AI were run on the test data twice. Examined against the double confirmed diagnosis by pathologists both via microscopes and digital slides, TB-AI achieved 97.94% sensitivity and 83.65% specificity. TB-AI can be a promising support system to detect stained TB bacilli and help make clinical decisions. It holds the potential to relieve the heavy workload of pathologists and decrease chances of missed diagnosis. Samples labeled as positive by TB-AI must be confirmed by pathologists, and those labeled as negative should be reviewed to make sure that the digital slides are qualified.

  5. Tuberculosis

    OpenAIRE

    Latorre Tortello, Pablo

    2011-01-01

    Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácido...

  6. Tuberculosis

    Directory of Open Access Journals (Sweden)

    Pablo Latorre Tortello

    1998-10-01

    Full Text Available Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácidos y alcohol, de ahí el nombre de bacilos ácido-alcohol resistente (BAAR. Su transmisión es directa, de persona a persona.

  7. Tuberculosis

    OpenAIRE

    Pablo Latorre Tortello

    1998-01-01

    Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácido...

  8. Validación de instrumento para identificar el nivel de vulnerabilidad de los trabajadores de la salud a la tuberculosis en instituciones de salud (IVTS TB-001

    Directory of Open Access Journals (Sweden)

    Óscar Andrés Cruz Martínez

    2015-12-01

    Full Text Available La Salud y Seguridad en el trabajo son una prioridad en los trabajadores que cuidan la salud, dada su permanente exposición a factores de riesgo en el proceso de trabajo que desarrollan. De forma particular, la exposición a la tuberculosis en los trabajadores sanitarios, se considera una problemática frecuente y relevante en su estudio, lo cual precisa la necesidad de desarrollar procesos metodológicos y de validación de instrumentos sólidos, que contribuyan a la identificación e intervención de los factores de vulnerabilidad de los trabajadores del sector salud a la tuberculosis. Objetivo: Diseñar y validar un instrumento que permita identificar el nivel de vulnerabilidad de los Trabajadores de la Salud a la Tuberculosis en Instituciones de Salud. Materiales y Métodos: Estudio de tipo metodológico, correspondiente al diseño y validación de un instrumento en sus fases de validación aparente y validación de contenido, que permita identificar el nivel de vulnerabilidad de los Trabajadores de la Salud a la Tuberculosis en Instituciones de Salud Resultados: Se efectuó el diseño del instrumento, en sus 4 dimensiones, 19 subdimensiones y 50 ítems, con su posterior validación aparente en la población objeto, mediante la valoración de la comprensibilidad, en una muestra aleatoria de N° = (502 trabajadores de la salud de dos instituciones en las cuales se brinda atención a pacientes con diagnóstico de tuberculosis. La valoración de la Comprensibilidad del instrumento en los trabajadores, fue del (97,8%. De igual manera, se realizó juicio de expertos y se obtuvo un índice mayor de > 0.58 en la comprensión de los ítems con N= (0.90, una precisión del N = (0.90, y una claridad del N = (0.92. En la validación de contenido se obtuvo una razón de validez de Lawshe modificado por Tristán del N = (0,91, demostrando características de validez aparente y de contenido. Conclusión: El diseño y validación del instrumento (IVTS TB

  9. Advocacy, partnership and political commitment for TB vaccine research.

    Science.gov (United States)

    Olesen, Ole F; Chan, Sharon; Chappell, Janice; Guo, Yan; Leite, Luciana C C

    2016-08-01

    The 4th Global Forum on TB Vaccines, convened in Shanghai, China, from 21 - 24 April 2015, brought together a wide and diverse community involved in tuberculosis vaccine research and development to discuss the current status of, and future directions for this critical effort. This paper summarizes the sessions on Advancing the Pipeline: A Vision for the Next Decade, Engaging the BRICS: Basic Research to Manufacturing, and Regulatory and Access Issues for New TB Vaccines. Summaries of all sessions from the 4th Global Forum are compiled in a special supplement of Tuberculosis. [August 2016, Vol 99, Supp S1, S1-S30]. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Conjugation with an Inulin-Chitosan Adjuvant Markedly Improves the Immunogenicity of Mycobacterium tuberculosis CFP10-TB10.4 Fusion Protein.

    Science.gov (United States)

    Yu, Weili; Hu, Tao

    2016-11-07

    Protein-based vaccines are of potential to deal with the severe situations posed by Mycobacterium tuberculosis (Mtb). Due to inherently poor immunogenicity of Mtb protein antigens, a potent immunostimulatory adjuvant is needed to enhance the cellular and humoral immune response to Mtb protein antigens. Inulin and chitosan (Cs) are polysaccharide adjuvants that can be used to achieve such an objective. The inulin-Cs conjugate (inulin-Cs) acted as a potent adjuvant through a synergistic interaction of inulin and Cs. CFP10 and TB10.4 are two important virulent protein antigens of Mtb. The CFP10-TB10.4 fusion protein (CT) was constructed and used as the protein antigen. In the present study, an adjuvant delivery system (inulin-Cs-CT) was developed by covalent conjugation of CT with inulin-Cs. Conjugation with inulin-Cs significantly increased the hydrodynamic volume of CT and did not alter the structure of CT. High levels of Th1-type cytokines (IFN-γ, TNF-α, and IL-2) and Th2-type cytokine (IL-4) were secreted by provocation of inulin-Cs-CT. Inulin-Cs-CT elicited high CT-specific antibody titers, mostly in the form of IgG1 and IgG2b. Pharmacokinetics revealed that conjugation with inulin-Cs could prolong the serum exposure of CT to the immune system. Pharmacodynamics suggested that conjugation with inulin-Cs led to an efficient production of CT-specific IgG. Thus, conjugation of inulin-Cs can serve as a potent adjuvant delivery system to improve the immunogenicity of the Mtb protein antigens.

  11. Molecular Diagnosis of Tuberculosis.

    Science.gov (United States)

    Nurwidya, Fariz; Handayani, Diah; Burhan, Erlina; Yunus, Faisal

    2018-01-01

    Tuberculosis (TB) is one of the leading causes of adult death in the Asia-Pacific Region, including Indonesia. As an infectious disease caused by Mycobacterium tuberculosis (MTB), TB remains a major public health issue especially in developing nations due to the lack of adequate diagnostic testing facilities. Diagnosis of TB has entered an era of molecular detection that provides faster and more cost-effective methods to diagnose and confirm drug resistance in TB cases, meanwhile, diagnosis by conventional culture systems requires several weeks. New advances in the molecular detection of TB, including the faster and simpler nucleic acid amplification test (NAAT) and whole-genome sequencing (WGS), have resulted in a shorter time for diagnosis and, therefore, faster TB treatments. In this review, we explored the current findings on molecular diagnosis of TB and drug-resistant TB to see how this advancement could be integrated into public health systems in order to control TB.

  12. Cross-talk between the Immune System and Tuberculosis Pathogenesis; a Review with Emphasis on the Immune Based Treatment

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Javan

    2016-11-01

    Full Text Available As a globally major health problem, tuberculosis (TB causes almost two million cases of death annually. Epidemiological studies demonstrate that a third of the world’s individuals is infected with Mycobacterium tuberculosis. Approximately 10% of infected patients with M. tuberculosis develop chronic manifestation as TB. Due to HIV coinfection and emerging the drug-resistant TB, the disease has been increasing and its control has been frustrated in several parts of the world.Current diagnostic techniques and therapeutic tools for TB are not satisfactory. Consequently, it is urgently essential to establish new therapies concerning vaccines, immunotherapeutic agents to provide prosperous attempts for TB controlling. To achieve this goal, it is required to be armed with comprehensive understanding of immunobiology and immunopathogenesis of TB. This would be beneficial in designing new immune-based protections, drug discoveries, personalized medicine by choosing highly-effective immunotherapeutic interventions, identification and development of novel drug candidates. Hopefully, immunotherapies could be advantageous in modulating the immune system in patients with TB, providing efficient control of M. tuberculosis infection perpetuation and, therefore, its pathogenesis. This review herein attempts to describe the function of immune system in response to TB that is of the therapeutical and clinical importance. Moreover, new insights based on therapeutics to resolve TB with immunological orientation will be discussed.

  13. Tuberculosis

    OpenAIRE

    Mendoza Zuñiga, Marleny; Bastidas Párraga, Gustavo; León Untiveros, Paúl Albert

    2013-01-01

    La tuberculosis es una enfermedad infectocontagiosa producida por el bacilo de Koch, que ataca a los pulmones pero puede ser difuminada por todo el cuerpo. El siguiente artículo de información nos da una visión amplia de la detección, diagnóstico y tratamiento de la misma.

  14. Inappropriate Tuberculosis Treatment Regimens in Chinese Tuberculosis Hospitals

    NARCIS (Netherlands)

    Xue He, Guang; van den Hof, Susan; van der Werf, Marieke J.; Guo, Hui; Hu, Yuan Lian; Fan, Ji Huan; Zhang, Wei Min; Tostado, Christopher P.; Borgdorff, Martien W.

    2011-01-01

    This investigation of tuberculosis (TB) treatment regimens in 6 TB hospitals in China showed that only 18% of patients with new cases and 9% of patients with retreatment cases were prescribed standard TB treatment regimens. Adherence to treatment guidelines needs to be improved in TB hospitals to

  15. [Fight against tuberculosis in the world].

    Science.gov (United States)

    El Kamel, A; Joobeur, S; Skhiri, N; Cheikh Mhamed, S; Mribah, H; Rouatbi, N

    2015-01-01

    Tuberculosis (TB) in a major health problem in the world. WHO and its partners especially, the stop TB partnership launched numerous strategies against TB especially in the 1990. Strategy DOTS (directly observed therapy short course) was launched in 1995. One main key was the direct supervision of drug intake by patients. Progress was achieved but it was insufficient. A new strategy called "Stop TB Strategy 2006-2015" was launched in 2006 in the context of Millennium Development Goals (MDG) elaborated by United Nations. The common goals were to halt and start to reverse the incidence of TB, reduce the prevalence and death rate by 50% compared to their level in 1990 by 2015 to eliminate TB as a public health problem by 2050. The end of 2010 marks the mid-point of the Global Plan and is an obvious time to update it and take into account actual progress with a focus on the 2015 to reach goals. So an updated Global Plan to stop TB 2011-2015, was launched. Expected progress and targets were defined for 2015, in diagnosis and treatment, in co-infection TB/HIV, in drug-resistant TB and achievements expected in new tests for diagnosis, new medications, new vaccines and new regimens with shorter duration of treatment. WHO and partners have started discussions to define the new post 2015 strategy to TB control and elimination. Risk factors (diabetes, malnutrition, tobacco smoke…) and socioeconomic factors, which are associated with TB, should be included in the new strategy to eliminate TB in 2050. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Mycobacterium tuberculosis Lineage 4 comprises globally distributed and geographically restricted sublineages

    Science.gov (United States)

    Coscolla, Mireia; Liu, Qingyun; Trauner, Andrej; Fenner, Lukas; Rutaihwa, Liliana; Borrell, Sonia; Luo, Tao; Gao, Qian; Kato-Maeda, Midori; Ballif, Marie; Egger, Matthias; Macedo, Rita; Mardassi, Helmi; Moreno, Milagros; Tudo Vilanova, Griselda; Fyfe, Janet; Globan, Maria; Thomas, Jackson; Jamieson, Frances; Guthrie, Jennifer L.; Asante-Poku, Adwoa; Yeboah-Manu, Dorothy; Wampande, Eddie; Ssengooba, Willy; Joloba, Moses; Henry Boom, W.; Basu, Indira; Bower, James; Saraiva, Margarida; Vaconcellos, Sidra E. G.; Suffys, Philip; Koch, Anastasia; Wilkinson, Robert; Gail-Bekker, Linda; Malla, Bijaya; Ley, Serej D.; Beck, Hans-Peter; de Jong, Bouke C.; Toit, Kadri; Sanchez-Padilla, Elisabeth; Bonnet, Maryline; Gil-Brusola, Ana; Frank, Matthias; Penlap Beng, Veronique N.; Eisenach, Kathleen; Alani, Issam; Wangui Ndung’u, Perpetual; Revathi, Gunturu; Gehre, Florian; Akter, Suriya; Ntoumi, Francine; Stewart-Isherwood, Lynsey; Ntinginya, Nyanda E.; Rachow, Andrea; Hoelscher, Michael; Cirillo, Daniela Maria; Skenders, Girts; Hoffner, Sven; Bakonyte, Daiva; Stakenas, Petras; Diel, Roland; Crudu, Valeriu; Moldovan, Olga; Al-Hajoj, Sahal; Otero, Larissa; Barletta, Francesca; Jane Carter, E.; Diero, Lameck; Supply, Philip; Comas, Iñaki; Niemann, Stefan; Gagneux, Sebastien

    2016-01-01

    Generalist and specialist species differ in the breadth of their ecological niche. Little is known about the niche width of obligate human pathogens. Here we analyzed a global collection of Mycobacterium tuberculosis Lineage 4 clinical isolates, the most geographically widespread cause of human tuberculosis. We show that Lineage 4 comprises globally distributed and geographically restricted sublineages, suggesting a distinction between generalists and specialists. Population genomic analyses showed that while the majority of human T cell epitopes were conserved in all sublineages, the proportion of variable epitopes was higher in generalists. Our data further support a European origin for the most common generalist sublineage. Hence, the global success of Lineage 4 reflects distinct strategies adopted by different sublineages and the influence of human migration. PMID:27798628

  17. Fixed Dose Combination for TB treatment

    Directory of Open Access Journals (Sweden)

    Tjandra Y. Aditama

    2003-06-01

    Full Text Available According to the World Health Organization, a third of the world’s population is infected with tuberculosis. The disease is responsible for nearly 2 million deaths each year and over 8 million were developing active diseases. Moreover, according to WHO (2000, tuberculosis deaths are estimated to increase to 35 million between 2000-2020. The majority of tuberculosis patients worldwide are still treated with single drugs, or with 2-drug fixed-dose combinations (FDCs. To improve tuberculosis treatment, 2- and 3-drug FDCs were recommended by the World Health Organization (WHO as part of the DOTS strategy. Since 1999 a 4-drug FDC was included on the WHO Model List of Essential Drugs. Today, FDCs are important tools to further improve the quality of care for people with TB, and accelerate DOTS expansion to reach the global TB control targets. Fixed dose combination TB drugs could simplifies both treatment and management of drug supply, and may prevent the emergence of drug resistance .Prevention of drug resistance is just one of the potential benefits of the use of FDCs. FDCs simplify administration of drugs by reducing the number of pills a patient takes each day and decreasing the risk of incorrect prescriptions. Most tuberculosis patients need only take 3–4 FDCs tablets per day during the intensive phase of treatment, instead of the 15–16 tablets per day that is common with single-drug formulations It is much simpler to explain to patients that they need to take four tablets of the same type and colour, rather than a mixture of tablets of different shapes, colours and sizes. Also, the chance of taking an incomplete combination of drugs is eliminated, since the four essential drugs are combined into one tablet. FDCs are also simpler for care-givers as they minimize the risk of confusion. Finally, drug procurement, in all its components (stock management, shipping, distribution, is simplified by FDCs. Adverse reactions to drugs are not more

  18. Evaluation of immune responses in HIV infected patients with pleural tuberculosis by the QuantiFERON® TB-Gold interferon-gamma assay

    Directory of Open Access Journals (Sweden)

    Lekabe Jacob M

    2008-03-01

    Full Text Available Abstract Background Diagnosis of tuberculous (TB pleuritis is difficult and better diagnostic tools are needed. New blood based interferon-gamma (IFN-γ tests are promising, but sensitivity could be low in HIV positive patients. The IFN-γ tests have not yet been validated for use in pleural fluid, a compartment with higher level of immune activation than in blood. Methods The QuantiFERON TB®-Gold (QFT-TB test was analysed in blood and pleural fluid from 34 patients presenting with clinically suspected pleural TB. Clinical data, HIV status and CD4 cell counts were recorded. Adenosine deaminase activity (ADA analysis and TB culture were performed on pleural fluid. Results The patients were categorised as 'confirmed TB' (n = 12, 'probable TB' (n = 16 and 'non-TB' pleuritis (n = 6 based on TB culture results and clinical and biochemical criteria. The majority of the TB patients were HIV infected (82%. The QFT-TB in pleural fluid was positive in 27% and 56% of the 'confirmed TB' and 'probable TB' cases, respectively, whereas the corresponding sensitivities in blood were 58% and 83%. Indeterminate results in blood (25% were caused by low phytohemagglutinin (PHA = positive control IFN-γ responses, significantly lower in the TB patients as compared to the 'non-TB' cases (p = 0.02. Blood PHA responses correlated with CD4 cell count (r = 0.600, p = 0.028. In contrast, in pleural fluid indeterminate results (52% were caused by high Nil (negative control IFN-γ responses in both TB groups. Still, the Nil IFN-γ responses were lower than the TB antigen responses (p Conclusion The QFT-TB test in blood could contribute to the diagnosis of TB pleuritis in the HIV positive population. Still, the number of inconclusive results is too high to recommend the commercial QFT-TB test for routine use in pleural fluid in a TB/HIV endemic resource-limited setting.

  19. Latent tuberculosis infection in individuals with human immunodeficiency virus infection: comparison of tuberculin skin test to the anti TB-IgM antibodies

    International Nuclear Information System (INIS)

    Alvi, S.M.; Nadimi, M.; Shokri, S.; Zamani, G.A.

    2010-01-01

    To determine Latent Tuberculosis Infection (LTBI) prevalence and compare TST results to the anti TB-IgM anti bodies (ATIA) for the diagnosis of LTBI in HIV infected individuals. Sixty two randomized sampled HIV infected subjects from an addict treatment center in Ahvaz southwest Iran underwent TST, using 5 TU of purified protein derivative, and measuring ATIA. Data were analyzed in SPSS (version 16, USA). Of 62 participants, 34 (54.8%) had positive result for TST, whereas 6(9.7%) had positive ATIA. Overall concordance between TST and ATIA was 45.2% (Kappa= 0.37, P = 0.32). In subjects with positive test results by either TST or ATIA, only 4.8% had positive test results by both tests. Discordant results were found in 54.8% of subjects. Positive results for both tests in subjects categorized in two groups (above and below 200 CD4-cell/mm3) had no significant difference (P>0.05). LTBI prevalence among HIV infected individuals in studied area is higher than other parts of the world. TST is a useful test for LTBI diagnosis and prefer to ATIA. Concordance between TST and ATIA is low. (author)

  20. Controlled-release approaches towards the chemotherapy of tuberculosis

    Directory of Open Access Journals (Sweden)

    Saifullah B

    2012-10-01

    Full Text Available Bullo Saifullah,1 Mohd Zobir B Hussein,1,2 Samer Hasan Hussein Al Ali11Department of Chemistry, Faculty of Science, Universiti Putra Malaysia, Serdang, Selangor, Malaysia; 2Advanced Materials and Nanotechnology Laboratory, Institute of Advanced Technology, Universiti Putra Malaysia, Serdang, Selangor, MalaysiaAbstract: Tuberculosis (TB, caused by the bacteria Mycobacterium tuberculosis, is notorious for its lethality to humans. Despite technological advances, the tubercle bacillus continues to threaten humans. According to the World Health Organization's 2011 global report on TB, 8.8 million cases of TB were reported in 2010, with a loss of 1.7 million human lives. As drug-susceptible TB requires long-term treatment of between 6 and 9 months, patient noncompliance remains the most important reason for treatment failure. For multidrug-resistant TB, patients must take second-line anti-TB drugs for 18–24 months and many adverse effects are associated with these drugs. Drug-delivery systems (DDSs seem to be the most promising option for advancement in the treatment of TB. DDSs reduce the adverse effects of drugs and their dosing frequency as well as shorten the treatment period, and hence improve patient compliance. Further advantages of these systems are that they target the disease area, release the drugs in a sustained manner, and are biocompatible. In addition, targeted delivery systems may be useful in dealing with extensively drug-resistant TB because many side effects are associated with the drugs used to cure the disease. In this paper, we discuss the DDSs developed for the targeted and slow delivery of anti-TB drugs and their possible advantages and disadvantages.Keywords: Mycobacterium tuberculosis, drug-delivery system, targeted delivery, anti-TB drug, TB, patient compliance

  1. International tuberculosis research collaborations within Asia.

    Science.gov (United States)

    Molton, James S; Singh, Shweta; Chen, Ling Jun; Paton, Nicholas I

    2017-09-07

    Asia bears more than half the global tuberculosis (TB) burden. Economic development in the region has increased available funding for biomedical research and opportunity for collaboration. We explored the extent of international tuberculosis research collaborations between institutions within Asia. We conducted a Pubmed search for all articles with tuberculosis in the title published during a 12 month period with at least one author affiliation listed in Asia, then identified international collaborations from institution websites and internet searches. We identified 99 international collaborations involving an institution within Asia, of which only 8 (8.1%) were collaborations between Asian institutions. The remainder were with institutions outside of Asia. The paucity of intra-Asian international research collaboration represents a lost opportunity to optimise regional research funding, capacity building and the development of an Asia-relevant TB research agenda.

  2. Taking medicines to treat tuberculosis

    Science.gov (United States)

    Tuberculosis - medicines; DOT; Directly observed therapy; TB - medicines ... Ellner JJ. Tuberculosis. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: Elsevier Saunders; 2016:chap 324. ...

  3. TB Terms

    Science.gov (United States)

    ... sputum can also be used to do a culture. TB blood test – a test that uses a blood sample to find out if you are infected with TB bacteria. The test measures the response to TB proteins when they are mixed with a small amount of blood. Examples of these TB blood tests include QuantiFERON ® -TB ...

  4. Pleural tuberculosis: A concise clinical review.

    Science.gov (United States)

    Shaw, Jane A; Irusen, Elvis M; Diacon, Andreas H; Koegelenberg, Coenraad F

    2018-05-01

    Tuberculosis (TB) is the leading infectious cause of death worldwide, and the commonest cause of death in people living with HIV. Globally, pleural TB remains one of the most frequent causes of pleural exudates, particularly in TB-endemic areas and in the HIV positive population. Most TB pleural effusions are exudates with high adenosine deaminase (ADA), lymphocyte-rich, straw-coloured and free flowing, with a low yield on mycobacterial culture. TB pleurisy can also present as loculated neutrophil-predominant effusions which mimic parapneumonic effusions. Rarely, they can present as frank TB empyema, containing an abundance of mycobacteria. Up to 80% of patients have parenchymal involvement on chest imaging. The diagnosis is simple if M. tuberculosis is detected in sputum, pleural fluid or biopsy specimens, and the recent advent of liquid medium culture techniques has increased the microbiological yield dramatically. Where the prevalence of TB is high the presence of a lymphocyte-predominant exudate with a high ADA has a positive predictive value of 98%. In low prevalence areas, the absence of an elevated ADA and lymphocyte predominance makes TB very unlikely, and pleural biopsy should be performed to confirm the diagnosis. Pleural biopsy for liquid culture and susceptibility testing must also be considered where the prevalence of drug resistant TB is high. Treatment regimens are identical to those administered for pulmonary TB. Initial pleural drainage may have a role in symptom relief and in hastening the resolution of the effusion. Surgical intervention may be required in loculated effusions and empyemas. © 2018 John Wiley & Sons Ltd.

  5. European policies in the management of tuberculosis among migrants

    Directory of Open Access Journals (Sweden)

    Lia D’Ambrosio

    2017-03-01

    Full Text Available Globally 10.4 million new tuberculosis (TB incident cases were estimated to have occurred in 2015, of which 3% were reported in the World Health Organization European Region. Importantly, about 25% of the global multidrug-resistant TB (MDR-TB cases are reported in the European Region, representing one of the greatest challenges to TB control; these are reported particularly in the countries of the Former Soviet Union. Over a quarter of TB cases in the European Union and European Economic Area (EU/EEA are reported among foreign-born individuals. In line with the recent increase of migration flows towards Europe, TB among migrant populations is also on the rise, emphasizing the need for a better understanding of the TB trends at the regional and sub-regional levels, and of the existing policies on migrants and refugees. The present article is aimed at describing the policies and practices of European countries with a low and intermediate TB incidence with regard to the detection and management of TB and latent TB infection (LTBI among refugees in Europe.

  6. Overview of drug-resistant tuberculosis worldwide

    Directory of Open Access Journals (Sweden)

    Ali A Velayati

    2016-01-01

    Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

  7. Space-time clustering characteristics of tuberculosis in China, 2005-2011.

    Directory of Open Access Journals (Sweden)

    Fei Zhao

    Full Text Available OBJECTIVES: China is one of the 22 tuberculosis (TB high-burden countries in the world. As TB is a major public health problem in China, spatial analysis could be applied to detect geographic distribution of TB clusters for targeted intervention on TB epidemics. METHODS: Spatial analysis was applied for detecting TB clusters on county-based TB notification data in the national notifiable infectious disease case reporting surveillance system from 2005 to 2011. Two indicators of TB epidemic were used including new sputum smear-positive (SS+ notification rate and total TB notification rate. Global Moran's I by ArcGIS was used to assess whether TB clustering and its trend were significant. SaTScan software that used the retrospective space-time analysis and Possion probability model was utilized to identify geographic areas and time period of potential clusters with notification rates on county-level from 2005 to 2011. RESULTS: Two indicators of TB notification had presented significant spatial autocorrelation globally each year (p<0.01. Global Moran's I of total TB notification rate had positive trend as time went by (t=6.87, p<0.01. The most likely clusters of two indicators had similar spatial distribution and size in the south-central regions of China from 2006 to 2008, and the secondary clusters in two regions: northeastern China and western China. Besides, the secondary clusters of total TB notification rate had two more large clustering centers in Inner Mongolia, Gansu and Qinghai provinces and several smaller clusters in Shanxi, Henan, Hebei and Jiangsu provinces. CONCLUSION: The total TB notification cases clustered significantly in some special areas each year and the clusters trended to aggregate with time. The most-likely and secondary clusters that overlapped among two TB indicators had higher TB burden and risks of TB transmission. These were the focused geographic areas where TB control efforts should be prioritized.

  8. Serial QuantiFERON-TB Gold In-Tube assay and tuberculin skin test to diagnose latent tuberculosis in household Mexican contacts: conversion and reversion rates and associated factors using conventional and borderline zone definitions

    Directory of Open Access Journals (Sweden)

    Joel Monárrez-Espino

    2014-11-01

    Full Text Available A cohort of 123 adult contacts was followed for 18‐24 months (86 completed the follow-up to compare conversion and reversion rates based on two serial measures of QuantiFERON (QFT and tuberculin skin test (TST (PPD from TUBERSOL, Aventis Pasteur, Canada for diagnosing latent tuberculosis (TB in household contacts of TB patients using conventional (C and borderline zone (BZ definitions. Questionnaires were used to obtain information regarding TB exposure, TB risk factors and socio-demographic data. QFT (IU/mL conversion was defined as 0.70 (BZ and reversion was defined as ≥0.35 to 10 (BZ and reversion was defined as ≥5 to <5 (C. The QFT conversion and reversion rates were 10.5% and 7% with C and 8.1% and 4.7% with the BZ definitions, respectively. The TST rates were higher compared with QFT, especially with the C definitions (conversion 23.3%, reversion 9.3%. The QFT conversion and reversion rates were higher for TST ≥5; for TST, both rates were lower for QFT <0.35. No risk factors were associated with the probability of converting or reverting. The inconsistency and apparent randomness of serial testing is confusing and adds to the limitations of these tests and definitions to follow-up close TB contacts.

  9. Digital health for the End TB Strategy: developing priority products and making them work.

    Science.gov (United States)

    Falzon, Dennis; Timimi, Hazim; Kurosinski, Pascal; Migliori, Giovanni Battista; Van Gemert, Wayne; Denkinger, Claudia; Isaacs, Chris; Story, Alistair; Garfein, Richard S; do Valle Bastos, Luis Gustavo; Yassin, Mohammed A; Rusovich, Valiantsin; Skrahina, Alena; Van Hoi, Le; Broger, Tobias; Abubakar, Ibrahim; Hayward, Andrew; Thomas, Bruce V; Temesgen, Zelalem; Quraishi, Subhi; von Delft, Dalene; Jaramillo, Ernesto; Weyer, Karin; Raviglione, Mario C

    2016-07-01

    In 2014, the World Health Organization (WHO) developed the End TB Strategy in response to a World Health Assembly Resolution requesting Member States to end the worldwide epidemic of tuberculosis (TB) by 2035. For the strategy's objectives to be realised, the next 20 years will need novel solutions to address the challenges posed by TB to health professionals, and to affected people and communities. Information and communication technology presents opportunities for innovative approaches to support TB efforts in patient care, surveillance, programme management and electronic learning. The effective application of digital health products at a large scale and their continued development need the engagement of TB patients and their caregivers, innovators, funders, policy-makers, advocacy groups, and affected communities.In April 2015, WHO established its Global Task Force on Digital Health for TB to advocate and support the development of digital health innovations in global efforts to improve TB care and prevention. We outline the group's approach to stewarding this process in alignment with the three pillars of the End TB Strategy. The supplementary material of this article includes target product profiles, as developed by early 2016, defining nine priority digital health concepts and products that are strategically positioned to enhance TB action at the country level. The content of this work is ©the authors or their employers. Design and branding are ©ERS 2016.

  10. Paediatric TB/HIV co-infection – 'an uncompromising duet that ...

    African Journals Online (AJOL)

    2011-10-01

    Oct 1, 2011 ... tuberculosis (TB) in 2009, childhood TB accounted for 11% (884 000 cases).1 ... reduction in incident TB in ART-treated children compared with ..... Obesity is associated with an increased risk of miscarriage but its effect on.

  11. Colworth prize lecture 2016: exploiting new biological targets from a whole-cell phenotypic screening campaign for TB drug discovery.

    Science.gov (United States)

    Moynihan, Patrick Joseph; Besra, Gurdyal S

    2017-10-01

    Mycobacterium tuberculosis is the aetiological agent of tuberculosis (TB) and is the leading bacterial cause of mortality and morbidity in the world. One third of the world's population is infected with TB, and in conjunction with HIV represents a serious problem that urgently needs addressing. TB is a disease of poverty and mostly affects young adults in their productive years, primarily in the developing world. The most recent report from the World Health Organisation states that 8 million new cases of TB were reported and that ~1.5 million people died from TB. The efficacy of treatment is threatened by the emergence of multi-drug and extensively drug-resistant strains of M. tuberculosis. It can be argued that, globally, M. tuberculosis is the single most important infectious agent affecting mankind. Our research aims to establish an academic-industrial partnership with the goal of discovering new drug targets and hit-to-lead new chemical entities for TB drug discovery.

  12. Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

    Science.gov (United States)

    Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

    2010-06-01

    The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

  13. Tuberculosis-a World Health Organization Perspective.

    Science.gov (United States)

    Sotgiu, Giovanni; Sulis, Giorgia; Matteelli, Alberto

    2017-01-01

    Tuberculosis (TB) is an important cause of morbidity and mortality worldwide. The World Health Organization (WHO) has implemented and scaled-up three important global public health strategies (i.e., DOTS, Stop TB, and End TB) to improve the international scenario. Their epidemiological impact was relevant, as they decreased the number of potential new cases of disease and death. However, the emergence and spread of TB/HIV coinfection and multidrug-resistant TB have hindered the progress towards the elimination of TB by 2050. More efforts are required to increase the global annual decline of the TB incidence rate. Political commitment is necessary, with global and national strategies oriented to the adoption and adaptation of the international, evidence-based recommendations on diagnosis, treatment, and prevention. Research and development activities should be planned to improve the current tools adopted to fight the disease. New rapid diagnostics, an updated and effective therapeutic armamentarium, and an effective preventive vaccine could represent the solution to address the current epidemiological threats.

  14. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability

    OpenAIRE

    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.

    2017-01-01

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  15. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

    Science.gov (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-06-01

    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  16. Large-scale genomic analysis shows association between homoplastic genetic variation in Mycobacterium tuberculosis genes and meningeal or pulmonary tuberculosis.

    NARCIS (Netherlands)

    Ruesen, Carolien; Chaidir, Lidya; van Laarhoven, Arjan; Dian, Sofiati; Ganiem, Ahmad Rizal; Nebenzahl-Guimaraes, Hanna; Huynen, Martijn A; Alisjahbana, Bachti; Dutilh, Bas E; van Crevel, Reinout

    2018-01-01

    Meningitis is the most severe manifestation of tuberculosis. It is largely unknown why some people develop pulmonary TB (PTB) and others TB meningitis (TBM); we examined if the genetic background of infecting M. tuberculosis strains may be relevant.

  17. The Emergence of Extensively Drug‐Resistant Tuberculosis: A Global Health Crisis Requiring New Interventions: Part I: The Origins and Nature of the Problem

    OpenAIRE

    Ellner, Jerrold J.

    2008-01-01

    Surveillance studies and outbreak investigations indicate that an extensively drug‐resistant (XDR) form of tuberculosis (TB) is increasing in prevalence worldwide. In outbreak settings among HIV‐infected, there is a high‐case fatality rate. Better outcomes occur in HIV‐uninfected, particularly if drug susceptibility test (DST) results are available rapidly to allow tailoring of drug therapy. This review will be presented in two segments. The first characterizes the problem posed by XDR‐TB, ad...

  18. Can Brazil play a more important role in global tuberculosis drug production? An assessment of current capacity and challenges.

    Science.gov (United States)

    Gemal, Andre; Keravec, Joel; Menezes, Alexandre; Trajman, Anete

    2013-03-27

    Despite the existence of effective treatment, tuberculosis is still a global public health issue. The World Health Organization recommends a six-month four-drug regimen in fixed-dose combination formulation to treat drug sensitive tuberculosis, and long course regimens with several second-line drugs to treat multi-drug resistant tuberculosis. To achieve the projected tuberculosis elimination goal by 2050, it will be essential to ensure a non-interrupted supply of quality-assured tuberculosis drugs. However, quality and affordable tuberculosis drug supply is still a significant challenge for National Tuberculosis Programs. Quality drug production requires a combination of complex steps. The first challenge is to guarantee the quality of tuberculosis active pharmaceutical ingredients, then ensure an adequate manufacturing process, according to international standards, to guarantee final product's safety, efficacy and quality. Good practices for storage, transport, distribution and quality control procedures must follow. In contrast to other high-burden countries, Brazil produces tuberculosis drugs through a strong network of public sector drug manufacturers regulated by a World Health Organization-certified national sanitary authority. The installed capacity for production surpasses the 71,000 needed treatments in the country. However, in order to be prepared to act as a global supplier, important bottlenecks are to be overcome. This article presents an in-depth analysis of the current status of production of tuberculosis drugs in Brazil and the bottlenecks and opportunities for the country to sustain national demand and play a role as a potential global supplier. Raw material and drug production, quality control, international certification and pre-qualification, political commitment and regulatory aspects are discussed, as well recommendations for tackling these bottlenecks. This discussion becomes more important as new drugs and regimens to treat tuberculosis are

  19. Tuberculosis and Stigmatization: Pathways and Interventions

    OpenAIRE

    Courtwright, Andrew; Turner, Abigail Norris

    2010-01-01

    The institutional and community norms that lead to the stigmatization of tuberculosis (TB) are thought to hinder TB control. We performed a systematic review of the literature on TB stigma to identify the causes and evaluate the impact of stigma on TB diagnosis and treatment. Several themes emerged: fear of infection is the most common cause of TB stigma; TB stigma has serious socioeconomic consequences, particularly for women; qualitative approaches to measuring TB stigma are more commonly u...

  20. Assessing the impact of defining a global priority research agenda to address HIV-associated tuberculosis.

    Science.gov (United States)

    Odone, Anna; Matteelli, Alberto; Chiesa, Valentina; Cella, Paola; Ferrari, Antonio; Pezzetti, Federica; Signorelli, Carlo; Getahun, Haileyesus

    2016-11-01

    In 2010, the WHO issued 77 priority research questions (PRQs) to address HIV-associated TB. Objective of the this study was to assess the impact of defining the research agenda in stimulating and directing research around priority research questions. We used number and type of scientific publications as a proxy to quantitatively assess the impact of research agenda setting. We conducted 77 single systematic reviews - one for every PRQ - building 77 different search strategies using PRQs' keywords. Multivariate logistic regression models were applied to assess the quantity and quality of research produced over time and accounting for selected covariates. In 2009-2015, PRQs were addressed by 1631 publications (median: 11 studies published per PRQ, range 1-96). The most published area was 'Intensified TB case finding' (median: 23 studies/PRQ, range: 2-74). The majority (62.1%, n = 1013) were published as original studies, and more than half (58%, n = 585) were conducted in the African region. Original studies' publication increased over the study period (P trend = <0.001). They focused more on the 'Intensified TB case finding' (OR = 2.17, 95% CI: 1.56-2.93) and 'Drug-resistant TB and HIV infection' (OR = 2.12, 95% CI: 1.47-3.06) areas than non-original studies. Original studies were published in journals of lower impact factor and received a smaller number of citations than non-original studies (OR = 0.54, 95% CI: 0.42-0.69). The generation of evidence to address PRQs has increased over time particularly in selected fields. Setting a priority research agenda for HIV-associated TB might have positively influenced the direction and the conduct of research and contributed to the global response to such a major threat to health. © 2016 John Wiley & Sons Ltd.

  1. Tuberculosis

    OpenAIRE

    Juan Carlos Rodríguez, D.

    2014-01-01

    La tuberculosis sigue constituyendo un problema de salud pública a nivel mundial con casi nueve millones de casos nuevos en 2012 y se estima que un tercio de la humanidad está infectada. A nivel nacional, si bien las tasas son alentadoras, la variación regional es muy importante. En los últimos años se han registrado progresos importantes tanto en el conocimiento de la conducta del bacilo de Koch, el causante de la enfermedad, como en los métodos para detectarlo. Así los IGRAS (Interferon G R...

  2. The impact of HIV status and antiretroviral treatment on TB treatment outcomes of new tuberculosis patients attending co-located TB and ART services in South Africa: a retrospective cohort study.

    Science.gov (United States)

    Nglazi, Mweete D; Bekker, Linda-Gail; Wood, Robin; Kaplan, Richard

    2015-11-19

    The implementation of collaborative TB-HIV services is challenging. We, therefore, assessed TB treatment outcomes in relation to HIV infection and antiretroviral therapy (ART) among TB patients attending a primary care service with co-located ART and TB clinics in Cape Town, South Africa. In this retrospective cohort study, all new TB patients aged ≥ 15 years who registered and initiated TB treatment between 1 October 2009 and 30 June 2011 were identified from an electronic database. The effects of HIV-infection and ART on TB treatment outcomes were analysed using a multinomial logistic regression model, in which treatment success was the reference outcome. The 797 new TB patients included in the analysis were categorized as follows: HIV- negative, in 325 patients (40.8 %); HIV-positive on ART, in 339 patients (42.5 %) and HIV-positive not on ART, in 133 patients (16.7 %). Overall, bivariate analyses showed no significant difference in death and default rates between HIV-positive TB patients on ART and HIV-negative patients. Statistically significant higher mortality rates were found among HIV-positive patients not on ART compared to HIV-negative patients (unadjusted odds ratio (OR) 3.25; 95 % confidence interval (CI) 1.53-6.91). When multivariate analyses were conducted, the only significant difference between the patient categories on TB treatment outcomes was that HIV-positive TB patients not on ART had significantly higher mortality rates than HIV-negative patients (adjusted OR 4.12; 95 % CI 1.76-9.66). Among HIV-positive TB patients (n = 472), 28.2 % deemed eligible did not initiate ART in spite of the co-location of TB and ART services. When multivariate analyses were restricted to HIV-positive patients in the cohort, we found that being HIV-positive not on ART was associated with higher mortality (adjusted OR 7.12; 95 % CI 2.95-18.47) and higher default rates (adjusted OR 2.27; 95 % CI 1.15-4.47). There was no significant difference in death and

  3. Managing latent tuberculosis infection and tuberculosis in children

    Directory of Open Access Journals (Sweden)

    I. Carvalho

    2018-03-01

    Full Text Available Tuberculosis (TB is a major cause of childhood morbidity and mortality worldwide. The aim of this review is to describe the management of the child with TB and latent tuberculosis infection (LTBI.To develop this article, a working group reviewed relevant epidemiological and other scientific studies and established practices in conducting LBTI and TB in children. The article describes how to manage the child with LTBI, considering transmission and infectiousness of tuberculosis, contact screening and prioritization of contacts and recommendations on treatment of children with LTBI and how to manage the child with TB considering the susceptibility of children to developing tuberculosis, epidemiology and classification of tuberculosis in children, diagnosis and treatment. Keywords: Tuberculosis, Pediatric, Childhood, Latent tuberculosis infection

  4. Estimating the tuberculosis burden in resource-limited countries: a capture-recapture study in Yemen.

    Science.gov (United States)

    Bassili, A; Al-Hammadi, A; Al-Absi, A; Glaziou, P; Seita, A; Abubakar, I; Bierrenbach, A L; van Hest, N A

    2013-04-01

    The lack of applicable population-based methods to measure tuberculosis (TB) incidence rates directly at country level emphasises the global need to generate robust TB surveillance data to ascertain trends in disease burden and to assess the performance of TB control programmes in the context of the United Nations Millenium Development Goals and World Health Organization targets for TB control. To estimate the incidence of TB cases (all forms) and sputum smear-positive disease, and the level of under-reporting of TB in Yemen in 2010. Record-linkage and three-source capture-recapture analysis of data collected through active prospective longitudinal surveillance within the public and private non-National Tuberculosis Programme sector in twelve Yemeni governorates, selected by stratified cluster random sampling. For all TB cases, the estimated ratio of notified to incident cases and completeness of case ascertainment after record linkage, i.e., the ratio of detected to incident cases, was respectively 71% (95%CI 64-80) and 75% (95%CI 68-85). For sputum smear-positive TB cases, these ratios were respectively 67% (95%CI 58-75) and 76% (95%CI 66-84). We estimate that there were 13 082 (95%CI 11 610-14 513) TB cases in Yemen in 2010. Under-reporting of TB in Yemen is estimated at 29% (95%CI 20-36).

  5. Smoking habit as a risk factor in tuberculosis: a case-control study

    Directory of Open Access Journals (Sweden)

    Edhyana Sahiratmadja

    2016-02-01

    Full Text Available Indonesia is fifth in the tuberculosis (TB prevalence globally and this country is one of the largest tobacco producers. Smoking has been reported to be an important risk factor for TB and a reduction in smoking could be expected to have a significant impact on TB incidence and prevalence. However, studies from various countries yielded conflicting results. Our study aims to explore the association between smoking and TB in Indonesia as TB-endemic country. In two major cities of Indonesia, Jakarta and Bandung, a case-control study had been conducted. TB was diagnosed based on WHO criteria including clinical presentation, and chest X-ray (CXR examination, and confirmed by microscopic detection of acid-fast bacilli in Ziehl-Nielsen stained sputum smears or by culture of M. tuberculosis. Newly diagnosed smear-positive pulmonary TB patients (n=802 and their spouses (n=253 or sex-matched neighborhood controls (n=534 were interviewed about their smoking habits. An extensive questionnaire was used to collect data about smoking habits of both patients and controls. Smoking categories were grouped into ever (for current/past smokers and never. Our study result showed that smoking appears not to be strongly associated with TB (OR=0.99, 95% CI 0.76-1.31. The reasons for the effect heterogeneity remain to be elucidated as smoking is a lethal habit and should be well controlled. The need to incorporate tobacco cessation programs into TB treatment is strongly recommended to improve TB control.

  6. Smoking habit as a risk factor in tuberculosis: a case-control study

    Directory of Open Access Journals (Sweden)

    Edhyana Sahiratmadja

    2011-12-01

    Full Text Available Indonesia is fifth in the tuberculosis (TB prevalence globally and this country is one of the largest tobacco producers. Smoking has been reported to be an important risk factor for TB and a reduction in smoking could be expected to have a significant impact on TB incidence and prevalence. However, studies from various countries yielded conflicting results. Our study aims to explore the association between smoking and TB in Indonesia as TB-endemic country. In two major cities of Indonesia, Jakarta and Bandung, a case-control study had been conducted. TB was diagnosed based on WHO criteria including clinical presentation, and chest X-ray (CXR examination, and confirmed by microscopic detection of acid-fast bacilli in Ziehl-Nielsen stained sputum smears or by culture of M. tuberculosis. Newly diagnosed smear-positive pulmonary TB patients (n=802 and their spouses (n=253 or sex-matched neighborhood controls (n=534 were interviewed about their smoking habits. An extensive questionnaire was used to collect data about smoking habits of both patients and controls. Smoking categories were grouped into ever (for current/past smokers and never. Our study result showed that smoking appears not to be strongly associated with TB (OR=0.99, 95% CI 0.76-1.31. The reasons for the effect heterogeneity remain to be elucidated as smoking is a lethal habit and should be well controlled. The need to incorporate tobacco cessation programs into TB treatment is strongly recommended to improve TB control.

  7. Using giant African pouched rats to detect human tuberculosis

    African Journals Online (AJOL)

    ebutamanya

    2015-08-31

    Aug 31, 2015 ... Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. About one-third of Earth's population has latent TB, which means that they have been exposed to M. tuberculosis but not become ill. About 10% of people with latent TB develop active. TB, that is, they become ill with the disease, ...

  8. Diagnostic accuracy, incremental yield and prognostic value of Determine TB-LAM for routine diagnostic testing for tuberculosis in HIV-infected patients requiring acute hospital admission in South Africa: a prospective cohort.

    Science.gov (United States)

    Lawn, Stephen D; Kerkhoff, Andrew D; Burton, Rosie; Schutz, Charlotte; Boulle, Andrew; Vogt, Monica; Gupta-Wright, Ankur; Nicol, Mark P; Meintjes, Graeme

    2017-03-21

    We previously reported that one-third of HIV-positive adults requiring medical admission to a South African district hospital had laboratory-confirmed tuberculosis (TB) and that almost two-thirds of cases could be rapidly diagnosed using Xpert MTB/RIF-testing of concentrated urine samples obtained on the first day of admission. Implementation of urine-based, routine, point-of-care TB screening is an attractive intervention that might be facilitated by use of a simple, low-cost diagnostic tool, such as the Determine TB-LAM lateral-flow rapid test for HIV-associated TB. Sputum, urine and blood samples were systematically obtained from unselected HIV-positive adults within 24 hours of admission to a South African township hospital. Additional clinical samples were obtained during hospitalization as clinically indicated. TB was defined by the detection of Mycobacterium tuberculosis in any sample using Xpert MTB/RIF or liquid culture. The diagnostic yield, accuracy and prognostic value of urine-lipoarabinomannan (LAM) testing were determined, but urine-LAM results did not inform treatment decisions. Consecutive HIV-positive adult acute medical admissions not already receiving TB treatment (n = 427) were enrolled regardless of clinical presentation or symptoms. TB was diagnosed in 139 patients (TB prevalence 32.6%; median CD4 count 80 cells/μL). In the first 24 hours of admission, sputum (spot and/or induced) samples were obtained from 37.0% of patients and urine samples from 99.5% of patients (P < 0.001). The diagnostic yields from these specimens were 19.4% (n = 27/139) for sputum-microscopy, 26.6% (n = 37/139) for sputum-Xpert, 38.1% (n = 53/139) for urine-LAM and 52.5% (n = 73/139) for sputum-Xpert/urine-LAM combined (P < 0.01). Corresponding yields among patients with CD4 counts <100 cells/μL were 18.9%, 24.3%, 55.4% and 63.5%, respectively (P < 0.01). The diagnostic yield of urine-LAM was unrelated to respiratory symptoms, and

  9. Primary and secondary anti-tuberculosis drug resistance in Hitossa District of Arsi Zone, Oromia Regional State, Central Ethiopia

    Directory of Open Access Journals (Sweden)

    Shallo Daba Hamusse

    2016-07-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB drugs which is resistant to the major first-line anti-TB drugs, Isoniazid and Rifampicin, has become a major global challenge in tuberculosis (TB control programme. However, its burden at community level is not well known. Thus, the aim of study was to assess the prevalence of primary and secondary resistance to any first line anti-TB drugs and MDR TB in Hitossa District of Oromia Regional State, Central Ethiopia. Methods Population based cross- sectional study was conducted on individuals aged ≥15 years. Those with symptoms suggestive of TB were interviewed and two sputum specimens were collected from each and examined using Lowenstein-Jensen (LJ culture medium. Further, the isolates were confirmed by the Ziehl-Neelsen microscopic examination method. Drug susceptibility test (DST was also conducted on LJ medium using a simplified indirect proportion method. The resistance strains were then determined by percentage of colonies that grew on the critical concentration of Isoniazid, Streptomycin, Rifampicin and Ethambutol. Results The overall resistance of all forms of TB to any first-line anti-TB drug was 21.7 %. Of the total new and previously treated culture positive TB cases, 15.3 and 48.8 % respectively were found to be a resistant to any of the first-line anti-TB drugs. Further, of all forms of TB, the overall resistance of MDR-TB was 4.7 %. However, of the total new TB cases, 2.4 % had primary while 14.3 % had secondary MDR-TB. Resistance to any of the first-line anti-TB drugs (adjusted odd ratio (AOR, 8.1; 95 % CI: 2.26–29.30 and MDR-TB (AOR, 7.1; 95 % CI: 2.6–43.8 was found to be linked with previous history of anti-TB treatment. Conclusions The study has identified a high rate of primary and secondary resistance to any of the first-line anti-TB drugs and MDR-TB in the study area. The resistance may have resulted from sub-optimal performance of directly observed

  10. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  11. Improving Tuberculosis Case Finding in Indonesia

    NARCIS (Netherlands)

    R.A. Ahmad (Riris)

    2011-01-01

    textabstractTuberculosis (TB) is an infectious disease caused by the bacterium Mycobacterium tuberculosis. The most frequent clinical manifestation of the disease is pulmonary TB, but it can affect any part of the body (extra-pulmonary TB), including the skin, lymph nodes, spine, joints,

  12. High prevalence of tuberculosis diagnosed during autopsy ...

    African Journals Online (AJOL)

    The primary aims of tuberculosis (TB) control programmes is early diagnosis and prompt treatment of infectious cases to limit transmission. Failure to diagnose and adequately treat TB could lead to premature death and unrecognized transmission of Mycobacterium tuberculosis. The proportion of missed TB cases has not ...

  13. Low sputum smear positive tuberculosis among pulmonary ...

    African Journals Online (AJOL)

    Low sputum smear positive tuberculosis among pulmonary tuberculosis suspects in a tertiary hospital in Mwanza, Tanzania. ... The risk factors among smear positive TB patients were co-illness (32.5%), previous history of TB (7.5%) and history of positive TB contact (4.7%). These findings also show that as CD4+ T Cells ...

  14. Atypical tuberculosis presenting with primary infertility and ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is caused by mycobacterium tuberculosis. It remains a public health concern especially in developing country. Pulmonary infection is the main presentation. However, genitourinary TB is common especially with the increase in Human Immunodeficiency virus (HIV) infection. Genitourinary TB is one of the ...

  15. Disease-related knowledge, attitude and practices of tuberculosis ...

    African Journals Online (AJOL)

    Preferred Customer

    BACKGROUND: Tuberculosis (TB) is a major public health problem. World Health ... hospitals were interviewed on their knowledge, attitude and practice related to TB using pre-tested ..... patients exercise care to limit the spread of. TB, only ...

  16. HIV-infected presumptive tuberculosis patients without tuberculosis: How many are eligible for antiretroviral therapy in Karnataka, India?

    Directory of Open Access Journals (Sweden)

    Ajay M.V. Kumar

    2017-03-01

    Full Text Available For certain subgroups within people living with the human immunodeficiency virus (HIV [active tuberculosis (TB, pregnant women, children <5 years old, and serodiscordant couples], the World Health Organization recommends antiretroviral therapy (ART irrespective of CD4 count. Another subgroup which has received increased attention is “HIV-infected presumptive TB patients without TB”. In this study, we assess the proportion of HIV-infected presumptive TB patients eligible for ART in Karnataka State (population 60 million, India. This was a cross-sectional analysis of data of HIV-infected presumptive TB patients diagnosed in May 2015 abstracted from national TB and HIV program records. Of 42,585 presumptive TB patients, 28,964 (68% were tested for HIV and 2262 (8% were HIV positive. Of the latter, 377 (17% had active TB. Of 1885 “presumptive TB patients without active TB”, 1100 (58% were already receiving ART. Of the remaining 785 who were not receiving ART, 617 (79% were assessed for ART eligibility and of those, 548 (89% were eligible for ART. About 90% of “HIV-infected presumptive TB patients without TB” were eligible for ART. This evidence supports a public health approach of starting all “HIV-infected presumptive TB patients without TB” on ART irrespective of CD4 count in line with global thinking about ‘test and treat’.

  17. Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.

    Science.gov (United States)

    Merker, Matthias; Blin, Camille; Mona, Stefano; Duforet-Frebourg, Nicolas; Lecher, Sophie; Willery, Eve; Blum, Michael G B; Rüsch-Gerdes, Sabine; Mokrousov, Igor; Aleksic, Eman; Allix-Béguec, Caroline; Antierens, Annick; Augustynowicz-Kopeć, Ewa; Ballif, Marie; Barletta, Francesca; Beck, Hans Peter; Barry, Clifton E; Bonnet, Maryline; Borroni, Emanuele; Campos-Herrero, Isolina; Cirillo, Daniela; Cox, Helen; Crowe, Suzanne; Crudu, Valeriu; Diel, Roland; Drobniewski, Francis; Fauville-Dufaux, Maryse; Gagneux, Sébastien; Ghebremichael, Solomon; Hanekom, Madeleine; Hoffner, Sven; Jiao, Wei-wei; Kalon, Stobdan; Kohl, Thomas A; Kontsevaya, Irina; Lillebæk, Troels; Maeda, Shinji; Nikolayevskyy, Vladyslav; Rasmussen, Michael; Rastogi, Nalin; Samper, Sofia; Sanchez-Padilla, Elisabeth; Savic, Branislava; Shamputa, Isdore Chola; Shen, Adong; Sng, Li-Hwei; Stakenas, Petras; Toit, Kadri; Varaine, Francis; Vukovic, Dragana; Wahl, Céline; Warren, Robin; Supply, Philip; Niemann, Stefan; Wirth, Thierry

    2015-03-01

    Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiated worldwide in several waves. We detected successive increases in population size for this pathogen over the last 200 years, practically coinciding with the Industrial Revolution, the First World War and HIV epidemics. Two MDR clones of this lineage started to spread throughout central Asia and Russia concomitantly with the collapse of the public health system in the former Soviet Union. Mutations identified in genes putatively under positive selection and associated with virulence might have favored the expansion of the most successful branches of the lineage.

  18. Beyond multidrug-resistant tuberculosis in Europe: a TBNET study

    NARCIS (Netherlands)

    Günther, G.; van Leth, F.; Altet, N.; Dedicoat, M.; Duarte, R.; Gualano, G.; Kunst, H.; Muylle, I.; Spinu, V.; Tiberi, S.; Viiklepp, P.; Lange, C.; Alexandru, S.; Cernenco, I.; Ciobanu, A.; Donica, A.; Cayla, J.; Fina, L.; Galvao, M. L. de Souza; Maldonado, J.; Avsar, K.; Bang, D.; Andersen, A. B.; Barbuta, R.; Dubceac, V.; Bothamley, G.; Crudu, V.; Davilovits, M.; Atunes, A.; de Lange, W.; Leimane, V.; Rusmane, L.; de Lorenzo, S.; Cuppen, F.; de Guchtenaire, I.; Magis-Escurra, C.; McLaughlin, A.-M.; Meesters, R.; te Pas, M.; Prins, B.; Mütterlein, R.; Kotrbova, J.; Polcová, V.; Vasakova, M.; Pontali, E.; Rumetshofer, R.; Rowhani, M.; Skrahina, A.; Avchinko, V.; Katovich, D.

    2015-01-01

    The emergence of drug-resistant tuberculosis (TB) is a challenge to TB control in Europe. We evaluated second-line drug susceptibility testing in Mycobacterium tuberculosis isolates from patients with multidrug-resistant, pre-extensively drug-resistant (pre-XDR-TB) and XDR-TB at 23 TBNET sites in 16

  19. Tuberculosis-Related Diabetes

    DEFF Research Database (Denmark)

    Aftab, Huma; Christensen, Dirk L.; Ambreen, Atiqa

    2017-01-01

    Individuals with newly diagnosed tuberculosis (TB) were screened for diabetes (DM) with fasting plasma glucose (FPG) in Pakistan. A significant decrease in FPG was observed when TB was treated. Of those with newly diagnosed DM, 46% and 62% no longer had hyperglycemia after 3 and 6 months, respect......Individuals with newly diagnosed tuberculosis (TB) were screened for diabetes (DM) with fasting plasma glucose (FPG) in Pakistan. A significant decrease in FPG was observed when TB was treated. Of those with newly diagnosed DM, 46% and 62% no longer had hyperglycemia after 3 and 6 months...

  20. Tuberculosis and mass gatherings-opportunities for defining burden, transmission risk, and the optimal surveillance, prevention, and control measures at the annual Hajj pilgrimage.

    Science.gov (United States)

    Zumla, Alimuddin; Saeed, Abdulaziz Bin; Alotaibi, Badriah; Yezli, Saber; Dar, Osman; Bieh, Kingsley; Bates, Matthew; Tayeb, Tamara; Mwaba, Peter; Shafi, Shuja; McCloskey, Brian; Petersen, Eskild; Azhar, Esam I

    2016-06-01

    Tuberculosis (TB) is now the most common infectious cause of death worldwide. In 2014, an estimated 9.6 million people developed active TB. There were an estimated three million people with active TB including 360000 with multidrug-resistant TB (MDR-TB) who were not diagnosed, and such people continue to fuel TB transmission in the community. Accurate data on the actual burden of TB and the transmission risk associated with mass gatherings are scarce and unreliable due to the small numbers studied and methodological issues. Every year, an estimated 10 million pilgrims from 184 countries travel to the Kingdom of Saudi Arabia (KSA) to perform the Hajj and Umrah pilgrimages. A large majority of pilgrims come from high TB burden and MDR-TB endemic areas and thus many may have undiagnosed active TB, sub-clinical TB, and latent TB infection. The Hajj pilgrimage provides unique opportunities for the KSA and the 184 countries from which pilgrims originate, to conduct high quality priority research studies on TB under the remit of the Global Centre for Mass Gatherings Medicine. Research opportunities are discussed, including those related to the definition of the TB burden, transmission risk, and the optimal surveillance, prevention, and control measures at the annual Hajj pilgrimage. The associated data are required to develop international recommendations and guidelines for TB management and control at mass gathering events. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Host immunity to Mycobacterium tuberculosis and risk of tuberculosis

    DEFF Research Database (Denmark)

    Michelsen, Sascha Wilk; Soborg, Bolette; Agger, Else-Marie

    2016-01-01

    BACKGROUND: Human immune responses to latent Mycobacterium tuberculosis (Mtb) infection (LTBI) may enable individuals to control Mtb infection and halt progression to tuberculosis (TB), a hypothesis applied in several novel TB vaccines. We aimed to evaluate whether immune responses to selected LTBI...

  2. Alto a la tuberculosis en mi generación: Un llamado a un mundo libre de tuberculosis. Podcast del Día Mundial de la Tuberculosis del 2013 (Stop TB in My Lifetime: A Call for a World Free of TBWorld TB Day 2013)

    Centers for Disease Control (CDC) Podcasts

    En este podcast el doctor Kenneth Castro, Director de la División de Eliminación de la Tuberculosis, habla sobre el Día Mundial de la Tuberculosis, así como del tema y eslogan de este año.

  3. A Pilot Trial of Jawarish Amla as Adjuvant to Anti-Tubercular Treatment Drugs for Control of Adverse Reactions in DOTS Regime in Pulmonary TB

    OpenAIRE

    Sherwani, Arish Mohammad Khan; Zulkifle, Mohammad; Rehmatulla,

    2013-01-01

    Background and objectives One of the greatest challenges of health care systems at the dawn of the 21st century is tuberculosis (TB). Drug resistant strains of TB are becoming a global public health risk. These strains commonly appear due to faulty therapies. Patients frequently stop treatment due to the toxicity of anti-tubercular treatment (ATT) drugs. Amla (Emblica officinalis) is a well-known Unani single drug. Jawarish amla is a Unani compound formulation which is commonly used to admini...

  4. Diabetes is a strong predictor of mortality during tuberculosis treatment

    DEFF Research Database (Denmark)

    Faurholt-Jepsen, Daniel; Range, Nyagosya; PrayGod, George

    2013-01-01

    Strong evidence suggests diabetes may be associated with tuberculosis (TB) and could influence TB treatment outcomes. We assessed the role of diabetes on sputum culture conversion and mortality among patients undergoing TB treatment.......Strong evidence suggests diabetes may be associated with tuberculosis (TB) and could influence TB treatment outcomes. We assessed the role of diabetes on sputum culture conversion and mortality among patients undergoing TB treatment....

  5. Detectemos la TB. Tratemos la TB. Trabajemos juntos para eliminar la TB. (Find TB. Treat TB. Working together to eliminate TB.)

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    Este podcast trata sobre el Día Mundial de la Tuberculosis y el tema de los CDC para el año 2014.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  6. A rare presentation of disseminated tuberculosis: Prostatic abscess.

    Science.gov (United States)

    Verma, Ajay; Singh, Anubhuti; Kishore, Kislay; Kant, Surya

    2017-10-01

    Involvement of the prostate by tuberculosis (TB) occurs rarely and tuberculosis prostate abscess is an even rarer occurrence. It has been reported in immunocompromised patients, mainly human immunodeficiency virus seropositive individuals. We are reporting a case of tuberculosis prostatic abscess in an immunocompetent patient with relapse of TB. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

  7. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  8. Beyond UHC: monitoring health and social protection coverage in the context of tuberculosis care and prevention.

    Directory of Open Access Journals (Sweden)

    Knut Lönnroth

    2014-09-01

    Full Text Available Tuberculosis (TB remains a major global public health problem. In all societies, the disease affects the poorest individuals the worst. A new post-2015 global TB strategy has been developed by WHO, which explicitly highlights the key role of universal health coverage (UHC and social protection. One of the proposed targets is that "No TB affected families experience catastrophic costs due to TB." High direct and indirect costs of care hamper access, increase the risk of poor TB treatment outcomes, exacerbate poverty, and contribute to sustaining TB transmission. UHC, conventionally defined as access to health care without risk of financial hardship due to out-of-pocket health care expenditures, is essential but not sufficient for effective and equitable TB care and prevention. Social protection interventions that prevent or mitigate other financial risks associated with TB, including income losses and non-medical expenditures such as on transport and food, are also important. We propose a framework for monitoring both health and social protection coverage, and their impact on TB epidemiology. We describe key indicators and review methodological considerations. We show that while monitoring of general health care access will be important to track the health system environment within which TB services are delivered, specific indicators on TB access, quality, and financial risk protection can also serve as equity-sensitive tracers for progress towards and achievement of overall access and social protection.

  9. Enhancing the role of private practitioners in tuberculosis prevention and care activities in India

    Directory of Open Access Journals (Sweden)

    Tanu Anand

    2017-01-01

    Full Text Available India accounts for the highest number of incident tuberculosis (TB cases globally. Hence, to impact the TB incidence world over, there is an urgent need to address and accelerate TB control activities in the country. Nearly, half of the TB patients first seek TB care in private sector. However, the participation of private practitioners (PPs has been patchy in TB prevention and care and distrust exists between public and private sector. PPs usually have varied diagnostic and treatment practices that are inadequate and amplify the risk of drug resistance. Hence, their regulation and involvement as key stakeholders are important in TB prevention and care in India if we are to achieve TB control at global level. However, there remain certain barriers and gaps, which are preventing their upscaling. The current paper aims to discuss the status of private sector involvement in TB prevention and care in India. The paper also discusses the strategies and initiatives taken by the government in this regard as evidence shows that the involvement of private sector in co-opting directly observed treatment short-course (DOTS helps to enhance case finding and treatment outcomes; it improves the accessibility of quality TB care with greater geographic coverage. Besides public-private mix, DOTS has been found more cost-effective and reduces financial burden of patients. The paper also offers to present some more solutions both at policy and program level for upscaling the engagement of PPs in the national TB control program.

  10. Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

    Science.gov (United States)

    Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

    2017-03-01

    With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

  11. Nilai Diagnostik Metode “Real Time” PCR GeneXpert pada TB Paru BTA Negatif

    Directory of Open Access Journals (Sweden)

    Eka Kurniawan

    2016-09-01

    Full Text Available  AbstrakTuberkulosis (TB paru adalah penyakit menular yang disebabkan oleh kuman Mycobacterium tuberkulosis. TB masih tetap menjadi masalah kesehatan dunia karena lebih kurang 1/3 penduduk dunia terinfeksi oleh kuman ini dan sumber penularannya berasal dari Basil Tahan Asam (BTA positif maupun negatif. TB paru BTA negatif didiagnosis berdasarkan gambaran klinis dan rontgen torak yang sesuai TB serta pertimbangan dokter sehingga hal ini dapat menimbulkan under atau over diagnosis TB. GeneXpert merupakan pemeriksaan molekuler dengan metode “real time“ PCR dan merupakan penemuan terobosan untuk mendiagnosis TB secara cepat. Tujuan penelitiian ini adalah melakukan penilaian validitas GeneXpert pada TB paru BTA negatif dibandingkan dengan kultur Loweinstein Jensen. Desain penelitian uji diagnostik ini adalah cross sectional study. Penelitian dilakukan terhadap 40 orang pasien TB paru BTA negatif di Puskesmas sekitar kota Padang dan pasien yang dirawat di Bagian Penyakit Dalam RS dr. M. Djamil Padang. Dilakukan pemeriksaan sputum dengan GeneXpert dan dibandingkan dengan kultur Loweinstein Jensen. Hasil uji diagnostik dengan GeneXpert untuk mendiagnosis TB paru BTA negatif didapatkan sensitivitas 83.33%, spesifisitas 95.46%, nilai prediksi positif 93.75%, nilai prediksi negatif 87.5% dan akurasi 90% serta hasil uji kappa didapatkan 0.796. Disimpulkan GeneXpert memiliki sensitivitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif dan akurasi yang tinggi pada TB paru BTA negatif.Kata kunci: nilai diagnostik, TB paru BTA negatif, GeneXpert AbstractPulmonary tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. TB is still a global health problem. Approximately one third of the world population is infected by Mycobacterium tuberculosis and the source of infection came from smear positive and negative patient. Smear negative pulmonary TB can be considered based on clinical symptom and chest x-ray as well as

  12. Plant natural products research in tuberculosis drug discovery and ...

    African Journals Online (AJOL)

    Plant natural products research in tuberculosis drug discovery and development: A situation report ... African Journal of Biotechnology ... tuberculosis (XDR-TB), call for the development of new anti-tuberculosis drugs to combat this disease.

  13. Tuberculosis Epidemiology at the Country Scale: Self-Limiting Process and the HIV Effects.

    Directory of Open Access Journals (Sweden)

    Felipe Augusto Maurin Krsulovic

    Full Text Available The global spread of the human immunodeficiency virus (HIV is the main hypothesis behind tuberculosis (TB positive trends in the last decades, according to modeling studies and World Health Organization Reports (WHO. On one hand, TB (WHO reports do not explicitly consider a modeling approach, but cover country and global TB trends. On the other hand, modeling studies usually do not cover the scale of WHO reports, because of the amount of parameters estimated to describe TB natural history. Here we combined these two principal sources of TB studies covering TB High Burden Countries (HBCs dynamics. Our main goals were: (i to detect the endogenous component of TB dynamics since 1974 for TB HBCs; and (ii to explore the HIV exogenous effects on TB models`parameters.We explored the relationship between the TB per capita population rate of change (RI and the infectious class size following an endogenous/exogenous framework. RI can be affected by intra-population processes (i.e. competition, predation and exogenous variables like HIV. We found that TB dynamics had always a strong endogenous component, represented by a negative correlation between TB population size and RI, which was captured by the discrete logistic model. Moreover, we explored the HIV exogenous effects on TB models`parameters. We found that overall the TB+HIV logistic model was more parsimonious than TB model alone, principally in the African region. Our results showed that HIV affected principally TB carrying capacity, as expected by the known HIV effects on TB natural-history. We also tested if DOTS (Directly Observed Treatment Short-Course Strategy, poverty levels and BCG (Bacillus Calmette-Guérin coverage explained the models´ residuals variances, but they did not.Since 1974, TB dynamics were categorized in distinct chronological domains, with different dynamics but nearly the same underlying mechanism: a negative relationship between RI and infected class size (i.e. self

  14. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  15. Trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of extrapulmonary tuberculosis cases in referral hospitals in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2012-01-01

    Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.

  16. Most Influential Literature in Spinal Tuberculosis: A Global Disease Without Global Evidence.

    Science.gov (United States)

    Held, Michael; Castelein, Sophie; Bruins, Marie-Fien; Laubscher, Maritz; Dunn, Robert; Keel, Marius; Ahmad, Sufian; Hoppe, Sven

    2018-02-01

    Bibliometric review of the literature. This bibliometric analysis aims to give an overview of the most influential academic literature written on spinal tuberculosis. All databases included in the Thomson Reuters Web of Knowledge were searched for the most influential publications in spinal tuberculosis. The most cited articles published between 1950 and 2015, with the main focus on orthopedic surgery, were identified using a multistep approach, and a total of 100 articles were included. The publications were then analyzed in this bibliometric analysis. The number of citations ranged from 243 to 36, with an average of 77.11. The articles were published in 34 different journals, and the studies were conducted in 20 different countries. The top 3 countries, India, the United States, and China, published a total of 51% (n = 51) of all articles. Low-burden countries produced 60% (n = 60) of all articles in our list. African centers produced only 4% (n = 4) of all included articles. Indian and Chinese researchers dominate evidence in spinal tuberculosis. Other areas with high disease burden, such as Africa, do not feature. Most publications are retrospective studies with a low level of evidence.

  17. Global, regional, and national incidence and mortality for HIV, tuberculosis, and malaria during 1990-2013 : a systematic analysis for the Global Burden of Disease Study 2013

    NARCIS (Netherlands)

    Murray, Christopher J. L.; Ortblad, Katrina F.; Guinovart, Caterina; Lim, Stephen S.; Wolock, Timothy M.; Roberts, D. Allen; Dansereau, Emily A.; Graetz, Nicholas; Barber, Ryan M.; Brown, Jonathan C.; Wang, Haidong; Duber, Herbert C.; Naghavi, Mohsen; Dicker, Daniel; Dandona, Lalit; Salomon, Joshua A.; Heuton, Kyle R.; Foreman, Kyle; Phillips, David E.; Fleming, Thomas D.; Flaxman, Abraham D.; Phillips, Bryan K.; Johnson, Elizabeth K.; Coggeshall, Megan S.; Abd-Allah, Foad; Abera, Semaw Ferede; Abraham, Jerry P.; Abubakar, Ibrahim; Abu-Raddad, Laith J.; Abu-Rmeileh, Niveen Me; Achoki, Tom; Adeyemo, Austine Olufemi; Adou, Arsene Kouablan; Adsuar, Jose C.; Agardh, Emilie Elisabet; Akena, Dickens; Al Kahbouri, Mazin J.; Alasfoor, Deena; Albittar, Mohammed I.; Alcala-Cerra, Gabriel; Angel Alegretti, Miguel; Alemu, Zewdie Aderaw; Alfonso-Cristancho, Rafael; Alhabib, Samia; Ali, Raghib; Alla, Francois; Allen, Peter J.; Alsharif, Ubai; Alvarez, Elena; Alvis-Guzman, Nelson; Amankwaa, Adansi A.; Amare, Azmeraw T.; Amini, Hassan; Ammar, Walid; Anderson, Benjamin O.; Antonio, Carl Abelardo T.; Anwari, Palwasha; Arnlov, Johan; Arsenijevic, Valentina S. Arsic; Artaman, Ali; Asghar, Rana J.; Assadi, Reza; Atkins, Lydia S.; Badawi, Alaa; Balakrishnan, Kalpana; Banerjee, Amitava; Basu, Sanjay; Beardsley, Justin; Bekele, Tolesa; Bell, Michelle L.; Bernabe, Eduardo; Beyene, Tariku Jibat; Bhala, Neeraj; Bhalla, Ashish; Bhutta, Zulfiqar A.; Bin Abdulhak, Aref; Binagwaho, Agnes; Blore, Jed D.; Basara, Berrak Bora; Bose, Dipan; Brainin, Michael; Breitborde, Nicholas; Castaneda-Orjuela, Carlos A.; Catala-Lopez, Ferran; Chadha, Vineet K.; Chang, Jung-Chen; Chiang, Peggy Pei-Chia; Chuang, Ting-Wu; Colomar, Mercedes; Cooper, Leslie Trumbull; Cooper, Cyrus; Courville, Karen J.; Cowie, Benjamin C.; Criqui, Michael H.; Dandona, Rakhi; Dayama, Anand; De Leo, Diego; Degenhardt, Louisa; Del Pozo-Cruz, Borja; Deribe, Kebede; Des Jarlais, Don C.; Dessalegn, Muluken; Dharmaratne, Samath D.; Dilmen, Ugur; Ding, Eric L.; Driscoll, Tim R.; Durrani, Adnan M.; Ellenbogen, Richard G.; Ermakov, Sergey Petrovich; Esteghamati, Alireza; Faraon, Emerito Jose A.; Farzadfar, Farshad; Fereshtehnejad, Seyed-Mohammad; Fijabi, Daniel Obadare; Forouzanfar, Mohammad H.; Paleo, Urbano Fra; Gaffikin, Lynne; Gamkrelidze, Amiran; Gankpe, Fortune Gbetoho; Geleijnse, Johanna M.; Gessner, Bradford D.; Gibney, Katherine B.; Ginawi, Ibrahim Abdelmageem Mohamed; Glaser, Elizabeth L.; Gona, Philimon; Goto, Atsushi; Gouda, Hebe N.; Gugnani, Harish Chander; Gupta, Rajeev; Gupta, Rahul; Hafezi-Nejad, Nima; Hamadeh, Randah Ribhi; Hammami, Mouhanad; Hankey, Graeme J.; Harb, Hilda L.; Maria Haro, Josep; Havmoeller, Rasmus; Hay, Simon I.; Hedayati, Mohammad T.; Heredia Pi, Ileana B.; Hoek, Hans W.; Hornberger, John C.; Hosgood, H. Dean; Hotez, Peter J.; Hoy, Damian G.; Huang, John J.; Iburg, Kim M.; Idrisov, Bulat T.; Innos, Kaire; Jacobsen, Kathryn H.; Jeemon, Panniyammakal; Jensen, Paul N.; Jha, Vivekanand; Jiang, Guohong; Jonas, Jost B.; Juel, Knud; Kan, Haidong; Kankindi, Ida; Karam, Nadim E.; Karch, Andre; Karema, Corine Kakizi; Kaul, Anil; Kawakami, Norito; Kazi, Dhruv S.; Kemp, Andrew H.; Kengne, Andre Pascal; Keren, Andre; Kereselidze, Maia; Khader, Yousef Saleh; Khalifa, Shams Eldin Ali Hassan; Khan, Ejaz Ahmed; Khang, Young-Ho; Khonelidze, Irma; Kinfu, Yohannes; Kinge, Jonas M.; Knibbs, Luke; Kokubo, Yoshihiro; Kosen, S.; Defo, Barthelemy Kuate; Kulkarni, Veena S.; Kulkarni, Chanda; Kumar, Kaushalendra; Kumar, Ravi B.; Kumar, G. Anil; Kwan, Gene F.; Lai, Taavi; Balaji, Arjun Lakshmana; Lam, Hilton; Lan, Qing; Lansingh, Van C.; Larson, Heidi J.; Larsson, Anders; Lee, Jong-Tae; Leigh, James; Leinsalu, Mall; Leung, Ricky; Li, Yichong; Li, Yongmei; Ferreira De Lima, Graca Maria; Lin, Hsien-Ho; Lipshultz, Steven E.; Liu, Shiwei; Liu, Yang; Lloyd, Belinda K.; Lotufo, Paulo A.; Pedro Machado, Vasco Manuel; Maclachlan, Jennifer H.; Magis-Rodriguez, Carlos; Majdan, Marek; Mapoma, Christopher Chabila; Marcenes, Wagner; Barrieotos Marzan, Melvin; Masci, Joseph R.; Mashal, Mohammad Taufiq; Mason-Jones, Amanda J.; Mayosi, Bongani M.; Mazorodze, Tasara T.; Mckay, Abigail Cecilia; Meaney, Peter A.; Mehndiratta, Man Mohan; Mejia-Rodriguez, Fabiola; Melaku, Yohannes Adama; Memish, Ziad A.; Mendoza, Walter; Miller, Ted R.; Mills, Edward J.; Mohammad, Karzan Abdulmuhsin; Mokdad, Ali H.; Mola, Glen Liddell; Monasta, Lorenzo; Montico, Marcella; Moore, Ami R.; Mori, Rintaro; Moturi, Wilkister Nyaora; Mukaigawara, Mitsuru; Murthy, Kinnari S.; Naheed, Aliya; Naidoo, Kovin S.; Naldi, Luigi; Nangia, Vinay; Narayan, K. M. Venkat; Nash, Denis; Nejjari, Chakib; Nelson, Robert G.; Neupane, Sudan Prasad; Newton, Charles R.; Ng, Marie; Nisar, Muhammad Imran; Nolte, Sandra; Norheim, Ole F.; Nowaseb, Vincent; Nyakarahuka, Luke; Oh, In-Hwan; Ohkubo, Takayoshi; Olusanya, Bolajoko O.; Omer, Saad B.; Opio, John Nelson; Orisakwe, Orish Ebere; Pandian, Jeyaraj D.; Papachristou, Christina; Paternina Caicedo, Angel J.; Patten, Scott B.; Paul, Vinod K.; Pavlin, Boris Igor; Pearce, Neil; Pereira, David M.; Pervaiz, Aslam; Pesudovs, Konrad; Petzold, Max; Pourmalek, Farshad; Qato, Dima; Quezada, Amado D.; Quistberg, D. Alex; Rafay, Anwar; Rahimi, Kazem; Rahimi-Movaghar, Vafa; Rahman, Sajjad Ur; Raju, Murugesan; Rana, Saleem M.; Razavi, Homie; Reilly, Robert Quentin; Remuzzi, Giuseppe; Richardus, Jan Hendrik; Ronfani, Luca; Roy, Nobhojit; Sabin, Nsanzimana; Saeedi, Mohammad Yahya; Sahraian, Mohammad Ali; Samonte, Genesis May J.; Sawhney, Monika; Schneider, Ione J. C.; Schwebel, David C.; Seedat, Soraya; Sepanlou, Sadaf G.; Servan-Mori, Edson E.; Sheikhbahaei, Sara; Shibuya, Kenji; Shin, Hwashin Hyun; Shiue, Ivy; Shivakoti, Rupak; Sigfusdottir, Inga Dora; Silberberg, Donald H.; Silva, Andrea P.; Simard, Edgar P.; Singh, Jasvinder A.; Skirbekk, Vegard; Sliwa, Karen; Soneji, Samir; Soshnikov, Sergey S.; Sreeramareddy, Chandrashekhar T.; Stathopoulou, Vasiliki Kalliopi; Stroumpoulis, Konstantinos; Swaminathan, Soumya; Sykes, Bryan L.; Tabb, Karen M.; Talongwa, Roberto Tchio; Tenkorang, Eric Yeboah; Terkawi, Abdullah Sulieman; Thomson, Alan J.; Thorne-Lyman, Andrew L.; Towbin, Jeffrey A.; Traebert, Jefferson; Tran, Bach X.; Dimbuene, Zacharie Tsala; Tsilimbaris, Miltiadis; Uchendu, Uche S.; Ukwaja, Kingsley N.; Uzun, Selen Begum; Vallely, Andrew J.; Vasankari, Tommi J.; Venketasubramanian, N.; Violante, Francesco S.; Vlassov, Vasiliy Victorovich; Vollset, Stein Emil; Waller, Stephen; Wallin, Mitchell T.; Wang, Linhong; Wang, XiaoRong; Wang, Yanping; Weichenthal, Scott; Weiderpass, Elisabete; Weintraub, Robert G.; Westerman, Ronny; White, Richard A.; Wilkinson, James D.; Williams, Thomas Neil; Woldeyohannes, Solomon Meseret; Wong, John Q.; Xu, Gelin; Yang, Yong C.; Yano, Yuichiro; Yentur, Gokalp Kadri; Yip, Paul; Yonemoto, Naohiro; Yoon, Seok-Jun; Younis, Mustafa; Yu, Chuanhua; Jin, Kim Yun; Zaki, Maysaa El Sayed; Zhao, Yong; Zheng, Yingfeng; Zhou, Maigeng; Zhu, Jun; Zou, Xiao Nong; Lopez, Alan D.; Vos, Theo

    2014-01-01

    Background The Millennium Declaration in 2000 brought special global attention to HIV, tuberculosis, and malaria through the formulation of Millennium Development Goal (MDG) 6. The Global Burden of Disease 2013 study provides a consistent and comprehensive approach to disease estimation for between

  18. Implications of the global financial crisis for the response to diseases of poverty within overall health sector development: the case of tuberculosis.

    Science.gov (United States)

    Maher, Dermot

    2010-01-01

    The global financial crisis poses a threat to global health, and may exacerbate diseases of poverty, e.g. HIV, malaria and tuberculosis. Exploring the implications of the global financial crisis for the health sector response to tuberculosis is useful to illustrate the practical problems and propose possible solutions. The response to tuberculosis is considered in the context of health sector development. Problems and solutions are considered in five key areas: financing, prioritization, government regulation, integration and decentralization. Securing health gains in global tuberculosis control depends on protecting expenditure by governments of countries badly affected by tuberculosis and by donors, taking measures to increase efficiencies, prioritizing health expenditures and strengthening government regulation. Lessons learned will be valuable for stakeholders involved in the health sector response to tuberculosis and other diseases of poverty.

  19. Provider-initiated HIV testing & counselling in incident tuberculosis cases under National TB Programme conditions at a tertiary care teaching hospital in Tirupati, south India

    Directory of Open Access Journals (Sweden)

    Alladi Mohan

    2017-01-01

    >Interpretation & conclusions: The findings of this study showed that a higher proportion of TB patients underwent HIV testing (75% compared to the national figure of 63 per cent in 2013-2014. HIV seropositivity (4.6% in TB patients who underwent HIV testing was similar to the five per cent figure observed at national level during 2013-2014. The HIV status of 25 per cent of patients with incident TB still remained unknown, suggesting a need for better integration and co-ordination for effective management of HIV-TB co-infection.

  20. Tuberculosis Data and Statistics

    Science.gov (United States)

    ... Advisory Groups Federal TB Task Force Data and Statistics Language: English (US) Español (Spanish) Recommend on Facebook ... Set) Mortality and Morbidity Weekly Reports Data and Statistics Decrease in Reported Tuberculosis Cases MMWR 2010; 59 ( ...

  1. Tuberculosis Notification: Issues and Challenges

    Directory of Open Access Journals (Sweden)

    Manisha Nagpal

    2013-08-01

    Full Text Available Tuberculosis (TB is a major public health problem. An emerging menace in India is drug resistant forms of TB. In order to ensure proper TB diagnosis and case management, reduce TB transmission and address the problems of emergence of spread of Drug Resistant-TB, it is essential to have complete information of all TB cases. Therefore, Govt. of India declared Tuberculosis a notifiable disease on 7th May 2012. This paper highlights the fact that notification of TB in the absence of regulation of diagnostic practices, rational use of anti-TB medicines and availability of diagnostic and treatment facilities for drug-resistant TB will pose more problems rather than provide solutions to this problem.

  2. A Mycobacterium tuberculosis cluster demonstrating the use of genotyping in urban tuberculosis control

    NARCIS (Netherlands)

    G. de Vries (Gerard); R.M. van Hest (Reinier); C.C.A. Burdo (Conny); D. van Soolingen (Dick); J.H. Richardus (Jan Hendrik)

    2009-01-01

    textabstractBackground: DNA fingerprinting of Mycobacterium tuberculosis isolates offers better opportunities to study links between tuberculosis (TB) cases and can highlight relevant issues in urban TB control in low-endemic countries. Methods: A medium-sized molecular cluster of TB cases with

  3. Latent tuberculosis in HIV positive, diagnosed by the M. tuberculosis specific interferon-gamma test

    DEFF Research Database (Denmark)

    Brock, Inger; Ruhwald, Morten; Lundgren, Bettina

    2006-01-01

    Although tuberculosis (TB) is a minor problem in Denmark, severe and complicated cases occur in HIV positive. Since the new M. tuberculosis specific test for latent TB, the QuantiFERON-TB In-Tube test (QFT-IT) became available the patients in our clinic have been screened for the presence of latent...

  4. Latent tuberculosis in HIV positive, diagnosed by the M. tuberculosis specific interferon-gamma test

    DEFF Research Database (Denmark)

    Brock, Inger; Ruhwald, Morten; Lundgren, Bettina

    2006-01-01

    BACKGROUND: Although tuberculosis (TB) is a minor problem in Denmark, severe and complicated cases occur in HIV positive. Since the new M. tuberculosis specific test for latent TB, the QuantiFERON-TB In-Tube test (QFT-IT) became available the patients in our clinic have been screened...

  5. Optimization of TB/HIV co-treatment in Ethiopian patients

    OpenAIRE

    Degu, Wondwossen Amogne

    2015-01-01

    Tuberculosis (TB) and HIV infection act with deadly synergy. HIV is the most important risk factor for latent TB reactivation and active TB progression following exposure or reinfection while TB accelerates HIV progression. TB is the most frequent cause of morbidity and mortality in HIV infection. Anti-TB therapy (ATT) must precede initiation of combination Antiretroviral Therapy (cART), TB being the most immediate threat. Undoubtedly cART benefits; however, important clinical ...

  6. Tuberculosis Case Finding With Combined Rapid Point-of-Care Assays (Xpert MTB/RIF and Determine TB LAM) in HIV-Positive Individuals Starting Antiretroviral Therapy in Mozambique.

    Science.gov (United States)

    Floridia, Marco; Ciccacci, Fausto; Andreotti, Mauro; Hassane, Archa; Sidumo, Zita; Magid, Nurja A; Sotomane, Horacio; David, Muhlavasse; Mutemba, Elsa; Cebola, Junia; Mugunhe, Remigio Josè; Riccardi, Fabio; Marazzi, Maria Cristina; Giuliano, Marina; Palombi, Leonardo; Mancinelli, Sandro

    2017-11-13

    Tuberculosis is a major health concern in several countries, and effective diagnostic algorithms for use in human immunodeficiency virus (HIV)-positive patients are urgently needed. At prescription of antiretroviral therapy, all patients in 3 Mozambican health centers were screened for tuberculosis, with a combined approach: World Health Organization (WHO) 4-symptom screening (fever, cough, night sweats, and weight loss), a rapid test detecting mycobacterial lipoarabinomannan in urine (Determine TB LAM), and a molecular assay performed on a sputum sample (Xpert MTB/RIF; repeated if first result was negative). Patients with positive LAM or Xpert MTB/RIF results were referred for tuberculosis treatment. Among 972 patients with a complete diagnostic algorithm (58.5% female; median CD4 cell count, 278/μL; WHO HIV stage I, 66.8%), 98 (10.1%) tested positive with Xpert (90, 9.3%) or LAM (34, 3.5%) assays. Compared with a single-test Xpert strategy, dual Xpert tests improved case finding by 21.6%, LAM testing alone improved it by 13.5%, and dual Xpert tests plus LAM testing improved it by 32.4%. Rifampicin resistance in Xpert-positive patients was infrequent (2.5%). Among patients with positive results, 22 of 98 (22.4%) had no symptoms at WHO 4-symptom screening. Patients with tuberculosis diagnosed had significantly lower CD4 cell counts and hemoglobin levels, more advanced WHO stage, and higher HIV RNA levels. Fifteen (15.3%) did not start tuberculosis treatment, mostly owing to rapidly deteriorating clinical conditions or logistical constraints. The median interval between start of the diagnostic algorithm and start of tuberculosis treatment was 7 days. The prevalence of tuberculosis among Mozambican HIV-positive patients starting antiretroviral therapy was 10%, with limited rifampicin resistance. Use of combined point-of-care tests increased case finding, with a short time to treatment. Interventions are needed to remove logistical barriers and prevent presentation

  7. Alveolar Epithelial Cells in Mycobacterium tuberculosis Infection: Active Players or Innocent Bystanders?

    Science.gov (United States)

    Scordo, Julia M; Knoell, Daren L; Torrelles, Jordi B

    2016-01-01

    Tuberculosis (TB) is a disease that kills one person every 18 s. TB remains a global threat due to the emergence of drug-resistant Mycobacterium tuberculosis (M.tb) strains and the lack of an efficient vaccine. The ability of M.tb to persist in latency, evade recognition following seroconversion, and establish resistance in vulnerable populations warrants closer examination. Past and current research has primarily focused on examination of the role of alveolar macrophages and dendritic cells during M.tb infection, which are critical in the establishment of the host response during infection. However, emerging evidence indicates that the alveolar epithelium is a harbor for M.tb and critical during progression to active disease. Here we evaluate the relatively unexplored role of the alveolar epithelium as a reservoir and also its capacity to secrete soluble mediators upon M.tb exposure, which influence the extent of infection. We further discuss how the M.tb-alveolar epithelium interaction instigates cell-to-cell crosstalk that regulates the immune balance between a proinflammatory and an immunoregulatory state, thereby prohibiting or allowing the establishment of infection. We propose that consideration of alveolar epithelia provides a more comprehensive understanding of the lung environment in vivo in the context of host defense against M.tb. © 2015 S. Karger AG, Basel.

  8. Alveolar epithelial cells in Mycobacterium tuberculosis infection: Active Players or Innocent Bystanders

    Science.gov (United States)

    Scordo, Julia M.; Knoell, Daren L.; Torrelles, Jordi B.

    2015-01-01

    Tuberculosis (TB) is a disease that kills one person every 18 seconds. TB remains a global threat due to the emergence of drug resistance Mycobacterium tuberculosis (M.tb) strains and the lack of an efficient vaccine. The ability of M.tb to persist in latency, evade recognition following sero-conversion and establish resistance in vulnerable populations warrants closer examination. Past and current research has primarily focused on examination of the role of alveolar macrophages and dendritic cells during M.tb infection, which are critical in the establishment of the host response during infection. However, emerging evidence indicates that the alveolar epithelium is a harbor for M.tb and critical during progression to active disease. Here we evaluate the relatively unexplored role of the alveolar epithelium as a reservoir and also its capacity to secrete soluble mediators upon M.tb exposure that influence the extent of infection. We further discuss how the M.tb-alveolar epithelia interaction instigate cell to cell crosstalk that regulates immune balance between a pro-inflammatory or immunoregulatory state thereby prohibiting or allowing the establishment of infection. We propose that consideration of the alveolar epithelia provides a more comprehensive understanding of the lung environment in vivo in the context of host defense against M.tb. PMID:26384325

  9. HIV/TB co-infection:perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India

    OpenAIRE

    Lakshminarayanan, Mahalakshmi

    2009-01-01

    The WHO recommends routine HIV testing among TB patients as a key strategy to combat the dual HIV/TB epidemic. India has integrated its HIV and TB control programs and is offering provider initiated HIV testing for all TB patients since 2007. Using a mixed methods approach, this study aims to understand the perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India. A survey conducted by the Tuberculosis Research Center, India on 300 TB patients is th...

  10. Tuberculosis in South Asia: a tide in the affairs of men.

    Science.gov (United States)

    Basnyat, Buddha; Caws, Maxine; Udwadia, Zarir

    2018-01-01

    Tuberculosis (TB) remains the most common cause of infectious disease deaths worldwide. What is perhaps less appreciated is that the caseload of tuberculosis patients in South Asia is staggering.South Asia has almost 40% of the global TB burden with 4,028,165 cases in 2015. This region also has a disproportionate share of TB deaths (681,975 deaths, 38% of the global burden). Worldwide just 12.5% of TB cases are in HIV positive individuals, but much research and investment has focused on HIV-associated TB. Only 3.5% of patients with tuberculosis in South Asia have HIV co-infection. Not surprisingly with such a huge burden of disease, this region has an estimated 184,336 multi drug resistant (MDR) cases among notified TB cases which accounts for a third of global MDR burden. Crucially, at least 70% of the estimated MDR cases remain untreated in this region and MDR treatment success ranged from only 46% for India to 88% for Sri Lanka in the 2012 cohort that received treatment. This region represents many of the drivers of the modern TB epidemic: rapid urbanization and high density populations with dramatically rising incidence of diabetes, a burgeoning and largely unregulated private sector with escalating drug resistance and high air pollution both outdoor and household. From bacterial biochemistry to policy implementation, we suggest ways in which South Asia can seize the opportunity lead global TB elimination by demonstrating feasibility in some of the world's most densely populated cities and remotest reaches of the Himalayas. Clearly political will is essential, but we cannot defeat TB without understanding how to eliminate it in South Asia.

  11. Stop TB in My Lifetime: A Call for a World Free of TB - World TB Day 2013

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    In this podcast Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses World TB Day, the 2013 slogan and theme.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/13/2012.

  12. Treatment of Latent Tuberculosis Infection

    OpenAIRE

    Tang, Patrick; Johnston, James

    2017-01-01

    Opinion statement The treatment of latent tuberculosis infection (LTBI) is an essential component of tuberculosis (TB) elimination in regions that have a low incidence of TB. However, the decision to treat individuals with LTBI must consider the limitations of current diagnostic tests for LTBI, the risk of developing active TB disease, the potential adverse effects from chemoprophylactic therapy, and the importance of treatment adherence. When an individual has been diagnosed with LTBI and ac...

  13. Challenges of TB diagnosis and treatment in South Africa | Wood ...

    African Journals Online (AJOL)

    It is estimated that 2 billion of the world\\'s population are latently infected with Mycobacterium tuberculosis (Mtb) with a resultant 8 - 9 million cases of active tuberculosis (TB) and 1.6 million deaths annually.1 The tools used for diagnosis of TB have remained largely unchanged since the 1880s when sputum microscopy, Mtb ...

  14. Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

    Science.gov (United States)

    Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

    2018-01-01

    Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

  15. Automated High-Throughput Genotyping for Study of Global Epidemiology of Mycobacterium tuberculosis Based on Mycobacterial Interspersed Repetitive Units

    Science.gov (United States)

    Supply, Philip; Lesjean, Sarah; Savine, Evgueni; Kremer, Kristin; van Soolingen, Dick; Locht, Camille

    2001-01-01

    Large-scale genotyping of Mycobacterium tuberculosis is especially challenging, as the current typing methods are labor-intensive and the results are difficult to compare among laboratories. Here, automated typing based on variable-number tandem repeats (VNTRs) of genetic elements named mycobacterial interspersed repetitive units (MIRUs) in 12 mammalian minisatellite-like loci of M. tuberculosis is presented. This system combines analysis of multiplex PCRs on a fluorescence-based DNA analyzer with computerized automation of the genotyping. Analysis of a blinded reference set of 90 strains from 38 countries (K. Kremer et al., J. Clin. Microbiol. 37:2607–2618, 1999) demonstrated that it is 100% reproducible, sensitive, and specific for M. tuberculosis complex isolates, a performance that has not been achieved by any other typing method tested in the same conditions. MIRU-VNTRs can be used for analysis of the global genetic diversity of M. tuberculosis complex strains at different levels of evolutionary divergence. To fully exploit the portability of this typing system, a website was set up for the analysis of M. tuberculosis MIRU-VNTR genotypes via the Internet. This opens the way for global epidemiological surveillance of tuberculosis and should lead to novel insights into the evolutionary and population genetics of this major pathogen. PMID:11574573

  16. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology

    Science.gov (United States)

    Mazars, Edith; Lesjean, Sarah; Banuls, Anne-Laure; Gilbert, Michèle; Vincent, Véronique; Gicquel, Brigitte; Tibayrenc, Michel; Locht, Camille; Supply, Philip

    2001-01-01

    The worldwide threat of tuberculosis to human health emphasizes the need to develop novel approaches to a global epidemiological surveillance. The current standard for Mycobacterium tuberculosis typing based on IS6110 restriction fragment length polymorphism (RFLP) suffers from the difficulty of comparing data between independent laboratories. Here, we propose a high-resolution typing method based on variable number tandem repeats (VNTRs) of genetic elements named mycobacterial interspersed repetitive units (MIRUs) in 12 human minisatellite-like regions of the M. tuberculosis genome. MIRU-VNTR profiles of 72 different M. tuberculosis isolates were established by PCR analysis of all 12 loci. From 2 to 8 MIRU-VNTR alleles were identified in the 12 regions in these strains, which corresponds to a potential of over 16 million different combinations, yielding a resolution power close to that of IS6110-RFLP. All epidemiologically related isolates tested were perfectly clustered by MIRU-VNTR typing, indicating that the stability of these MIRU-VNTRs is adequate to track outbreak episodes. The correlation between genetic relationships inferred from MIRU-VNTR and IS6110-RFLP typing was highly significant. Compared with IS6110-RFLP, high-resolution MIRU-VNTR typing has the considerable advantages of being fast, appropriate for all M. tuberculosis isolates, including strains that have a few IS6110 copies, and permitting easy and rapid comparison of results from independent laboratories. This typing method opens the way to the construction of digital global databases for molecular epidemiology studies of M. tuberculosis. PMID:11172048

  17. European union standards for tuberculosis care.

    Science.gov (United States)

    Migliori, G B; Zellweger, J P; Abubakar, I; Ibraim, E; Caminero, J A; De Vries, G; D'Ambrosio, L; Centis, R; Sotgiu, G; Menegale, O; Kliiman, K; Aksamit, T; Cirillo, D M; Danilovits, M; Dara, M; Dheda, K; Dinh-Xuan, A T; Kluge, H; Lange, C; Leimane, V; Loddenkemper, R; Nicod, L P; Raviglione, M C; Spanevello, A; Thomsen, V Ø; Villar, M; Wanlin, M; Wedzicha, J A; Zumla, A; Blasi, F; Huitric, E; Sandgren, A; Manissero, D

    2012-04-01

    The European Centre for Disease Prevention and Control (ECDC) and the European Respiratory Society (ERS) jointly developed European Union Standards for Tuberculosis Care (ESTC) aimed at providing European Union (EU)-tailored standards for the diagnosis, treatment and prevention of tuberculosis (TB). The International Standards for TB Care (ISTC) were developed in the global context and are not always adapted to the EU setting and practices. The majority of EU countries have the resources and capacity to implement higher standards to further secure quality TB diagnosis, treatment and prevention. On this basis, the ESTC were developed as standards specifically tailored to the EU setting. A panel of 30 international experts, led by a writing group and the ERS and ECDC, identified and developed the 21 ESTC in the areas of diagnosis, treatment, HIV and comorbid conditions, and public health and prevention. The ISTCs formed the basis for the 21 standards, upon which additional EU adaptations and supplements were developed. These patient-centred standards are targeted to clinicians and public health workers, providing an easy-to-use resource, guiding through all required activities to ensure optimal diagnosis, treatment and prevention of TB. These will support EU health programmes to identify and develop optimal procedures for TB care, control and elimination.

  18. Managing a case of extensively drug-resistant (XDR) pulmonary tuberculosis in Singapore.

    Science.gov (United States)

    Phua, Chee Kiang; Chee, Cynthia B E; Chua, Angeline P G; Gan, Suay Hong; Ahmed, Aneez D B; Wang, Yee Tang

    2011-03-01

    Extensively drug-resistant tuberculosis (XDR-TB) is an emerging global health risk. We present the first case report of XDR-TB in Singapore. A 41-year-old Indonesian lady with previously treated pulmonary tuberculosis presented with chronic cough. Her sputum was strongly acid-fast bacilli positive and grew Mycobacterium tuberculosis complex resistant to first and second-line TB medications. She received 5 months of intensive multidrug treatment without sputum smear conversion. She then underwent resection of the diseased lung. The total cost incurred amounted to over S$100,000. She achieved sputum smear/culture conversion post-surgery, but will require further medical therapy for at least 18 months. XDRTB is poorly responsive to therapy and extremely expensive to manage. Its prevention by strict compliance to therapy is paramount.

  19. 1 APOPO's tuberculosis research agenda: achievements ...

    African Journals Online (AJOL)

    microorganism that causes tuberculosis (TB), in human sputum samples and to ..... when working in this fully-automated cage and it is anticipated that future TB .... continued and replicated in Mozambique, which will help to ascertain the ...

  20. Mycothiol acetyltransferase (Rv0819) of Mycobacterium tuberculosis is a potential biomarker for direct diagnosis of tuberculosis using patient serum specimens.

    Science.gov (United States)

    Zeitoun, H; Bahey-El-Din, M; Kassem, M A; Aboushleib, H M

    2017-12-01

    Mycobacterium tuberculosis infection constitutes a global threat that results in significant morbidity and mortality worldwide. Efficient and early diagnosis of tuberculosis (TB) is of paramount importance for successful treatment. The aim of the current study is to investigate the mycobacterial mycothiol acetyltransferase Rv0819 as a potential novel biomarker for the diagnosis of active TB infection. The gene encoding Rv0819 was cloned and successfully expressed in Escherichia coli. The recombinant Rv0819 was purified using metal affinity chromatography and was used to raise murine polyclonal antibodies against Rv0819. The raised antibodies were employed for direct detection of Rv0819 in patient serum samples using dot blot assay and competitive enzyme-linked immunosorbent assay (ELISA). Serum samples were obtained from 68 confirmed new TB patients and 35 healthy volunteers as negative controls. The dot blot assay showed sensitivity of 64·7% and specificity of 100%, whereas the competitive ELISA assay showed lower sensitivity (54·4%) and specificity (88·57%). The overall sensitivity of the combined results of the two tests was found to be 89·7%. Overall, the mycobacterial Rv0819 is a potential TB serum biomarker that can be exploited, in combination with other TB biomarkers, for efficient and reliable diagnosis of active TB infection. The early and accurate diagnosis of tuberculosis infection is of paramount importance for initiating treatment and avoiding clinical complications. Most current diagnostic tests have poor sensitivity and/or specificity and in many cases they are too expensive for routine diagnostic testing in resource-limited settings. In the current study, we examined a novel mycobacterial serum biomarker, namely mycothiol acetyltransferase Rv0819. The antigen was detectable in serum specimens of a significant number of tuberculosis patients. This article proves the importance of Rv0819 and paves the way towards its future use as a useful

  1. Tuberculosis stigma in Gezira State, Sudan

    DEFF Research Database (Denmark)

    Suleiman MM, Ahmed; Sahal, Nagla; Sodemann, Morten

    2013-01-01

    OBJECTIVE: To evaluate the prevalence of tuberculosis (TB) stigma and to determine the relation between socio-demographic characteristics and TB stigma among TB cases and their controls in Gezira State, Sudan. METHODS: A case-control study design was used. New smear-positive TB patients registere...

  2. TB Testing for People Living with HIV

    Centers for Disease Control (CDC) Podcasts

    2012-07-23

    Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, explains why it is important for people living with HIV to be tested for TB.  Created: 7/23/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 7/23/2012.

  3. Efficacy and Safety of Antiretroviral Therapy Initiated One Week after Tuberculosis Therapy in Patients with CD4 Counts < 200 Cells/μL: TB-HAART Study, a Randomized Clinical Trial.

    Directory of Open Access Journals (Sweden)

    Wondwossen Amogne

    Full Text Available Given the high death rate the first two months of tuberculosis (TB therapy in HIV patients, it is critical defining the optimal time to initiate combination antiretroviral therapy (cART.A randomized, open-label, clinical trial comparing efficacy and safety of efavirenz-based cART initiated one week, four weeks, and eight weeks after TB therapy in patients with baseline CD4 count < 200 cells/μL was conducted. The primary endpoint was all-cause mortality rate at 48 weeks. The secondary endpoints were hepatotoxicity-requiring interruption of TB therapy, TB-associated immune reconstitution inflammatory syndrome, new AIDS defining illnesses, CD4 counts, HIV RNA levels, and AFB smear conversion rates. All analyses were intention-to-treat.We studied 478 patients with median CD4 count of 73 cells/μL and 5.2 logs HIV RNA randomized to week one (n = 163, week four (n = 160, and week eight (n = 155. Sixty-four deaths (13.4% occurred in 339.2 person-years. All-cause mortality rates at 48 weeks were 25 per 100 person-years in week one, 18 per 100 person-years in week four and 15 per 100 person-years in week eight (P = 0.2 by the log-rank test. All-cause mortality incidence rate ratios in subgroups with CD4 count below 50 cells/μL versus above were 2.8 in week one (95% CI 1.2-6.7, 3.1 in week four (95% CI 1.2-8.6 and 5.1 in week eight (95% CI 1.8-16. Serum albumin < 3 gms/dL (adjusted HR, aHR = 2.3 and CD4 < 50 cells/μL (aHR = 2.7 were independent predictors of mortality. Compared with similar subgroups from weeks four and eight, first-line TB treatment interruption was high in week one deaths (P = 0.03 and in the CD4 subgroup <50 cells/μL (P = 0.02.Antiretroviral therapy one week after TB therapy doesn't improve overall survival. Despite increased mortality with CD4 < 50 cells/μL, we recommend cART later than the first week of TB therapy to avoid serious hepatotoxicity and treatment interruption.ClinicalTrials.gov NCT 01315301.

  4. Why the tuberculosis incidence rate is not falling in New Zealand.

    Science.gov (United States)

    Das, Dilip; Baker, Michael; Venugopal, Kamalesh; McAllister, Susan

    2006-10-13

    To assess the role of migration from high-incidence countries, HIV/AIDS infection, and prevalence of multi-drug resistant organisms as contributors to tuberculosis (TB) incidence in New Zealand (NZ) relative to ongoing local transmission and reactivation of disease. TB notification data and laboratory data for the period 1995 to 2004 and population data from the 1996 and 2001 Census were used to calculate incidence rates of TB by age and ethnicity, country of birth (distinguishing high and low -incidence countries), and interval between migration and onset of disease. Published reports of multi-drug-resistant TB for the period 1995 to 2004 were reviewed. Anonymous HIV surveillance data held by AIDS Epidemiology Group were matched with coded and anonymised TB surveillance data to measure the extent of HIV/AIDS coinfection in notified TB cases. Migration of people from high-TB incidence countries is the main source of TB in NZ. Of those who develop TB, a quarter does so within a year of migration, and a quarter of this group (mainly refugees) probably enter the country with pre-existing disease. Rates of local TB transmission and reactivation of old disease are declining steadily for NZ-born populations, except for NZ-born Maori and Pacific people under 40. HIV/AIDS and multi-drug-resistant organisms are not significant contributors to TB incidence in NZ and there is no indication that their role is increasing. TB incidence is not decreasing in NZ mainly due to migration of TB infected people from high-incidence countries and subsequent development of active disease in some of them in NZ. This finding emphasises the importance of regional and global TB control initiatives. Refugees and migrants are not acting as an important source of TB for most NZ-born populations. Those caring for them should have a high level of clinical suspicion for TB.

  5. CDC WONDER: Online Tuberculosis Information System (OTIS)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Online Tuberculosis Information System (OTIS) on CDC WONDER contains information on verified tuberculosis (TB) cases reported to the Centers for Disease Control...

  6. Challenges in diagnosing tuberculosis in children

    DEFF Research Database (Denmark)

    Rahman, Nadia; Pedersen, Karin Kæreby; Rosenfeldt, Vibeke

    2012-01-01

    Clinical investigations of childhood tuberculosis (TB) are challenged by the paucibacillary nature of the disease and the difficulties in obtaining specimens. We investigated the challenges in diagnosing TB in children in a low-incidence country.......Clinical investigations of childhood tuberculosis (TB) are challenged by the paucibacillary nature of the disease and the difficulties in obtaining specimens. We investigated the challenges in diagnosing TB in children in a low-incidence country....

  7. Hysterosalpingographic Appearances of Female Genital Tract Tuberculosis: Part I. Fallopian Tube

    Directory of Open Access Journals (Sweden)

    Firoozeh Ahmadi

    2014-01-01

    Full Text Available Female genital tuberculosis (TB remains as a major cause of tubal obstruction leading to infertility, especially in developing countries. The global prevalence of genital tuberculosis has increased during the past two decades due to increasing acquired immunodeficiency syndrome (AIDS. Genital TB is commonly asymptomatic, and it is diagnosed during infertility investigations. Despite of recent advances in imaging tools, such as computerized tomography (CT scan, magnetic resonance imaging (MRI and ultrasongraphy, hysterosalpingography is still the standard screening test for evaluation of tubal infertility and a valuable tool for diagnosis of female genital tuberculosis. Tuberculosis gives rise to various appearances on hysterosalpingography (HSG from non-specific changes to specific findings. The present pictorial review illustrates and describes specific and non-specific radiographic features of female genital tuberculosis in two parts. Part I presents specific findings of tuberculosis related to tubes such as "beaded tube", "golf club tube", "pipestem tube", "cobble stone tube" and "leopard skin tube". Part II describes adverse effects of tuberculosis on structure of endometrium and radiological specific findings such as "dwarfed" uterus with lymphatic intravasation and occluded tubes, "T-shaped" tuberculosis uterus, "pseudounicornuate" uterus and "Collar-stud abscess", which have not been encountered in the majority of non-tuberculosis cases.

  8. Basic Tuberculosis Facts

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    In this podcast, Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses basic TB prevention, testing, and treatment information.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/12/2012.

  9. Mathematical model of tuberculosis epidemic with recovery time delay

    Science.gov (United States)

    Iskandar, Taufiq; Chaniago, Natasya Ayuningtia; Munzir, Said; Halfiani, Vera; Ramli, Marwan

    2017-12-01

    Tuberculosis (TB) is a contagious disease which can cause death. The disease is caused by Mycobacterium Tuberculosis which generally affects lungs and other organs such as lymph gland, intestine, kidneys, uterus, bone, and brain. The spread of TB occurs through the bacteria-contaminated air which is inhaled into the lungs. The symptoms of the TB patients are cough, chest pain, shortness of breath, appetite lose, weight lose, fever, cold, and fatigue. World Health Organization (WHO) reported that Indonesia placed the second in term of the most TB cases after India which has 23 % cases while China is reported to have 10 % cases in global. TB has become one of the greatest death threats in global. One way to countermeasure TB disease is by administering vaccination. However, a medication is needed when one has already infected. The medication can generally take 6 months of time which consists of two phases, inpatient and outpatient. Mathematical models to analyze the spread of TB have been widely developed. One of them is the SEIR type model. In this model the population is divided into four groups, which are suspectible (S), exposed (S), infected (I), recovered (R). In fact, a TB patient needs to undergo medication with a period of time in order to recover. This article discusses a model of TB spread with considering the term of recovery (time delay). The model is developed in SIR type where the population is divided into three groups, suspectible (S), infected (I), and recovered (R). Here, the vaccine is given to the susceptible group and the time delay is considered in the group undergoing the medication.

  10. New drugs and perspectives for new anti-tuberculosis regimens

    Directory of Open Access Journals (Sweden)

    S. Tiberi

    2018-03-01

    Full Text Available Tuberculosis (TB is the ninth cause of global death, more than any other infectious disease. With growing drug resistance the epidemic remains and will require significant attention and investment for the elimination of this disease to occur. With susceptible TB treatment not changing over the last four decades and the advent of drug resistance, new drugs and regimens are required.Recently, through greater collaboration and research networks some progress with significant advances has taken place, not withstanding the comparatively low amount of resources invested. Of late the availability of the new drugs bedaquiline, delamanid and repurposed drugs linezolid, clofazimine and carbapenems are being used more frequently in drug-resistant TB regimens.The WHO shorter multidrug-resistant tuberculosis regimen promises to reach more patients and treat them more quickly and more cheaply.With this new enthusiasm and hope we this review gives an update on the new drugs and perspectives for the treatment of drug-susceptible and drug-resistant tuberculosis. Keywords: Bedaquiline, Delamanid, Linezolid, MDR, XDR-TB, TB

  11. Efficacy of Adjunctive Tofacitinib Therapy in Mouse Models of Tuberculosis

    Directory of Open Access Journals (Sweden)

    Mamoudou Maiga

    2015-08-01

    Full Text Available The global tuberculosis (TB epidemic and the spread of multi- and extensively-drug resistant strains of Mycobacterium tuberculosis (M.tb have been fueled by low adherence to following lengthy treatment protocols, and the rapid spread of HIV (Human Immunodeficiency Virus. Persistence of the infection in immunocompetent individuals follows from the ability of M.tb to subvert host immune responses in favor of survival within macrophages. Alternative host-directed strategies are therefore being currently sought to improve treatment efficacy and duration. In this study, we evaluated tofacitinib, a new oral Janus kinase (JAK blocker with anti-inflammatory properties, in shortening tuberculosis treatment. BALB/c mice, which are immunocompetent, showed acceleration of M.tb clearance achieving apparent sterilization after 16 weeks of adjunctive tofacitinib therapy at average exposures higher than recommended in humans, while mice receiving standard treatment alone did not achieve clearance until 24 weeks. True sterilization with tofacitinib was not achieved until five months. C3HeB/FeJ mice, which show reduced pro-inflammatory cytokines during M.tb infection, did not show improved clearance with adjunctive tofacitinib therapy, indicating that the nature of granulomatous lesions and host immunity may influence responsiveness to tofacitinib. Our findings suggest that the JAK pathway could be explored further for host-directed therapy in immunocompetent individuals.

  12. Efficacy of Adjunctive Tofacitinib Therapy in Mouse Models of Tuberculosis

    Science.gov (United States)

    Maiga, Mamoudou; Ahidjo, Bintou Ahmadou; Maiga, Mariama C.; Cheung, Laurene; Pelly, Shaaretha; Lun, Shichun; Bougoudogo, Flabou; Bishai, William R.

    2015-01-01

    The global tuberculosis (TB) epidemic and the spread of multi- and extensively-drug resistant strains of Mycobacterium tuberculosis (M.tb) have been fueled by low adherence to following lengthy treatment protocols, and the rapid spread of HIV (Human Immunodeficiency Virus). Persistence of the infection in immunocompetent individuals follows from the ability of M.tb to subvert host immune responses in favor of survival within macrophages. Alternative host-directed strategies are therefore being currently sought to improve treatment efficacy and duration. In this study, we evaluated tofacitinib, a new oral Janus kinase (JAK) blocker with anti-inflammatory properties, in shortening tuberculosis treatment. BALB/c mice, which are immunocompetent, showed acceleration of M.tb clearance achieving apparent sterilization after 16 weeks of adjunctive tofacitinib therapy at average exposures higher than recommended in humans, while mice receiving standard treatment alone did not achieve clearance until 24 weeks. True sterilization with tofacitinib was not achieved until five months. C3HeB/FeJ mice, which show reduced pro-inflammatory cytokines during M.tb infection, did not show improved clearance with adjunctive tofacitinib therapy, indicating that the nature of granulomatous lesions and host immunity may influence responsiveness to tofacitinib. Our findings suggest that the JAK pathway could be explored further for host-directed therapy in immunocompetent individuals. PMID:26425693

  13. Community Involvement in TB Research

    NARCIS (Netherlands)

    M. van der Werf (Marloes); S.G. Heumann (Silke); E.M.H. Mitchell

    2011-01-01

    textabstractWhile communities at risk have been both drivers and partners in HIV research, their important role in TB research is yet to be fully realized. Involvement of communities in tuberculosis care and prevention is currently on the international agenda. This creates opportunities and

  14. A Histomorphological Pattern Analysis of Pulmonary Tuberculosis in Lung Autopsy and Surgically Resected Specimens

    Directory of Open Access Journals (Sweden)

    Mamta Gupta

    2016-01-01

    Full Text Available Background. Tuberculosis (TB is a major cause of morbidity and mortality globally. Many cases are diagnosed on autopsy and a subset of patients may require surgical intervention either due to the complication or sequelae of TB. Materials and Methods. 40 cases of resected lung specimens following surgery or autopsy in which a diagnosis of pulmonary tuberculosis was made were included. Histopathological pattern analysis of pulmonary tuberculosis along with associated nonneoplastic changes and identification of Mycobacterium tuberculosis bacilli was done. Results. The mean age of diagnosis was 41 years with male predominance (92.5%. Tuberculosis was suspected in only 12.1% of cases before death. Seven cases were operated upon due to associated complications or suspicion of malignancy. Tubercular consolidation was the most frequent pattern followed by miliary tuberculosis. The presence of necrotizing granulomas was seen in 33 cases (82.5%. Acid fast bacilli were seen in 57.5% cases on Ziehl-Neelsen stain. Conclusion. Histopathology remains one of the most important methods for diagnosing tuberculosis, especially in TB prevalent areas. It should be considered in the differential diagnosis of all respiratory diseases because of its varied clinical presentations and manifestations.

  15. The role of the Technical Review Panel of the Global Fund to Fight HIV/AIDS, Tuberculosis and Malaria: an analysis of grant recommendations.

    Science.gov (United States)

    Schmidt-Traub, Guido

    2018-04-01

    The independent Technical Review Panel (TRP) of the Global Fund to Fight HIV/AIDS, Tuberculosis and Malaria is a unique mechanism to review funding proposals and to provide recommendations on their funding. Its functioning and performance have received little attention in the scientific literature. We aimed to identify predictors for TRP recommendations, whether these were in line with the Global Fund's ambition to give priority to countries most in need, and whether they correlated with grant performance. We combined data on proposals and applications under the Rolling Continuation Channel, TRP recommendations and grant implementation during the rounds-based mechanism (2002-2010) with country characteristics. Ordered logistic and OLS regressions were used to identify predictors for per-capita funding requests, TRP recommendations, Global Fund funding and grant performance ratings. We tested for financial suppression of large funding proposals and whether fragile or English-speaking countries performed differently from other countries. We found that funding requests and TRP recommendations were consistent with disease burden, but independent of other country characteristics. Countries with larger populations requested less funding per capita, but there is no evidence of financial suppression by the TRP. Proposals from fragile countries were as likely to be recommended as proposals from other countries, and resulting grants performed equally well except for lower performance of HIV/AIDS grants. English-speaking countries obtained more funding for TB and malaria than other countries. In conclusion, the independent TRP acted in line with the guiding principles of the Global Fund to direct funding to countries most in need without ex ante country allocation. The Global Fund appears to have promoted learning on how to design and implement large-scale programs in fragile and non-fragile countries. Other pooled financing mechanisms may consider TRP operating principles to

  16. "Tuberculosis Case Management" Training.

    Science.gov (United States)

    Knebel, Elisa; Kolodner, Jennifer

    2001-01-01

    The need to isolated health providers with critical knowledge in tuberculosis (TB) case management prompted the development of "Tuberculosis Case Management" CD-ROM. Features include "Learning Center,""Examination Room," and "Library." The combination of audio, video, and graphics allows participants to…

  17. Tuberculosis transmission by patients with smear-negative pulmonary tuberculosis in a large cohort in the Netherlands

    NARCIS (Netherlands)

    Tostmann, Alma; Kik, Sandra V.; Kalisvaart, Nico A.; Sebek, Maruschka M.; Verver, Suzanne; Boeree, Martin J.; van Soolingen, Dick

    2008-01-01

    Background. Sputum smear microscopy is commonly used for diagnosing tuberculosis (TB). Although patients with sputum smear-negative TB are less infectious than patients with smear-positive TB, they also contribute to TB transmission. The objective of this study was to determine the proportion of TB

  18. Tuberculosis transmission by patients with smear-negative pulmonary tuberculosis in a large cohort in the Netherlands.

    NARCIS (Netherlands)

    Tostmann, A.; Kik, S.V.; Kalisvaart, N.A.; Sebek, M.M.; Verver, S.; Boeree, M.J.; Soolingen, D. van

    2008-01-01

    BACKGROUND: Sputum smear microscopy is commonly used for diagnosing tuberculosis (TB). Although patients with sputum smear-negative TB are less infectious than patients with smear-positive TB, they also contribute to TB transmission. The objective of this study was to determine the proportion of TB

  19. Your Child with Tuberculosis: A Guide for Parents and Guardians = Su Nino con Tuberculosis: Un Manual para Los Padres.

    Science.gov (United States)

    Amaro, Rodolfo

    Presented in both Spanish and English versions, this booklet is a guide for parents and guardians of children who have tuberculosis (TB). The booklet is organized around specific questions covering topics such as the causes and spread of TB, demographics of TB sufferers, detecting and curing TB, TB treatment and medications, research on the…

  20. Obstructive lung disease as a complication in post pulmonary TB

    Science.gov (United States)

    Tarigan, A. P.; Pandia, P.; Eyanoer, P.; Tina, D.; Pratama, R.; Fresia, A.; Tamara; Silvanna

    2018-03-01

    The case of post TB is a problem that arises in the community. Pulmonary tuberculosis (TB) can affect lung function. Therefore, we evaluated impaired pulmonary function in subjects with diagnosed prior pulmonary TB. A Case Series study, pulmonary function test was performed in subjects with a history of pulmonary tuberculosis; aged ≥18 years were included. Exclusion criteria was a subject who had asthma, obesity, abnormal thorax and smoking history. We measured FEV1 and FVC to evaluate pulmonary function. Airflow obstruction was FEV1/FVC%pulmonary TB, 5 subjects (23%) had airflow obstruction with FEV1/FVC% value pulmonary TB.

  1. Managing and monitoring tuberculosis using web-based tools in combination with traditional approaches.

    Science.gov (United States)

    Chapman, Ann Ln; Darton, Thomas C; Foster, Rachel A

    2013-01-01

    Tuberculosis (TB) remains a global health emergency. Ongoing challenges include the coordination of national and international control programs, high levels of drug resistance in many parts of the world, and availability of accurate and rapid diagnostic tests. The increasing availability and reliability of Internet access throughout both affluent and resource-limited countries brings new opportunities to improve TB management and control through the integration of web-based technologies with traditional approaches. In this review, we explore current and potential future use of web-based tools in the areas of TB diagnosis, treatment, epidemiology, service monitoring, and teaching and training.

  2. Rolling out Xpert MTB/RIF® for tuberculosis detection in HIV-positive populations: An opportunity for systems strengthening

    Directory of Open Access Journals (Sweden)

    Ishani Pathmanathan

    2017-03-01

    Conclusion: Xpert MTB/RIF will only improve patient outcomes if optimally implemented within the context of strong tuberculosis programmes and systems. Roll-out of this technology to people living with HIV and others in resource-limited settings offers the opportunity to leverage current tuberculosis and HIV laboratory, diagnostic and programmatic investments, while also addressing challenges and strengthening coordination between laboratory systems, laboratory-programme interfaces, and tuberculosis-HIV programme interfaces. If successful, the benefits of this tool could extend beyond progress toward global End TB Strategy goals, to improve system-wide capacity for global disease detection and control.

  3. Towards tuberculosis elimination: an action framework for low-incidence countries.

    LENUS (Irish Health Repository)

    2015-04-01

    This paper describes an action framework for countries with low tuberculosis (TB) incidence (<100 TB cases per million population) that are striving for TB elimination. The framework sets out priority interventions required for these countries to progress first towards "pre-elimination" (<10 cases per million) and eventually the elimination of TB as a public health problem (less than one case per million). TB epidemiology in most low-incidence countries is characterised by a low rate of transmission in the general population, occasional outbreaks, a majority of TB cases generated from progression of latent TB infection (LTBI) rather than local transmission, concentration to certain vulnerable and hard-to-reach risk groups, and challenges posed by cross-border migration. Common health system challenges are that political commitment, funding, clinical expertise and general awareness of TB diminishes as TB incidence falls. The framework presents a tailored response to these challenges, grouped into eight priority action areas: 1) ensure political commitment, funding and stewardship for planning and essential services; 2) address the most vulnerable and hard-to-reach groups; 3) address special needs of migrants and cross-border issues; 4) undertake screening for active TB and LTBI in TB contacts and selected high-risk groups, and provide appropriate treatment; 5) optimise the prevention and care of drug-resistant TB; 6) ensure continued surveillance, programme monitoring and evaluation and case-based data management; 7) invest in research and new tools; and 8) support global TB prevention, care and control. The overall approach needs to be multisectorial, focusing on equitable access to high-quality diagnosis and care, and on addressing the social determinants of TB. Because of increasing globalisation and population mobility, the response needs to have both national and global dimensions.

  4. Tuberculosis mortality trends in cuba, 1998 to 2007.

    Science.gov (United States)

    González, Edilberto; Risco, Grisel E; Borroto, Susana; Perna, Abel; Armas, Luisa

    2009-01-01

    Introduction Tuberculosis (TB) is a major cause of illness and death throughout the world. The World Health Organization's Global Plan to Stop TB 2006-2015 proposes that countries cut TB mortality by half compared to 1990 rates. In Cuba, TB mortality declined steadily throughout the 20th century, particularly after 1960. Objective Describe TB mortality distribution and trends in Cuba from January 1998 to December 2007 by infection site, sex, age and province, and determine progress towards the WHO's 2015 target for TB mortality reduction. Methods A time series ecological study was conducted. Death certificates stating TB as cause of death were obtained from the Ministry of Public Health's National Statistics Division, and population data by age group, sex, and province were obtained from the National Statistics Bureau. Crude and specific death rate trends and variation were analyzed. Results TB mortality declined from 0.4 per 100,000 population in 1998 to 0.2 (under half the 1990 rate) in 2007. Clinical forms of the disease, both pulmonary and extrapulmonary, also declined. The highest mortality rates were found in males and in the group aged ≥ 65 years. Rates were also highest in the capital, Havana, with extreme values of 0.73 and 0.39 per 100,000 population at the beginning and end of the period, respectively. Conclusions Deaths from TB declined steadily compared to total deaths and deaths caused by infectious diseases. The Global Plan to Stop TB target was met well ahead of 2015. If this trend continues, TB is likely to become an exceptional cause of death in Cuba.

  5. Testing for TB Infection

    Science.gov (United States)

    ... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

  6. The Bandim tuberculosis score

    DEFF Research Database (Denmark)

    Rudolf, Frauke; Joaquim, Luis Carlos; Vieira, Cesaltina

    2013-01-01

    Background: This study was carried out in Guinea-Bissau ’ s capital Bissau among inpatients and outpatients attending for tuberculosis (TB) treatment within the study area of the Bandim Health Project, a Health and Demographic Surveillance Site. Our aim was to assess the variability between 2...... physicians in performing the Bandim tuberculosis score (TBscore), a clinical severity score for pulmonary TB (PTB), and to compare it to the Karnofsky performance score (KPS). Method : From December 2008 to July 2009 we assessed the TBscore and the KPS of 100 PTB patients at inclusion in the TB cohort and...

  7. Tuberculosis burden in an urban population: a cross sectional tuberculosis survey from Guinea Bissau

    DEFF Research Database (Denmark)

    Bjerregaard-Andersen, Morten; da Silva, Zacarias J; Ravn, Pernille

    2010-01-01

    BACKGROUND: Little is known about the prevalence of pulmonary tuberculosis (TB) in low income countries. We conducted a cross sectional survey for pulmonary TB and TB symptoms in Bissau, Guinea-Bissau, in an urban cohort with known HIV prevalence. TB surveillance in the area is routinely based...

  8. Tuberculosis burden in an urban population: a cross sectional tuberculosis survey from Guinea-Bissau

    DEFF Research Database (Denmark)

    Bjerregaard-Andersen, Morten; da Silva, Zacarias J; Ravn, Pernille

    2010-01-01

    ABSTRACT: BACKGROUND: Little is known about the prevalence of pulmonary tuberculosis (TB) in low income countries. We conducted a cross sectional survey for pulmonary TB and TB symptoms in Bissau, Guinea-Bissau, in an urban cohort with known HIV prevalence. TB surveillance in the area is routinely...

  9. A review of co-morbidity between infectious and chronic disease in Sub Saharan Africa: TB and diabetes mellitus, HIV and metabolic syndrome, and the impact of globalization.

    Science.gov (United States)

    Young, Fiona; Critchley, Julia A; Johnstone, Lucy K; Unwin, Nigel C

    2009-09-14

    Africa is facing a rapidly growing chronic non-communicable disease burden whilst at the same time experiencing continual high rates of infectious disease. It is well known that some infections increase the risk of certain chronic diseases and the converse. With an increasing dual burden of disease in Sub Saharan Africa the associations between diseases and our understanding of them will become of increased public health importance. In this review we explore the relationships reported between tuberculosis and diabetes mellitus, human immunodeficiency virus, its treatment and metabolic risk. We aimed to address the important issues surrounding these associations within a Sub Saharan African setting and to describe the impact of globalization upon them. Diabetes has been associated with a 3-fold incident risk of tuberculosis and it is hypothesised that tuberculosis may also increase the risk of developing diabetes. During co-morbid presentation of tuberculosis and diabetes both tuberculosis and diabetes outcomes are reported to worsen. Antiretroviral therapy for HIV has been associated with an increased risk of developing metabolic syndrome and HIV has been linked with an increased risk of developing both diabetes and cardiovascular disease. Globalization is clearly related to an increased risk of diabetes and cardiovascular disease. It may be exerting other negative and positive impacts upon infectious and chronic non-communicable disease associations but at present reporting upon these is sparse. The impact of these co-morbidities in Sub Saharan Africa is likely to be large. An increasing prevalence of diabetes may hinder efforts at tuberculosis control, increasing the number of susceptible individuals in populations where tuberculosis is endemic, and making successful treatment harder. Roll out of anti-retroviral treatment coverage within Sub Saharan Africa is an essential response to the HIV epidemic however it is likely to lead to a growing number of individuals

  10. Sputum microbiota in tuberculosis as revealed by 16S rRNA pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Man Kit Cheung

    Full Text Available BACKGROUND: Tuberculosis (TB remains a global threat in the 21st century. Traditional studies of the disease are focused on the single pathogen Mycobacterium tuberculosis. Recent studies have revealed associations of some diseases with an imbalance in the microbial community. Characterization of the TB microbiota could allow a better understanding of the disease. METHODOLOGY/PRINCIPAL FINDINGS: Here, the sputum microbiota in TB infection was examined by using 16S rRNA pyrosequencing. A total of 829,873 high-quality sequencing reads were generated from 22 TB and 14 control sputum samples. Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were the five major bacterial phyla recovered, which together composed over 98% of the microbial community. Proteobacteria and Bacteroidetes were more represented in the TB samples and Firmicutes was more predominant in the controls. Sixteen major bacterial genera were recovered. Streptococcus, Neisseria and Prevotella were the most predominant genera, which were dominated by several operational taxonomic units grouped at a 97% similarity level. Actinomyces, Fusobacterium, Leptotrichia, Prevotella, Streptococcus, and Veillonella were found in all TB samples, possibly representing the core genera in TB sputum microbiota. The less represented genera Mogibacterium, Moryella and Oribacterium were enriched statistically in the TB samples, while a genus belonging to the unclassified Lactobacillales was enriched in the controls. The diversity of microbiota was similar in the TB and control samples. CONCLUSIONS/SIGNIFICANCE: The composition and diversity of sputum microbiota in TB infection was characterized for the first time by using high-throughput pyrosequencing. It lays the framework for examination of potential roles played by the diverse microbiota in TB pathogenesis and progression, and could ultimately facilitate advances in TB treatment.

  11. Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

    Directory of Open Access Journals (Sweden)

    Bony Wiem Lestari

    2016-12-01

    Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

  12. Human Rights and the Global Fund to Fight AIDS, Tuberculosis and Malaria

    Science.gov (United States)

    Jürgens, Ralf; Lim, Hyeyoung; Timberlake, Susan; Smith, Matthew

    2017-01-01

    Abstract The Global Fund to Fight AIDS, Tuberculosis and Malaria was created to greatly expand access to basic services to address the three diseases in its name. From its beginnings, its governance embodied some human rights principles: civil society is represented on its board, and the country coordination mechanisms that oversee funding requests to the Global Fund include representatives of people affected by the diseases. The Global Fund’s core strategies recognize that the health services it supports would not be effective or cost-effective without efforts to reduce human rights-related barriers to access and utilization of health services, particularly those faced by socially marginalized and criminalized persons. Basic human rights elements were written into Global Fund grant agreements, and various technical support measures encouraged the inclusion in funding requests of programs to reduce human rights-related barriers. A five-year initiative to provide intensive technical and financial support for the scaling up of programs to reduce these barriers in 20 countries is ongoing. PMID:29302175

  13. The Global Fund to Fight AIDS, Tuberculosis and Malaria: 10 years on.

    Science.gov (United States)

    Hanefeld, Johanna

    2014-02-01

    The Global Fund to Fight AIDS, Tuberculosis and Malaria (the Global Fund or GFATM) is a private public partnership aimed at leveraging and providing funding for the three focal diseases outlined in its title. Set up in 2002, the fund was part of a new 'breed' of players in the field of global health, combining skills from bilateral and multilateral agencies with private sector and civil society. Highly innovative in its structure and funding model, the Global Fund's secretariat in Geneva provides grants directly to one or more organisations - not just governments - in recipient countries. Despite great successes, including scaling up treatment for AIDS to reach 4.2 million people, the fund has been the subject of intense debate. This includes discussion of its impact on health systems and allegations of financial irregularities among recipients in four countries. The organisation has now emerged with a new strategy, funding model and executive director. This paper charts its history, discusses some of the challenges faced, drawing on fieldwork conducted by the author in 2007-08, and reflects on recent changes and the road ahead.

  14. Tuberculosis Vaccines and Prevention of Infection

    Science.gov (United States)

    Day, Tracey A.; Scriba, Thomas J.; Hatherill, Mark; Hanekom, Willem A.; Evans, Thomas G.; Churchyard, Gavin J.; Kublin, James G.; Bekker, Linda-Gail; Self, Steven G.

    2014-01-01

    SUMMARY Tuberculosis (TB) is a leading cause of death worldwide despite the availability of effective chemotherapy for over 60 years. Although Mycobacterium bovis bacillus Calmette-Guérin (BCG) vaccination protects against active TB disease in some populations, its efficacy is suboptimal. Development of an effective TB vaccine is a top global priority that has been hampered by an incomplete understanding of protective immunity to TB. Thus far, preventing TB disease, rather than infection, has been the primary target for vaccine development. Several areas of research highlight the importance of including preinfection vaccines in the development pipeline. First, epidemiology and mathematical modeling studies indicate that a preinfection vaccine would have a high population-level impact for control of TB disease. Second, immunology studies support the rationale for targeting prevention of infection, with evidence that host responses may be more effective during acute infection than during chronic infection. Third, natural history studies indicate that resistance to TB infection occurs in a small percentage of the population. Fourth, case-control studies of BCG indicate that it may provide protection from infection. Fifth, prevention-of-infection trials would have smaller sample sizes and a shorter duration than disease prevention trials and would enable opportunities to search for correlates of immunity as well as serve as a criterion for selecting a vaccine product for testing in a larger TB disease prevention trial. Together, these points support expanding the focus of TB vaccine development efforts to include prevention of infection as a primary goal along with vaccines or other interventions that reduce the rate of transmission and reactivation. PMID:25428938

  15. The risk of global epidemic replacement with drug-resistant Mycobacterium tuberculosis strains

    Directory of Open Access Journals (Sweden)

    Emma S. McBryde

    2017-03-01

    Results and conclusions: The ability of MDR-TB to dominate DS-TB was highly sensitive to the relative transmissibility of the resistant strain; however, MDR-TB could dominate even when its transmissibility was modestly reduced (to between 50% and 100% as transmissible as the DS-TB strain. This model suggests that it may take decades or more for strain replacement to occur. It was also found that while the amplification of resistance is the early cause of MDR-TB, this will rapidly give way to person-to-person transmission.

  16. Tuberculosis 2015: burden, challenges and strategy for control and elimination

    Directory of Open Access Journals (Sweden)

    Mario Raviglione

    2016-06-01

    Full Text Available Tuberculosis (TB is a leading cause of morbidity and mortality worldwide, accounting for about 9.6 million new cases and 1.5 million deaths annually. The poorest and socially excluded groups carry the largest burden of disease, which makes it essential to properly address the social determinants of health through poverty reduction measures and targeted interventions on high-risk populations. The spread of multidrug-resistance TB requires special attention and highlights the need to foster research on TB diagnostics, new drugs and vaccines. Although many advances have been made in the fight against TB over the last twenty years, a lot is still needed to achieve global elimination. The new end-TB strategy that was first launched in 2014 by the World Health Organization, is fully in line with the seventeen Sustainable Development Goals that came into effect since January 2016 and sets ambitious goals for the post-2015 agenda. A 90% reduction in TB-related mortality and an 80% decline in TB incidence within 2030 as well as the abolition of catastrophic expenditures for TB-affected people are the main targets of this strategy. Strong government commitment and adequate financing from all countries together with community engagement and appropriate investments in research are necessary in order to reach these objectives.

  17. Enhancing TB case detection: experience in offering upfront Xpert MTB/RIF testing to pediatric presumptive TB and DR TB cases for early rapid diagnosis of drug sensitive and drug resistant TB.

    Directory of Open Access Journals (Sweden)

    Neeraj Raizada

    Full Text Available Diagnosis of pulmonary tuberculosis (PTB in children is challenging due to difficulties in obtaining good quality sputum specimens as well as the paucibacillary nature of disease. Globally a large proportion of pediatric tuberculosis (TB cases are diagnosed based only on clinical findings. Xpert MTB/RIF, a highly sensitive and specific rapid tool, offers a promising solution in addressing these challenges. This study presents the results from pediatric groups taking part in a large demonstration study wherein Xpert MTB/RIF testing replaced smear microscopy for all presumptive PTB cases in public health facilities across India.The study covered a population of 8.8 million across 18 programmatic sub-district level tuberculosis units (TU, with one Xpert MTB/RIF platform established at each study TU. Pediatric presumptive PTB cases (both TB and Drug Resistant TB (DR-TB accessing any public health facilities in study area were prospectively enrolled and tested on Xpert MTB/RIF following a standardized diagnostic algorithm.4,600 pediatric presumptive pulmonary TB cases were enrolled. 590 (12.8%, CI 11.8-13.8 pediatric PTB were diagnosed. Overall 10.4% (CI 9.5-11.2 of presumptive PTB cases had positive results by Xpert MTB/RIF, compared with 4.8% (CI 4.2-5.4 who had smear-positive results. Upfront Xpert MTB/RIF testing of presumptive PTB and presumptive DR-TB cases resulted in diagnosis of 79 and 12 rifampicin resistance cases, respectively. Positive predictive value (PPV for rifampicin resistance detection was high (98%, CI 90.1-99.9, with no statistically significant variation with respect to past history of treatment.Upfront access to Xpert MTB/RIF testing in pediatric presumptive PTB cases was associated with a two-fold increase in bacteriologically-confirmed PTB, and increased detection of rifampicin-resistant TB cases under routine operational conditions across India. These results suggest that routine Xpert MTB/RIF testing is a promising

  18. Associations between Mycobacterium tuberculosis Strains and Phenotypes

    Science.gov (United States)

    Brown, Timothy; Nikolayevskyy, Vladyslav; Velji, Preya

    2010-01-01

    To inform development of tuberculosis (TB) control strategies, we characterized a total of 2,261 Mycobacterium tuberculosis complex isolates by using multiple phenotypic and molecular markers, including polymorphisms in repetitive sequences (spoligotyping and variable-number tandem repeats [VNTRs]) and large sequence and single-nucleotide polymorphisms. The Beijing family was strongly associated with multidrug resistance (p = 0.0001), and VNTR allelic variants showed strong associations with spoligotyping families: >5 copies at exact tandem repeat (ETR) A, >2 at mycobacterial interspersed repetitive unit 24, and >3 at ETR-B associated with the East African–Indian and M. bovis strains. All M. tuberculosis isolates were differentiated into 4 major lineages, and a maximum parsimony tree was constructed suggesting a more complex phylogeny for M. africanum. These findings can be used as a model of pathogen global diversity. PMID:20113558

  19. International standards for tuberculosis care: Relevance and implications for laboratory professionals

    Directory of Open Access Journals (Sweden)

    Pai M

    2007-01-01

    Full Text Available On World Tuberculosis (TB Day 2006, the International Standards for Tuberculosis Care (ISTC was officially released and widely endorsed by several agencies and organizations. The ISTC release was the culmination of a year long global effort to develop and set internationally acceptable, evidence-based standards for tuberculosis care. The ISTC describes a widely endorsed level of care that all practitioners, public and private, should seek to achieve in managing individuals who have or are suspected of having, TB and is intended to facilitate the effective engagement of all healthcare providers in delivering high quality care for patients of all ages, including those with smear-positive, smear-negative and extra-pulmonary TB, TB caused by drug-resistant Mycobacterium tuberculosis and TB/HIV coinfection. In this article, we present the ISTC, with a special focus on the diagnostic standards and describe their implications and relevance for laboratory professionals in India and worldwide. Laboratory professionals play a critical role in ensuring that all the standards are actually met by providing high quality laboratory services for smear microscopy, culture and drug susceptibility testing and other services such as testing for HIV infection. In fact, if the ISTC is widely followed, it can be expected that there will be a greater need and demand for quality assured laboratory services and this will have obvious implications for all laboratories in terms of work load, requirement for resources and trained personnel and organization of quality assurance systems.

  20. Temporal distribution of tuberculosis in the State of Amazonas, Brazil

    Directory of Open Access Journals (Sweden)

    Marlucia da Silva Garrido

    2015-06-01

    Full Text Available Tuberculosis (TB is one of the infectious diseases that contributes most to the morbidity and mortality of millions of people worldwide. Brazil is one of 22 countries that accounts for 80% of the tuberculosis global burden. The highest incidence rates in Brazil occur in the States of Amazonas and Rio de Janeiro. The aim of this study was to describe the temporal distribution of TB in the State of Amazonas. Between 2001 and 2011, 28,198 cases of tuberculosis were reported in Amazonas, distributed among 62 municipalities, with the capital Manaus reporting the highest (68.7% concentration of cases. Tuberculosis was more prevalent among males (59.3% aged 15 to 34 years old (45.5%, whose race/color was predominantly pardo (64.7% and who had pulmonary TB (84.3%. During this period, 81 cases of multidrug-resistant TB were registered, of which the highest concentration was reported from 2008 onward (p = 0.002. The municipalities with the largest numbers of indigenous individuals affected were São Gabriel da Cachoeira (93%, Itamarati (78.1%, and Santa Isabel do Rio Negro (70.1%. The future outlook for this region includes strengthening the TB control at the primary care level, by expanding diagnostic capabilities, access to treatment, research projects developed in collaboration with the Dr. Heitor Vieira Dourado Tropical Medicine Foundation .;Fundação de Medicina Tropical Dr. Heitor Vieira Dourado (FMT-HVD.; and financing institutions, such as the project for the expansion of the Clinical Research Center and the creation of a hospital ward for individuals with transmissible respiratory diseases, including TB.

  1. Mycobacterium tuberculosis lipolytic enzymes as potential biomarkers for the diagnosis of active tuberculosis.

    Directory of Open Access Journals (Sweden)

    Belinda Brust

    Full Text Available BACKGROUND: New diagnosis tests are urgently needed to address the global tuberculosis (TB burden and to improve control programs especially in resource-limited settings. An effective in vitro diagnostic of TB based on serological methods would be regarded as an attractive progress because immunoassays are simple, rapid, inexpensive, and may offer the possibility to detect cases missed by standard sputum smear microscopy. However, currently available serology tests for TB are highly variable in sensitivity and specificity. Lipolytic enzymes have recently emerged as key factors in lipid metabolization during dormancy and/or exit of the non-replicating growth phase, a prerequisite step of TB reactivation. The focus of this study was to analyze and compare the potential of four Mycobacterium tuberculosis lipolytic enzymes (LipY, Rv0183, Rv1984c and Rv3452 as new markers in the serodiagnosis of active TB. METHODS: Recombinant proteins were produced and used in optimized ELISA aimed to detect IgG and IgM serum antibodies against the four lipolytic enzymes. The capacity of the assays to identify infection was evaluated in patients with either active TB or latent TB and compared with two distinct control groups consisting of BCG-vaccinated blood donors and hospitalized non-TB individuals. RESULTS: A robust humoral response was detected in patients with active TB whereas antibodies against lipolytic enzymes were infrequently detected in either uninfected groups or in subjects with latent infection. High specifity levels, ranging from 93.9% to 97.5%, were obtained for all four antigens with sensitivity values ranging from 73.4% to 90.5%, with Rv3452 displaying the highest performances. Patients with active TB usually exhibited strong IgG responses but poor IgM responses. CONCLUSION: These results clearly indicate that the lipolytic enzymes tested are strongly immunogenic allowing to distinguish active from latent TB infections. They appear as potent

  2. A systematic assessment of the concept and practice of public-private mix for tuberculosis care and control.

    Science.gov (United States)

    Malmborg, Rasmus; Mann, Gillian; Squire, S Bertel

    2011-11-10

    The STOP TB Partnership aims to improve global tuberculosis (TB) control through expanding access to the directly observed treatment short course (DOTS) strategy. One approach to this is 'Engaging all Care Providers', which evolved from 'Public-Private Mix (PPM) DOTS'. The overall aim of this study was to systematically assess whether and to what degree the STOP TB Partnership's four global objectives of engaging all care providers are met through existing PPM interventions. These four objectives are; 1) Increase TB case detection; 2) Improve TB treatment outcomes; 3) Enhance access and equity; 4) Reduce financial burden on patients. The specific objectives of this assessment were to 1) Understand what PPM means to the STOP TB Partnership's PPM Subgroup and to National Tuberculosis Programme managers; 2) Scope the nature of existing country-level PPM interventions and 3) Review PPM practice against the global PPM objectives. We undertook a systematic, multi-facetted assessment. The methods included interviews with National Tuberculosis Programme managers from high burden countries, clarification of key issues with the STOP TB Partnership PPM secretariat and a review of publicly accessible reports and published articles on PPM projects. Both the literature review and interviews with the National Tuberculosis Programme managers yielded data on project characteristics; PPM models at country level; National Tuberculosis Programme partners; and mechanisms for engagement. Matrices were developed from the literature review and the interviews to show the relationship between services and service providers for different PPM projects. Data from the literature were assessed against each of the four global PPM objectives. Twelve National Tuberculosis Programme managers from high burden countries were interviewed about the scope of PPM partnerships. Understanding of PPM and types of engaged providers varied considerably; 'private-for-profit qualified clinical providers' were

  3. Miliary tuberculosis: A new look at an old foe

    Directory of Open Access Journals (Sweden)

    Surendra K. Sharma

    2016-05-01

    Full Text Available Miliary tuberculosis (TB, is a fatal form of disseminated TB characterized by tiny tubercles evident on gross pathology similar to innumerable millet seeds in size and appearance. Global HIV/AIDS pandemic and increasing use of immunosuppressive drugs have altered the epidemiology of miliary TB. Keeping in mind its protean manifestations, clinicians should have a low threshold for suspecting miliary TB. Careful physical examination should focus on identifying organ system involvement early, particularly TB meningitis, as this has therapeutic significance. Fundus examination for detecting choroid tubercles can help in early diagnosis as their presence is pathognomonic of miliary TB. Imaging modalities help in recognizing the miliary pattern, define the extent of organ system involvement and facilitate image guided fine-needle aspiration cytology or biopsy from various organ sites. Sputum or BAL fluid examination, pleural, pericardial, peritoneal fluid and cerebrospinal fluid studies, fine needle aspiration cytology or biopsy of the lymph nodes, needle biopsy of the liver, bone marrow aspiration and biopsy, testing of body fluids must be carried out. GeneXpert MTB/RIF, line probe assay, mycobacterial culture and drug-susceptibility testing must be carried out as appropriate and feasible. Treatment of miliary TB should be started at the earliest as this can be life saving. Response to first-line anti-TB drugs is good. Screening and monitoring for complications like acute respiratory distress syndrome (ARDS, adverse drug reactions like drug-induced liver injury, drug-drug interactions, especially in patients co-infected with HIV/AIDS, are warranted. Sparse data are available from randomized controlled trials regarding optimum regimen and duration of anti-TB treatment. Keywords: Miliary tuberculosis, Human immunodeficiency virus, Diagnosis, Treatment, Complications

  4. Automatic identification of tuberculosis mycobacterium

    Directory of Open Access Journals (Sweden)

    Cicero Ferreira Fernandes Costa Filho

    Full Text Available Introduction According to the Global TB control report of 2013, “Tuberculosis (TB remains a major global health problem. In 2012, an estimated 8.6 million people developed TB and 1.3 million died from the disease. Two main sputum smear microscopy techniques are used for TB diagnosis: Fluorescence microscopy and conventional microscopy. Fluorescence microscopy is a more expensive diagnostic method because of the high costs of the microscopy unit and its maintenance. Therefore, conventional microscopy is more appropriate for use in developing countries. Methods This paper presents a new method for detecting tuberculosis bacillus in conventional sputum smear microscopy. The method consists of two main steps, bacillus segmentation and post-processing. In the first step, the scalar selection technique was used to select input variables for the segmentation classifiers from four color spaces. Thirty features were used, including the subtractions of the color components of different color spaces. In the post-processing step, three filters were used to separate bacilli from artifact: a size filter, a geometric filter and a Rule-based filter that uses the components of the RGB color space. Results In bacillus identification, an overall sensitivity of 96.80% and an error rate of 3.38% were obtained. An image database with 120-sputum-smear microscopy slices of 12 patients with objects marked as bacillus, agglomerated bacillus and artifact was generated and is now available online. Conclusions The best results were obtained with a support vector machine in bacillus segmentation associated with the application of the three post-processing filters.

  5. Diabetes mellitus: an important risk factor for reactivation of tuberculosis

    Directory of Open Access Journals (Sweden)

    Ernesto Solá

    2016-07-01

    Full Text Available Diabetes mellitus was identified as a risk factor for developing tuberculosis (TB infection, and relapse after therapy. The risk of acquiring TB is described as comparable to that of HIV population. The fact that diabetics are 3× times more prone to develop pulmonary TB than nondiabetics cannot be overlooked. With DM recognized as global epidemic, and TB affecting one-third of the world population, physicians must remain vigilant. We present a 45-year-old woman born in Dominican Republic (DR, with 10-year history of T2DM treated with metformin, arrived to our Urgency Room complaining of dry cough for the past 3months. Interview unveiled unintentional 15lbs weight loss, night sweats, occasional unquantified fever, and general malaise but denied bloody sputum. She traveled to DR 2years before, with no known ill exposure. Physical examination showed a thin body habitus, otherwise well appearing woman with stable vital signs, presenting solely right middle lung field ronchi. LDH, ESR, hsCRP and Hg A1C were elevated. Imaging revealed a right middle lobe cavitation. Sputum for AFB disclosed active pulmonary TB. Our case portrays that the consideration of TB as differential diagnosis in diabetics should be exercised with the same strength, as it is undertaken during the evaluation of HIV patients with lung cavitation. Inability to recognize TB will endanger the patient, hospital dwellers and staff, and perpetuate this global public health menace.

  6. Pre-employment screening of latent tuberculosis infection among healthcare workers using tuberculin skin test and QuantiFERON-TB Gold test at a tertiary care hospital in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Mohamed El-Helaly

    2014-11-01

    Full Text Available Summary: Objective: To assess the agreement between the tuberculin skin test (TST and the QuantiFERON-TB Gold test (QFT-G as pre-employment screening tests for latent tuberculosis infection (LTBI among healthcare workers. Methods: A retrospective cross-sectional study was conducted among 1412 healthcare workers who were screened for LTBI during the period from August 2009 to May 2011 at a tertiary-care hospital in the Kingdom of Saudi Arabia (KSA. The studied population was screened for LTBI using both TST and QFT-G simultaneously. The agreement between both tests was quantified using the Kappa coefficient (κ. Results: Comparing the results of QFT-G with TST, the tests had a significant overall agreement of 73.7% (1040/1412; κ = 0.33; p < 0.01. Negative concordance comprised 60.1% of the results, and positive concordance comprised 13.5%. However, positive TST but negative QFT comprised 16.3% of the results, and negative TST but positive QFT-G comprised 10.1%. Concordance was significantly associated with young age, female gender, Saudi-born nationals, and early career but not job type (clinical versus non-clinical nor status of Bacillus Calmette–Guerin (BCG vaccination. Conclusions: This study demonstrated 73.7% overall agreement between TST and QFT-G results among healthcare workers during pre-employment screening for LTBI. The results need to be confirmed in future studies before recommending QFT-G as a pre-employment screening test for LTBI. Keywords: Latent tuberculosis infection, Healthcare workers, Tuberculin skin test, QuantiFERON-TB Gold test

  7. Multi drug resistant tuberculosis: a challenge in the management of ...

    African Journals Online (AJOL)

    kemrilib

    tuberculosis has been reported all over Africa but the prevalence is still low. The ... TB patients are co-infected with HIV in Kenya. [2]. MDR TB, which .... Seventeen children had smear positive tuberculosis, of which 13 had cavitatory pulmonary disease. Eight children had central nervous system TB. Thirty-six children were.

  8. Modeling Tuberculosis in Lung and Central Nervous System

    NARCIS (Netherlands)

    M. El-Kebir (Mohammed)

    2010-01-01

    htmlabstractTuberculosis (TB) is caused by the bacterium Mycobacterium tuberculosis (Mtb). Most cases of TB are pulmonary, i.e. the main infection site is in the lung. In this work, we consider pulmonary TB as well as tuberculous meningitis (TBM). The latter is caused by infection of the meninges in

  9. Drug-resistant tuberculosis in Mumbai, India: An agenda for operations research

    Science.gov (United States)

    Mistry, Nerges; Tolani, Monica; Osrin, David

    2012-01-01

    Operations research (OR) is well established in India and is also a prominent feature of the global and local agendas for tuberculosis (TB) control. India accounts for a quarter of the global burden of TB and of new cases. Multidrug-resistant TB is a significant problem in Mumbai, India’s most populous city, and there have been recent reports of totally resistant TB. Much thought has been given to the role of OR in addressing programmatic challenges, by both international partnerships and India’s Revised National TB Control Programme. We attempt to summarize the major challenges to TB control in Mumbai, with an emphasis on drug resistance. Specific challenges include diagnosis of TB and defining cure, detecting drug resistant TB, multiple sources of health care in the private, public and informal sectors, co-infection with human immunodeficiency virus (HIV) and a concurrent epidemic of non-communicable diseases, suboptimal prescribing practices, and infection control. We propose a local agenda for OR: modeling the effects of newer technologies, active case detection, and changes in timing of activities, and mapping hotspots and contact networks; modeling the effects of drug control, changing the balance of ambulatory and inpatient care, and adverse drug reactions; modeling the effects of integration of TB and HIV diagnosis and management, and preventive drug therapy; and modeling the effects of initiatives to improve infection control. PMID:24501697

  10. Horizontal acquisition of a hypoxia-responsive molybdenum cofactor biosynthesis pathway contributed to Mycobacterium tuberculosis pathoadaptation.

    Science.gov (United States)

    Levillain, Florence; Poquet, Yannick; Mallet, Ludovic; Mazères, Serge; Marceau, Michael; Brosch, Roland; Bange, Franz-Christoph; Supply, Philip; Magalon, Axel; Neyrolles, Olivier

    2017-11-01

    The unique ability of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, to persist for long periods of time in lung hypoxic lesions chiefly contributes to the global burden of latent TB. We and others previously reported that the M. tuberculosis ancestor underwent massive episodes of horizontal gene transfer (HGT), mostly from environmental species. Here, we sought to explore whether such ancient HGT played a part in M. tuberculosis evolution towards pathogenicity. We were interested by a HGT-acquired M. tuberculosis-specific gene set, namely moaA1-D1, which is involved in the biosynthesis of the molybdenum cofactor. Horizontal acquisition of this gene set was striking because homologues of these moa genes are present all across the Mycobacterium genus, including in M. tuberculosis. Here, we discovered that, unlike their paralogues, the moaA1-D1 genes are strongly induced under hypoxia. In vitro, a M. tuberculosis moaA1-D1-null mutant has an impaired ability to respire nitrate, to enter dormancy and to survive in oxygen-limiting conditions. Conversely, heterologous expression of moaA1-D1 in the phylogenetically closest non-TB mycobacterium, Mycobacterium kansasii, which lacks these genes, improves its capacity to respire nitrate and grants it with a marked ability to survive oxygen depletion. In vivo, the M. tuberculosis moaA1-D1-null mutant shows impaired survival in hypoxic granulomas in C3HeB/FeJ mice, but not in normoxic lesions in C57BL/6 animals. Collectively, our results identify a novel pathway required for M. tuberculosis resistance to host-imposed stress, namely hypoxia, and provide evidence that ancient HGT bolstered M. tuberculosis evolution from an environmental species towards a pervasive human-adapted pathogen.

  11. La resistencia a múltiples fármacos: una amenaza para el control de la tuberculosis Multiple drug resistance: a threat for tuberculosis control

    Directory of Open Access Journals (Sweden)

    Ernesto Montoro Cardoso

    2004-07-01

    Full Text Available Drug-resistant tuberculosis (TB was reported soon after the introduction of streptomycin, although it did not receive major attention until recently. It was not considered a major issue in the industrialized world until outbreaks of multidrug-resistant TB (MDR-TB were reported among HIV infected people. Administration of standard short-course chemotherapy (SSCC with first-line drugs under directly observed therapy (DOT is the cornerstone of modern TB control. Unfortunately, data available on the treatment outcome of MDR-TB cases under routine programmatic conditions suggest that patients with MDR-TB respond poorly to SSCC with first-line drugs. Since 1994, the World Health Organization and the International Union Against Tuberculosis and Lung Disease (IUATLD have conducted anti-TB drug resistance surveys through a network of subregional laboratories and researchers. Drug resistance was present in almost all settings surveyed, and prevalence varied widely across regions. High prevalence of MDR-TB is widespread in the Russian Federation and areas of the former Soviet Union (Estonia, Kazakhstan, Latvia, and Lithuania as well as Israel, Liaoning and Henan Provinces in China, and Ecuador. The Global Project has surveyed areas representing over one third of notified TB cases. However, enormous gaps still exist in the most crucial areas. The most effective strategy to prevent the emergence of drug resistance is through implementation of the directly observed treatment short (DOTS strategy. Effective implementation of the DOTS strategy saves lives through decreased TB transmission, decreased risk of emergence of drug- resistance, and decreased risk for individual TB patients of treatment failure, TB relapse, and death. The World Bank recognizes the DOTS strategy as one of the most cost-effective health interventions, and recommends that effective TB treatment be a part of the essential clinical services package available in primary health care settings

  12. PATTERN OF EXTRA PULMONARY TUBERCULOSIS AS SEEN IN A TERTIARY CARE CENTER IN SOUTH INDIA

    Directory of Open Access Journals (Sweden)

    Supriya Adiody

    2017-12-01

    Full Text Available BACKGROUND Tuberculosis is one of the major infectious diseases affecting the global population. It ranks alongside HIV as a leading cause of death worldwide. Around 9.6 million people were estimated to be suffering from TB in 2014, out of which 480000 were cases of multi drug resistant TB (MDR-TB. Tuberculosis most commonly affects the lungs. It can involve almost any organ system of the body, the so called extra pulmonary TB. EPTB possess a diagnostic challenge for the clinicians because of lack of specific and usual symptoms of cough. In this study, we have analysed the pattern of EPTB in our center. MATERIALS AND METHODS It was a prospective observational study. 60 patients suffering from EPTB were included and these patients were selected on basis of radiological or histological confirmation of TB with or without AFB positivity source of data included physician prescribing records, patient medication profile, laboratory investigations and presentations. Study was conducted over a period of one year. Patients with Pulmonary Tuberculosis (PTB and HIV were excluded. CONCLUSION Maximum number of patients were in the age group of 21 to 40 years. Males predominantly suffered from the disease. Lymph node TB was the commonest form of EPTB followed by pleural effusion RESULTS There was a slight male preponderance. Lymph node was the commonest site of involvement in EPTB, followed by pleural effusion.

  13. Global Reconstruction for Extensive Destruction in Tuberculosis of the Lumbar Spine and Lumbosacral Junction: A Case Report

    Science.gov (United States)

    Uvaraj, Nalli R.; Bosco, Aju; Gopinath, Nalli R.

    2014-01-01

    Study Design Case report. Objective To analyze the surgical difficulties in restoring global spinal stability and to describe an effective surgical option for tuberculosis with extensive destruction of the lumbosacral spine. Advanced tuberculosis with destruction of the lumbosacral spine can result in a kyphosis or hypolordosis, leading to back pain, spinal instability, and neurological deficits. The conventional treatment goals of lumbosacral tuberculosis are to correct and prevent a lumbar kyphosis, treat or prevent a neurological deficit, and restore global spinal stability. Instrumentation at the lumbosacral junction is technically demanding due to the complex local anatomy, the unique biomechanics, and the difficult fixation in the surrounding diseased bone. Methods We report a 21-year-old woman with tuberculosis from L1 to S2 with back pain and spinal instability. The radiographs showed a kyphosis of the lumbar spine. The magnetic resonance imaging and computed tomography scans revealed extensive destruction of the lumbar and lumbosacral spine. Spinopelvic stabilization combined with anterior debridement and reconstruction with free fibular strut graft was performed. Results The radiographs at follow-up showed a good correction of the kyphosis and excellent graft incorporation and fusion. Conclusions Anterior column reconstruction with a fibular strut graft helps restore and maintain the vertebral height. Posterior stabilization with spinopelvic fixation can be an effective surgical option for reconstructing the spine in extensive lumbosacral tuberculosis with sacral body destruction, requiring long fusions to the sacrum. It augments spinal stability, prevents graft-related complications, and accelerates the graft incorporation and fusion, thereby permitting early mobilization and rehabilitation. In spinal tuberculosis, antitubercular therapy may have to be prolonged in cases with large disease load, based on the clinicoradiographic and laboratory

  14. Antigen-Specific Interferon-Gamma Responses and Innate Cytokine Balance in TB-IRIS

    NARCIS (Netherlands)

    Goovaerts, Odin; Jennes, Wim; Massinga-Loembé, Marguerite; Ceulemans, Ann; Worodria, William; Mayanja-Kizza, Harriet; Colebunders, Robert; Kestens, Luc; Loembé, Marguerite Massinga; Mayanja, Harriet; Mascart, Francoise; van den Bergh, Rafael; Locht, Camille; Reiss, Peter; Cobelens, Frank; Ondoa, Pascale; Pakker, Nadine; Mugerwa, Roy

    2014-01-01

    Background: Tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS) remains a poorly understood complication in HIV-TB patients receiving antiretroviral therapy (ART). TB-IRIS could be associated with an exaggerated immune response to TB-antigens. We compared the recovery of

  15. Obstructive Jaundice Due to Tuberculosis of Distal CBD and ...

    African Journals Online (AJOL)

    Abdominal tuberculosis (TB) commonly affects the intestinal tract, lymph nodes, peritoneum, and solid organs in varying combinations. Hepatobiliary or pancreatic TB is rare and the preoperative diagnosis is difficult. Though rare, there have been a few citations of intrahepatic tuberculosis, but isolated bile duct tuberculosis ...

  16. Epidemics. War on an old scourge. Tuberculosis is back and some nations are unable to restrain it.

    Science.gov (United States)

    1995-09-29

    The World Health Organization (WHO) in 1993 declared a global emergency against tuberculosis (TB). Despite that call for action and government programs to slow its spread, TB continues to kill millions of people annually. An estimated 20 million people are sick worldwide with full-blown TB, nearly two-thirds of whom are in Asia. TB bacteria are emitted from infectious individuals through a cough, sneeze, or breathy discourse, after which they travel through the air to infect other individuals. If untreated, there is a 5-10% chance that the bacteria will become active, attacking the lungs, causing prolonged coughing, weight loss, and ultimately death. Living in crowded or unclean areas increases one's risk of contracting the TB bacteria. Once infected, compromised immune systems will have a harder time than healthy, strong systems fighting off development of the disease. The poor are therefore usually the most severely affected by TB. HIV infection and disease also increase one's susceptibility to TB and other diseases, in addition to making TB more difficult to detect. HIV is spreading in Asia faster than anywhere else on the planet. Since the source of the current TB epidemic is infectious patients who are not totally cured, the WHO recommends that health care workers provide patients with a proper dose of antibiotics and make sure that they take it every day for six months as the most effective TB control strategy. China, India, and Thailand, Asia's most seriously affected countries for TB, have committed to adopting the strategy.

  17. A narrative review of recent progress in understanding the relationship between tuberculosis and protein energy malnutrition.

    Science.gov (United States)

    Hood, M L H

    2013-11-01

    Protein energy malnutrition (PEM) and tuberculosis (TB) are the major public health issues, particularly in the developing country setting. Malnutrition is an underlying cause of many deaths and when left untreated devastates normal physical and cognitive development. TB continues to gather momentum as a serious infectious killer. They have both rightly been highlighted as important global health issues by their inclusion in the Millennium Development Goals. But what is known of their relationship with one another? It is historically accepted that PEM and TB have a synergistic relationship adversely having an impact on one another. However, researchers have sought to apply this understanding in an examination of the relationship between TB and PEM with often inconclusive results. This narrative review of recently published research and current knowledge may help delineate the association between PEM and TB mortality. Such results will assist future research in this important area of health--an area lacking evidence-based guidance.

  18. Demographics of tuberculosis in district mansehra

    International Nuclear Information System (INIS)

    Kamal, M.

    2015-01-01

    Tuberculosis is one of the leading causes of morbidity and mortality across the globe. Pakistan is one of the 22 high tuberculosis burden countries of the world sharing more than 80% of the global burden of tuberculosis. Methods: This study was a retrospective case-based study that analyzed secondary data obtained from TB-03 form at the office of the District Tuberculosis Control Officer (DTO), Mansehra. Data was entered into SPSS-20 and analyzed. Results: A total of 625 patients with a mean age of 32.1±19.1 years were registered at the DTO office during the year 2013. Most of the patients were female (57%) as compared to males (43%). The most common treatment outcome was treatment completed, recorded against 56% of the patients. The proportion of patients declared cured at the end of the treatment was 236 (37.8%). There were only 4 (0.64%) cases of treatment failure during 2013. Conclusion: Despite falling incidence of tuberculosis and mortality across the globe, tuberculosis is still a major determinant of disease in our society. Aggressive case detection and treatment is needed to manage this disease. (author)

  19. The Global Fund to Fight AIDS, Tuberculosis and Malaria's investments in harm reduction through the rounds-based funding model (2002-2014).

    Science.gov (United States)

    Bridge, Jamie; Hunter, Benjamin M; Albers, Eliot; Cook, Catherine; Guarinieri, Mauro; Lazarus, Jeffrey V; MacAllister, Jack; McLean, Susie; Wolfe, Daniel

    2016-01-01

    Harm reduction is an evidence-based, effective response to HIV transmission and other harms faced by people who inject drugs, and is explicitly supported by the Global Fund to Fight AIDS, Tuberculosis and Malaria. In spite of this, people who inject drugs continue to have poor and inequitable access to these services and face widespread stigma and discrimination. In 2013, the Global Fund launched a new funding model-signalling the end of the previous rounds-based model that had operated since its founding in 2002. This study updates previous analyses to assess Global Fund investments in harm reduction interventions for the duration of the rounds-based model, from 2002 to 2014. Global Fund HIV and TB/HIV grant documents from 2002 to 2014 were reviewed to identify grants that contained activities for people who inject drugs. Data were collected from detailed grant budgets, and relevant budget lines were recorded and analysed to determine the resources allocated to different interventions that were specifically targeted at people who inject drugs. 151 grants for 58 countries, plus one regional proposal, contained activities targeting people who inject drugs-for a total investment of US$ 620 million. Two-thirds of this budgeted amount was for interventions in the "comprehensive package" defined by the United Nations. 91% of the identified amount was for Eastern Europe and Asia. This study represents an updated, comprehensive assessment of Global Fund investments in harm reduction from its founding (2002) until the start of the new funding model (2014). It also highlights the overall shortfall of harm reduction funding, with the estimated global need being US$ 2.3 billion for harm reduction in 2015 alone. Using this baseline, the Global Fund must carefully monitor its new funding model and ensure that investments in harm reduction are maintained or scaled-up. There are widespread concerns regarding the withdrawal from middle-income countries where harm reduction remains

  20. Time of highest tuberculosis death risk and associated factors: an observation of 12 years in Northern Thailand

    Directory of Open Access Journals (Sweden)

    Saiyud Moolphate

    2011-02-01

    patients at higher risk for TB death. These findings would be useful for prioritizing interventions in order to diminish TB-related deaths globally. Studies based on these findings are necessary for the introduction of newer intervention strategies.Keywords: tuberculosis, TB death, Thailand, time of death

  1. Patients with secondary amenorrhea due to tuberculosis ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is a disease which can affect various organs, including human's genital organs such as the endometrium. Tuberculosis endometritis can cause clinical symptoms of secondary amenorrhea and infertility. Infertility in genital TB caused by the involvement of the endometrium. The case presentation is ...

  2. Modelling the Transitional Dynamics of Mycobacterium Tuberculosis ...

    African Journals Online (AJOL)

    The World Health Organization's targets of eliminating Tuberculosis (TB) by 2050 is challenged by the emergence and spread of drug resistance TB. However, the traditional mechanism of resistance is that of acquired resistance, whereby the mycobacterium Tuberculosis (MTB) strain develops mutations under selective ...

  3. The emergence of extensively drug-resistant tuberculosis: a global health crisis requiring new interventions: part I: the origins and nature of the problem.

    Science.gov (United States)

    Ellner, Jerrold J

    2008-12-01

    Surveillance studies and outbreak investigations indicate that an extensively drug-resistant (XDR) form of tuberculosis (TB) is increasing in prevalence worldwide. In outbreak settings among HIV-infected, there is a high-case fatality rate. Better outcomes occur in HIV-uninfected, particularly if drug susceptibility test (DST) results are available rapidly to allow tailoring of drug therapy. This review will be presented in two segments. The first characterizes the problem posed by XDR-TB, addressing the epidemiology and evolution of XDR-TB and treatment outcomes. The second reviews technologic advances that may contribute to the solution, new diagnostics, and advances in understanding drug resistance and in the development of new drugs.

  4. Conjugated and Entrapped HPMA-PLA Nano-Polymeric Micelles Based Dual Delivery of First Line Anti TB Drugs: Improved and Safe Drug Delivery against Sensitive and Resistant Mycobacterium Tuberculosis.

    Science.gov (United States)

    Upadhyay, Seema; Khan, Iliyas; Gothwal, Avinash; Pachouri, Praveen K; Bhaskar, N; Gupta, Umesh D; Chauhan, Devendra S; Gupta, Umesh

    2017-09-01

    First line antiTB drugs have several physical and toxic manifestations which limit their applications. RIF is a hydrophobic drug and has low water solubility and INH is hepatotoxic. The main objective of the study was to synthesize, characterize HPMA-PLA co-polymeric micelles for the effective dual delivery of INH and RIF. HPMA-PLA co-polymer and HPMA-PLA-INH (HPI) conjugates were synthesized and characterized by FT-IR and 1 H-NMR spectroscopy. Later on RIF loaded HPMA-PLA-INH co-polymeric micelles (PMRI) were formulated and characterized for size, zeta potential and surface morphology (SEM, TEM) as well as critical micellar concentration. The safety was assessed through RBC's interaction study. The prepared PMRI were evaluated through MABA assay against sensitive and resistant strains of M. Tuberculosis. Size, zeta and entrapment efficiency for RIF loaded HPMA-PLA-INH polymeric micelles (PMRI) was 87.64 ± 1.98 nm, -19 ± 1.93 mV and 97.2 ± 1.56%, respectively. In vitro release followed controlled and sustained delivery pattern. Sustained release was also supported by release kinetics. Haemolytic toxicity of HPI and PMRI was 8.57 and 7.05% (p PLA polymeric micelles (PMRI) were more effective against sensitive and resistant M tuberculosis. The developed approach can lead to improved patient compliance and reduced dosing in future, offering improved treatment of tuberculosis.

  5. Nuclear imaging: A powerful novel approach for tuberculosis

    International Nuclear Information System (INIS)

    Johnson, Daniel H.; Via, Laura E.; Kim, Peter; Laddy, Dominick; Lau, Chuen-Yen; Weinstein, Edward A.; Jain, Sanjay

    2014-01-01

    Nearly 20 years after the World Health Organization declared tuberculosis (TB) a global public health emergency, TB still remains a major global threat with 8.6 million new cases and 1.3 million deaths annually. Mycobacterium tuberculosis adapts to a quiescent physiological state, and is notable for complex interaction with the host, producing poorly-understood disease states ranging from latent infection to fully active disease. Of the approximately 2.5 billion people latently infected with M. tuberculosis, many will develop reactivation disease (relapse), years after the initial infection. While progress has been made on some fronts, the alarming spread of multidrug-resistant, extensively drug-resistant, and more recently totally-drug resistant strains is of grave concern. New tools are urgently needed for rapidly diagnosing TB, monitoring TB treatments and to allow unique insights into disease pathogenesis. Nuclear bioimaging is a powerful, noninvasive tool that can rapidly provide three-dimensional views of disease processes deep within the body and conduct noninvasive longitudinal assessments of the same patient. In this review, we discuss the application of nuclear bioimaging to TB, including the current state of the field, considerations for radioprobe development, study of TB drug pharmacokinetics in infected tissues, and areas of research and clinical needs that could be addressed by nuclear bioimaging. These technologies are an emerging field of research, overcome several fundamental limitations of current tools, and will have a broad impact on both basic research and patient care. Beyond diagnosis and monitoring disease, these technologies will also allow unique insights into understanding disease pathogenesis; and expedite bench-to-bedside translation of new therapeutics. Finally, since molecular imaging is readily available for humans, validated tracers will become valuable tools for clinical applications

  6. Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

  7. Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

    Directory of Open Access Journals (Sweden)

    Kiyohiko Izumi

    Full Text Available Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots.Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed.Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2% were general inhabitants, 42 (6.5% were foreign-born people, and 184 were homeless people (28.6%. The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households.Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission

  8. Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

    Science.gov (United States)

    Izumi, Kiyohiko; Ohkado, Akihiro; Uchimura, Kazuhiro; Murase, Yoshiro; Tatsumi, Yuriko; Kayebeta, Aya; Watanabe, Yu; Ishikawa, Nobukatsu

    2015-01-01

    Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots. Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics) identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed. Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2%) were general inhabitants, 42 (6.5%) were foreign-born people, and 184 were homeless people (28.6%). The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households. Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission dynamics in an

  9. High Frequency of CD4+ T Cells Specific for the TB10.4 Protein Correlates with Protection against Mycobacterium tuberculosis Infection

    Czech Academy of Sciences Publication Activity Database

    Hervas-Stubbs, S.; Majlessi, L.; Šimšová, Marcela; Morová, Jana; Rojas, M. J.; Nouzé, C.; Brodin, P.; Šebo, Peter; Leclerc, C.

    2006-01-01

    Roč. 74, č. 6 (2006), s. 3396-3407 ISSN 0019-9567 R&D Projects: GA AV ČR IBS5020311 Institutional research plan: CEZ:AV0Z50200510 Keywords : t cell s * mycobacterium tuberculosis * protein Subject RIV: EE - Microbiology, Virology Impact factor: 4.004, year: 2006

  10. Global, regional, and national incidence and mortality for HIV, tuberculosis, and malaria during 1990—2013: a systematic analysis for the Global Burden of Disease Study 2013

    DEFF Research Database (Denmark)

    J L Murray, Christopher; F Ortblad, Katrina; Guinovart, Caterina

    2014-01-01

    Background The Millennium Declaration in 2000 brought special global attention to HIV, tuberculosis, and malaria through the formulation of Millennium Development Goal (MDG) 6. The Global Burden of Disease 2013 study provides a consistent and comprehensive approach to disease estimation for between...... with and without antiretroviral therapy (ART). For concentrated epidemics, we calibrated Spectrum models to fit vital registration data corrected for misclassification of HIV deaths. In generalised epidemics, we minimised a loss function to select epidemic curves most consistent with prevalence data...... and demographic data for all-cause mortality. We analysed counterfactual scenarios for HIV to assess years of life saved through prevention of mother-to-child transmission (PMTCT) and ART. For tuberculosis, we analysed vital registration and verbal autopsy data to estimate mortality using cause of death ensemble...

  11. Collectin CL-LK Is a Novel Soluble Pattern Recognition Receptor for Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Troegeler, Anthony; Lugo-Villarino, Geanncarlo; Hansen, Søren

    2015-01-01

    Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize mycobacte......Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize...

  12. Extrathoracic manifestations of tuberculosis

    International Nuclear Information System (INIS)

    Kienzl-Palma, D.; Prosch, H.

    2016-01-01

    Besides the lungs, tuberculosis (TB) can affect any organ system. In most cases, extrathoracic TB occurs in immunosuppressed patients as part of a severe illness via hematogenous spread. Extrathoracic involvement most commonly involves abdominal organs, especially the urogenital tract and less commonly the central nervous system (CNS) and the musculoskeletal system. Most frequently, computed tomography (CT) is used for detecting extrathoracic TB manifestations, except for CNS and musculoskeletal manifestations, where contrast-enhanced magnetic resonance imaging (MRI) is the gold standard. Extrathoracic manifestations of TB may be indistinguishable from inflammatory or malignant causes. Due to unspecific symptoms the diagnosis is often delayed. This article summarizes and discusses the various radiological manifestations of extrathoracic manifestation of TB. Radiological modalities for screening extrathoracic TB are CT and MRI. Conventional X-radiographs do not play a role in the diagnosis of extrathoracic TB. The possibility of extrathoracic TB should be considered particularly in immunosuppressed patients, such as the homeless, alcoholics or drug addicts or in patients with an immigrant background from the endemic areas of TB. The most likely site of extrathoracic TB is the abdomen; however, infections of the CNS or musculoskeletal systems and multisystem infections can also occur. In patients with suspected extrathoracic TB, radiological modalities for screening are CT, especially for abdominal infections and lymphadenopathy and MRI with contrast media for the musculoskeletal system and the CNS. (orig.) [de

  13. Development and optimization of an ESAT6-ELISA-based detection system of Mycobacterium tuberculosis complex, suitable for bovine TB eradication

    Directory of Open Access Journals (Sweden)

    Rouhollah Keshavarz

    2015-01-01

    Conclusion: Performing the ELISA test based on ESAT-6 antigen shows that this test can be a suitable way for screening beside the tuberculin test for accurate detection. It is noticed that the specificity of the ELISA test was determined more than the tuberculin test, especially since the culture and PCR are gold standards. Therefore, incorrect sampling can change the specificity of the tuberculin test. The results of this kit can encourage designing of an ELISA kit for the detection of human TB.

  14. Relationship between CT scans and serum tests for diagnosing tuberculosis

    International Nuclear Information System (INIS)

    Oliveira, Marcela de; Pina, Diana R.; Giacomini, Guilherme; Alvarez, Matheus; Pavan, Ana Luiza M.; Pereira, Paulo C.M.

    2014-01-01

    Tuberculosis (TB) is one of the oldest infectious diseases in the world and still affects humanity today. Since 1993, the World Health Organization (WHO) considers TB as a global emergency. The clinical history of the individual, the serum exams and particularly, the imaging examination of the thorax, are used for diagnostic confirmation and monitoring of disease. TB is a chronic disease that usually evolves with pulmonary sequelae that must be monitored. The exam of the image more precise to assess the radiological patterns found in these patients is high-resolution computed tomography (HRCT), which aids in medical diagnosis and permit the determination of the area affected by radiological abnormalities of pulmonary tuberculosis. The best known of such modifications by means of exams or more accurate techniques is of extreme importance. Therefore, this study aimed to show the quantification, performed by algorithms, of the areas affected by the radiological abnormalities of TB through the HRCT, and compared with serum exams. We studied 16 patients with confirmed diagnosis of TB. The serum exams evaluated included: hemoglobin, hematocrit, albumin, speed hemo sedimentation and C-reactive protein. With the values of serum exams we observed that patients have anemia, low albumin levels and inflammatory activity, corroborating imaging exams, which show severe impairment of lung area due to the inflammation caused by disease activity. (author)

  15. Common patterns and disease-related signatures in tuberculosis and sarcoidosis.

    Science.gov (United States)

    Maertzdorf, Jeroen; Weiner, January; Mollenkopf, Hans-Joachim; Bauer, Torsten; Prasse, Antje; Müller-Quernheim, Joachim; Kaufmann, Stefan H E

    2012-05-15

    In light of the marked global health impact of tuberculosis (TB), strong focus has been on identifying biosignatures. Gene expression profiles in blood cells identified so far are indicative of a persistent activation of the immune system and chronic inflammatory pathology in active TB. Definition of a biosignature with unique specificity for TB demands that identified profiles can differentiate diseases with similar pathology, like sarcoidosis (SARC). Here, we present a detailed comparison between pulmonary TB and SARC, including whole-blood gene expression profiling, microRNA expression, and multiplex serum analytes. Our analysis reveals that previously disclosed gene expression signatures in TB show highly similar patterns in SARC, with a common up-regulation of proinflammatory pathways and IFN signaling and close similarity to TB-related signatures. microRNA expression also presented a highly similar pattern in both diseases, whereas cytokines in the serum of TB patients revealed a slightly elevated proinflammatory pattern compared with SARC and controls. Our results indicate several differences in expression between the two diseases, with increased metabolic activity and significantly higher antimicrobial defense responses in TB. However, matrix metallopeptidase 14 was identified as the most distinctive marker of SARC. Described communalities as well as unique signatures in blood profiles of two distinct inflammatory pulmonary diseases not only have considerable implications for the design of TB biosignatures and future diagnosis, but they also provide insights into biological processes underlying chronic inflammatory disease entities of different etiology.

  16. Evaluation of a Tuberculosis Skin Testing Program

    Science.gov (United States)

    Kahn, Pamela

    2009-01-01

    There has been a recent slowdown in the decline of rates of tuberculosis (TB) in the United States. However, there are disparities in TB diagnosis between U.S.-born and foreign-born persons and between Whites and minorities. Measures for achieving TB elimination include identification of high-risk persons, including children and adolescents, at…

  17. Factors Associated with Prevalent Tuberculosis Among Patients ...

    African Journals Online (AJOL)

    Background: Tuberculosis (TB) causes significant morbidity/mortality among human immunodeficiency virus‑infected individuals in Africa. Reducing TB burden in the era of highly active antiretroviral therapy (HAART) is a public health priority. Aim: We determined the factors associated with prevalent TB among patients ...

  18. Tuberculosis prevalence surveys: rationale and cost

    NARCIS (Netherlands)

    Glaziou, P.; van der Werf, M. J.; Onozaki, I.; Dye, C.; Borgdorff, M. W.; Chiang, C.-Y.; Cobelens, F.; Enarson, D. A.; Gopi, P. G.; Holtz, T. H.; Kim, S. J.; van Leth, F.; Lew, W.-J.; Lonnroth, K.; van Maaren, P.; Narayanan, P. R.; Williams, B.

    2008-01-01

    This article is the first of the educational series 'Assessing tuberculosis (TB) prevalence through population-based surveys'. The series will give overall guidance in conducting cross-sectional surveys of pulmonary TB (PTB) disease. TB prevalence surveys are most valuable in areas where

  19. Central nervous system tuberculosis | Cherian | African Health ...

    African Journals Online (AJOL)

    Central nervous system (CNS) involvement, one of the most devastating clinical manifestations of tuberculosis (TB) is noted in 5 to 10% of extrapulmonary TB cases, and accounts for approximately 1% of all TB cases. Definitive diagnosis of tuberculous meningitis (TBM) depends upon the detection of the tubercle bacilli in ...

  20. High Antigen Dose Is Detrimental to Post-Exposure Vaccine Protection against Tuberculosis.

    Science.gov (United States)

    Billeskov, Rolf; Lindenstrøm, Thomas; Woodworth, Joshua; Vilaplana, Cristina; Cardona, Pere-Joan; Cassidy, Joseph P; Mortensen, Rasmus; Agger, Else Marie; Andersen, Peter

    2017-01-01

    Mycobacterium tuberculosis (Mtb), the etiologic agent of tuberculosis (TB), causes 1.8M deaths annually. The current vaccine, BCG, has failed to eradicate TB leaving 25% of the world's population with latent Mtb infection (LTBI), and 5-10% of these people will reactivate and develop active TB. An efficient therapeutic vaccine targeting LTBI could have an enormous impact on global TB incidence, and could be an important aid in fighting multidrug resistance, which is increasing globally. Here we show in a mouse model using the H56 (Ag85B-ESAT-6-Rv2660) TB vaccine candidate that post-exposure, but not preventive, vaccine protection requires low vaccine antigen doses for optimal protection. Loss of protection from high dose post-exposure vaccination was not associated with a loss of overall vaccine response magnitude, but rather with greater differentiation and lower functional avidity of vaccine-specific CD4 T cells. High vaccine antigen dose also led to a decreased ability of vaccine-specific CD4 T cells to home into the Mtb-infected lung parenchyma, a recently discovered important feature of T cell protection in mice. These results underscore the importance of T cell quality rather than magnitude in TB-vaccine protection, and the significant role that antigen dosing plays in vaccine-mediated protection.

  1. High Antigen Dose Is Detrimental to Post-Exposure Vaccine Protection against Tuberculosis

    Directory of Open Access Journals (Sweden)

    Rolf Billeskov

    2018-01-01

    Full Text Available Mycobacterium tuberculosis (Mtb, the etiologic agent of tuberculosis (TB, causes 1.8M deaths annually. The current vaccine, BCG, has failed to eradicate TB leaving 25% of the world’s population with latent Mtb infection (LTBI, and 5–10% of these people will reactivate and develop active TB. An efficient therapeutic vaccine targeting LTBI could have an enormous impact on global TB incidence, and could be an important aid in fighting multidrug resistance, which is increasing globally. Here we show in a mouse model using the H56 (Ag85B-ESAT-6-Rv2660 TB vaccine candidate that post-exposure, but not preventive, vaccine protection requires low vaccine antigen doses for optimal protection. Loss of protection from high dose post-exposure vaccination was not associated with a loss of overall vaccine response magnitude, but rather with greater differentiation and lower functional avidity of vaccine-specific CD4 T cells. High vaccine antigen dose also led to a decreased ability of vaccine-specific CD4 T cells to home into the Mtb-infected lung parenchyma, a recently discovered important feature of T cell protection in mice. These results underscore the importance of T cell quality rather than magnitude in TB-vaccine protection, and the significant role that antigen dosing plays in vaccine-mediated protection.

  2. 1 Tuberculosis in India: A need of Public Awareness & Education

    African Journals Online (AJOL)

    2015-05-07

    May 7, 2015 ... MDR-TB(Multi-drug resistant tuberculosis) in absolute numbers during 2008 ... treatment units, One TB Hospital, 501 DOT centres, 38 NGOs and 2829 private .... presence of the family member or accompanying person.

  3. Technical aspects of mediastinal ultrasound for pediatric pulmonary tuberculosis

    NARCIS (Netherlands)

    Pool, Kara-Lee; Heuvelings, Charlotte C.; Bélard, Sabine; Grobusch, Martin P.; Zar, Heather J.; Bulas, Dorothy; Garra, Brian; Andronikou, Savvas

    2017-01-01

    Diagnosing childhood pulmonary tuberculosis (TB) may be challenging due to difficulties in obtaining adequate sputum samples, paucibacillary disease and the low sensitivity of diagnostic tests. Chest radiography is an important diagnostic tool for pulmonary TB, but it involves radiation exposure,

  4. Prevalence and risk factors for tuberculosis infection among hospital workers in Hanoi, Viet Nam.

    Science.gov (United States)

    Lien, Luu Thi; Hang, Nguyen Thi Le; Kobayashi, Nobuyuki; Yanai, Hideki; Toyota, Emiko; Sakurada, Shinsaku; Thuong, Pham Huu; Cuong, Vu Cao; Nanri, Akiko; Mizoue, Tetsuya; Matsushita, Ikumi; Harada, Nobuyuki; Higuchi, Kazue; Tuan, Le Anh; Keicho, Naoto

    2009-08-27

    Transmission of tuberculosis (TB) to health care workers (HCWs) is a global issue. Although effective infection control measures are expected to reduce nosocomial TB, HCWs' infection has not been assessed enough in TB high burden countries. We conducted a cross-sectional study to determine the prevalence of TB infection and its risk factors among HCWs in Hanoi, Viet Nam. A total of 300 HCWs including all staff members in a municipal TB referral hospital received an interferon-gamma release assay (IGRA), QuantiFERON-TB Gold In-Tube(TM), followed by one- and two-step tuberculin skin test (TST) and a questionnaire-based interview. Agreement between the tests was evaluated by kappa statistics. Risk factors for TB infection were analyzed using a logistic regression model. Among the participants aged from 20 to 58 years (median = 40), prevalence of TB infection estimated by IGRA, one- and two-step TST was 47.3%, 61.1% and 66.3% respectively. Although the levels of overall agreement between IGRA and TST were moderate, the degree of agreement was low in the group with BCG history (kappa = 0.29). Working in TB hospital was associated with twofold increase in odds of TB infection estimated by IGRA. Increased age, low educational level and the high body mass index also demonstrated high odds ratios of IGRA positivity. Prevalence of TB infection estimated by either IGRA or TST is high among HCWs in the hospital environment for TB care in Viet Nam and an infection control program should be reinforced. In communities with heterogeneous history of BCG vaccination, IGRA seems to estimate TB infection more accurately than any other criteria using TST.

  5. Prevalence and risk factors for tuberculosis infection among hospital workers in Hanoi, Viet Nam.

    Directory of Open Access Journals (Sweden)

    Luu Thi Lien

    Full Text Available BACKGROUND: Transmission of tuberculosis (TB to health care workers (HCWs is a global issue. Although effective infection control measures are expected to reduce nosocomial TB, HCWs' infection has not been assessed enough in TB high burden countries. We conducted a cross-sectional study to determine the prevalence of TB infection and its risk factors among HCWs in Hanoi, Viet Nam. METHODOLOGY/PRINCIPAL FINDINGS: A total of 300 HCWs including all staff members in a municipal TB referral hospital received an interferon-gamma release assay (IGRA, QuantiFERON-TB Gold In-Tube(TM, followed by one- and two-step tuberculin skin test (TST and a questionnaire-based interview. Agreement between the tests was evaluated by kappa statistics. Risk factors for TB infection were analyzed using a logistic regression model. Among the participants aged from 20 to 58 years (median = 40, prevalence of TB infection estimated by IGRA, one- and two-step TST was 47.3%, 61.1% and 66.3% respectively. Although the levels of overall agreement between IGRA and TST were moderate, the degree of agreement was low in the group with BCG history (kappa = 0.29. Working in TB hospital was associated with twofold increase in odds of TB infection estimated by IGRA. Increased age, low educational level and the high body mass index also demonstrated high odds ratios of IGRA positivity. CONCLUSIONS/SIGNIFICANCE: Prevalence of TB infection estimated by either IGRA or TST is high among HCWs in the hospital environment for TB care in Viet Nam and an infection control program should be reinforced. In communities with heterogeneous history of BCG vaccination, IGRA seems to estimate TB infection more accurately than any other criteria using TST.

  6. [Tuberculosis and its control--lessons from the past and future prospect].

    Science.gov (United States)

    Shimao, Tadao

    2005-06-01

    Koch R reported the discovery of tubercle bacilli on March 24, 1882, and the numbers of death from phthisis were collected in the vital statistics from the latter half of 1883 in Japan. Tuberculosis death was officially adopted in the Japanese vital statistics from 1899, and there was certain disagreement existed between the numbers of death from TB and phthisis in 1899, the analysis on the trend of TB in Japan was done based on TB death. Trend of TB in Japan in the past 100 years could be divided into five phases. In phase 1 (1899-1918), TB mortality had increased with the first industrialization of Japan with main focus on the weaving industry. During this period, TB mortality of female was higher than that of male and then major victims of TB were young girls born from 1890 to 1925. In phase 2 (1918-1930), TB mortality decreased through excess death of TB cases by the influenza pandemic in 1918. This decline due to influenza pandemic was seen all over the world, and in the European countries and the U.S., the decline continued up to 1945 while in Japan, TB had increased again in the phase 3 (1930-1945) mainly due to second industrialization with main focus on heavy industry and the impact of quasi-war and war conditions. In phase 4 (1945-mid 1970s), TB started to decline fast due to the excess death of TB cases during the World War II and then, the application of modern TB control started from early 1950s. In phase 5 (from mid 1970s until now), decline of TB has showed down. Increase or slowdown of TB decline was seen nearly all countries of the world, however, its causes were different from country to country. In case of Japan, slowdown was caused by the rapid ageing of the population, in developing countries mainly by the impact of HIV epidemic and in industrialized countries, mainly by the migration of the population and partly by the HIV epidemic. Contribution of phthisiology in Japan to the global progress of phthisiology could be summarized as follows

  7. Managing and monitoring tuberculosis using web-based tools in combination with traditional approaches

    Directory of Open Access Journals (Sweden)

    Chapman AL

    2013-11-01

    Full Text Available Ann LN Chapman,1 Thomas C Darton,2 Rachel A Foster11Department of Infection and Tropical Medicine, Sheffield Teaching Hospitals NHS Foundation Trust, Sheffield, 2Oxford Vaccine Group, Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Oxford, UKAbstract: Tuberculosis (TB remains a global health emergency. Ongoing challenges include the coordination of national and international control programs, high levels of drug resistance in many parts of the world, and availability of accurate and rapid diagnostic tests. The increasing availability and reliability of Internet access throughout both affluent and resource-limited countries brings new opportunities to improve TB management and control through the integration of web-based technologies with traditional approaches. In this review, we explore current and potential future use of web-based tools in the areas of TB diagnosis, treatment, epidemiology, service monitoring, and teaching and training.Keywords: tuberculosis, information communication technology, Internet

  8. Unusual presentation of extrapulmonary tuberculosis: a case report ...

    African Journals Online (AJOL)

    This case study highlights an unusual manifestation of extrapulmonary tuberculosis (TB) in a person living with HIV, namely mammary TB. Clinicians practising in settings where HIV and TB are endemic need to be aware of the clinical presentation, diagnosis and management of mammary TB.

  9. Therapeutic vaccines for tuberculosis-A systematic review

    NARCIS (Netherlands)

    Gröschel, Matthias I.; Prabowo, Satria A.; Cardona, Pere-Joan; Stanford, John L.; van der Werf, Tjip S.

    2014-01-01

    For eradication of tuberculosis (TB) by 2050, the declared aim of the Stop TB Partnership, novel treatment strategies are indispensable. The emerging epidemic of multi-drug resistant (MDR) TB has fuelled the debate about TB vaccines, as increasing numbers of patients can no longer be cured by

  10. Conjoint alcohol and tobacco use among tuberculosis patients in ...

    African Journals Online (AJOL)

    Objective. To determine the prevalence of, and factors associated with conjoint alcohol and tobacco use among tuberculosis (TB) patients in South Africa (SA). Methods. In a cross-sectional survey, 4 900 (54.5% men, 45.5% women) consecutively selected TB patients (including new TB and new TB retreatment patients) ...

  11. KNOWLEDGE AND MISCONCEPTIONS OF PULMONARY TUBERCULOSIS PATIENTS AT DOTS CENTRE, URBAN MEERUT.

    Directory of Open Access Journals (Sweden)

    R Bansal

    2013-06-01

    Full Text Available Background: India is the second most populated country in the world; it has more new TB cases annually than any other country. In 2008, 1.98 million were estimated to have occurred in India, of whom 0.87 million were infectious cases, thus amounting to a fifth of the global burden of TB.With the entire country geographically covered under the DOTS program, research into socioeconomic impact of TB on patients and their households is crucial for providing comprehensive patient-friendly TB services and to document the benefits of DOTS. Objective: The present study was undertaken with the following objectives: (1 To determine the socio-demographic variables of registered patients for DOTS Treatment at Urban Health Training center Meerut. (2 To assess knowledge, awareness and attitude regarding Pulmonary Tuberculosis and its treatment among the patients. Materials and Methods: A cross-sectional study of 200 TB patients was done using a pre-tested semi-quantitative questionnaire in UHTC Meerut Period of Study: During 2010-2012. Results: Knowledge and awareness regarding Pulmonary Tuberculosis in patients at DOTS centre, Urban Meerut was very poor. There is a great need to educate the people about misconceptions like food and utensils as mode of transmission. BCC using the person to person contact in community , at health center and awareness campaigns are crucial in educating the ignorance seen in our field practice area. Conclusion: Poor knowledge and misconceptions concerning tuberculosis was quite concern in the patients. TB control program will remain ineffective unless myths and fears of TB patients are addressed related to causation of tuberculosis, mode of spread, and methods of prevention.

  12. KNOWLEDGE AND MISCONCEPTIONS OF PULMONARY TUBERCULOSIS PATIENTS AT DOTS CENTRE, URBAN MEERUT.

    Directory of Open Access Journals (Sweden)

    R Bansal

    2013-08-01

    Full Text Available Background: India is the second most populated country in the world; it has more new TB cases annually than any other country. In 2008, 1.98 million were estimated to have occurred in India, of whom 0.87 million were infectious cases, thus amounting to a fifth of the global burden of TB.With the entire country geographically covered under the DOTS program, research into socioeconomic impact of TB on patients and their households is crucial for providing comprehensive patient-friendly TB services and to document the benefits of DOTS. Objective: The present study was undertaken with the following objectives: (1 To determine the socio-demographic variables of registered patients for DOTS Treatment at Urban Health Training center Meerut. (2 To assess knowledge, awareness and attitude regarding Pulmonary Tuberculosis and its treatment among the patients. Materials and Methods: A cross-sectional study of 200 TB patients was done using a pre-tested semi-quantitative questionnaire in UHTC Meerut Period of Study: During 2010-2012. Results: Knowledge and awareness regarding Pulmonary Tuberculosis in patients at DOTS centre, Urban Meerut was very poor. There is a great need to educate the people about misconceptions like food and utensils as mode of transmission. BCC using the person to person contact in community , at health center and awareness campaigns are crucial in educating the ignorance seen in our field practice area. Conclusion: Poor knowledge and misconceptions concerning tuberculosis was quite concern in the patients. TB control program will remain ineffective unless myths and fears of TB patients are addressed related to causation of tuberculosis, mode of spread, and methods of prevention.

  13. A model of population dynamics of TB in a prison system and application to South Africa.

    Science.gov (United States)

    Witbooi, Peter; Vyambwera, Sibaliwe Maku

    2017-11-29

    Tuberculosis (TB) continues to spread in South African prisons in particular, as prisons are over-capacitated and have poor ventilation. The awaiting trial detainees are not screened on admission and are at high risk of getting infected with TB. We propose a compartmental model to describe the population dynamics of TB disease in prisons. Our model considers the inflow of susceptible, exposed and TB infectives into the prison population. Removal of individuals out of the prison population can be either by death or by being released from prison, as compared to a general population in which removal is only by death. We describe conditions, including non-inflow of infectives into the prison, which will ensure that TB can be eradicated from the prison population. The model is calibrated for the South African prison system, by using data in existing literature. The model can be used to make quantitative projections of TB prevalence and to measure the effect of interventions. Illustrative simulations in this regard are presented. The model can be used for other prison populations too, if data is available to calculate the model parameters. Various simulations generated with our model serve to illustrate how it can be utilized in making future projections of the levels of prevalence of TB, and to quantify the effect of interventions such as screening, treatment or reduction of transmission parameter values through improved living conditions for inmates. This makes it particularly useful as there are various targets set by the World Health Organization and by governments, for reduction of TB prevalence and ultimately its eradication. Towards eradication of TB from a prison system, the theorem on global stability of the disease-free state is a useful indicator.

  14. Reciprocity and Ethical Tuberculosis Treatment and Control.

    Science.gov (United States)

    Silva, Diego S; Dawson, Angus; Upshur, Ross E G

    2016-03-01

    This paper explores the notion of reciprocity in the context of active pulmonary and laryngeal tuberculosis (TB) treatment and related control policies and practices. We seek to do three things: First, we sketch the background to contemporary global TB care and suggest that poverty is a key feature when considering the treatment of TB patients. We use two examples from TB care to explore the role of reciprocity: isolation and the use of novel TB drugs. Second, we explore alternative means of justifying the use of reciprocity through appeal to different moral and political theoretical traditions (i.e., virtue ethics, deontology, and consequentialism). We suggest that each theory can be used to provide reasons to take reciprocity seriously as an independent moral concept, despite any other differences. Third, we explore general meanings and uses of the concept of reciprocity, with the primary intention of demonstrating that it cannot be simply reduced to other more frequently invoked moral concepts such as beneficence or justice. We argue that reciprocity can function as a mid-level principle in public health, and generally, captures a core social obligation arising once an individual or group is burdened as a result of acting for the benefit of others (even if they derive a benefit themselves). We conclude that while more needs to be explored in relation to the theoretical justification and application of reciprocity, sufficient arguments can be made for it to be taken more seriously as a key principle within public health ethics and bioethics more generally.

  15. Risk assessment of hepatotoxicity among tuberculosis and human immunodeficiency virus/AIDS-coinfected patients under tuberculosis treatment

    OpenAIRE

    Williams Ngouleun; Prosper Cabral Biapa Nya; Anatole Constant Pieme; Phelix Bruno Telefo

    2016-01-01

    Objective/background: Tuberculosis (TB) is a worldwide public health problem. It is a contagious and grave disease caused by Mycobacterium tuberculosis. Current drugs such as isoniazid, pyrazinamide, and rifampicin used for the treatment of tuberculosis are potentially hepatotoxic and can lead to drug hepatitis. In order to improve the follow-up of TB patients in Cameroon, we carried out a study which aimed to evaluate the hepatotoxicity risk factors associated with anti-TB drugs. Methods:...

  16. The production and sales of anti-tuberculosis drugs in China.

    Science.gov (United States)

    Huang, Yang-Mu; Zhao, Qi-Peng; Ren, Qiao-Meng; Peng, Dan-Lu; Guo, Yan

    2016-10-04

    Tuberculosis (TB) is a major infectious disease globally. Adequate and proper use of anti-TB drugs is essential for TB control. This study aims to study China's production capacity and sales situation of anti-TB drugs, and to further discuss the potential for China to contribute to global TB control. The production data of anti-TB drugs in China from 2011 to 2013 and the sales data from 2010 to 2014 were extracted from Ministry of Industry and Information Technology database of China and IMS Health database, respectively. The number of drugs was standardized to the molecular level of the key components before calculating. All data were described and analyzed by Microsoft Excel. First-line drugs were the majority in both sales (89.5 %) and production (92.3 %) of anti-TB drugs in China. The production of rifampicin held the majority share in active pharmaceutical ingredients (APIs) and finished products, whilst ethambutol and pyrazinamide were the top two sales in finished products. Fixed-dose combinations only held small percentages in total production and sales weight, though a slight increase was observed. The production and sales of streptomycin showed a tendency of decrease after 2012. The trends and proportion of different anti-TB drugs were similar in production and sales, however, the production weight was much larger than that of sales, especially for rifampicin and isoniazid. First-line drugs were the predominant medicine produced and used in China. While the low production and sales of the second-line TB drugs and FDCs rose concerns for the treatment of multiple drug resistant TB. The redundant production amount, as well as the prompt influence of national policy on drug production and sales, indicated the potential for China to better contribute to global TB control.

  17. Sonographic Findings of Abdominal Tuberculosis in Children With Pulmonary Tuberculosis

    NARCIS (Netherlands)

    Bélard, Sabine; Heller, Tom; Orie, Viyanti; Heuvelings, Charlotte C.; Bateman, Lindy; Workman, Lesley; Grobusch, Martin P.; Zar, Heather J.

    2017-01-01

    Ultrasound reports of 102 children with microbiologically confirmed or clinically diagnosed pulmonary tuberculosis (TB) showed that 23 of 37 (64%) and 23 of 65 (36%) had TB suggestive abdominal lymphadenopathy, and 16 of 37 (44%) and 8 of 65 (13%) had splenic microabscesses, respectively. Splenic

  18. Trends in discovery of new drugs for tuberculosis therapy.

    Science.gov (United States)

    Riccardi, Giovanna; Pasca, Maria Rosalia

    2014-09-01

    After the introduction of isoniazid and rifampicin, the second one discovered in the Lepetit Research Laboratories (Milan, Italy), under the supervision of Professor Piero Sensi, tuberculosis (TB) was considered an illness of the past. Unfortunately, this infectious disease is still a global health fear, due to the multidrug-resistant Mycobacterium tuberculosis and extensively circulating drug-resistant strains, as well as the unrecognized TB transmission, especially in regions with high HIV incidence. In the last few years, new antitubercular molecules appeared on the horizon both in preclinical and clinical stage of evaluation. In this review, we focus on a few of them and on their mechanism of action. Two new promising drug targets, DprE1 and MmpL3, are also discussed.

  19. A cross sectional study of knowledge and attitudes towards tuberculosis amongst front-line tuberculosis personnel in high burden areas of Lima, Peru.

    Directory of Open Access Journals (Sweden)

    Mark Minnery

    Full Text Available INTRODUCTION: Tuberculosis, reported as the second most common infectious cause of death worldwide, is a key mortality contributor in developing countries and globally. The disease is endemic in Peru and while relative success was achieved during the 1990s in its control, this slowed as new complications, such as multi drug resistant TB arose. Health centre workers participating in the national DOTS program, create the front-line TB work-force in Peru meaning their knowledge and attitudes about the disease are key in its control. METHODS: A Spanish language, multiple choice knowledge and attitudes survey was designed based on previous successful studies and the national Peruvian TB control guidelines. It was applied to two health networks in Lima, Peru amongst 301 health workers participating in the national TB control program from 66 different health centres. The study results were analysed to test mean knowledge scores amongst different groups, overall gaps in key areas of TB treatment and control knowledge, and attitudes towards the disease and the national TB control program. RESULTS: A mean knowledge score of 10.1 (+/- 1.7 out of 15 or 67.3% correct was shown. Demographics shown to have an effect on knowledge score were age and level of education. Major knowledge gaps were noted primarily in themes relating to treatment and diagnostics. Greater community involvement including better patient education about TB was seen as important in implementing the national TB control program. Participants were in disagreement about the current distribution of health resources throughout the study area. Discussion Serious knowledge gaps were identified from the survey; these reflect findings from a previous study in Lima and other studies from TB endemic areas throughout the world. Understanding these gaps and observations made by front-line TB workers in Lima may help to improve the national TB control program and other control efforts globally.

  20. Inhibition of Glutamine Synthetase: A Potential Drug Target in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Sherry L. Mowbray

    2014-08-01

    Full Text Available Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. Globally, tuberculosis is second only to AIDS in mortality and the disease is responsible for over 1.3 million deaths each year. The impractically long treatment schedules (generally 6–9 months and unpleasant side effects of the current drugs often lead to poor patient compliance, which in turn has resulted in the emergence of multi-, extensively- and totally-drug resistant strains. The development of new classes of anti-tuberculosis drugs and new drug targets is of global importance, since attacking the bacterium using multiple strategies provides the best means to prevent resistance. This review presents an overview of the various strategies and compounds utilized to inhibit glutamine synthetase, a promising target for the development of drugs for TB therapy.

  1. Buoyant density of Mycobacterium tuberculosis: implications for sputum processing

    NARCIS (Netherlands)

    den Hertog, A. L.; Klatser, P. R.; Anthony, R. M.

    2009-01-01

    A tuberculosis (TB) research laboratory in the Netherlands. The concentration of Mycobacterium tuberculosis cells from sputum is almost universally performed by centrifugation after chemical liquefaction. These methods are thus dependent on the effective sedimentation of mycobacterial cells, and the

  2. Association between Mycobacterium tuberculosis lineage and site of disease in Florida, 2009-2015.

    Science.gov (United States)

    Séraphin, Marie Nancy; Doggett, Richard; Johnston, Lori; Zabala, Jose; Gerace, Alexandra M; Lauzardo, Michael

    2017-11-01

    Mycobacterium tuberculosis is characterized into four global lineages with strong geographical restriction. To date one study in the United States has investigated M. tuberculosis lineage association with tuberculosis (TB) disease presentation (extra-pulmonary versus pulmonary). We update this analysis using recent (2009-2015) data from the State of Florida to measure lineage association with pulmonary TB, the infectious form of the disease. M. tuberculosis lineage was assigned based on the spacer oligonucleotide typing (spoligotyping) patterns. TB disease site was defined as exclusively pulmonary or extra-pulmonary. We used ORs to measure the association between M. tuberculosis lineages and pulmonary compared to extra-pulmonary TB. The final multivariable model was adjusted for patient socio-demographics, HIV and diabetes status. We analyzed 3061 cases, 83.4% were infected with a Euro-American lineage, 8.4% Indo-Oceanic and 8.2% East-Asian lineage. The majority of the cases (86.0%) were exclusively pulmonary. Compared to the Indo-Oceanic lineage, infection with a Euro-American (AOR=1.87, 95% CI: 1.21, 2.91) or an East-Asian (AOR=2.11, 95% CI: 1.27, 3.50) lineage favored pulmonary disease compared to extra-pulmonary. In a sub-analysis among pulmonary cases, strain lineage was not associated with sputum smear positive status, indicating that the observed association with pulmonary disease is independent of host contagiousness. As an obligate pathogen, M. tuberculosis' fitness is directly correlated to its transmission potential. In this analysis, we show that M. tuberculosis lineage is associated with pulmonary disease presentation. This association may explain the predominance in a region of certain lineages compared to others. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Productivity losses associated with tuberculosis deaths in the World Health Organization African region.

    Science.gov (United States)

    Kirigia, Joses Muthuri; Muthuri, Rosenabi Deborah Karimi

    2016-06-01

    In 2014, almost half of the global tuberculosis deaths occurred in the World Health Organization (WHO) African Region. Approximately 21.5 % of the 6 060 742 TB cases (new and relapse) reported to the WHO in 2014 were in the African Region. The specific objective of this study was to estimate future gross domestic product (GDP) losses associated with TB deaths in the African Region for use in advocating for better strategies to prevent and control tuberculosis. The cost-of-illness method was used to estimate non-health GDP losses associated with TB deaths. Future non-health GDP losses were discounted at 3 %. The analysis was conducted for three income groups of countries. One-way sensitivity analysis at 5 and 10 % discount rates was undertaken to assess the impact on the expected non-health GDP loss. The 0.753 million tuberculosis deaths that occurred in the African Region in 2014 would be expected to decrease the future non-health GDP by International Dollars (Int$) 50.4 billion. Nearly 40.8, 46.7 and 12.5 % of that loss would come from high and upper-middle- countries or lower-middle- and low-income countries, respectively. The average total non-health GDP loss would be Int$66 872 per tuberculosis death. The average non-health GDP loss per TB death was Int$167 592 for Group 1, Int$69 808 for Group 2 and Int$21 513 for Group 3. Tuberculosis exerts a sizeable economic burden on the economies of the WHO AFR countries. This implies the need to strongly advocate for better strategies to prevent and control tuberculosis and to help countries end the epidemic of tuberculosis by 2030, as envisioned in the United Nations General Assembly resolution on Sustainable Development Goals (SDGs).

  4. Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Chen, Fan; Zhou, Jing; Luo, Fengling; Mohammed, Al-Bayati; Zhang, Xiao-Lian

    2007-01-01

    Worldwide, tuberculosis (TB) remains the most frequent and important infectious disease causing morbidity and death. One-third of the world's population is infected with Mycobacterium tuberculosis (MTB), the etiologic agent of TB. Because of the global health problems of TB, the development of potent new anti-TB drugs without cross-resistance with known antimycobacterial agents is urgently needed. In this study, we have applied a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process to identify a single aptamer (NK2) that binds to viru