WorldWideScience

Sample records for germ line specification

  1. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.

    Science.gov (United States)

    Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan

    2013-11-19

    The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.

  2. Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

    International Nuclear Information System (INIS)

    Tucker, M.A.

    1988-01-01

    Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

  3. Understanding Mammalian Germ Line Development with In Vitro Models.

    Science.gov (United States)

    Martínez-Arroyo, Ana M; Míguez-Forján, Jose M; Remohí, Jose; Pellicer, Antonio; Medrano, Jose V

    2015-09-15

    Germ line development is crucial in organisms with sexual reproduction to complete their life cycle. In mammals, knowledge about germ line development is based mainly on the mouse model, in which genetic and epigenetic events are well described. However, little is known about how germ line development is orchestrated in humans, especially in the earliest stages. New findings derived from human in vitro models to obtain germ cells can shed light on these questions. This comprehensive review summarizes the current knowledge about mammalian germ line development, emphasizing the state of the art obtained from in vitro models for germ cell-like cell derivation. Current knowledge of the pluripotency cycle and germ cell specification has allowed different in vitro strategies to obtain germ cells with proven functionality in mouse models. Several reports during the last 10 years show that in vitro germ cell derivation with proven functionality to generate a healthy offspring is possible in mice. However, differences in the embryo development and pluripotency potential between human and mouse make it difficult to extrapolate these results. Further efforts on both human and mouse in vitro models to obtain germ cells from pluripotent stem cells may help to elucidate how human physiological events take place; therefore, therapeutic strategies can also be considered.

  4. Epigenetic reprogramming in the porcine germ line

    DEFF Research Database (Denmark)

    Matzen, Sara Maj Hyldig; Croxall, Nicola; Contreras, David A.

    2011-01-01

    BACKGROUND: Epigenetic reprogramming is critical for genome regulation during germ line development. Genome-wide demethylation in mouse primordial germ cells (PGC) is a unique reprogramming event essential for erasing epigenetic memory and preventing the transmission of epimutations to the next...... an increased proportion of cells in G2. CONCLUSIONS: Our study demonstrates that epigenetic reprogramming occurs in pig migratory and gonadal PGC, and establishes the window of time for the occurrence of these events. Reprogramming of histone H3K9me2 and H3K27me3 detected between E15-E21 precedes the dynamic...... DNA demethylation at imprinted loci and DNA repeats between E22-E42. Our findings demonstrate that major epigenetic reprogramming in the pig germ line follows the overall dynamics shown in mice, suggesting that epigenetic reprogramming of germ cells is conserved in mammals. A better understanding...

  5. Germ line mechanics – and unfinished business

    Science.gov (United States)

    Wessel, Gary M.

    2016-01-01

    Primordial germ cells are usually made early in the development of an organism. These are the mother of all stem cells that are necessary for propagation of the species, yet use highly diverse mechanisms between organisms. How they are specified, and when and where they form, are central to developmental biology. Using diverse organisms to study this development is illuminating for understanding the mechanics these cells use in this essential function, and for identifying the breadth of evolutionary changes that have occurred between species. This essay emphasizes how echinoderms may contribute to the patch-work quilt of our understanding of germ line formation during embryogenesis. PMID:26970000

  6. A germ cell determinant reveals parallel pathways for germ line development in Caenorhabditis elegans.

    Science.gov (United States)

    Mainpal, Rana; Nance, Jeremy; Yanowitz, Judith L

    2015-10-15

    Despite the central importance of germ cells for transmission of genetic material, our understanding of the molecular programs that control primordial germ cell (PGC) specification and differentiation are limited. Here, we present findings that X chromosome NonDisjunction factor-1 (XND-1), known for its role in regulating meiotic crossover formation, is an early determinant of germ cell fates in Caenorhabditis elegans. xnd-1 mutant embryos display a novel 'one PGC' phenotype as a result of G2 cell cycle arrest of the P4 blastomere. Larvae and adults display smaller germ lines and reduced brood size consistent with a role for XND-1 in germ cell proliferation. Maternal XND-1 proteins are found in the P4 lineage and are exclusively localized to the nucleus in PGCs, Z2 and Z3. Zygotic XND-1 turns on shortly thereafter, at the ∼300-cell stage, making XND-1 the earliest zygotically expressed gene in worm PGCs. Strikingly, a subset of xnd-1 mutants lack germ cells, a phenotype shared with nos-2, a member of the conserved Nanos family of germline determinants. We generated a nos-2 null allele and show that nos-2; xnd-1 double mutants display synthetic sterility. Further removal of nos-1 leads to almost complete sterility, with the vast majority of animals without germ cells. Sterility in xnd-1 mutants is correlated with an increase in transcriptional activation-associated histone modification and aberrant expression of somatic transgenes. Together, these data strongly suggest that xnd-1 defines a new branch for PGC development that functions redundantly with nos-2 and nos-1 to promote germline fates by maintaining transcriptional quiescence and regulating germ cell proliferation. © 2015. Published by The Company of Biologists Ltd.

  7. Specification of primordial germ cells in medaka (Oryzias latipes

    Directory of Open Access Journals (Sweden)

    Raz Erez

    2007-01-01

    Full Text Available Abstract Background Primordial germ cells (PGCs give rise to gametes that are responsible for the development of a new organism in the next generation. Two modes of germ line specification have been described: the inheritance of asymmetrically-localized maternally provided cytoplasmic determinants and the induction of the PGC fate by other cell types. PGCs specification in zebrafish appears to depend on inheritance of germ plasm in which several RNA molecules such as vasa and nanos reside. Whether the specification mode of PGCs found in zebrafish is general for other fish species was brought into question upon analysis of olvas expression – the vasa homologue in another teleost, medaka (Oryzias latipes. Here, in contrast to the findings in zebrafish, the PGCs are found in a predictable position relative to a somatic structure, the embryonic shield. This finding, coupled with the fact that vasa mRNA, which is localized to the germ plasm of zebrafish but does not label a similar structure in medaka opened the possibility of fundamentally different mechanisms governing PGC specification in these two fish species. Results In this study we addressed the question concerning the mode of PGC specification in medaka using embryological experiments, analysis of RNA stability in the PGCs and electron microscopy observations. Dramatic alterations in the somatic environment, i.e. induction of a secondary axis or mesoderm formation alteration, did not affect the PGC number. Furthermore, the PGCs of medaka are capable of protecting specific RNA molecules from degradation and could therefore exhibit a specific mRNA expression pattern controlled by posttrancriptional mechanisms. Subsequent analysis of 4-cell stage medaka embryos using electron microscopy revealed germ plasm-like structures located at a region corresponding to that of zebrafish germ plasm. Conclusion Taken together, these results are consistent with the idea that in medaka the inheritance of

  8. Environmentally induced transgenerational epigenetic reprogramming of primordial germ cells and the subsequent germ line.

    Directory of Open Access Journals (Sweden)

    Michael K Skinner

    Full Text Available A number of environmental factors (e.g. toxicants have been shown to promote the epigenetic transgenerational inheritance of disease and phenotypic variation. Transgenerational inheritance requires the germline transmission of altered epigenetic information between generations in the absence of direct environmental exposures. The primary periods for epigenetic programming of the germ line are those associated with primordial germ cell development and subsequent fetal germline development. The current study examined the actions of an agricultural fungicide vinclozolin on gestating female (F0 generation progeny in regards to the primordial germ cell (PGC epigenetic reprogramming of the F3 generation (i.e. great-grandchildren. The F3 generation germline transcriptome and epigenome (DNA methylation were altered transgenerationally. Interestingly, disruptions in DNA methylation patterns and altered transcriptomes were distinct between germ cells at the onset of gonadal sex determination at embryonic day 13 (E13 and after cord formation in the testis at embryonic day 16 (E16. A larger number of DNA methylation abnormalities (epimutations and transcriptional alterations were observed in the E13 germ cells than in the E16 germ cells. These observations indicate that altered transgenerational epigenetic reprogramming and function of the male germline is a component of vinclozolin induced epigenetic transgenerational inheritance of disease. Insights into the molecular control of germline transmitted epigenetic inheritance are provided.

  9. Germ-line gene therapy and the medical imperative.

    Science.gov (United States)

    Munson, Ronald; Davis, Lawrence H

    1992-06-01

    Somatic cell gene therapy has yielded promising results. If germ cell gene therapy can be developed, the promise is even greater: hundreds of genetic diseases might be virtually eliminated. But some claim the procedure is morally unacceptable. We thoroughly and sympathetically examine several possible reasons for this claim but find them inadequate. There is no moral reason, then, not to develop and employ germ-line gene therapy. Taking the offensive, we argue next that medicine has a prima facie moral obligation to do so.

  10. FLI-1 Flightless-1 and LET-60 Ras control germ line morphogenesis in C. elegans

    Directory of Open Access Journals (Sweden)

    Dentler William L

    2008-05-01

    Full Text Available Abstract Background In the C. elegans germ line, syncytial germ line nuclei are arranged at the cortex of the germ line as they exit mitosis and enter meiosis, forming a nucleus-free core of germ line cytoplasm called the rachis. Molecular mechanisms of rachis formation and germ line organization are not well understood. Results Mutations in the fli-1 gene disrupt rachis organization without affecting meiotic differentiation, a phenotype in C. elegans referred to here as the germ line morphogenesis (Glm phenotype. In fli-1 mutants, chains of meiotic germ nuclei spanned the rachis and were partially enveloped by invaginations of germ line plasma membrane, similar to nuclei at the cortex. Extensions of the somatic sheath cells that surround the germ line protruded deep inside the rachis and were associated with displaced nuclei in fli-1 mutants. fli-1 encodes a molecule with leucine-rich repeats and gelsolin repeats similar to Drosophila flightless 1 and human Fliih, which have been shown to act as cytoplasmic actin regulators as well as nuclear transcriptional regulators. Mutations in let-60 Ras, previously implicated in germ line development, were found to cause the Glm phenotype. Constitutively-active LET-60 partially rescued the fli-1 Glm phenotype, suggesting that LET-60 Ras and FLI-1 might act together to control germ line morphogenesis. Conclusion FLI-1 controls germ line morphogenesis and rachis organization, a process about which little is known at the molecular level. The LET-60 Ras GTPase might act with FLI-1 to control germ line morphogenesis.

  11. Functions of huntingtin in germ layer specification and organogenesis.

    Directory of Open Access Journals (Sweden)

    Giang D Nguyen

    Full Text Available Huntington's disease (HD is a neurodegenerative disease caused by abnormal polyglutamine expansion in the huntingtin protein (Htt. Although both Htt and the HD pathogenic mutation (mHtt are implicated in early developmental events, their individual involvement has not been adequately explored. In order to better define the developmental functions and pathological consequences of the normal and mutant proteins, respectively, we employed embryonic stem cell (ESC expansion, differentiation and induction experiments using huntingtin knock-out (KO and mutant huntingtin knock-in (Q111 mouse ESC lines. In KO ESCs, we observed impairments in the spontaneous specification and survival of ectodermal and mesodermal lineages during embryoid body formation and under inductive conditions using retinoic acid and Wnt3A, respectively. Ablation of BAX improves cell survival, but failed to correct defects in germ layer specification. In addition, we observed ensuing impairments in the specification and maturation of neural, hepatic, pancreatic and cardiomyocyte lineages. These developmental deficits occurred in concert with alterations in Notch, Hes1 and STAT3 signaling pathways. Moreover, in Q111 ESCs, we observed differential developmental stage-specific alterations in lineage specification and maturation. We also observed changes in Notch/STAT3 expression and activation. Our observations underscore essential roles of Htt in the specification of ectoderm, endoderm and mesoderm, in the specification of neural and non-neural organ-specific lineages, as well as cell survival during early embryogenesis. Remarkably, these developmental events are differentially deregulated by mHtt, raising the possibility that HD-associated early developmental impairments may contribute not only to region-specific neurodegeneration, but also to non-neural co-morbidities.

  12. Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor.

    Science.gov (United States)

    Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J

    1997-10-01

    Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.

  13. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  14. Sequence and expression pattern of the germ line marker vasa in honey bees and stingless bees

    Science.gov (United States)

    2009-01-01

    Queens and workers of social insects differ in the rates of egg laying. Using genomic information we determined the sequence of vasa, a highly conserved gene specific to the germ line of metazoans, for the honey bee and four stingless bees. The vasa sequence of social bees differed from that of other insects in two motifs. By RT-PCR we confirmed the germ line specificity of Amvasa expression in honey bees. In situ hybridization on ovarioles showed that Amvasa is expressed throughout the germarium, except for the transition zone beneath the terminal filament. A diffuse vasa signal was also seen in terminal filaments suggesting the presence of germ line cells. Oocytes showed elevated levels of Amvasa transcripts in the lower germarium and after follicles became segregated. In previtellogenic follicles, Amvasa transcription was detected in the trophocytes, which appear to supply its mRNA to the growing oocyte. A similar picture was obtained for ovarioles of the stingless bee Melipona quadrifasciata, except that Amvasa expression was higher in the oocytes of previtellogenic follicles. The social bees differ in this respect from Drosophila, the model system for insect oogenesis, suggesting that changes in the sequence and expression pattern of vasa may have occurred during social evolution. PMID:21637523

  15. Sequence and expression pattern of the germ line marker vasa in honey bees and stingless bees

    Directory of Open Access Journals (Sweden)

    Érica Donato Tanaka

    2009-01-01

    Full Text Available Queens and workers of social insects differ in the rates of egg laying. Using genomic information we determined the sequence of vasa, a highly conserved gene specific to the germ line of metazoans, for the honey bee and four stingless bees. The vasa sequence of social bees differed from that of other insects in two motifs. By RT-PCR we confirmed the germ line specificity of Amvasa expression in honey bees. In situ hybridization on ovarioles showed that Amvasa is expressed throughout the germarium, except for the transition zone beneath the terminal filament. A diffuse vasa signal was also seen in terminal filaments suggesting the presence of germ line cells. Oocytes showed elevated levels of Amvasa transcripts in the lower germarium and after follicles became segregated. In previtellogenic follicles, Amvasa transcription was detected in the trophocytes, which appear to supply its mRNA to the growing oocyte. A similar picture was obtained for ovarioles of the stingless bee Melipona quadrifasciata, except that Amvasa expression was higher in the oocytes of previtellogenic follicles. The social bees differ in this respect from Drosophila, the model system for insect oogenesis, suggesting that changes in the sequence and expression pattern of vasa may have occurred during social evolution.

  16. Germ-line origins of mutation in families with hemophilia B: The sex ratio varies with the type of mutation

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.; Bottema, C.D.K.; Schaid, D.J.; Sommer, S.S. (Mayo Clinic/Foundation, Rochester, MN (United States)); Cohen, M.P. (Vanderbilt Univ., Nashville, TN (United States)); Sexauer, C.L. (Children' s Hospital, Oklahoma City, OK (United States))

    1993-01-01

    Previous epidemiological and biochemical studies have generated conflicting estimates of the sex ratio of mutation. Direct genomic sequencing in combination with haplotype analysis extends previous analyses by allowing the precise mutation to be determined in a given family. From analysis of the factor IX gene of 260 consecutive families with hemophilia B, the authors report the germ-line origin of mutation in 25 families. When combined with 14 origins of mutation reported by others and with 4 origins previously reported by them, a total of 25 occur in the female germ line, and 18 occur in the male germ line. The excess of germ-line origins in females does not imply an overall excess mutation rate per base pair in the female germ line. Bayesian analysis of the data indicates that the sex ratio varies with the type of mutation. The aggregate of single-base substitutions shows a male predominance of germ-line mutations (P < .002). The maximum-likelihood estimate of the male predominance is 3.5-fold. Of the single-base substitutions, deletions display a sex ratio of unity. Analysis of the parental age at transmission of a new mutation suggests that germ-line mutations are associated with a small increase in parental age in females but little, if any, increase in males. Although direct genomic sequencing offers a general method for defining the origin of mutation in specific families, accurate estimates of the sex ratios of different mutational classes require large sample sizes and careful correction for multiple biases of ascertainment. The biases in the present data result in an underestimate of the enhancement of mutation in males. 62 refs., 1 fig., 5 tabs.

  17. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Science.gov (United States)

    Wang, Xin; Zhao, Yongjun; Wong, Kim; Ehlers, Peter; Kohara, Yuji; Jones, Steven J; Marra, Marco A; Holt, Robert A; Moerman, Donald G; Hansen, Dave

    2009-01-01

    Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm) or female (oocyte) fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution. PMID:19426519

  18. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2009-05-01

    Full Text Available Abstract Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm or female (oocyte fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution.

  19. The ethics of germ line gene manipulation--a five dimensional debate.

    Science.gov (United States)

    Carter, Lucy

    2002-10-01

    Contributors to the debate surrounding the ethics of germ line gene manipulation have by and large concentrated their efforts on discussions of the potential risks that are associated with the use of this technology. Many international advisory committees have ruled out the acceptability of germ line gene manipulation at least for the time being. The purpose of this work is to generate much needed discussion on the many other ethical issues concerning the implementation of not only germ line gene manipulation but also other related biotechnologies. In this paper I systematically investigate and analyse the most salient issues put forward by proponents and opponents alike. I argue that if germ line manipulation proves to be a safe and effective procedure, then the principle of beneficence imposes on the medical profession a moral duty to pursue the technology.

  20. The diversity of nanos expression in echinoderm embryos supports different mechanisms in germ cell specification.

    Science.gov (United States)

    Fresques, Tara; Swartz, Steven Zachary; Juliano, Celina; Morino, Yoshiaki; Kikuchi, Mani; Akasaka, Koji; Wada, Hiroshi; Yajima, Mamiko; Wessel, Gary M

    2016-07-01

    Specification of the germ cell lineage is required for sexual reproduction in all animals. However, the timing and mechanisms of germ cell specification is remarkably diverse in animal development. Echinoderms, such as sea urchins and sea stars, are excellent model systems to study the molecular and cellular mechanisms that contribute to germ cell specification. In several echinoderm embryos tested, the germ cell factor Vasa accumulates broadly during early development and is restricted after gastrulation to cells that contribute to the germ cell lineage. In the sea urchin, however, the germ cell factor Vasa is restricted to a specific lineage by the 32-cell stage. We therefore hypothesized that the germ cell specification program in the sea urchin/Euechinoid lineage has evolved to an earlier developmental time point. To test this hypothesis we determined the expression pattern of a second germ cell factor, Nanos, in four out of five extant echinoderm clades. Here we find that Nanos mRNA does not accumulate until the blastula stage or later during the development of all other echinoderm embryos except those that belong to the Echinoid lineage. Instead, Nanos is expressed in a restricted domain at the 32-128 cell stage in Echinoid embryos. Our results support the model that the germ cell specification program underwent a heterochronic shift in the Echinoid lineage. A comparison of Echinoid and non-Echinoid germ cell specification mechanisms will contribute to our understanding of how these mechanisms have changed during animal evolution. © 2016 Wiley Periodicals, Inc.

  1. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  2. Lack of GNAQ and GNA11 germ-line mutations in familial melanoma pedigrees with uveal melanoma or blue nevi

    Directory of Open Access Journals (Sweden)

    Jason Ezra Hawkes

    2013-06-01

    Full Text Available Approximately 10% of melanoma cases are familial, but only 25-40% of familial melanoma cases can be attributed to germ-line mutations in the CDKN2A - the most significant high-risk melanoma susceptibility locus identified to date. The pathogenic mutation(s in most of the remaining familial melanoma pedigrees have not yet been identified. The most common mutations in nevi and sporadic melanoma are found in BRAF and NRAS, both of which result in constitutive activation of the MAPK pathway. However, these mutations are not found in uveal melanomas or the intradermal melanocytic proliferations known as blue nevi. Rather, multiple studies report a strong association between these lesions and somatic mutations in Guanine nucleotide-binding protein G(q subunit alpha (GNAQ, Guanine nucleotide-binding protein G(q subunit alpha-11 (GNA11 and BRCA1 associated protein-1 (BAP1. Recently, germ-line mutations in BAP1, the gene encoding a tumor suppressing deubiquitinating enzyme, have been associated with predisposition to a variety of cancers including uveal melanoma, but no studies have examined the association of germ-line mutations in GNAQ and GNA11 with uveal melanoma and blue nevi. We have now done so by sequencing exon 5 of both of these genes in 13 unique familial melanoma pedigrees, members of which have had either uveal or cutaneous melanoma and/or blue nevi. Germ-line DNA from a total of 22 individuals was used for sequencing; however no deleterious mutations were detected. Nevertheless, such candidate gene studies and the discovery of novel germ-line mutations associated with an increased MM susceptibility can lead to a better understanding of the pathways involved in melanocyte transformation, formulation of risk assessment, and the development of specific drug therapies.

  3. The DEAD-box protein MEL-46 is required in the germ line of the nematode Caenorhabditis elegans.

    Science.gov (United States)

    Minasaki, Ryuji; Puoti, Alessandro; Streit, Adrian

    2009-06-17

    In the hermaphrodite of the nematode Caenorhabditis elegans, the first germ cells differentiate as sperm. Later the germ line switches to the production of oocytes. This process requires the activity of a genetic regulatory network that includes among others the fem, fog and mog genes. The function of some of these genes is germline specific while others also act in somatic tissues. DEAD box proteins have been shown to be involved in the control of gene expression at different steps such as transcription and pre-mRNA processing. We show that the Caenorhabditis elegans gene mel-46 (maternal effect lethal) encodes a DEAD box protein that is related to the mammalian DDX20/Gemin3/DP103 genes. mel-46 is expressed throughout development and mutations in mel-46 display defects at multiple developmental stages. Here we focus on the role of mel-46 in the hermaphrodite germ line. mel-46(yt5) mutant hermaphrodites are partially penetrant sterile and fully penetrant maternal effect lethal. The germ line of mutants shows variable defects in oogenesis. Further, mel-46(yt5) suppresses the complete feminization caused by mutations in fog-2 and fem-3, two genes that are at the top and the center, respectively, of the genetic germline sex determining cascade, but not fog-1 that is at the bottom of this cascade. The C. elegans gene mel-46 encodes a DEAD box protein that is required maternally for early embryogenesis and zygotically for postembryonic development. In the germ line, it is required for proper oogenesis. Although it interacts genetically with genes of the germline sex determination machinery its primary function appears to be in oocyte differentiation rather than sex determination.

  4. Doubly uniparental inheritance of mitochondria as a model system for studying germ line formation.

    Directory of Open Access Journals (Sweden)

    Liliana Milani

    Full Text Available BACKGROUND: Doubly Uniparental Inheritance (DUI of mitochondria occurs when both mothers and fathers are capable of transmitting mitochondria to their offspring, in contrast to the typical Strictly Maternal Inheritance (SMI. DUI was found in some bivalve molluscs, in which two mitochondrial genomes are inherited, one through eggs, the other through sperm. During male embryo development, spermatozoon mitochondria aggregate in proximity of the first cleavage furrow and end up in the primordial germ cells, while they are dispersed in female embryos. METHODOLOGY/PRINCIPAL FINDINGS: We used MitoTracker, microtubule staining and transmission electron microscopy to examine the mechanisms of this unusual distribution of sperm mitochondria in the DUI species Ruditapes philippinarum. Our results suggest that in male embryos the midbody deriving from the mitotic spindle of the first division concurs in positioning the aggregate of sperm mitochondria. Furthermore, an immunocytochemical analysis showed that the germ line determinant Vasa segregates close to the first cleavage furrow. CONCLUSIONS/SIGNIFICANCE: In DUI male embryos, spermatozoon mitochondria aggregate in a stable area on the animal-vegetal axis: in organisms with spiral segmentation this zone is not involved in cleavage, so the aggregation is maintained. Moreover, sperm mitochondria reach the same embryonic area in which also germ plasm is transferred. In 2-blastomere embryos, the segregation of sperm mitochondria in the same region with Vasa suggests their contribution in male germ line formation. In DUI male embryos, M-type mitochondria must be recognized by egg factors to be actively transferred in the germ line, where they become dominant replacing the Balbiani body mitochondria. The typical features of germ line assembly point to a common biological mechanism shared by DUI and SMI organisms. Although the molecular dynamics of the segregation of sperm mitochondria in DUI species are unknown

  5. Germ line determinants are not localized early in sea urchin development, but do accumulate in the small micromere lineage.

    Science.gov (United States)

    Juliano, Celina E; Voronina, Ekaterina; Stack, Christie; Aldrich, Maryanna; Cameron, Andrew R; Wessel, Gary M

    2006-12-01

    Two distinct modes of germ line determination are used throughout the animal kingdom: conditional-an inductive mechanism, and autonomous-an inheritance of maternal factors in early development. This study identifies homologs of germ line determinants in the sea urchin Strongylocentrotus purpuratus to examine its mechanism of germ line determination. A list of conserved germ-line associated genes from diverse organisms was assembled to search the S. purpuratus genome for homologs, and the expression patterns of these genes were examined during embryogenesis by whole mount in situ RNA hybridization and QPCR. Of the 14 genes tested, all transcripts accumulate uniformly during oogenesis and Sp-pumilio, Sp-tudor, Sp-MSY, and Sp-CPEB1 transcripts are also uniformly distributed during embryonic development. Sp-nanos2, Sp-seawi, and Sp-ovo transcripts, however, are enriched in the vegetal plate of the mesenchyme blastula stage and Sp-vasa, Sp-nanos2, Sp-seawi, and Sp-SoxE transcripts are localized in small micromere descendents at the tip of the archenteron during gastrulation and are then enriched in the left coelomic pouch of larvae. The results of this screen suggest that sea urchins conditionally specify their germ line, and support the hypothesis that this mechanism is the basal mode of germ line determination amongst deuterostomes. Furthermore, accumulation of germ line determinants selectively in small micromere descendents supports the hypothesis that these cells contribute to the germ line.

  6. Spondyloepiphseal dysplasia congenita in siblings born to unaffected parents: ? germ line mosaicism

    Energy Technology Data Exchange (ETDEWEB)

    Mulla, W.; McDonald-McGinn, D.; Zackai, E. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)] [and others

    1994-09-01

    Germ line mosaicism has been used to explain the birth of more than one child affected with a dominantly inherited disorder born to unaffected parents. Furthermore, it has been confirmed clinically in families where recurrence in siblings was originally thought to be autosomal recessive, but were affected individuals have reproduced affected offspring. Firm evidence of germ line mosaicism using mutation analysis by molecular methods exists for some autosomal disorders. We present two siblings with spondyloepipheseal dysplasia congenita (SEDC) born to unaffected parents. This suggests the presence of germ line mosaicism in this entity. Patient 1 was born at 32 weeks gestation to a G1P1 Puerto Rican mother. The pregnancy was complicated by polyhydramnios. The neonate, a short-limbed dwarf, died at 15 hours of age from respiratory distress and a compromised thoracic cavity. Patient 2, the sibling of patient 1 was born at 37 weeks gestation after a pregnancy complicated by polyhydramnios and prenatal ultrasound diagnosis of short-limbed dwarfism. The diagnosis of SEDC was made and, after review of the sibling`s postmortem X-rays, it was felt that she was similarly affected. The family history reveals no history of dwarfism or consanguinity. The SEDC is described as an autosomal dominant form of dwarfism with variable presentation including some cases that have been lethal in the neonatal period. SEDC is now believed to represent a family of collagen II mutations. Sporadic cases that have arisen in families with no history have been ascribed to new heterozygous mutations. Other families in which SEDC and SEMD recurred without a family history most likely represent germ line mosaicism. In these cases molecular studies should be pursued to document a collagen II mutation. We believe that germ line mosaicism is the most plausible explanation for recurrence in our family.

  7. Differential expression of conserved germ line markers and delayed segregation of male and female primordial germ cells in a hermaphrodite, the leech helobdella.

    Science.gov (United States)

    Cho, Sung-Jin; Vallès, Yvonne; Weisblat, David A

    2014-02-01

    In sexually reproducing animals, primordial germ cells (PGCs) are often set aside early in embryogenesis, a strategy that minimizes the risk of genomic damage associated with replication and mitosis during the cell cycle. Here, we have used germ line markers (piwi, vasa, and nanos) and microinjected cell lineage tracers to show that PGC specification in the leech genus Helobdella follows a different scenario: in this hermaphrodite, the male and female PGCs segregate from somatic lineages only after more than 20 rounds of zygotic mitosis; the male and female PGCs share the same (mesodermal) cell lineage for 19 rounds of zygotic mitosis. Moreover, while all three markers are expressed in both male and female reproductive tissues of the adult, they are expressed differentially between the male and female PGCs of the developing embryo: piwi and vasa are expressed preferentially in female PGCs at a time when nanos is expressed preferentially in male PGCs. A priori, the delayed segregation of male and female PGCs from somatic tissues and from one another increases the probability of mutations affecting both male and female PGCs of a given individual. We speculate that this suite of features, combined with a capacity for self-fertilization, may contribute to the dramatically rearranged genome of Helobdella robusta relative to other animals.

  8. Germ-line PHD1 and PHD2 mutations detected in patients with pheochromocytoma/paraganglioma-polycythemia.

    Science.gov (United States)

    Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel

    2015-01-01

    We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.

  9. Genetic modification of the human germ line: The reasons why this project has no future.

    Science.gov (United States)

    Morange, Michel

    2015-01-01

    Modification of the human germ line has remained a distant but valuable objective for most biologists since the emergence of genetics (and even before). To study the historical transformations of this project, I have selected three periods - the 1930s, at the pinnacle of eugenics, around 1974 when molecular biology triumphed, and today - and have adopted three criteria to estimate the feasibility of this project: the state of scientific knowledge, the existence of suitable tools, and societal demands. Although the long-awaited techniques to modify the germ line are now available, I will show that most of the expectations behind this project have disappeared, or are considered as being reachable by highly different strategies. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  10. Differentiation in Stem Cell Lineages and in Life: Explorations in the Male Germ Line Stem Cell Lineage.

    Science.gov (United States)

    Fuller, Margaret T

    2016-01-01

    I have been privileged to work on cellular differentiation during a great surge of discovery that has revealed the molecular mechanisms and genetic regulatory circuitry that control embryonic development and adult tissue maintenance and repair. Studying the regulation of proliferation and differentiation in the male germ line stem cell lineage has allowed us investigate how the developmental program imposes layers of additional controls on fundamental cellular processes like cell cycle progression and gene expression to give rise to the huge variety of specialized cell types in our bodies. We are beginning to understand how local signals from somatic support cells specify self-renewal versus differentiation in the stem cell niche at the apical tip of the testis. We are discovering the molecular events that block cell proliferation and initiate terminal differentiation at the switch from mitosis to meiosis-a signature event of the germ cell program. Our work is beginning to reveal how the developmental program that sets up the dramatic new cell type-specific transcription program that prepares germ cells for meiotic division and spermatid differentiation is turned on when cells become spermatocytes. I have had the privilege of working with incredible students, postdocs, and colleagues who have discovered, brainstormed, challenged, and refined our science and our ideas of how developmental pathways and cellular mechanisms work together to drive differentiation. © 2016 Elsevier Inc. All rights reserved.

  11. Proliferation of endogenous retroviruses in the early stages of a host germ line invasion.

    Science.gov (United States)

    Ishida, Yasuko; Zhao, Kai; Greenwood, Alex D; Roca, Alfred L

    2015-01-01

    Endogenous retroviruses (ERVs) comprise 8% of the human genome and are common in all vertebrate genomes. The only retrovirus known to be currently transitioning from exogenous to endogenous form is the koala retrovirus (KoRV), making koalas (Phascolarctos cinereus) ideal for examining the early stages of retroviral endogenization. To distinguish endogenous from exogenous KoRV proviruses, we isolated koala genomic regions flanking KoRV integration sites. In three wild southern Australian koalas, there were fewer KoRV loci than in three captive Queensland koalas, consistent with reports that southern Australian koalas carry fewer KoRVs. Of 39 distinct KoRV proviral loci examined in a sire-dam-progeny triad, all proved to be vertically transmitted and endogenous; none was exogenous. Of the 39 endogenous KoRVs (enKoRVs), only one was present in the genomes of both the sire and the dam, suggesting that, at this early stage in the retroviral invasion of a host germ line, very large numbers of ERVs have proliferated at very low frequencies in the koala population. Sequence divergence between the 5'- and 3'-long terminal repeats (LTRs) of a provirus can be used as a molecular clock. Within each of ten enKoRVs, the 5'-LTR sequence was identical to the 3'-LTR sequence, suggesting a maximum age for enKoRV invasion of the koala germ line of approximately 22,200-49,900 years ago, although a much younger age is possible. Across the ten proviruses, seven LTR haplotypes were detected, indicating that at least seven different retroviral sequences had entered the koala germ line. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Proliferation of Endogenous Retroviruses in the Early Stages of a Host Germ Line Invasion

    Science.gov (United States)

    Ishida, Yasuko; Zhao, Kai; Greenwood, Alex D.; Roca, Alfred L.

    2015-01-01

    Endogenous retroviruses (ERVs) comprise 8% of the human genome and are common in all vertebrate genomes. The only retrovirus known to be currently transitioning from exogenous to endogenous form is the koala retrovirus (KoRV), making koalas (Phascolarctos cinereus) ideal for examining the early stages of retroviral endogenization. To distinguish endogenous from exogenous KoRV proviruses, we isolated koala genomic regions flanking KoRV integration sites. In three wild southern Australian koalas, there were fewer KoRV loci than in three captive Queensland koalas, consistent with reports that southern Australian koalas carry fewer KoRVs. Of 39 distinct KoRV proviral loci examined in a sire–dam–progeny triad, all proved to be vertically transmitted and endogenous; none was exogenous. Of the 39 endogenous KoRVs (enKoRVs), only one was present in the genomes of both the sire and the dam, suggesting that, at this early stage in the retroviral invasion of a host germ line, very large numbers of ERVs have proliferated at very low frequencies in the koala population. Sequence divergence between the 5′- and 3′-long terminal repeats (LTRs) of a provirus can be used as a molecular clock. Within each of ten enKoRVs, the 5′-LTR sequence was identical to the 3′-LTR sequence, suggesting a maximum age for enKoRV invasion of the koala germ line of approximately 22,200–49,900 years ago, although a much younger age is possible. Across the ten proviruses, seven LTR haplotypes were detected, indicating that at least seven different retroviral sequences had entered the koala germ line. PMID:25261407

  13. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  14. Mismatch repair deficiency does not enhance ENU mutagenesis in the zebrafish germ line.

    Science.gov (United States)

    Feitsma, Harma; de Bruijn, Ewart; van de Belt, Jose; Nijman, Isaac J; Cuppen, Edwin

    2008-07-01

    S(N)1-type alkylating agents such as N-ethyl-N-nitrosourea (ENU) are very potent mutagens. They act by transferring their alkyl group to DNA bases, which, upon mispairing during replication, can cause single base pair mutations in the next replication cycle. As DNA mismatch repair (MMR) proteins are involved in the recognition of alkylation damage, we hypothesized that ENU-induced mutation rates could be increased in a MMR-deficient background, which would be beneficial for mutagenesis approaches. We applied a standard ENU mutagenesis protocol to adult zebrafish deficient in the MMR gene msh6 and heterozygous controls to study the effect of MMR on ENU-induced DNA damage. Dose-dependent lethality was found to be similar for homozygous and heterozygous mutants, indicating that there is no difference in ENU resistance. Mutation discovery by high-throughput dideoxy resequencing of genomic targets in outcrossed progeny of the mutagenized fish did also not reveal any differences in germ line mutation frequency. These results may indicate that the maximum mutation load for zebrafish has been reached with the currently used, highly optimized ENU mutagenesis protocol. Alternatively, the MMR system in the zebrafish germ line may be saturated very rapidly, thereby having a limited effect on high-dose ENU mutagenesis.

  15. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

    Science.gov (United States)

    Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

    1990-11-30

    Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

  16. The perfect host: a mouse host embryo facilitating more efficient germ line transmission of genetically modified embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Robert A Taft

    Full Text Available There is a continual need to improve efficiency in creating precise genetic modifications in mice using embryonic stem cells (ESCs. We describe a novel approach resulting in 100% germline transmission from competent injected ESCs. We developed an F1 mouse host embryo (Perfect Host, PH that selectively ablates its own germ cells via tissue-specific induction of diphtheria toxin. This approach allows competent microinjected ESCs to fully dominate the germline, eliminating competition for this critical niche in the developing and adult animal. This is in contrast to conventional methods, where competition from host germ cells results in offspring derived from host cells and ESCs, necessitating extensive breeding of chimeras and genotyping to identify germline. The germline transmission process is also complicated by variability in the actual number of ESCs that colonize the germline niche and the proportion that are germline competent. To validate the PH approach we used ESC lines derived from 129 F1, BALB/cByJ, and BTBR backgrounds as well as an iPS line. Resulting chimeric males produced 194 offspring, all paternally derived from the introduced stem cells, with no offspring being derived from the host genome. We further tested this approach using eleven genetically modified C57BL/6N ESC lines (International Knockout Mouse Consortium. ESC germline transmission was observed in 9/11 (82% lines using PH blastocysts, compared to 6/11 (55% when conventional host blastocysts were used. Furthermore, less than 35% (83/240 of mice born in the first litters from conventional chimeras were confirmed to be of ESC-origin. By comparison, 100% (137/137 of the first litter offspring of PH chimeras were confirmed as ESC-derived. Together, these data demonstrate that the PH approach increases the probability of germline transmission and speeds the generation of ESC derived animals from chimeras. Collectively, this approach reduces the time and costs inherent in the

  17. Germ cell specification and ovary structure in the rotifer Brachionus plicatilis.

    Science.gov (United States)

    Smith, James M; Cridge, Andrew G; Dearden, Peter K

    2010-08-02

    The segregation of the germline from somatic tissues is an essential process in the development of all animals. Specification of the primordial germ cells (PGCs) takes place via different strategies across animal phyla; either specified early in embryogenesis by the inheritance of maternal determinants in the cytoplasm of the oocyte ('preformation') or selected later in embryonic development from undifferentiated precursors by a localized inductive signal ('epigenesis'). Here we investigate the specification and development of the germ cells in the rotifer Brachionus plicatilis, a member of the poorly-characterized superphyla Lophotrochozoa, by isolating the Brachionus homologues of the conserved germ cell markers vasa and nanos, and examining their expression using in situ hybridization. Bpvasa and Bpnos RNA expression have very similar distributions in the Brachionus ovary, showing ubiquitous expression in the vitellarium, with higher levels in the putative germ cell cluster. Bpvas RNA expression is present in freshly laid eggs, remaining ubiquitous in embryos until at least the 96 cell stage after which expression narrows to a small cluster of cells at the putative posterior of the embryo, consistent with the developing ovary. Bpnos RNA expression is also present in just-laid eggs but expression is much reduced by the four-cell stage and absent by the 16-cell stage. Shortly before hatching of the juvenile rotifer from the egg, Bpnos RNA expression is re-activated, located in a subset of posterior cells similar to those expressing Bpvas at the same stage. The observed expression of vasa and nanos in the developing B. plicatilis embryo implies an epigenetic origin of primordial germ cells in Rotifer.

  18. Germ cell specification and ovary structure in the rotifer Brachionus plicatilis

    Directory of Open Access Journals (Sweden)

    Smith James M

    2010-08-01

    Full Text Available Abstract Background The segregation of the germline from somatic tissues is an essential process in the development of all animals. Specification of the primordial germ cells (PGCs takes place via different strategies across animal phyla; either specified early in embryogenesis by the inheritance of maternal determinants in the cytoplasm of the oocyte ('preformation' or selected later in embryonic development from undifferentiated precursors by a localized inductive signal ('epigenesis'. Here we investigate the specification and development of the germ cells in the rotifer Brachionus plicatilis, a member of the poorly-characterized superphyla Lophotrochozoa, by isolating the Brachionus homologues of the conserved germ cell markers vasa and nanos, and examining their expression using in situ hybridization. Results Bpvasa and Bpnos RNA expression have very similar distributions in the Brachionus ovary, showing ubiquitous expression in the vitellarium, with higher levels in the putative germ cell cluster. Bpvas RNA expression is present in freshly laid eggs, remaining ubiquitous in embryos until at least the 96 cell stage after which expression narrows to a small cluster of cells at the putative posterior of the embryo, consistent with the developing ovary. Bpnos RNA expression is also present in just-laid eggs but expression is much reduced by the four-cell stage and absent by the 16-cell stage. Shortly before hatching of the juvenile rotifer from the egg, Bpnos RNA expression is re-activated, located in a subset of posterior cells similar to those expressing Bpvas at the same stage. Conclusions The observed expression of vasa and nanos in the developing B. plicatilis embryo implies an epigenetic origin of primordial germ cells in Rotifer.

  19. Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3

    International Nuclear Information System (INIS)

    Fan Jun; Akabane, Hiroto; Zheng Xuehai; Zhou Xuan; Zhang Li; Liu Qiang; Zhang Yonglian; Yang Jing; Zhu Guozhang

    2007-01-01

    The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function

  20. Disrupting the male germ line to find infertility and contraception targets.

    Science.gov (United States)

    Archambeault, Denise R; Matzuk, Martin M

    2014-05-01

    Genetically-manipulated mouse models have become indispensible for broadening our understanding of genes and pathways related to male germ cell development. Until suitable in vitro systems for studying spermatogenesis are perfected, in vivo models will remain the gold standard for inquiry into testicular function. Here, we discuss exciting advances that are allowing researchers faster, easier, and more customizable access to their mouse models of interest. Specifically, the trans-NIH Knockout Mouse Project (KOMP) is working to generate knockout mouse models of every gene in the mouse genome. The related Knockout Mouse Phenotyping Program (KOMP2) is performing systematic phenotypic analysis of this genome-wide collection of knockout mice, including fertility screening. Together, these programs will not only uncover new genes involved in male germ cell development but also provide the research community with the mouse models necessary for further investigations. In addition to KOMP/KOMP2, another promising development in the field of mouse models is the advent of CRISPR (clustered regularly interspaced short palindromic repeat)-Cas technology. Utilizing 20 nucleotide guide sequences, CRISPR/Cas has the potential to introduce sequence-specific insertions, deletions, and point mutations to produce null, conditional, activated, or reporter-tagged alleles. CRISPR/Cas can also successfully target multiple genes in a single experimental step, forgoing the multiple generations of breeding traditionally required to produce mouse models with deletions, insertions, or mutations in multiple genes. In addition, CRISPR/Cas can be used to create mouse models carrying variants identical to those identified in infertile human patients, providing the opportunity to explore the effects of such mutations in an in vivo system. Both the KOMP/KOMP2 projects and the CRISPR/Cas system provide powerful, accessible genetic approaches to the study of male germ cell development in the mouse. A

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  4. The Nanos3-3'UTR is required for germ cell specific NANOS3 expression in mouse embryos.

    Directory of Open Access Journals (Sweden)

    Hitomi Suzuki

    Full Text Available BACKGROUND: The regulation of gene expression via a 3' untranslated region (UTR plays essential roles in the discrimination of the germ cell lineage from somatic cells during embryogenesis. This is fundamental to the continuation of a species. Mouse NANOS3 is an essential protein required for the germ cell maintenance and is specifically expressed in these cells. However, the regulatory mechanisms that restrict the expression of this gene in the germ cells is largely unknown at present. METHODOLOGY/PRINCIPAL FINDINGS: In our current study, we show that differences in the stability of Nanos3 mRNA between germ cells and somatic cells is brought about in a 3'UTR-dependent manner in mouse embryos. Although Nanos3 is transcribed in both cell lineages, it is efficiently translated only in the germ lineage. We also find that the translational suppression of NANOS3 in somatic cells is caused by a 3'UTR-mediated mRNA destabilizing mechanism. Surprisingly, even when under the control of the CAG promoter which induces strong ubiquitous transcription in both germ cells and somatic cells, the addition of the Nanos3-3'UTR sequence to the coding region of exogenous gene was effective in restricting protein expression in germ cells. CONCLUSIONS/SIGNIFICANCE: Our current study thus suggests that Nanos3-3'UTR has an essential role in translational control in the mouse embryo.

  5. Substrate specificity and pH dependence of homogeneous wheat germ acid phosphatase.

    Science.gov (United States)

    Van Etten, R L; Waymack, P P

    1991-08-01

    The broad substrate specificity of a homogeneous isoenzyme of wheat germ acid phosphatase (WGAP) was extensively investigated by chromatographic, electrophoretic, NMR, and kinetic procedures. WGAP exhibited no divalent metal ion requirement and was unaffected upon incubation with EDTA or o-phenanthroline. A comparison of two catalytically homogeneous isoenzymes revealed little difference in substrate specificity. The specificity of WGAP was established by determining the Michaelis constants for a wide variety of substrates. p-Nitrophenyl phosphate, pyrophosphate, tripolyphosphate, and ATP were preferred substrates while lesser activities were seen toward sugar phosphates, trimetaphosphate, phosphoproteins, and (much less) phosphodiesters. An extensive table of Km and Vmax values is given. The pathway for the hydrolysis of trimetaphosphate was examined by colorimetric and 31P NMR methods and it was found that linear tripolyphosphate is not a free intermediate in the enzymatic reaction. In contrast to literature reports, homogeneous wheat germ acid phosphatase exhibits no measurable carboxylesterase activity, nor does it hydrolyze phenyl phosphonothioate esters or phytic acid at significant rates.

  6. Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, W.M.; Dausman, J.; Beard, C.; Jaenisch, R. (Massachusetts Inst. of Technology, Cambridge (United States)); Johnson, C.; Lawrence, J.B. (Univ. of Massachusetts Medical School, Worcester (United States))

    1993-03-26

    Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protection analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.

  7. Germ-line CAG repeat instability causes extreme CAG repeat expansion with infantile-onset spinocerebellar ataxia type 2

    DEFF Research Database (Denmark)

    Vinther-Jensen, Tua; Ek, Jakob; Duno, Morten

    2013-01-01

    The spinocerebellar ataxias (SCA) are a genetically and clinically heterogeneous group of diseases, characterized by dominant inheritance, progressive cerebellar ataxia and diverse extracerebellar symptoms. A subgroup of the ataxias is caused by unstable CAG-repeat expansions in their respective ...... of paternal germ-line repeat sequence instability of the expanded SCA2 locus.European Journal of Human Genetics advance online publication, 10 October 2012; doi:10.1038/ejhg.2012.231....

  8. The clinical phenotype of Lynch syndrome due to germ-line PMS2 mutations.

    Science.gov (United States)

    Senter, Leigha; Clendenning, Mark; Sotamaa, Kaisa; Hampel, Heather; Green, Jane; Potter, John D; Lindblom, Annika; Lagerstedt, Kristina; Thibodeau, Stephen N; Lindor, Noralane M; Young, Joanne; Winship, Ingrid; Dowty, James G; White, Darren M; Hopper, John L; Baglietto, Laura; Jenkins, Mark A; de la Chapelle, Albert

    2008-08-01

    Although the clinical phenotype of Lynch syndrome (also known as hereditary nonpolyposis colorectal cancer) has been well described, little is known about disease in PMS2 mutation carriers. Now that mutation detection methods can discern mutations in PMS2 from mutations in its pseudogenes, more mutation carriers have been identified. Information about the clinical significance of PMS2 mutations is crucial for appropriate counseling. Here, we report the clinical characteristics of a large series of PMS2 mutation carriers. We performed PMS2 mutation analysis using long-range polymerase chain reaction and multiplex ligation-dependent probe amplification for 99 probands diagnosed with Lynch syndrome-associated tumors showing isolated loss of PMS2 by immunohistochemistry. Penetrance was calculated using a modified segregation analysis adjusting for ascertainment. Germ-line PMS2 mutations were detected in 62% of probands (n = 55 monoallelic; 6 biallelic). Among families with monoallelic PMS2 mutations, 65.5% met revised Bethesda guidelines. Compared with the general population, in mutation carriers, the incidence of colorectal cancer was 5.2-fold higher, and the incidence of endometrial cancer was 7.5-fold higher. In North America, this translates to a cumulative cancer risk to age 70 years of 15%-20% for colorectal cancer, 15% for endometrial cancer, and 25%-32% for any Lynch syndrome-associated cancer. No elevated risk for non-Lynch syndrome-associated cancers was observed. PMS2 mutations contribute significantly to Lynch syndrome, but the penetrance for monoallelic mutation carriers appears to be lower than that for the other mismatch repair genes. Modified counseling and cancer surveillance guidelines for PMS2 mutation carriers are proposed.

  9. A landscape of germ line mutations in a cohort of inherited bone marrow failure patients.

    Science.gov (United States)

    Bluteau, Olivier; Sebert, Marie; Leblanc, Thierry; Peffault de Latour, Régis; Quentin, Samuel; Lainey, Elodie; Hernandez, Lucie; Dalle, Jean-Hugues; Sicre de Fontbrune, Flore; Lengline, Etienne; Itzykson, Raphael; Clappier, Emmanuelle; Boissel, Nicolas; Vasquez, Nadia; Da Costa, Mélanie; Masliah-Planchon, Julien; Cuccuini, Wendy; Raimbault, Anna; De Jaegere, Louis; Adès, Lionel; Fenaux, Pierre; Maury, Sébastien; Schmitt, Claudine; Muller, Marc; Domenech, Carine; Blin, Nicolas; Bruno, Bénédicte; Pellier, Isabelle; Hunault, Mathilde; Blanche, Stéphane; Petit, Arnaud; Leverger, Guy; Michel, Gérard; Bertrand, Yves; Baruchel, André; Socié, Gérard; Soulier, Jean

    2018-02-15

    Bone marrow (BM) failure (BMF) in children and young adults is often suspected to be inherited, but in many cases diagnosis remains uncertain. We studied a cohort of 179 patients (from 173 families) with BMF of suspected inherited origin but unresolved diagnosis after medical evaluation and Fanconi anemia exclusion. All patients had cytopenias, and 12.0% presented ≥5% BM blast cells. Median age at genetic evaluation was 11 years; 20.7% of patients were aged ≤2 years and 36.9% were ≥18 years. We analyzed genomic DNA from skin fibroblasts using whole-exome sequencing, and were able to assign a causal or likely causal germ line mutation in 86 patients (48.0%), involving a total of 28 genes. These included genes in familial hematopoietic disorders ( GATA2 , RUNX1 ), telomeropathies ( TERC , TERT , RTEL1 ), ribosome disorders ( SBDS , DNAJC21 , RPL5 ), and DNA repair deficiency ( LIG4 ). Many patients had an atypical presentation, and the mutated gene was often not clinically suspected. We also found mutations in genes seldom reported in inherited BMF (IBMF), such as SAMD9 and SAMD9L (N = 16 of the 86 patients, 18.6%), MECOM/EVI1 (N = 6, 7.0%), and ERCC6L2 (N = 7, 8.1%), each of which was associated with a distinct natural history; SAMD9 and SAMD9L patients often experienced transient aplasia and monosomy 7, whereas MECOM patients presented early-onset severe aplastic anemia, and ERCC6L2 patients, mild pancytopenia with myelodysplasia. This study broadens the molecular and clinical portrait of IBMF syndromes and sheds light on newly recognized disease entities. Using a high-throughput sequencing screen to implement precision medicine at diagnosis can improve patient management and family counseling. © 2018 by The American Society of Hematology.

  10. Identifying functional cancer-specific miRNA-mRNA interactions in testicular germ cell tumor.

    Science.gov (United States)

    Sedaghat, Nafiseh; Fathy, Mahmood; Modarressi, Mohammad Hossein; Shojaie, Ali

    2016-09-07

    Testicular cancer is the most common cancer in men aged between 15 and 35 and more than 90% of testicular neoplasms are originated at germ cells. Recent research has shown the impact of microRNAs (miRNAs) in different types of cancer, including testicular germ cell tumor (TGCT). MicroRNAs are small non-coding RNAs which affect the development and progression of cancer cells by binding to mRNAs and regulating their expressions. The identification of functional miRNA-mRNA interactions in cancers, i.e. those that alter the expression of genes in cancer cells, can help delineate post-regulatory mechanisms and may lead to new treatments to control the progression of cancer. A number of sequence-based methods have been developed to predict miRNA-mRNA interactions based on the complementarity of sequences. While necessary, sequence complementarity is, however, not sufficient for presence of functional interactions. Alternative methods have thus been developed to refine the sequence-based interactions using concurrent expression profiles of miRNAs and mRNAs. This study aims to find functional cancer-specific miRNA-mRNA interactions in TGCT. To this end, the sequence-based predicted interactions are first refined using an ensemble learning method, based on two well-known methods of learning miRNA-mRNA interactions, namely, TaLasso and GenMiR++. Additional functional analyses were then used to identify a subset of interactions to be most likely functional and specific to TGCT. The final list of 13 miRNA-mRNA interactions can be potential targets for identifying TGCT-specific interactions and future laboratory experiments to develop new therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [CEA, DSV/DRR/SEGG/LDRG, Laboratory of Differentiation and Radiobiology of the Gonads, Unit of Gametogenesis and Genotoxicity, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [Univ. Paris 7-Denis Diderot, UFR of Biology, UMR-S 566, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [INSERM, U566, F-92265 Fontenay aux Roses (France); Bakalska, M. [Institute of Experimental Morphology and Anthropology, Bulgarian Academy of Sciences, Sofia (Bulgaria); Frydman, R. [Univ Paris-Sud, Clamart F-92140 (France); Frydman, R. [AP-HP, Service de Gynecologie-Obstetrique et Medecine de la Reproduction, Hopital Antoine Beclere, Clamart F-92141 (France); Frydman, R. [INSERM, U782, Clamart F-92140 (France)

    2009-07-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin {alpha}, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of {gamma}H2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin {alpha} did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  12. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    International Nuclear Information System (INIS)

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Bakalska, M.; Frydman, R.; Frydman, R.; Frydman, R.

    2009-01-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin α, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of γH2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin α did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  13. Maintaining sufficient nanos is a critical function for polar granule component in the specification of primordial germ cells.

    Science.gov (United States)

    Deshpande, Girish; Spady, Emma; Goodhouse, Joe; Schedl, Paul

    2012-11-01

    Primordial germ cells (PGC) are the precursors of germline stem cells. In Drosophila, PGC specification is thought to require transcriptional quiescence and three genes, polar granule component (pgc), nanos (nos), and germ cell less (gcl) function to downregulate Pol II transcription. While it is not understood how nos or gcl represses transcription, pgc does so by inhibiting the transcription elongation factor b (P-TEFb), which is responsible for phosphorylating Ser2 residues in the heptad repeat of the C-terminal domain (CTD) of the largest Pol II subunit. In the studies reported here, we demonstrate that nos are a critical regulatory target of pgc. We show that a substantial fraction of the PGCs in pgc embryos have greatly reduced levels of Nos protein and exhibit phenotypes characteristic of nos PGCs. Lastly, restoring germ cell-specific expression of Nos is sufficient to ameliorate the pgc phenotype.

  14. Analysis of the cytoskeleton organization and its possible functions in male earthworm germ-line cysts equipped with a cytophore.

    Science.gov (United States)

    Małota, Karol; Świątek, Piotr

    2016-10-01

    We studied the organization of F-actin and the microtubular cytoskeleton in male germ-line cysts in the seminal vesicles of the earthworm Dendrobaena veneta using light, fluorescent and electron microscopy along with both chemically fixed tissue and life cell imaging. Additionally, in order to follow the functioning of the cytoskeleton, we incubated the cysts in colchicine, nocodazole, cytochalasin D and latrunculin A. The male germ-line cells of D. veneta are interconnected via stable intercellular bridges (IB), and form syncytial cysts. Each germ cell has only one IB that connects it to the anuclear central cytoplasmic mass, the cytophore. During the studies, we analyzed the cytoskeleton in spermatogonial, spermatocytic and spermatid cysts. F-actin was detected in the cortical cytoplasm and forms distinct rings in the IBs. The arrangement of the microtubules changed dynamically during spermatogenesis. The microtubules are distributed evenly in whole spermatogonial and spermatocytic cysts; however, they primarily accumulate within the IBs in spermatogonia. In early spermatids, microtubules pass through the IBs and are present in whole cysts. During spermatid elongation, the microtubules form a manchette while they are absent in the cytophore and in the IBs. Use of cytoskeletal drugs did not alter the general morphology of the cysts. Detectable effects-the occurrence of nuclei in the late spermatids and manchette fragments in the cytophore-were observed only after incubation in nocodazole. Our results suggest that the microtubules are responsible for cytoplasmic/organelle transfer between the germ cells and the cytophore during spermatogenesis and for the positioning of the spermatid nuclei.

  15. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  16. The Dr-nanos gene is essential for germ cell specification in the planarian Dugesia ryukyuensis.

    Science.gov (United States)

    Nakagawa, Haruka; Ishizu, Hirotsugu; Chinone, Ayako; Kobayashi, Kazuya; Matsumoto, Midori

    2012-01-01

    Homologs of nanos are required for the formation and maintenance of germline stem cell (GSC) systems and for gametogenesis in many metazoans. Planarians can change their reproductive mode seasonally, alternating between asexual and sexual reproduction; they develop and maintain their somatic stem cells (SSCs) and GCSs from pluripotent stem cells known as neoblasts. We isolated a nanos homolog, Dr-nanos, from the expressed sequence tags (ESTs) of the sexualized form of Dugesia ryukyuensis. We examined the expression of Dr-nanos in asexual and sexualized planarians by in situ hybridization and analyzed its function using RNA interference (RNAi) together with a planarian sexualization assay. A nanos homolog, Dr-nanos, was identified in the planarian D. ryukyuensis. Dr-nanos expression was observed in the ovarian primordial cells of the asexual worms. This expression increased in proportion to sexualization and was localized in the early germline cells of the ovaries and testes. In X-ray-irradiated worms, the expression of Dr-nanos decreased to a large extent, indicating that Dr-nanos is expressed in some subpopulations of stem cells, especially in GSCs. During the sexualization process, worms in which Dr-nanos was knocked down by RNAi exhibited decreased numbers of oogonia in the ovaries and failed to develop testes, whereas the somatic sexual organs were not affected. We conclude that Dr-nanos is essential for the development of germ cells in the ovaries and testes and may have a function in the early stages of germ cell specification, but not in the development of somatic sexual organs.

  17. Symmetry breaking, germ layer specification and axial organisation in aggregates of mouse embryonic stem cells.

    Science.gov (United States)

    van den Brink, Susanne C; Baillie-Johnson, Peter; Balayo, Tina; Hadjantonakis, Anna-Katerina; Nowotschin, Sonja; Turner, David A; Martinez Arias, Alfonso

    2014-11-01

    Mouse embryonic stem cells (mESCs) are clonal populations derived from preimplantation mouse embryos that can be propagated in vitro and, when placed into blastocysts, contribute to all tissues of the embryo and integrate into the normal morphogenetic processes, i.e. they are pluripotent. However, although they can be steered to differentiate in vitro into all cell types of the organism, they cannot organise themselves into structures that resemble embryos. When aggregated into embryoid bodies they develop disorganised masses of different cell types with little spatial coherence. An exception to this rule is the emergence of retinas and anterior cortex-like structures under minimal culture conditions. These structures emerge from the cultures without any axial organisation. Here, we report that small aggregates of mESCs, of about 300 cells, self-organise into polarised structures that exhibit collective behaviours reminiscent of those that cells exhibit in early mouse embryos, including symmetry breaking, axial organisation, germ layer specification and cell behaviour, as well as axis elongation. The responses are signal specific and uncouple processes that in the embryo are tightly associated, such as specification of the anteroposterior axis and anterior neural development, or endoderm specification and axial elongation. We discuss the meaning and implications of these observations and the potential uses of these structures which, because of their behaviour, we suggest to call 'gastruloids'. © 2014. Published by The Company of Biologists Ltd.

  18. Specific immune cell and cytokine characteristics of human testicular germ cell neoplasia.

    Science.gov (United States)

    Klein, Britta; Haggeney, Thomas; Fietz, Daniela; Indumathy, Sivanjah; Loveland, Kate L; Hedger, Mark; Kliesch, Sabine; Weidner, Wolfgang; Bergmann, Martin; Schuppe, Hans-Christian

    2016-10-01

    Which immune cells and cytokine profiles are characteristic for testicular germ cell neoplasia and what consequences does this have for the understanding of the related testicular immunopathology? The unique immune environment of testicular germ cell neoplasia comprises B cells and dendritic cells as well as high transcript levels of IL-6 and other B cell supporting or T helper cell type 1 (Th1)-driven cytokines and thus differs profoundly from normal testis or inflammatory lesions associated with hypospermatogenesis. T cells are known to be the major component of inflammatory infiltrates associated with either hypospermatogenesis or testicular cancer. It has previously been reported that B cells are only involved within infiltrates of seminoma samples, but this has not been investigated further. Immunohistochemical characterisation (IHC) of infiltrating immune cells and RT-qPCR-based analysis of corresponding cytokine microenvironments was performed on different testicular pathologies. Testicular biopsies, obtained from men undergoing andrological work-up of infertility or taken during surgery for testicular cancer, were used in this study. Samples were grouped as follows: (i) normal spermatogenesis (n = 18), (ii) hypospermatogenesis associated with lymphocytic infiltrates (n = 10), (iii) samples showing neoplasia [germ cell neoplasia in situ (GCNIS, n = 26) and seminoma, n = 18]. IHC was performed using antibodies against T cells (CD3+), B cells (CD20cy+), dendritic cells (CD11c+), macrophages (CD68+) and mast cells (mast cell tryptase+). Degree and compartmental localisation of immune cells throughout all groups analysed was evaluated semi-quantitatively. RT-qPCR on RNA extracted from cryo-preserved tissue samples was performed to analyse mRNA cytokine expression, specifically levels of IL-1β, IL-6, IL-17a, tumour necrosis factor (TNF)-α (pro-inflammatory), IL-10, transforming growth factor (TGF)-β1 (anti-inflammatory), IL-2, IL-12a, IL-12b

  19. Effects of chemical and physical agents on recombination events in cells of the germ line of male and female Drosophila melanogaster.

    Science.gov (United States)

    Würgler, F E

    1991-01-01

    Genotoxic agents can induce mutations as well as recombination in the genetic material. The fruit fly Drosophila melanogaster was one of the first assay systems to test physical and chemical agents for recombinogenic effects. Such effects can be observed in cells of the germ line as well as in somatic cells. At present information is available on 54 agents, among them 48 chemicals that have been tested in cells of the germ line of males and/or females. Effects on meiotic recombination in female germ cells cannot simply be classified as positive or negative since for a number of agents, depending on the chromosome region studied, recombination frequencies may be increased, unaffected or decreased. The male germ line of D. melanogaster represents a unique situation because meiotic recombination does not occur. Among 25 agents tested in male germ cells 24 did induce male recombination, among them alkylating, intercalating and cross-linking agents, direct-acting ones as well as compounds needing metabolic activation. With several compounds the frequency of induced recombination is highest in the heterochromatic regions near the centromeres. In brood pattern analyses, e.g., after exposure of adult males to ionizing radiation, the first appearance of crossover progeny is indicative of the sampling of exposed spermatocytes. In premeiotic cells of the male and the female germ line mitotic recombination can occur. Upon clonal expansion of the recombinant cells, clusters of identical crossovers can be observed.

  20. Melatonin receptor genes (mel-1a, mel-1b, mel-1c) are differentially expressed in the avian germ line.

    Science.gov (United States)

    Kawashima, Takaharu; Stepińska, Urszula; Kuwana, Takashi; Olszańska, Bozenna

    2008-09-01

    The presence of melatonin receptor transcripts (mel-1a, mel-1b and mel-1c) was investigated in primordial germ cells (PGCs), immature and mature oocytes, and sperm of Japanese quail by reverse transcription--polymerase chain reaction (RT-PCR). The mel-1a transcript was detected in as few as in a thousand PGCs. Significant differences in the expression of melatonin receptor genes were found in differentiating germ cells: in PGCs only the mel-1a receptor was expressed, in blastoderms and immature oocytes all three transcripts (mel-1a, mel-1b, mel-1c) were present, while in mature ovulated oocytes the predominant transcript was mel-1c (with sporadic occurrence of mel-1a and mel-1b). In sperm, mel-1a and mel-1c were present but mel-1b was absent. This indicates that the expression of melatonin receptor genes changes throughout the differentiation of PGCs into adult gametes: during oocyte differentiation two additional transcripts, mel-1b and mel-1c, are synthesized in addition to mel-1a, but at oocyte maturation, mel-1a and mel-1b are degraded and only mel-1c remains. During male line (spermatozoa) differentiation mel-1c is transcribed in addition to mel-1a, with mel-1b being completely absent. Since melatonin and the activities of enzymes participating in melatonin synthesis are present in the avian yolk, it is reasonable to suggest a role for this molecule in early avian development and germ line differentiation. We propose that melatonin may act as a signaling molecule regulating some differentiation processes (e.g., cell proliferation, migration, etc.) before the formation of neural and hormonal systems.

  1. Antinutritive effects of wheat-germ agglutinin and other N-acetylglucosamine-specific lectins.

    Science.gov (United States)

    Pusztai, A; Ewen, S W; Grant, G; Brown, D S; Stewart, J C; Peumans, W J; Van Damme, E J; Bardocz, S

    1993-07-01

    Incorporation of N-acetylglucosamine-specific agglutinins from wheat germ (Triticum aestivum; WGA), thorn apple (Datura stramonium) or nettle (Urtica dioica) rhizomes in the diet at the level of 7 g/kg reduced the apparent digestibility and utilization of dietary proteins and the growth of rats, with WGA being the most damaging. As a result of their binding and endocytosis by the epithelial cells of the small intestine, all three lectins were growth factors for the gut and interfered with its metabolism and function to varying degrees. WGA was particularly effective; it induced extensive polyamine-dependent hyperplastic and hypertrophic growth of the small bowel by increasing its content of proteins, RNA and DNA. Furthermore, an appreciable portion of the endocytosed WGA was transported across the gut wall into the systemic circulation, where it was deposited in the walls of the blood and lymphatic vessels. WGA also induced the hypertrophic growth of the pancreas and caused thymus atrophy. Although the transfer of the gene of WGA into crop plants has been advocated to increase their insect resistance, as the presence of this lectin in the diet may harm higher animals at the concentrations required to be effective against most pests, its use in plants as natural insecticide is not without health risks for man.

  2. Bovine Lhx8, a Germ Cell-Specific Nuclear Factor, Interacts with Figla.

    Directory of Open Access Journals (Sweden)

    Liyuan Fu

    Full Text Available LIM homeobox 8 (Lhx8 is a germ cell-specific transcription factor essential for the development of oocytes during early oogenesis. In mice, Lhx8 deficiency causes postnatal oocyte loss and affects the expression of many oocyte-specific genes. The aims of this study were to characterize the bovine Lhx8 gene, determine its mRNA expression during oocyte development and early embryogenesis, and evaluate its interactions with other oocyte-specific transcription factors. The bovine Lhx8 gene encodes a protein of 377 amino acids. A splice variant of Lhx8 (Lhx8_v1 was also identified. The predicted bovine Lhx8 protein contains two LIM domains and one homeobox domain. However, one of the LIM domains in Lhx8_v1 is incomplete due to deletion of 83 amino acids near the N terminus. Both Lhx8 and Lhx8_v1 transcripts were only detected in the gonads but none of the somatic tissues examined. The expression of Lhx8 and Lhx8_v1 appears to be restricted to oocytes as none of the transcripts was detectable in granulosa or theca cells. The maternal Lhx8 transcript is abundant in GV and MII stage oocytes as well as in early embryos but disappear by morula stage. A nuclear localization signal that is required for the import of Lhx8 into nucleus was identified, and Lhx8 is predominantly localized in the nucleus when ectopically expressed in mammalian cells. Finally, a novel interaction between Lhx8 and Figla, another transcription factor essential for oogenesis, was detected. The results provide new information for studying the mechanisms of action for Lhx8 in oocyte development and early embryogenesis.

  3. Minichromosome maintenance helicase paralog MCM9 is dispensible for DNA replication but functions in germ-line stem cells and tumor suppression.

    Science.gov (United States)

    Hartford, Suzanne A; Luo, Yunhai; Southard, Teresa L; Min, Irene M; Lis, John T; Schimenti, John C

    2011-10-25

    Effective DNA replication is critical to the health and reproductive success of organisms. The six MCM2-7 proteins, which form the replicative helicase, are essential for high-fidelity replication of the genome. Many eukaryotes have a divergent paralog, MCM9, that was reported to be essential for loading MCM2-7 onto replication origins in the Xenopus oocyte extract system. To address the in vivo role of mammalian MCM9, we created and analyzed the phenotypes of mice with various mutations in Mcm9 and an intronic DNA replication-related gene Asf1a. Ablation of Mcm9 was compatible with cell proliferation and mouse viability, showing that it is nonessential for MCM2-7 loading or DNA replication. Mcm9 mutants underwent p53-independent embryonic germ-cell depletion in both sexes, with males also exhibiting defective spermatogonial stem-cell renewal. MCM9-deficient cells had elevated genomic instability and defective cell cycle reentry following replication stress, and mutant animals were prone to sex-specific cancers, most notably hepatocellular carcinoma in males. The phenotypes of mutant mice and cells suggest that MCM9 evolved a specialized but nonessential role in DNA replication or replication-linked quality-control mechanisms that are especially important for germ-line stem cells, and also for tumor suppression and genome maintenance in the soma.

  4. The Ovary of Tubifex tubifex (Clitellata, Naididae, Tubificinae Is Composed of One, Huge Germ-Line Cyst that Is Enriched with Cytoskeletal Components.

    Directory of Open Access Journals (Sweden)

    Anna Z Urbisz

    Full Text Available Recent studies on the ovary organization and oogenesis in Tubificinae have revealed that their ovaries are small polarized structures that are composed of germ cells in subsequent stages of oogenesis that are associated with somatic cells. In syncytial cysts, as a rule, each germ cell is connected to the central cytoplasmic mass, the cytophore, via only one stable intercellular bridge (ring canal. In this paper we present detailed data about the composition of germ-line cysts in Tubifex tubifex with special emphasis on the occurrence and distribution of the cytoskeletal elements. Using fixed material and live cell imaging techniques, we found that the entire ovary of T. tubifex is composed of only one, huge multicellular germ-line cyst, which may contain up to 2,600 cells. Its architecture is broadly similar to the cysts that are found in other clitellate annelids, i.e. a common, anuclear cytoplasmic mass in the center of the cyst and germ cells that are connected to it via intercellular bridges. The cytophore in the T. tubifex cyst extends along the long axis of the ovary in the form of elongated and branched cytoplasmic strands. Rhodamine-coupled phalloidin staining revealed that the prominent strands of actin filaments occur inside the cytophore. Similar to the cytophore, F-actin strands are branched and they are especially well developed in the middle and outermost parts of the ovary. Microfilaments are also present in the ring canals that connect the germ cells with the cytophore in the narrow end of the ovary. Using TubulinTracker, we found that the microtubules form a prominent network of loosely and evenly distributed tubules inside the cytophore as well as in every germ cell. The well-developed cytoskeletal elements in T. tubifex ovary seem to ensure the integrity of such a huge germ-line cyst of complex (germ cells-ring canals-cytophore organization. A comparison between the cysts that are described here and other well-known female

  5. Heterozygosity for a Bub1 mutation causes female-specific germ cell aneuploidy in mice

    Energy Technology Data Exchange (ETDEWEB)

    Leland, Shawn; Nagarajan, Prabakaran; Polyzos, Aris; Thomas, Sharon; Samaan, George; Donnell, Robert; Marchetti, Francesco; Venkatachalam, Sundaresan

    2009-06-24

    Aneuploidy, the most common chromosomal abnormality at birth and the main ascertained cause of pregnancy loss in humans, originates primarily from chromosome segregation errors during oogenesis. Here we report that heterozygosity for a mutation in the mitotic checkpoint kinase gene, Bub1, induces aneuploidy in female germ cells of mice, and that the effect increases with advancing maternal age. Analysis of Bub1 heterozygous oocytes showed that aneuploidy occurred primarily during the first meiotic division and involved premature sister chromatid separation. Furthermore, aneuploidy was inherited in zygotes and resulted in the loss of embryos after implantation. The incidence of aneuploidy in zygotes was sufficient to explain the reduced litter size in matings with Bub1 heterozygous females. No effects were seen in germ cells from heterozygous males. These findings show that Bub1 dysfunction is linked to inherited aneuploidy in female germ cells and may contribute to the maternal age-related increase in aneuploidy and pregnancy loss.

  6. Convergent evolution of germ granule nucleators: A hypothesis.

    Science.gov (United States)

    Kulkarni, Arpita; Extavour, Cassandra G

    2017-10-01

    Germ cells have been considered "the ultimate stem cell" because they alone, during normal development of sexually reproducing organisms, are able to give rise to all organismal cell types. Morphological descriptions of a specialized cytoplasm termed 'germ plasm' and associated electron dense ribonucleoprotein (RNP) structures called 'germ granules' within germ cells date back as early as the 1800s. Both germ plasm and germ granules are implicated in germ line specification across metazoans. However, at a molecular level, little is currently understood about the molecular mechanisms that assemble these entities in germ cells. The discovery that in some animals, the gene products of a small number of lineage-specific genes initiate the assembly (also termed nucleation) of germ granules and/or germ plasm is the first step towards facilitating a better understanding of these complex biological processes. Here, we draw on research spanning over 100years that supports the hypothesis that these nucleator genes may have evolved convergently, allowing them to perform analogous roles across animal lineages. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect

    Directory of Open Access Journals (Sweden)

    Ben Ewen-Campen

    2013-04-01

    Primordial germ cell (PGC formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this “germ plasm” acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  8. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect.

    Science.gov (United States)

    Ewen-Campen, Ben; Jones, Tamsin E M; Extavour, Cassandra G

    2013-06-15

    Primordial germ cell (PGC) formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this "germ plasm" acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola) suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  9. Radiation-induced germ-line mutations detected by a direct comparison of parents and children DNA sequences containing SNPs

    International Nuclear Information System (INIS)

    Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.

    2003-01-01

    Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose

  10. A novel transcriptional factor Nkapl is a germ cell-specific suppressor of Notch signaling and is indispensable for spermatogenesis.

    Directory of Open Access Journals (Sweden)

    Hidenobu Okuda

    Full Text Available Spermatogenesis is an elaborately regulated system dedicated to the continuous production of spermatozoa via the genesis of spermatogonia. In this process, a variety of genes are expressed that are relevant to the differentiation of germ cells at each stage. Although Notch signaling plays a critical role in germ cell development in Drosophila and Caenorhabditis elegans, its function and importance for spermatogenesis in mammals is controversial. We report that Nkapl is a novel germ cell-specific transcriptional suppressor in Notch signaling. It is also associated with several molecules of the Notch corepressor complex such as CIR, HDAC3, and CSL. It was expressed robustly in spermatogonia and early spermatocytes after the age of 3 weeks. Nkapl-deleted mice showed complete arrest at the level of pachytene spermatocytes. In addition, apoptosis was observed in this cell type. Overexpression of NKAPL in germline stem cells demonstrated that Nkapl induced changes in spermatogonial stem cell (SSC markers and the reduction of differentiation factors through the Notch signaling pathway, whereas testes with Nkapl deleted showed inverse changes in those markers and factors. Therefore, Nkapl is indispensable because aberrantly elevated Notch signaling has negative effects on spermatogenesis, affecting SSC maintenance and differentiation factors. Notch signaling should be properly regulated through the transcriptional factor Nkapl.

  11. Germ-line mutations at a mouse ESTR (Pc-3) locus and human microsatellite loci

    International Nuclear Information System (INIS)

    Ryo, Haruko; Nakajima, Hiroo; Nomura, Taisei

    2006-01-01

    We examined the use of the mouse Pc-3 ESTR (expanded simple tandem repeat) locus and 72 human microsatellite loci as potentially sensitive biomarkers for mutagenic exposures to germ cells in mice and humans respectively. In the mouse work, we treated male mice with TCDD (2, 3, 7, 8-tetrachlo-rodibenzo-p-dioxin; a chemical known to induce congenital anomalies in humans and mice) and, analysed the F 1 fetuses for Pc-3 mutations. Although the incidence of anomalies was higher in the TCDD group, there were no induced mutations. However, respiratory distress syndrome (RDS) was observed in 3 of 7 fetuses born to male mice which were treated with TCDD and which showed abnormal length of Pc-3 allele. In the human studies, the children of Chernobyl liquidators were examined for mutations at a total of 72 (31 autosomal, 1 X-linked and 40 Y-linked) microsatellite loci. This study was prompted by earlier findings of increases in microsatellite mutations in barn swallows and wheat in the highly contaminated areas after the Chernobyl accident. We examined 64 liquidator families (70 children) and 66 control families (70 children). However, no increases in mutation rates were found. The estimated mean dose to the liquidators was about 39 mSv and this might be one possible reason why no increases of mutations could be found. (author)

  12. Transplantation of germ cells from glial cell line-derived neurotrophic factor-overexpressing mice to host testes depleted of endogenous spermatogenesis by fractionated irradiation

    NARCIS (Netherlands)

    Creemers, L. B.; Meng, X.; den Ouden, K.; van Pelt, A. M. M.; Izadyar, F.; Santoro, M.; Sariola, H.; de rooij, D. G.

    2002-01-01

    With a novel method of eliminating spermatogenesis in host animals, male germ cells isolated from mice with targeted overexpression of glial cell line-derived neurotrophic factor (GDNF) were transplanted to evaluate their ability to reproduce the phenotype previously found in the transgenic animals.

  13. Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector.

    Science.gov (United States)

    Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J

    2002-04-01

    Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.

  14. Primordial Germ Cell-Mediated Chimera Technology Produces Viable Pure-Line Houbara Bustard Offspring: Potential for Repopulating an Endangered Species

    Science.gov (United States)

    Wernery, Ulrich; Liu, Chunhai; Baskar, Vijay; Guerineche, Zhor; Khazanehdari, Kamal A.; Saleem, Shazia; Kinne, Jörg; Wernery, Renate

    2010-01-01

    Background The Houbara bustard (Chlamydotis undulata) is a wild seasonal breeding bird populating arid sandy semi-desert habitats in North Africa and the Middle East. Its population has declined drastically during the last two decades and it is classified as vulnerable. Captive breeding programmes have, hitherto, been unsuccessful in reviving population numbers and thus radical technological solutions are essential for the long term survival of this species. The purpose of this study was to investigate the use of primordial germ cell-mediated chimera technology to produce viable Houbara bustard offspring. Methodology/Principal Findings Embryonic gonadal tissue was dissected from Houbara bustard embryos at eight days post-incubation. Subsequently, Houbara tissue containing gonadal primordial germ cells (gPGCs) was injected into White Leghorn chicken (Gallus gallus domesticus) embryos, producing 83/138 surviving male chimeric embryos, of which 35 chimeric roosters reached sexual maturity after 5 months. The incorporation and differentiation of Houbara gPGCs in chimeric chicken testis were assessed by PCR with Houbara-specific primers and 31.3% (5/16) gonads collected from the injected chicken embryos showed the presence of donor Houbara cells. A total of 302 semen samples from 34 chimeric roosters were analyzed and eight were confirmed as germline chimeras. Semen samples from these eight roosters were used to artificially inseminate three female Houbara bustards. Subsequently, 45 Houbara eggs were obtained and incubated, two of which were fertile. One egg hatched as a male live born Houbara; the other was female but died before hatching. Genotyping confirmed that the male chick was a pure-line Houbara derived from a chimeric rooster. Conclusion This study demonstrates for the first time that Houbara gPGCs can migrate, differentiate and eventually give rise to functional sperm in the chimeric chicken testis. This approach may provide a promising tool for propagation

  15. Primordial germ cell-mediated chimera technology produces viable pure-line Houbara bustard offspring: potential for repopulating an endangered species.

    Directory of Open Access Journals (Sweden)

    Ulrich Wernery

    2010-12-01

    Full Text Available The Houbara bustard (Chlamydotis undulata is a wild seasonal breeding bird populating arid sandy semi-desert habitats in North Africa and the Middle East. Its population has declined drastically during the last two decades and it is classified as vulnerable. Captive breeding programmes have, hitherto, been unsuccessful in reviving population numbers and thus radical technological solutions are essential for the long term survival of this species. The purpose of this study was to investigate the use of primordial germ cell-mediated chimera technology to produce viable Houbara bustard offspring.Embryonic gonadal tissue was dissected from Houbara bustard embryos at eight days post-incubation. Subsequently, Houbara tissue containing gonadal primordial germ cells (gPGCs was injected into White Leghorn chicken (Gallus gallus domesticus embryos, producing 83/138 surviving male chimeric embryos, of which 35 chimeric roosters reached sexual maturity after 5 months. The incorporation and differentiation of Houbara gPGCs in chimeric chicken testis were assessed by PCR with Houbara-specific primers and 31.3% (5/16 gonads collected from the injected chicken embryos showed the presence of donor Houbara cells. A total of 302 semen samples from 34 chimeric roosters were analyzed and eight were confirmed as germline chimeras. Semen samples from these eight roosters were used to artificially inseminate three female Houbara bustards. Subsequently, 45 Houbara eggs were obtained and incubated, two of which were fertile. One egg hatched as a male live born Houbara; the other was female but died before hatching. Genotyping confirmed that the male chick was a pure-line Houbara derived from a chimeric rooster.This study demonstrates for the first time that Houbara gPGCs can migrate, differentiate and eventually give rise to functional sperm in the chimeric chicken testis. This approach may provide a promising tool for propagation and conservation of endangered avian

  16. Assessment of the degree of contamination of rat germ cell preparations using specific cDNA probes

    Directory of Open Access Journals (Sweden)

    Savaris R.F.

    1997-01-01

    Full Text Available Recent reports showing a decrease in sperm count in men have brought new concerns about male infertility. Animal models have been widely used to provide some relevant information about the human male gamete, and extrapolations are made to men and to the clinical context. The present study assesses one of the methods used for separation of germ cells of the adult rat testis, namely centrifugal elutriation followed by density gradients (Percoll®. This method was chosen since it presents the best results for cell purity in separating germ cells from the rat testis. A comparison between continuous and discontinuous Percoll® gradients was performed in order to identify the best type of gradient to separate the cells. Maximal cell purity was obtained for spermatocytes (81 ± 8.2%, mean ± SEM and spermatids (84 ± 2.6% using centrifugal elutriation followed by continuous Percoll® gradients. A significant difference in purity was observed between elongating spermatids harvested from continuous Percoll® gradients and from discontinuous gradients. Molecular analysis was used to assess cell contamination by employing specific probes, namely transition protein 2 (TP2, mitochondrial cytochrome C oxidase II (COX II, and sulfated glycoprotein 1 (SGP1. Molecular analysis of the samples demonstrated that morphological criteria are efficient in characterizing the main composition of the cell suspension, but are not reliable for identifying minimal contamination from other cells. Reliable cell purity data should be established using molecular analysis

  17. Glial cell line-derived neurotrophic factor and endothelial cells promote self-renewal of rabbit germ cells with spermatogonial stem cell properties.

    Science.gov (United States)

    Kubota, Hiroshi; Wu, Xin; Goodyear, Shaun M; Avarbock, Mary R; Brinster, Ralph L

    2011-08-01

    Previous studies suggest that exogenous factors crucial for spermatogonial stem cell (SSC) self-renewal are conserved among several mammalian species. Since glial cell line-derived neurotrophic factor (GDNF) and fibroblast growth factor 2 (FGF2) are critical for rodent SSC self-renewal, we hypothesized that they might promote self-renewal of nonrodent SSCs. Therefore, we cultured testicular germ cells from prepubertal rabbits in the presence of GDNF and FGF2 and found they proliferated indefinitely as cellular clumps that displayed characteristics previously identified for rodent SSCs. The rabbit germ cells could not be maintained on mouse embryonic fibroblast (STO) feeders that support rodent SSC self-renewal in vitro but were rather supported on mouse yolk sac-derived endothelial cell (C166) feeder layers. Proliferation of rabbit germ cells was dependent on GDNF. Of critical importance was that clump-forming rabbit germ cells colonized seminiferous tubules of immunodeficient mice, proliferated for at least 6 mo, while retaining an SSC phenotype in the testes of recipient mice, indicating that they were rabbit SSCs. This study demonstrates that GDNF is a mitogenic factor promoting self-renewal that is conserved between rodent and rabbit SSCs; with an evolutionary separation of ∼ 60 million years. These findings provide a foundation to study the mechanisms governing SSC self-renewal in nonrodent species.

  18. MSH6 and PMS2 germ-line pathogenic variants implicated in Lynch syndrome are associated with breast cancer.

    Science.gov (United States)

    Roberts, Maegan E; Jackson, Sarah A; Susswein, Lisa R; Zeinomar, Nur; Ma, Xinran; Marshall, Megan L; Stettner, Amy R; Milewski, Becky; Xu, Zhixiong; Solomon, Benjamin D; Terry, Mary Beth; Hruska, Kathleen S; Klein, Rachel T; Chung, Wendy K

    2018-01-18

    PurposeAn association of Lynch syndrome (LS) with breast cancer has been long suspected; however, there have been insufficient data to address this question for each of the LS genes individually.MethodsWe conducted a retrospective review of personal and family history in 423 women with pathogenic or likely pathogenic germ-line variants in MLH1 (N = 65), MSH2 (N = 94), MSH6 (N = 140), or PMS2 (N = 124) identified via clinical multigene hereditary cancer testing. Standard incidence ratios (SIRs) of breast cancer were calculated by comparing breast cancer frequencies in our study population with those in the general population (Surveillance, Epidemiology, and End Results 18 data).ResultsWhen evaluating by gene, the age-standardized breast cancer risks for MSH6 (SIR = 2.11; 95% confidence interval (CI), 1.56-2.86) and PMS2 (SIR = 2.92; 95% CI, 2.17-3.92) were associated with a statistically significant risk for breast cancer whereas no association was observed for MLH1 (SIR = 0.87; 95% CI, 0.42-1.83) or MSH2 (SIR = 1.22; 95% CI, 0.72-2.06).ConclusionOur data demonstrate that two LS genes, MSH6 and PMS2, are associated with an increased risk for breast cancer and should be considered when ordering genetic testing for individuals who have a personal and/or family history of breast cancer.GENETICS in MEDICINE advance online publication, 18 January 2018; doi:10.1038/gim.2017.254.

  19. Testicular atrophy and loss of nerve growth factor-immunoreactive germ cell line in rats exposed to n-hexane and a protective effect of simultaneous exposure to toluene or xylene

    Energy Technology Data Exchange (ETDEWEB)

    Nylen, P; Johnson, A C; Hoeglund, G; Ebendal, T; Eriksdotter-Nilsson, M; Henschen, A; Olson, L; Hansson, T; Kronevi, T; Kvist, U

    1989-07-01

    Testicular and germ cell line morphology in rats were studied 2 weeks, 10 months and 14 months after cessation of a 61-day inhalation exposure to 1000 ppm n-hexane. Androgen biosynthetic capacity of testis, testosterone blood concentration, vas deferens morphology and noradrenaline (NA) concentration, epididymal sperm morphology, and fertility were also studied. Severe testicular atrophy involving the seminiferous tubules with loss of the nerve growth factor (NGF) immunoreactive germ cell line was found. Total loss of the germ cell line was found in a fraction of animals up to 14 months post-exposure, indicating permanent testicular damage. No impairment of androgen synthesis or androgen dependent accessory organs was observed. Simultaneous administration of 1000 ppm n-hexane and 1000 ppm toluene, or 1000 ppm n-hexane and 1000 ppm xylene, did not cause germ cell line alterations or testicular atrophy. Toluene and xylene were thus found to protect from n-hexane induced testicular atrophy. (orig.).

  20. RAB10 Interacts with the Male Germ Cell-Specific GTPase-Activating Protein during Mammalian Spermiogenesis

    Directory of Open Access Journals (Sweden)

    Ying-Hung Lin

    2017-01-01

    Full Text Available According to recent estimates, 2%–15% of couples are sterile, and approximately half of the infertility cases are attributed to male reproductive factors. However, the reasons remain undefined in approximately 25% of male infertility cases, and most infertility cases exhibit spermatogenic defects. Numerous genes involved in spermatogenesis still remain unknown. We previously identified Male Germ Cells Rab GTPase-Activating Proteins (MGCRABGAPs through cDNA microarray analysis of human testicular tissues with spermatogenic defects. MGCRABGAP contains a conserved RABGAP catalytic domain, TBC (Tre2/Bub2/Cdc16. RABGAP family proteins regulate cellular function (e.g., cytoskeletal remodeling, vesicular trafficking, and cell migration by inactivating RAB proteins. MGCRABGAP is a male germ cell-specific protein expressed in elongating and elongated spermatids during mammalian spermiogenesis. The purpose of this study was to identify proteins that interact with MGCRABGAP during mammalian spermiogenesis using a proteomic approach. We found that MGCRABGAP exhibited GTPase-activating bioability, and several MGCRABGAP interactors, possible substrates (e.g., RAB10, RAB5C, and RAP1, were identified using co-immunoprecipitation (co-IP and nano liquid chromatography-mass spectrometry/mass spectrometry (nano LC-MS/MS. We confirmed the binding ability between RAB10 and MGCRABGAP via co-IP. Additionally, MGCRABGAP–RAB10 complexes were specifically colocalized in the manchette structure, a critical structure for the formation of spermatid heads, and were slightly expressed at the midpiece of mature spermatozoa. Based on these results, we propose that MGCRABGAP is involved in mammalian spermiogenesis by modulating RAB10.

  1. Human-specific subcellular compartmentalization of P-element induced wimpy testis-like (PIWIL) granules during germ cell development and spermatogenesis

    NARCIS (Netherlands)

    Gomes Fernandes, Maria; He, Nannan; Wang, Fang; Van Iperen, Liesbeth; Eguizabal, Cristina; Matorras, Roberto; Roelen, Bernard A J; Chuva de Sousa Lopes, Susana M

    2018-01-01

    STUDY QUESTION: What is the dynamics of expression of P-element induced wimpy testis-like (PIWIL) proteins in the germline during human fetal development and spermatogenesis? SUMMARY ANSWER: PIWIL1, PIWIL2, PIWIL3 and PIWIL4 were expressed in a sex-specific fashion in human germ cells (GC) during

  2. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Science.gov (United States)

    Lawson, Bianca; Clulow, Simon; Mahony, Michael J; Clulow, John

    2013-01-01

    Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60%) over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+)-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research directions for

  3. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Bianca Lawson

    Full Text Available Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60% over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research

  4. A vector-based system for the differentiation of mouse embryonic stem cells toward germ-line cells

    Directory of Open Access Journals (Sweden)

    Reza Ebrahimzadeh-Vesal

    2014-08-01

    Conclusion: In this study, we demonstrated the in vitro generation of mouse embryonic stem cells to germ cells by using a backbone vector containing the fusion gene Stra8-EGFP. The Stra8 gene is a retinoic acid-responsive protein and is able to regulate meiotic initiation.

  5. Effects of specific and prolonged expression of zebrafish growth factors, Fgf2 and Lif in primordial germ cells in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wong, Ten-Tsao, E-mail: wong20@purdue.edu [Department of Animal Sciences, Purdue University, 901 W. State Street, West Lafayette, IN 47907 (United States); Collodi, Paul [Department of Animal Sciences, Purdue University, 901 W. State Street, West Lafayette, IN 47907 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer We discovered that nanos3 3 Prime UTR prolonged PGC-specific protein expression up to 26 days. Black-Right-Pointing-Pointer Expression of Fgf2 in PGCs significantly increased PGC number at later developmental stages. Black-Right-Pointing-Pointer Expression of Lif in PGCs resulted in a significant disruption of PGC migration. Black-Right-Pointing-Pointer Lif illicited its effect on PGC migration through Lif receptor a. Black-Right-Pointing-Pointer Our approach could be used to achieve prolonged PGC-specific expression of other proteins. -- Abstract: Primordial germ cells (PGCs), specified early in development, proliferate and migrate to the developing gonad before sexual differentiation occurs in the embryo and eventually give rise to spermatogonia or oogonia. In this study, we discovered that nanos3 3 Prime UTR, a common method used to label PGCs, not only directed PGC-specific expression of DsRed but also prolonged this expression up to 26 days post fertilization (dpf) when DsRed-nanos3 3 Prime UTR hybrid mRNAs were introduced into 1- to 2-cell-stage embryos. As such, we employed this knowledge to express zebrafish leukemia inhibitory factor (Lif), basic fibroblast growth factor (Fgf2) and bone morphogenetic protein 4 (Bmp4) in the PGCs and evaluate their effects on PGC development in vivo for over a period of 3 weeks. The results show that expression of Fgf2 significantly increased PGC number at 14- and 21-dpf while Bmp4 resulted in severe ventralization and death of the embryos by 3 days. Expression of Lif resulted in a significant disruption of PGC migration. Mopholino knockdown experiments indicated that Lif illicited its effect on PGC migration through Lif receptor a (Lifra) but not Lifrb. The general approach described in this study could be used to achieve prolonged PGC-specific expression of other proteins to investigate their roles in germ cell and gonad development. The results also indicate that zebrafish PGCs

  6. A novel germ-line point mutation in RET exon 8 (Gly(533)Cys) in a large kindred with familial medullary thyroid carcinoma

    OpenAIRE

    Silva, Adriana Madeira Alvares da [UNIFESP; Maciel, Rui Monteiro de Barros [UNIFESP; Dias-da-Silva, Magnus Régios [UNIFESP; Toledo, Silvia Regina Caminada de [UNIFESP; De Carvalho, Marcos B.; Cerutti, Janete Maria [UNIFESP

    2003-01-01

    Familial medullary thyroid carcinoma is related to germ-line mutations in the RET oncogene, mainly in cysteine codon 10 or 11, whereas noncysteine mutations in codons 13 - 15 are rare. We now report a new missense point mutation in exon 8 of the RET gene (1597G-->T) corresponding to a Gly(533)Cys substitution in the cystein-rich domain of RET protein in 76 patients from a 6-generation Brazilian family with 229 subjects, with ascendants from Spain. It is likely that the mutation causes familia...

  7. Germ cell development in the Honeybee (Apis mellifera; Vasa and Nanos expression

    Directory of Open Access Journals (Sweden)

    Dearden Peter K

    2006-02-01

    Full Text Available Abstract Background Studies of specification of germ-cells in insect embryos has indicated that in many taxa the germ cells form early in development, and their formation is associated with pole plasm, germ plasm or an organelle called the oosome. None of these morphological features associated with germ cell formation have been identified in the Honeybee Apis mellifera. In this study I report the cloning and expression analysis of Honeybee homologues of vasa and nanos, germ cell markers in insects and other animals. Results Apis vasa and nanos RNAs are present in early honeybee embryos, but the RNAs clear rapidly, without any cells expressing these germ cell markers past stage 2. These genes are then only expressed in a line of cells in the abdomen from stage 9 onwards. These cells are the developing germ cells that are moved dorsally by dorsal closure and are placed in the genital ridge. Conclusion This study of the expression of germ cell markers in the honeybee implies that in this species either germ cells are formed by an inductive event, late in embryogenesis, or they are formed early in development in the absence of vasa and nanos expression. This contrasts with germ cell development in other members of the Hymenoptera, Diptera and Lepidoptera.

  8. Tissue Specific Roles of Dynein Light Chain 1 in Regulating Germ Cell Apoptosis in Ceanorhabditis elegans

    DEFF Research Database (Denmark)

    Morthorst, Tine Hørning

    2015-01-01

    in the etiology of many diseases, including cancer, neurodegenerative, cardiovascular and autoimmune diseases. Several of the first genes found to regulate apoptosis were discovered in the nematode Caenorhabditis elegans. In this project, two different and tissue specific roles of C. elegans dynein light chain 1...

  9. Germ line mutations of mismatch repair genes in hereditary nonpolyposis colorectal cancer patients with small bowel cancer: International Society for Gastrointestinal Hereditary Tumours Collaborative Study

    DEFF Research Database (Denmark)

    Park, Jae-Gahb; Kim, Duck-Woo; Hong, Chang Won

    2006-01-01

    PURPOSE: The aim of study was to determine the clinical characteristics and mutational profiles of the mismatch repair genes in hereditary nonpolyposis colorectal cancer (HNPCC) patients with small bowel cancer (SBC). EXPERIMENTAL DESIGN: A questionnaire was mailed to 55 members of the Internatio......PURPOSE: The aim of study was to determine the clinical characteristics and mutational profiles of the mismatch repair genes in hereditary nonpolyposis colorectal cancer (HNPCC) patients with small bowel cancer (SBC). EXPERIMENTAL DESIGN: A questionnaire was mailed to 55 members...... of the International Society for Gastrointestinal Hereditary Tumours, requesting information regarding patients with HNPCC-associated SBC and germ line mismatch repair gene mutations. RESULTS: The study population consisted of 85 HNPCC patients with identified mismatch repair gene mutations and SBCs. SBC was the first...... HNPCC-associated malignancy in 14 of 41 (34.1%) patients for whom a personal history of HNPCC-associated cancers was available. The study population harbored 69 different germ line mismatch repair gene mutations, including 31 mutations in MLH1, 34 in MSH2, 3 in MSH6, and 1 in PMS2. We compared...

  10. Development of one control and one tumor-specific induced pluripotent stem cell line from laryngeal carcinoma patient

    Directory of Open Access Journals (Sweden)

    Yamin Zhang

    2017-12-01

    Full Text Available Skin fibroblasts and tumor fibroblasts were extracted from a 64-year old male patient clinically diagnosed with laryngeal carcinoma. Control and tumor specific induced pluripotent stem cells were reprogrammed with 5 reprogramming factors, Klf-4, c-Myc, Oct-4, Sox-2, and Lin-28, using the messenger RNA reprogramming system. The transgene-free iPSC lines showed pluripotency, confirmed by immunofluorescence staining. The iPSC lines also showed normal karyotype, and could form embryoid bodies in vitro and differentiate into the 3 germ layers in vivo. This in vitro cellular model can be used to study the oncogenesis and pathogenesis of laryngeal carcinoma.

  11. Germ killing by ultraviolet radiation

    International Nuclear Information System (INIS)

    Wawrik, O.

    1975-01-01

    Short-wave UV radiation, in particular the range about 250 nm, has a high germ reducing effect. Corresponding UV burners which above all emit radiation at the line of 254 nm can therefore be used effectively in all cases where the least possible content of germs in the air is aimed at. Apart from this it is also possible to reduce by this process the germs on surfaces and liquids. Especially in the most various ranges of pharmaceutical production one is steadily striving for efficient and last not least economic procedures by which it is possible to reduce the germs present in the air of a room. Numerous scientific investigations have sufficiently proved that short-wave UV radiation is extremely well appropriate for such purposes. Absolutely germ-free air in a room can only be obtained under laboratory conditions. In practice, however, the aim is not to achieve a 100 per cent killing of the germs present in a room but to make sure that the germ rate in certain rooms is constantly reduced to the lowest possible level. If in this connection it is referred to a germ reduction of 100 or 99 per cent this is but theory. (orig.) [de

  12. A potential germ cell-specific marker in Japanese flounder, Paralichthys olivaceus: identification and characterization of lymphocyte antigen 75 (Ly75/CD205)

    Science.gov (United States)

    Yang, Yang; Liu, Qinghua; Ma, Daoyuan; Song, Zongchen; Li, Jun

    2018-04-01

    Some germ cell marker genes, such as vasa, nanos, and dead end (dnd), have been identified in fish. Recently, lymphocyte antigen 75 (Ly75/CD205) has been identified as a mitotic germ cell-specific cell-surface marker in several fish species. In this study, the Japanese flounder ly75 homolog (ly75) was cloned and its expression pattern in gonads was analyzed. The full-length cDNA of ly75 was 7 346 bp, with an open reading frame (ORF) of 5 229 bp. The ORF encoded a protein containing 1 742 amino acids with a predicted molecular mass of 196.89 kDa. In adult tissues, ly75 transcripts were detected in all analyzed tissues but abundantly in the testis. In in-situ hybridization analyses, ly75 mRNA was predominantly localized in oocytes in the ovary and spermatogonia in the testis, but ly75 mRNA was not detected in oogonia, spermatocytes, spermatids, or spermatozoa. These results indicated that ly75 could be a potential germ cell-specific marker in P. olivaceus, as in other fishes.

  13. Towards a non-invasive method for early detection of testicular neoplasia in semen samples by identification of fetal germ cell-specific markers

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Carlsen, E; Jorgensen, N

    2007-01-01

    /gonocyte markers is presented. METHODS: Immunocytological staining for AP-2gamma [and in some cases, OCT-3/4, NANOG or placental alkaline phosphatase (PLAP)] was performed in semen samples from 294 infertile patients and 209 patients with TGCTs or other diseases. RESULTS: Presence of AP-2gamma-stained cells...... but reduced in participants with overt TGCTs, perhaps because of obstruction. Assay specificity was 93.6%, positive predictive value (PPV) 83.3% and negative predictive value (NPV) 60.3%. CONCLUSIONS: Immunocytological semen analysis based on expression of fetal germ cell markers in exfoliated cells has...

  14. Influence of vitamin D on cisplatin sensitivity in testicular germ cell cancer-derived cell lines and in a NTera2 xenograft model

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Blomberg Jensen, Martin; Nielsen, John Erik

    2013-01-01

    The active form of vitamin D, 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) has anti-proliferative, pro-apoptotic, and pro-differentiating effects in somatic cancer cells in vitro and in vivo. 1,25(OH)(2)D(3) also augments the anti-tumor effects of several chemotherapeutic agents, including...... cisplatin, which may have clinical relevance. Given the pro-differentiation effect of vitamin D recently demonstrated in testicular germ cell tumors (TGCTs), we hypothesized that 1,25(OH)(2)D(3) could be a beneficial adjunctive to existing chemotherapy regime used to treat these tumors. In this study, cell...... survival effects of 1,25(OH)(2)D(3), another pro-differentiation compound, retinoic acid and cisplatin were investigated in TGCT-derived cell lines in vitro. 1,25(OH)(2)D(3) augmented the effect of cisplatin in an embryonal carcinoma-derived cell line (NTera2), possibly through downregulation...

  15. Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

    Science.gov (United States)

    Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

    2017-03-15

    The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Stage-specific damage to synaptonemal complexes and metaphase chromosomes induced by X rays in male mouse germ cells

    International Nuclear Information System (INIS)

    Backer, L.C.; Sontag, M.R.; Allen, J.W.

    1991-01-01

    Synaptonemal complexes (SCs) reveal mutagen-induced effects in germ cell meiotic chromosomes. The study was aimed at characterizing relationships between SC and metaphase I chromosome damage following radiation exposure at various stages of spermatogenesis. Male mice were irradiated with doses of 0, 2, or 4 Gy, and spermatocytes were harvested at times consistent with earlier exposures as spermatogonial stem cells, preleptotene cells (premeiotic DNA synthesis), or meiotic prophase cells. After stem-cell exposure, twice as many rearrangements were observed in SCs as in metaphase I chromosomes. Irradiation during premeiotic DNA synthesis resulted in dose-related increases in SC breakage and rearrangements (including novel forms) and in metaphase chromosomal aberrations. Following prophase exposure, various types and levels of SC and metaphase damage were observed. Irradiation of zygotene cells led to high frequencies of chromosome multivalents in metaphase I without a correspondingly high level of damage in preceding prophase SCs. Thus, irradiation of premeiotic and meiotic cells results in variable relationships between SC and metaphase chromosome damage

  17. Breast cancer in patients carrying a germ-line CHEK2 mutation: Outcome after breast conserving surgery and adjuvant radiotherapy

    International Nuclear Information System (INIS)

    Meyer, Andreas; Doerk, Thilo; Sohn, Christof; Karstens, Johann H.; Bremer, Michael

    2007-01-01

    Background and purpose: Women carrying mutations in the CHEK2 gene are at an increased breast cancer risk. Data about outcome and prognosis for these patients after standard multimodality treatment are scarce at present. Materials and methods: One-hundred and fifty (150) patients with non-metastasized early-stage breast cancer (T1-2) receiving postoperative radiotherapy following breast-conservative surgery at our department were included in this analysis. Carriers were identified using mutation-specific restriction enzyme-based screening assays in previous investigations. Twenty-five breast cancer patients were heterozygous for one of three CHEK2 gene mutations (I157T, n = 13; 1100delC, n = 10; IVS2+1G > A, n = 2). The comparison group consisted of 125 early-stage breast cancer patients without a CHEK2 gene mutation (non-carriers). Median follow-up was 87 months for the total cohort of patients. Results: Local recurrences occurred in 13 patients (carriers, 3 (12%); non-carriers, 10 (8%)) and distant metastases occurred in 27 patients (carriers, 8 (32%); non-carriers, 19 (15%)). Twenty-five patients had deceased (carriers, 8 (32%); non-carriers, 17 (14%)) with all but 3 deaths related to breast cancer. Actuarial 7-year local relapse-free survival was 86% in carriers versus 90% in non-carriers (p = 0.48). Actuarial metastasis-free, disease-free and overall survival at 7 years were 64% vs. 84% (p = 0.045), 59% vs. 78% (p = 0.07) and 69% vs. 87% (p = 0.10), respectively. In a multivariate step-wise Cox regression analysis presence of a CHEK2 mutation remained a borderline significant discriminator for metastasis-free survival (p = 0.048; OR = 0.4; 95% CI 0.2-1.0) next to T-stage (p = 0.001; OR 0.3; 95% CI 0.1-0.6). Conclusions: Heterozygosity for a germline CHEK2 mutation appears to represent an adverse prognostic factor in patients with early-stage breast cancer. If confirmed in larger studies these data may serve as a basis for future surveillance and treatment

  18. Germ Cell-less Promotes Centrosome Segregation to Induce Germ Cell Formation

    Directory of Open Access Journals (Sweden)

    Dorothy A. Lerit

    2017-01-01

    Full Text Available The primordial germ cells (PGCs specified during embryogenesis serve as progenitors to the adult germline stem cells. In Drosophila, the proper specification and formation of PGCs require both centrosomes and germ plasm, which contains the germline determinants. Centrosomes are microtubule (MT-organizing centers that ensure the faithful segregation of germ plasm into PGCs. To date, mechanisms that modulate centrosome behavior to engineer PGC development have remained elusive. Only one germ plasm component, Germ cell-less (Gcl, is known to play a role in PGC formation. Here, we show that Gcl engineers PGC formation by regulating centrosome dynamics. Loss of gcl leads to aberrant centrosome separation and elaboration of the astral MT network, resulting in inefficient germ plasm segregation and aborted PGC cellularization. Importantly, compromising centrosome separation alone is sufficient to mimic the gcl loss-of-function phenotypes. We conclude Gcl functions as a key regulator of centrosome separation required for proper PGC development.

  19. Epigenetic features of testicular germ cell tumours in relation to epigenetic characteristics of foetal germ cells

    DEFF Research Database (Denmark)

    Kristensen, Dina Graae; Skakkebæk, Niels E; Rajpert-De Meyts, Ewa

    2013-01-01

    in humans. However, the common precursor of testicular cancers- the carcinoma in situ (CIS) cell- is thought to be an arrested foetal germ cell. Therefore studies of CIS cells may leverage information on human foetal germ cell development and, in particular, when neoplastic transformation is initiated....... In this review, we will focus on current knowledge of the epigenetics of CIS cells and relate it to the epigenetic changes occurring in early developing germ cells of mice during specification, migration and colonization. We will focus on DNA methylation and some of the best studied histone modifications like H3...... event in the initiation of testicular germ cell cancer. Even though only sparse information is available on epigenetic cues in human foetal germ cells, these indicate that the developmental patterns differ from the findings in mice and emphasize the need for further studies of foetal germ cell...

  20. Male and female rat bone marrow-derived mesenchymal stem cells are different in terms of the expression of germ cell specific genes.

    Science.gov (United States)

    Ghasemzadeh-Hasankolaei, Mohammad; Eslaminejad, Mohammadreza Baghaban; Batavani, Roozali; Ghasemzadeh-Hasankolaei, Maryam

    2015-06-01

    Recent studies have shown that mesenchymal stem cells (MSCs), under appropriate conditions, can differentiate into cell types including germ cells (GCs). These studies also show that MSCs without any induction express some GC-specific genes innately. Moreover, one report suggests that female MSCs have a greater tendency to differentiate into female instead of male GCs. Therefore, for the first time, this study attempts to assay and determine the differences between the expression levels of some important GC-specific genes (Stra8, Vasa, Dazl, Stella, Piwil2, Oct4, Fragilis, Rnf17 and c-Kit) in male and female bone marrow (BM)-MSCs of rats. BM sampling of the rate was performed by a newly established method. We cultured rat BM samples, then characterized male and female MSCs according to their adhesion onto the culture dish, their differentiation potential into bone, cartilage and fat cells, and phenotype analysis by flow cytometry. The expression of GC-specific genes and their expression levels were evaluated with reverse transcription polymerase chain reaction (RT-PCR) and real-time RT-PCR. Our results showed that Dazl and Rnf17 did not express in the cells. The majority of examined genes, except Piwil2, expressed at almost the same levels in male and female MSCs. Piwil2 had higher expression in male MSCs which was probably related to the more prominent role of Piwil2 in the male GC development process. Male BM-MSCs appeared more prone to differentiate into male rather than female GCs. Additional research should be performed to determine the exact role of different genes in the male and female GC development process.

  1. Human-specific subcellular compartmentalization of P-element induced wimpy testis-like (PIWIL) granules during germ cell development and spermatogenesis.

    Science.gov (United States)

    Gomes Fernandes, Maria; He, Nannan; Wang, Fang; Van Iperen, Liesbeth; Eguizabal, Cristina; Matorras, Roberto; Roelen, Bernard A J; Chuva De Sousa Lopes, Susana M

    2018-02-01

    What is the dynamics of expression of P-element induced wimpy testis-like (PIWIL) proteins in the germline during human fetal development and spermatogenesis? PIWIL1, PIWIL2, PIWIL3 and PIWIL4 were expressed in a sex-specific fashion in human germ cells (GC) during development and adulthood. PIWILs showed a mutually exclusive pattern of subcellular localization. PIWILs were present in the intermitochondrial cement and a single large granule in meiotic GC and their expression was different from that observed in mice, highlighting species-differences. In mice, PIWIL proteins play prominent roles in male infertility. PIWIL mouse mutants show either post-meiotic arrest at the round spermatid stage (PIWIL1) or arrest at the zygotene-pachytene stage of meiosis I (PIWIL2 and PIWIL4) in males, while females remain fertile. Recent studies have reported a robust piRNA pool in human fetal ovary. This is a qualitative analysis of PIWILs expression in paraffin-embedded fetal human male (N = 8), female gonads (N = 6) and adult testes (N = 5), and bioinformatics analysis of online available single-cell transcriptomics data of human fetal germ cells (n = 242). Human fetal gonads from elective abortion without medical indication and adult testes biopsies were donated for research with informed consent. Samples were fixed, paraffin-embedded and analyzed by immunofluorescence to study the temporal and cellular localization of PIWIL1, PIWIL2, PIWIL3 and PIWIL4. PIWIL1, PIWIL2 and PIWIL4 showed a mutually exclusive pattern of subcellular localization, particularly in female oocytes. To our surprise, PIWIL1 immunostaining revealed the presence of a single dense paranuclear body, resembling the chromatoid body of haploid spermatocytes, in meiotic oocytes. Moreover, in contrast to mice, PIWIL4, but not PIWIL2, localized to the intermitochondrial cement. PIWIL3 was not expressed in GC during development. The upregulation of PIWIL transcripts correlated with the transcription of markers

  2. Concept for Specific Lines of Business, Energy Saving Tourism

    International Nuclear Information System (INIS)

    Jilek, W.

    1998-01-01

    In the spirit of the objectives of the Energy Plan 1995 in order to make more efficient use of energy and thus to reduce energy requirements, to promote the use of renewable energies, and to attach maximum importance to the ecological compatibility of the energy systems, among other project the provincial government of Styria is pursuing the option of consulting small and medium-sized enterprises in a target manner. Three years after being launched, this Ecological Company Consulting scheme for various lines of business is now producing successful results, demonstrating that energy saving, business profit and ecology can go hand in hand by example of numerous pilot projects. Trade-specific concepts have been elaborated for foodstuffs, carpenters and car repair and sales firms, bakeries and hairdressers and, most recently, for tourist industry business /hotels, bars, restaurants, etc.). The province of Styria, represented by the Energy Commissioner and the department of waste management, is co-operating closely in the Ecological Company Consulting scheme with the Styrian Chamber of Commerce and the Economy Promotion Institute (Wirtschaftsfoerderungsinstitut). In several cases, other provinces, the Federal Ministry of Environmental, Youth and Family Affairs, and the Federal Chamber of Commerce have adopted the results of this co-operation, while in some cases subsidy schemes are linked to these trade-specific concepts. In the course of the scheme, the aim is to investigate energy requirements, saving potentials and questions of waste management. (author)

  3. New evidence for the origin of intracranial germ cell tumours from primordial germ cells

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Sehested, A; Juhler, M

    2006-01-01

    that it is not required for the initiation of malignant germ cell transformation. The expression of genes associated with embryonic stem cell pluripotency in CNS germ cell tumours strongly suggests that these tumours are derived from cells that retain, at least partially, an embryonic stem cell-like phenotype, which...... germ cell tumours and analysed expression of a wide panel of stem cell-related proteins (C-KIT, OCT-3/4 (POU5F1), AP-2gamma (TFAP2C), and NANOG) and developmentally regulated germ cell-specific proteins (including MAGE-A4, NY-ESO-1, and TSPY). Expression at the protein level was analysed in 21 children...... and young adults with intracranial germinomas and non-germinomas, contributing to a careful description of these unusual tumours and adding to the understanding of pathogenesis. Stem cell related proteins were highly expressed in intracranial germ cell tumours, and many similarities were detected...

  4. Molecular biological features of male germ cell differentiation

    Science.gov (United States)

    HIROSE, MIKA; TOKUHIRO, KEIZO; TAINAKA, HITOSHI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2007-01-01

    Somatic cell differentiation is required throughout the life of a multicellular organism to maintain homeostasis. In contrast, germ cells have only one specific function; to preserve the species by conveying the parental genes to the next generation. Recent studies of the development and molecular biology of the male germ cell have identified many genes, or isoforms, that are specifically expressed in the male germ cell. In the present review, we consider the unique features of male germ cell differentiation. (Reprod Med Biol 2007; 6: 1–9) PMID:29699260

  5. Differential Nanos 2 protein stability results in selective germ cell accumulation in the sea urchin.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2016-10-01

    Nanos is a translational regulator required for the survival and maintenance of primordial germ cells. In the sea urchin, Strongylocentrotus purpuratus (Sp), Nanos 2 mRNA is broadly transcribed but accumulates specifically in the small micromere (sMic) lineage, in part because of the 3'UTR element GNARLE leads to turnover in somatic cells but retention in the sMics. Here we found that the Nanos 2 protein is also selectively stabilized; it is initially translated throughout the embryo but turned over in the future somatic cells and retained only in the sMics, the future germ line in this animal. This differential stability of Nanos protein is dependent on the open reading frame (ORF), and is independent of the sumoylation and ubiquitylation pathways. Manipulation of the ORF indicates that 68 amino acids in the N terminus of the Nanos protein are essential for its stability in the sMics whereas a 45 amino acid element adjacent to the zinc fingers targets its degradation. Further, this regulation of Nanos protein is cell autonomous, following formation of the germ line. These results are paradigmatic for the unique presence of Nanos in the germ line by a combination of selective RNA retention, distinctive translational control mechanisms (Oulhen et al., 2013), and now also by defined Nanos protein stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. On the development of extragonadal and gonadal human germ cells

    Directory of Open Access Journals (Sweden)

    A. Marijne Heeren

    2016-02-01

    Full Text Available Human germ cells originate in an extragonadal location and have to migrate to colonize the gonadal primordia at around seven weeks of gestation (W7, or five weeks post conception. Many germ cells are lost along the way and should enter apoptosis, but some escape and can give rise to extragonadal germ cell tumors. Due to the common somatic origin of gonads and adrenal cortex, we investigated whether ectopic germ cells were present in the human adrenals. Germ cells expressing DDX4 and/or POU5F1 were present in male and female human adrenals in the first and second trimester. However, in contrast to what has been described in mice, where ‘adrenal’ and ‘ovarian’ germ cells seem to enter meiosis in synchrony, we were unable to observe meiotic entry in human ‘adrenal’ germ cells until W22. By contrast, ‘ovarian’ germ cells at W22 showed a pronounced asynchronous meiotic entry. Interestingly, we observed that immature POU5F1+ germ cells in both first and second trimester ovaries still expressed the neural crest marker TUBB3, reminiscent of their migratory phase. Our findings highlight species-specific differences in early gametogenesis between mice and humans. We report the presence of a population of ectopic germ cells in the human adrenals during development.

  7. The genome of the Hi5 germ cell line from Trichoplusia ni, an agricultural pest and novel model for small RNA biology.

    Science.gov (United States)

    Fu, Yu; Yang, Yujing; Zhang, Han; Farley, Gwen; Wang, Junling; Quarles, Kaycee A; Weng, Zhiping; Zamore, Phillip D

    2018-01-29

    We report a draft assembly of the genome of Hi5 cells from the lepidopteran insect pest, Trichoplusia ni , assigning 90.6% of bases to one of 28 chromosomes and predicting 14,037 protein-coding genes. Chemoreception and detoxification gene families reveal T. ni -specific gene expansions that may explain its widespread distribution and rapid adaptation to insecticides. Transcriptome and small RNA data from thorax, ovary, testis, and the germline-derived Hi5 cell line show distinct expression profiles for 295 microRNA- and >393 piRNA-producing loci, as well as 39 genes encoding small RNA pathway proteins. Nearly all of the W chromosome is devoted to piRNA production, and T. ni siRNAs are not 2´- O -methylated. To enable use of Hi5 cells as a model system, we have established genome editing and single-cell cloning protocols. The T. ni genome provides insights into pest control and allows Hi5 cells to become a new tool for studying small RNAs ex vivo. © 2018, Fu et al.

  8. Extragonadal Germ Cell Cancer (EGC)

    Science.gov (United States)

    The Testicular Cancer Resource Center Extragonadal Germ Cell Cancer (EGC) 95% of all testicular tumors are germ cell tumors. That is, the tumors originate in the sperm forming cells in the testicles ( ...

  9. AiGERM: A logic programming front end for GERM

    Science.gov (United States)

    Hashim, Safaa H.

    1990-01-01

    AiGerm (Artificially Intelligent Graphical Entity Relation Modeler) is a relational data base query and programming language front end for MCC (Mission Control Center)/STP's (Space Test Program) Germ (Graphical Entity Relational Modeling) system. It is intended as an add-on component of the Germ system to be used for navigating very large networks of information. It can also function as an expert system shell for prototyping knowledge-based systems. AiGerm provides an interface between the programming language and Germ.

  10. Guns, Germs and Steel

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 1. Guns, Germs and Steel - A Short History of Everybody for the Last 13,000 years. Suri Venkatachalam. Book Review Volume 6 Issue 1 January 2001 pp 84-88. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. Foodborne Germs and Illnesses

    Science.gov (United States)

    ... Español (Spanish) Recommend on Facebook Tweet Share Compartir What Causes Food Poisoning? Many different disease-causing germs can contaminate ... email address: Enter Email Address What’s this? Submit What's this? Submit Button ... of Foodborne Illness in the U.S. Food Safety is a CDC Winnable Battle Foodborne Illness ...

  12. [Germ cell membrane lipids in spermatogenesis].

    Science.gov (United States)

    Wang, Ting; Shi, Xiao; Quan, Song

    2016-05-01

    Spermatogenesis is a complex developmental process in which a diploid progenitor germ cell transforms into highly specialized spermatozoa. During spermatogenesis, membrane remodeling takes place, and cell membrane permeability and liquidity undergo phase-specific changes, which are all associated with the alteration of membrane lipids. Lipids are important components of the germ cell membrane, whose volume and ratio fluctuate in different phases of spermatogenesis. Abnormal lipid metabolism can cause spermatogenic dysfunction and consequently male infertility. Germ cell membrane lipids are mainly composed of cholesterol, phospholipids and glycolipids, which play critical roles in cell adhesion and signal transduction during spermatogenesis. An insight into the correlation of membrane lipids with spermatogenesis helps us to better understand the mechanisms of spermatogenesis and provide new approaches to the diagnosis and treatment of male infertility.

  13. GAGE cancer-germline antigens are recruited to the nuclear envelope by germ cell-less (GCL)

    DEFF Research Database (Denmark)

    Gjerstorff, Morten F; Rösner, Heike I; Pedersen, Christina B

    2012-01-01

    GAGE proteins are highly similar, primate-specific molecules with unique primary structure and undefined cellular roles. They are restricted to cells of the germ line in adult healthy individuals, but are broadly expressed in a wide range of cancers. In a yeast two-hybrid screen we identified the...... different dsDNA fragments, suggesting sequence-nonspecific binding. Dual association of GAGE family members with GCL at the nuclear envelope inner membrane in cells, and with dsDNA in vitro, implicate GAGE proteins in chromatin regulation in germ cells and cancer cells....... the metazoan transcriptional regulator, Germ cell-less (GCL), as an interaction partner of GAGE12I. GCL directly binds LEM-domain proteins (LAP2β, emerin, MAN1) at the nuclear envelope, and we found that GAGE proteins were recruited to the nuclear envelope inner membrane by GCL. Based on yeast two...

  14. Future plans for the MP line (Both general and specific)

    International Nuclear Information System (INIS)

    Underwood, D.G.

    1988-01-01

    This talk consists of three sections. Topics range from suggestions of possible physics, which are presented to provoke thought and discussion about the distant future, to specific goals of E-704 for the next running period. The sections are on physics issues, possible upgrades of the beam and experimental apparatus, and goals for the next running period. 4 refs., 5 figs

  15. Establishment of cell lines with rat spermatogonial stem cell characteristics

    NARCIS (Netherlands)

    van Pelt, Ans M. M.; Roepers-Gajadien, Hermien L.; Gademan, Iris S.; Creemers, Laura B.; de Rooij, Dirk G.; van Dissel-Emiliani, Federica M. F.

    2002-01-01

    Spermatogonial cell lines were established by transfecting a mixed population of purified rat A(s) (stem cells), A(pr) and A(al) spermatogonia with SV40 large T antigen. Two cell lines were characterized and found to express Hsp90alpha and oct-4, specific markers for germ cells and A spermatogonia,

  16. Neurl4 contributes to germ cell formation and integrity in Drosophila

    Directory of Open Access Journals (Sweden)

    Jennifer Jones

    2015-08-01

    Full Text Available Primordial germ cells (PGCs form at the posterior pole of the Drosophila embryo, and then migrate to their final destination in the gonad where they will produce eggs or sperm. Studies of the different stages in this process, including assembly of germ plasm in the oocyte during oogenesis, specification of a subset of syncytial embryonic nuclei as PGCs, and migration, have been informed by genetic analyses. Mutants have defined steps in the process, and the identities of the affected genes have suggested biochemical mechanisms. Here we describe a novel PGC phenotype. When Neurl4 activity is reduced, newly formed PGCs frequently adopt irregular shapes and appear to bud off vesicles. PGC number is also reduced, an effect exacerbated by a separate role for Neurl4 in germ plasm formation during oogenesis. Like its mammalian homolog, Drosophila Neurl4 protein is concentrated in centrosomes and downregulates centrosomal protein CP110. Reducing CP110 activity suppresses the abnormal PGC morphology of Neurl4 mutants. These results extend prior analyses of Neurl4 in cultured cells, revealing a heightened requirement for Neurl4 in germ-line cells in Drosophila.

  17. A role for Lin28 in primordial germ cell development and germ cell malignancy

    Science.gov (United States)

    West, Jason A.; Viswanathan, Srinivas R.; Yabuuchi, Akiko; Cunniff, Kerianne; Takeuchi, Ayumu; Park, In-Hyun; Sero, Julia E.; Zhu, Hao; Perez-Atayde, Antonio; Frazier, A. Lindsay; Surani, M. Azim; Daley, George Q.

    2009-01-01

    The rarity and inaccessibility of the earliest primordial germ cells (PGCs) in the mouse embryo thwarts efforts to investigate molecular mechanisms of germ cell specification. Stella marks the minute founder population of the germ lineage1,2. Here we differentiate mouse embryonic stem cells (ESCs) carrying a Stella transgenic reporter into putative PGCs in vitro. The Stella+ cells possess a transcriptional profile similar to embryo-derived PGCs, and like their counterparts in vivo, lose imprints in a time-dependent manner. Using inhibitory RNAs to screen candidate genes for effects on the development of Stella+ cells in vitro, we discovered that Lin28, a negative regulator of let-7 microRNA processing3-6, is essential for proper PGC development. We further show that Blimp1, a let-7 target and a master regulator of PGC specification7-9, can rescue the effect of Lin28-deficiency during PGC development, thereby establishing a mechanism of action for Lin28 during PGC specification. Over-expression of Lin28 promotes formation of Stella+ cells in vitro and PGCs in chimeric embryos, and is associated with human germ cell tumours. The differentiation of putative PGCs from ESCs in vitro recapitulates the early stages of gamete development in vivo, and provides an accessible system for discovering novel genes involved in germ cell development and malignancy. PMID:19578360

  18. A phase II single institution single arm prospective study with paclitaxel, ifosfamide and cisplatin (TIP) as first-line chemotherapy in high-risk germ cell tumor patients with more than ten years follow-up and retrospective correlation with ERCC1, Topoisomerase 1, 2A, p53 and HER-2 expression.

    Science.gov (United States)

    Ligia Cebotaru, Cristina; Zenovia Antone, Nicoleta; Diana Olteanu, Elena; Bejinariu, Nona; Buiga, Rares; Todor, Nicolae; Ioana Iancu, Dana; Eliade Ciuleanu, Tudor; Nagy, Viorica

    2016-01-01

    One half of high-risk germ cell tumor (HRGCT) patients relapse after standard chemotherapy. This phase II study evaluated prospectively the toxicity and efficacy in first-line of the paclitaxel-ifosfamide-cisplatin combination (TIP) in HRGCT patients and tried to identify biomarkers that may allow patient-tailored treatments. Between October 1997- September 2000, 28 chemo-naive HRGCT patients were enrolled. Patients received 4 cycles of TIP (paclitaxel 175 mg/m(2) day 1/; ifosfamide 1.2 g/m(2)/day, days 1-5; Mesna 1.2 g/m(2)/day, days 1-5; and cisplatin 20 mg/m(2)/day, days 1-5 every 3 weeks). A non-randomized comparison was made between HRGCT patients treated in the same period with first-line TIP and bleomycin-etoposide-cisplatin (BEP) (28 patients vs 20). In 17 HRGCT patients treated between 1998-2006, ERCC1, Topoisomerase 1 and 2A, p53 and HER-2 expression was retrospectively analysed by immunohistochemistry (IHC) (7 patients with TIP, 10 with BEP), and correlations were made with response to chemotherapy and survival. With a median follow-up of 72 months [range 48+...89+], 5-year disease free survival (DFS) was 55%, with 95% CI 36-72, and the overall survival (OS) was 63%, with 95% CI 44-78. In June 2015, with a median follow-up of 196.47 months (range 177.30-209.27) (>15 years), 12 [%?] patients were alive and disease-free, and 16 [%?] had died (12 specific causes). There was no significant correlation between the expression of ERCC1, Topoisomerase 1 and 2A, HER-2 and p53 and response to treatment. Long-term follow-up showed no difference in OS between TIP vs BEP as first-line therapy. Both regimens had mild toxicity.

  19. Great migration: epigenetic reprogramming and germ cell-oocyte metamorphosis determine individual ovarian reserve.

    Science.gov (United States)

    Celik, Onder; Aygun, Banu Kumbak; Celik, Nilufer; Aydin, Suleyman; Haberal, Esra Tustas; Sahin, Levent; Yavuz, Yasemin; Celik, Sudenaz

    2016-01-01

    Emigration is defined as a synchronized movement of germ cells between the yolk sack and genital ridges. The miraculous migration of germ cells resembles the remigration of salmon traveling from one habitat to other. This migration of germ cells is indispensible for the development of new generations. It is not, however, clear why germ cells differentiate during migration but not at the place of origin. In order to escape harmful somatic signals which might disturb the proper establishment of germ cells forced germ cell migration may be necessary. Another reason may be to benefit from the opportunities of new habitats. Therefore, emigration may have powerful effects on the population dynamics of the immigrant germ cells. While some of these cells do reach their target, some others die or reach to wrong targets. Only germ cell precursors with genetically, and structurally powerful can reach their target. Likewise, epigenetic reprogramming in both migratory and post-migratory germ cells is essential for the establishment of totipotency. During this journey some germ cells may sacrifice themselves for the goodness of the others. The number and quality of germ cells reaching the genital ridge may vary depending on the problems encountered during migration. If the aim in germ cell specification is to provide an optimal ovarian reserve for the continuity of the generation, then this cascade of events cannot be only accomplished at the same level for every one but also are manifested by several outcomes. This is significant evidence supporting the possibility of unique individual ovarian reserve.

  20. Homozygous germ-line mutation of the PMS2 mismatch repair gene: a unique case report of constitutional mismatch repair deficiency (CMMRD).

    Science.gov (United States)

    Ramchander, N C; Ryan, N A J; Crosbie, E J; Evans, D G

    2017-04-05

    deficiency syndrome should be considered in patients who present with early onset cancer, a strong family history of cancer, and cutaneous features resembling neurofibromatosis type I. Immunohistochemistry analysis of tumour and normal tissue is sensitive and specific for identifying patients with mismatch repair deficiency and should direct DNA sequencing of lymphocytic tissue to establish a diagnosis. Microsatellite instability status appears to be of little value in identifying patients who may have constitutional mismatch repair deficiency syndrome.

  1. Insights into the binding specificity of wild type and mutated wheat germ agglutinin towards Neu5Acα(2-3)Gal: a study by in silico mutations and molecular dynamics simulations.

    Science.gov (United States)

    Parasuraman, Ponnusamy; Murugan, Veeramani; Selvin, Jeyasigamani F A; Gromiha, M Michael; Fukui, Kazuhiko; Veluraja, Kasinadar

    2014-08-01

    Wheat germ agglutinin (WGA) is a plant lectin, which specifically recognizes the sugars NeuNAc and GlcNAc. Mutated WGA with enhanced binding specificity can be used as biomarkers for cancer. In silico mutations are performed at the active site of WGA to enhance the binding specificity towards sialylglycans, and molecular dynamics simulations of 20 ns are carried out for wild type and mutated WGAs (WGA1, WGA2, and WGA3) in complex with sialylgalactose to examine the change in binding specificity. MD simulations reveal the change in binding specificity of wild type and mutated WGAs towards sialylgalactose and bound conformational flexibility of sialylgalactose. The mutated polar amino acid residues Asn114 (S114N), Lys118 (G118K), and Arg118 (G118R) make direct and water mediated hydrogen bonds and hydrophobic interactions with sialylgalactose. An analysis of possible hydrogen bonds, hydrophobic interactions, total pair wise interaction energy between active site residues and sialylgalactose and MM-PBSA free energy calculation reveals the plausible binding modes and the role of water in stabilizing different binding modes. An interesting observation is that the binding specificity of mutated WGAs (cyborg lectin) towards sialylgalactose is found to be higher in double point mutation (WGA3). One of the substituted residues Arg118 plays a crucial role in sugar binding. Based on the interactions and energy calculations, it is concluded that the order of binding specificity of WGAs towards sialylgalactose is WGA3 > WGA1 > WGA2 > WGA. On comparing with the wild type, double point mutated WGA (WGA3) exhibits increased specificity towards sialylgalactose, and thus, it can be effectively used in targeted drug delivery and as biological cell marker in cancer therapeutics. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Pathway-specific differences between tumor cell lines and normal and tumor tissue cells

    Directory of Open Access Journals (Sweden)

    Tozeren Aydin

    2006-11-01

    Full Text Available Abstract Background Cell lines are used in experimental investigation of cancer but their capacity to represent tumor cells has yet to be quantified. The aim of the study was to identify significant alterations in pathway usage in cell lines in comparison with normal and tumor tissue. Methods This study utilized a pathway-specific enrichment analysis of publicly accessible microarray data and quantified the gene expression differences between cell lines, tumor, and normal tissue cells for six different tissue types. KEGG pathways that are significantly different between cell lines and tumors, cell lines and normal tissues and tumor and normal tissue were identified through enrichment tests on gene lists obtained using Significance Analysis of Microarrays (SAM. Results Cellular pathways that were significantly upregulated in cell lines compared to tumor cells and normal cells of the same tissue type included ATP synthesis, cell communication, cell cycle, oxidative phosphorylation, purine, pyrimidine and pyruvate metabolism, and proteasome. Results on metabolic pathways suggested an increase in the velocity nucleotide metabolism and RNA production. Pathways that were downregulated in cell lines compared to tumor and normal tissue included cell communication, cell adhesion molecules (CAMs, and ECM-receptor interaction. Only a fraction of the significantly altered genes in tumor-to-normal comparison had similar expressions in cancer cell lines and tumor cells. These genes were tissue-specific and were distributed sparsely among multiple pathways. Conclusion Significantly altered genes in tumors compared to normal tissue were largely tissue specific. Among these genes downregulation was a major trend. In contrast, cell lines contained large sets of significantly upregulated genes that were common to multiple tissue types. Pathway upregulation in cell lines was most pronounced over metabolic pathways including cell nucleotide metabolism and oxidative

  3. Diagnostic markers for germ cell neoplasms

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, Ewa; Nielsen, John E; Skakkebaek, Niels E

    2015-01-01

    This concise review summarises tissue and serum markers useful for differential diagnosis of germ cell tumours (GCTs), with focus on the most common testicular GCTs (TGCTs). GCTs are characterised by phenotypic heterogeneity due to largely retained embryonic pluripotency and aberrant somatic diff...... of molecular markers, which allow specific diagnosis of various subtypes of GCT and are very useful for early detection at the precursor stage and for monitoring of patients during the follow-up....

  4. Production of prostate-specific antigen by a breast cancer cell line, Sk-Br-3

    International Nuclear Information System (INIS)

    Kamali Sarvestani, E.; Ghaderi, A.

    2002-01-01

    Prostate-specific antigen is a 33-KDa serine protease that is produced predominantly by prostate epithelium. However, it has been shown that about 30-40% of female breast tumors produce prostate-specific antigen and its production is associated with the presence of estrogen and progesterone receptors. We have now developed a new tissue culture system to study prostate-specific antigen production in breast cancer and its association with prognostic factors such as progesterone receptor and c-erbB-2. For this purpose we investigated the ability of prostate-specific antigen production in five different cell lines, including two breast cancer cell lines, Sk-Br-3 and MDA-MB-453. The prostate-specific antigen in tissue culture supernatant and cytoplasm of the Sk-Br-3 cell line was detected by western blotting and immunoperoxidase, respectively. Furthermore, we found lower expression of c-erbB-2 in Sk-Br-3 than non-prostate-specific antigen producer breast cancer cell line, MDA-MB-453. Progesterone receptor was expressed by both prostate-specific antigen-positive and -negative cell lines and only the intensity of staining and the number of positive cells in Sk-Br-3 population was higher than MDA-MB-453. According to our findings prostate-specific antigen can be considered as a good prognostic factor in breast cancer and we suggest that these two cell lines are a good in vitro model to study the relationship of different breast cancer prognostic factors and their regulations

  5. Male Hypogonadism and Germ Cell Loss Caused by a Mutation in Polo-Like Kinase 4

    Science.gov (United States)

    Harris, Rebecca M.; Weiss, Jeffrey

    2011-01-01

    The genetic etiologies of male infertility remain largely unknown. To identify genes potentially involved in spermatogenesis and male infertility, we performed genome-wide mutagenesis in mice with N-ethyl-N-nitrosourea and identified a line with dominant hypogonadism and patchy germ cell loss. Genomic mapping and DNA sequence analysis identified a novel heterozygous missense mutation in the kinase domain of Polo-like kinase 4 (Plk4), altering an isoleucine to asparagine at residue 242 (I242N). Genetic complementation studies using a gene trap line with disruption in the Plk4 locus confirmed that the putative Plk4 missense mutation was causative. Plk4 is known to be involved in centriole formation and cell cycle progression. However, a specific role in mammalian spermatogenesis has not been examined. PLK4 was highly expressed in the testes both pre- and postnatally. In the adult, PLK4 expression was first detected in stage VIII pachytene spermatocytes and was present through step 16 elongated spermatids. Because the homozygous Plk4I242N/I242N mutation was embryonic lethal, all analyses were performed using the heterozygous Plk4+/I242N mice. Testis size was reduced by 17%, and histology revealed discrete regions of germ cell loss, leaving only Sertoli cells in these defective tubules. Testis cord formation (embryonic day 13.5) was normal. Testis histology was also normal at postnatal day (P)1, but germ cell loss was detected at P10 and subsequent ages. We conclude that the I242N heterozygous mutation in PLK4 is causative for patchy germ cell loss beginning at P10, suggesting a role for PLK4 during the initiation of spermatogenesis. PMID:21791561

  6. [The characters and specific features of new human embryonic stem cells lines].

    Science.gov (United States)

    Krylova, T A; Kol'tsova, A M; Zenin, V V; Gordeeva, O F; Musorina, A S; Goriachaia, T S; Shlykova, S A; Kamenetskaia, Iu K; Pinaev, G P; Polianskaia, G G

    2009-01-01

    Four continuous human embryonic stem cell lines (SC1, SC2, SC3 and SC4), derived from the blastocysts has been described. The cell lines were cultivated on mitotically inactivated human feeder cells. The cell lines SC1 and SC2 have passed through 150 population doublings and the cell lines SC3 and SC4 -- near 120 populations doublings, which exceeds Hayflick limit sufficiently. These cell lines maintain high activity of alkaline phosphatase, expression of transcription factor OCT-4 and cell surface antigens (SSEA-4, TRA-1-60 and TRA-1-81), confirming their ESC status and human specificity. Immunofluorescent detection of antigens, characteristic of ectoderm, endoderm and mesoderm confirms the ability of these cells to retain their pluripotency under in vitro condition. PCR analysis revealed expression of six genes specific for pluripotent cells (OCT-4, NANOG, DPPA3/STELLA, TDGF/CRIPTO and LEFTYA). Correlation between the level of proliferative activity and the character of DNA-bound fluorescent staining was found. Fluorescent dyes, Hoechst 33342 and PI, produced diffuse staining of the nuclei in slowly proliferating cells of the SC1 and SC2 lines. In contrast, in actively proliferating cells of the SC3 and SC4 lines, the clear staining of the nuclei was observed. Upon changing the cultivation condition, proliferative activity of SC3 and SC4 lines decreased and became similar to that of SC1 and SC2 lines. The character of the fluorescent staining of all these lines was also shown to be similar. These results show that quality of the fluorescent staining with Hoechst 33342 and PI reflects the level of proliferation. Possible causes and mechanisms of this feature of human ESC are discussed.

  7. Gene manipulation: churches against germ changes.

    Science.gov (United States)

    Budiansky, S

    An immediate ban on human genetic engineering that alters germ cells is called for in a resolution, written by activist Jeremy Rifkin, that was released last week over the signatures of 21 Catholic bishops, a broad spectrum of Protestant and Jewish religious leaders, and three scientists. The resolution takes a much harder line than was espoused by religious leaders in a letter to the now-defunct President's Commission for the Study of Ethical Problems in Medicine and Biomedical and Behavioral Research. Several of the signers indicated that they did not fully agree with the resolution, but saw it as a good vehicle to encourage public discussion.

  8. Origin of pluripotent germ cell tumours: the role of microenvironment during embryonic development

    DEFF Research Database (Denmark)

    Kristensen, David Møbjerg; Sonne, Si Brask; Ottesen, Anne Marie

    2008-01-01

    into virtually any type of tissue and form teratomas (non-seminomas). CIS cells display a close phenotypic similarity to fetal germ cells (primordial germ cells or gonocytes) suggesting an origin due to a developmental delay or arrest of differentiation of early germ cells. The pluripotency of these neoplasms...... in several tissue specific stem cells, such as TFAP2C (AP-2gamma) or KIT. CIS and seminomas highly express a number of pre-meiotic germ cell specific genes, which are down-regulated during development to non-seminomas, while the expression of other embryonic markers, such as SOX2, is up...

  9. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  10. Role of Axumin PET Scan in Germ Cell Tumor

    Science.gov (United States)

    2018-05-01

    Testis Cancer; Germ Cell Tumor; Testicular Cancer; Germ Cell Tumor of Testis; Germ Cell Tumor, Testicular, Childhood; Testicular Neoplasms; Testicular Germ Cell Tumor; Testicular Yolk Sac Tumor; Testicular Choriocarcinoma; Testicular Diseases; Germ Cell Cancer Metastatic; Germ Cell Neoplasm of Retroperitoneum; Germ Cell Cancer, Nos

  11. Identification of genome-specific transcripts in wheat–rye translocation lines

    Directory of Open Access Journals (Sweden)

    Tong Geon Lee

    2015-09-01

    Full Text Available Studying gene expression in wheat–rye translocation lines is complicated due to the presence of homeologs in hexaploid wheat and high levels of synteny between wheat and rye genomes (Naranjo and Fernandez-Rueda, 1991 [1]; Devos et al., 1995 [2]; Lee et al., 2010 [3]; Lee et al., 2013 [4]. To overcome limitations of current gene expression studies on wheat–rye translocation lines and identify genome-specific transcripts, we developed a custom Roche NimbleGen Gene Expression microarray that contains probes derived from the sequence of hexaploid wheat, diploid rye and diploid progenitors of hexaploid wheat genome (Lee et al., 2014. Using the array developed, we identified genome-specific transcripts in a wheat–rye translocation line (Lee et al., 2014. Expression data are deposited in the NCBI Gene Expression Omnibus (GEO under accession number GSE58678. Here we report the details of the methods used in the array workflow and data analysis.

  12. Human DAZL, DAZ and BOULE genes modulate primordial germ cell and haploid gamete formation

    Science.gov (United States)

    Kee, Kehkooi; Angeles, Vanessa T; Flores, Martha; Nguyen, Ha Nam; Pera, Renee A Reijo

    2009-01-01

    The leading cause of infertility in men and women is quantitative and qualitative defects in human germ cell (oocyte and sperm) development. Yet, it has not been possible to examine the unique developmental genetics of human germ cell formation and differentiation due to inaccessibility of germ cells during fetal development. Although several studies have shown that germ cells can be differentiated from mouse and human embryonic stem cells, human germ cells differentiated in these studies generally did not develop beyond the earliest stages1-8. Here we used a germ cell reporter to quantitate and isolate primordial germ cells derived from both male and female hESCs. Then, by silencing and overexpressing genes that encode germ cell-specific cytoplasmic RNA-binding proteins (not transcription factors), we modulated human germ cell formation and developmental progression. We observed that human DAZL (Deleted in AZoospermia-Like) functions in primordial germ cell formation, whereas closely-related genes, DAZ and BOULE, promote later stages of meiosis and development of haploid gametes. These results are significant to the generation of gametes for future basic science and potential clinical applications. PMID:19865085

  13. Tre1, a G protein-coupled receptor, directs transepithelial migration of Drosophila germ cells.

    Directory of Open Access Journals (Sweden)

    Prabhat S Kunwar

    2003-12-01

    Full Text Available In most organisms, germ cells are formed distant from the somatic part of the gonad and thus have to migrate along and through a variety of tissues to reach the gonad. Transepithelial migration through the posterior midgut (PMG is the first active step during Drosophila germ cell migration. Here we report the identification of a novel G protein-coupled receptor (GPCR, Tre1, that is essential for this migration step. Maternal tre1 RNA is localized to germ cells, and tre1 is required cell autonomously in germ cells. In tre1 mutant embryos, most germ cells do not exit the PMG. The few germ cells that do leave the midgut early migrate normally to the gonad, suggesting that this gene is specifically required for transepithelial migration and that mutant germ cells are still able to recognize other guidance cues. Additionally, inhibiting small Rho GTPases in germ cells affects transepithelial migration, suggesting that Tre1 signals through Rho1. We propose that Tre1 acts in a manner similar to chemokine receptors required during transepithelial migration of leukocytes, implying an evolutionarily conserved mechanism of transepithelial migration. Recently, the chemokine receptor CXCR4 was shown to direct migration in vertebrate germ cells. Thus, germ cells may more generally use GPCR signaling to navigate the embryo toward their target.

  14. Repair and mutation induction in mouse germ cells: a summary and some thoughts

    International Nuclear Information System (INIS)

    Russell, L.B.

    1979-01-01

    The various lines of evidence for repair of premutational damage in mouse germ cells are reviewed with the implications for future experiment planning. Relation between mutagenicity and carcinogenicity are discussed

  15. Nuclear Reprogramming in Mouse Primordial Germ Cells: Epigenetic Contribution

    Directory of Open Access Journals (Sweden)

    Massimo De Felici

    2011-01-01

    Full Text Available The unique capability of germ cells to give rise to a new organism, allowing the transmission of primary genetic information from generation to generation, depends on their epigenetic reprogramming ability and underlying genomic totipotency. Recent studies have shown that genome-wide epigenetic modifications, referred to as “epigenetic reprogramming”, occur during the development of the gamete precursors termed primordial germ cells (PGCs in the embryo. This reprogramming is likely to be critical for the germ line development itself and necessary to erase the parental imprinting and setting the base for totipotency intrinsic to this cell lineage. The status of genome acquired during reprogramming and the associated expression of key pluripotency genes render PGCs susceptible to transform into pluripotent stem cells. This may occur in vivo under still undefined condition, and it is likely at the origin of the formation of germ cell tumors. The phenomenon appears to be reproduced under partly defined in vitro culture conditions, when PGCs are transformed into embryonic germ (EG cells. In the present paper, I will try to summarize the contribution that epigenetic modifications give to nuclear reprogramming in mouse PGCs.

  16. Pathogenesis of germ cell neoplasia in testicular dysgenesis and disorders of sex development

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Lindhardt Johansen, Marie; Juul, Anders

    2015-01-01

    in individuals with 46,XY DSD. We summarise knowledge concerning development and sex differentiation of human gonads, with focus on sex-dimorphic steps of germ cell maturation, including meiosis. We also briefly outline the histopathology of germ cell neoplasia in situ (GCNIS) and gonadoblastoma (GDB), which......Development of human gonads is a sex-dimorphic process which evolved to produce sex-specific types of germ cells. The process of gonadal sex differentiation is directed by the action of the somatic cells and ultimately results in germ cells differentiating to become functional gametes through...

  17. Differentiation of primordial germ cells from induced pluripotent stem cells of primary ovarian insufficiency.

    Science.gov (United States)

    Leng, Lizhi; Tan, Yueqiu; Gong, Fei; Hu, Liang; Ouyang, Qi; Zhao, Yan; Lu, Guangxiu; Lin, Ge

    2015-03-01

    Can the induced pluripotent stem cells (iPSCs) derived from women with primary ovarian insufficiency (POI) differentiate into germ cells for potential disease modeling in vitro? The iPSC lines derived from POI patients with 46, X, del(X)(q26) or 46, X, del(X)(q26)9qh+ could differentiate into germ cells and expressed lower levels of genes in the deletion region of the X chromosome. iPSC technology has been envisioned as an approach for generating patient-specific stem cells for disease modeling and for developing novel therapies. It has also been confirmed that iPSCs differentiate into germ cells. We compared the differentiation ability of germ cells and the gene expression level of germ cell-related genes in the X chromosome deletion region of iPSC lines derived from POI patients (n = 2) with an iPSC line derived from normal fibroblasts (n = 1). We established three iPSC lines from two patients with partial Xq deletion-induced POI and normal fibroblasts by overexpressing four factors: octamer-binding transcription factor 4 (OCT4), sex-determining region Y-box 2 (SOX2), Nanog homeobox (NANOG), and lin-28 homolog (LIN28), using lentiviral vectors. We then generated stable-transfected fluorescent reporter cell lines under the control of the Asp-Glu-Ala-Asp box polypeptide 4 (DDX4, also called VASA) promoter, and selected clonal derived sublines. We induced subline differentiation into germ cells by adding Wnt3a (30 ng/ml) and bone morphogenetic protein 4 (100 ng/ml). After 12 days of differentiation, green fluorescent protein (GFP)-positive and GFP-negative cells were isolated via fluorescence-activated cell sorting and analyzed for endogenous VASA protein (immunostaining) and for germ cell markers and genes expressed in the deleted region of the X chromosome (quantitative RT-PCR). The POI- and normal fibroblast-derived iPSCs had typical self-renewal and pluripotency characteristics. After stable transfection with the VASA-GFP construct, the sublines POI1-iPS-V.1

  18. Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6 causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

    Directory of Open Access Journals (Sweden)

    Takao Sasado

    Full Text Available Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68. CPSF6 is a component of the Cleavage Factor Im complex (CFIm which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

  19. Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

    Science.gov (United States)

    Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

    2017-01-01

    Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

  20. Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens

    Science.gov (United States)

    2011-01-01

    Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301

  1. Modes in Component Behavior Specification via EBP and their Application in Product Lines

    Czech Academy of Sciences Publication Activity Database

    Kofroň, Jan; Plášil, František; Šerý, O.

    2009-01-01

    Roč. 51, č. 1 (2009), s. 31-41 ISSN 0950-5849 R&D Projects: GA AV ČR 1ET400300504 Grant - others:GA ČR(CZ) GA201/08/0266 Institutional research plan: CEZ:AV0Z10300504 Keywords : behavior specification * component modes * software product lines Subject RIV: JC - Computer Hardware ; Software Impact factor: 1.821, year: 2009

  2. Establishment of monoclonal HCC cell lines with organ site-specific tropisms

    International Nuclear Information System (INIS)

    Wan, Jinliang; Wen, Duo; Dong, Lili; Tang, Jun; Liu, Dongli; Liu, Yang; Tao, Zhonghua; Gao, Dongmei; Sun, Huichuan; Cao, Ya; Fan, Jia; Wu, Weizhong

    2015-01-01

    Organ site-specific metastasis is an ominous feature for most poor-prognostic hepatocellular carcinoma (HCC) patients. Cancer cell lines and animal models are indispensable for investigating the molecular mechanisms of organ specific tropism. However, till now, little is known about the drivers in HCC metastatic tropism, and also no effective way has been developed to block the process of tropistic metastasis. In this study, we established several monoclonal HCC cell lines from HCCLM3-RFP together with their xenograft models, and then analyzed their metastatic potentials and tropisms using in-vitro and in-vivo assays, and finally elucidated the driving forces of HCC tropistic metastases. Six monoclonal cell lines with different organ site-specific tropism were established successfully. SPARC, VCAM1 and ANGPTL4 were found positively correlated with the potentials of lung metastasis, while ITGA1 had a positive relation to lymph node metastasis of enterocoelia. By our powerful platforms, HCC metastatic tropisms in clinic could be easily mimicked and recapitulated for exploring the bilateral interactions between tumor and its microenvironment, elucidating the drivers of HCC metastatic tropisms, and testing anti-cancer effects of newly developed agent in pre-clinical stage. The online version of this article (doi:10.1186/s12885-015-1692-0) contains supplementary material, which is available to authorized users

  3. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters

    NARCIS (Netherlands)

    Adriaansen-Tennekes, R.; Vries Reilingh, de G.; Nieuwland, M.G.B.; Parmentier, H.K.; Savelkoul, H.F.J.

    2009-01-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based

  4. Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D)

    International Nuclear Information System (INIS)

    Judge, S.M.; Chatterton, R.T. Jr.

    1983-01-01

    The purpose of this study was to examine the lactogenic response of human mammary cancer cell lines to hormones in vitro. Progesterone was found to stimulate the incorporation of 14C from [14C]acetate into triglycerides (TG) and to promote accumulation of TG with a fatty acid composition similar to that of human milk fat in T-47D cells. Lipid droplets were observed in larger numbers without concomitant accumulation of casein granules in cells incubated with progesterone, but secretion of lipid into the medium did not occur. An effect of progesterone on TG accumulation was detectable after 12 hr and was maximal at 72 hr. Increasing doses of progesterone (10(-9) to 10(-5) M) caused a progressive increase in TG accumulation. The presence of cortisol and/or prolactin did not alter TG formation nor the dose response of the cells to progesterone. The growth rate of T-47D cells was not altered by the presence of progesterone in the medium. Neither of the human mammary cancer cell lines, MCF-7 and HBL-100, nor the human fibroblast cell lines, 28 and 857, responded to progesterone. The data indicate that, while the normally lactogenic hormones do not stimulate milk product biosynthesis in the cell lines tested, progesterone specifically stimulated synthesis and accumulation of TG in the T-47D cells

  5. Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression

    Directory of Open Access Journals (Sweden)

    Juni eSarkar

    2014-07-01

    Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.

  6. Optical scatterometry system for detecting specific line edge roughness of resist gratings subjected to detector noises

    International Nuclear Information System (INIS)

    Lee, Yen-Min; Li, Jia-Han; Cheng, Hsin-Hung; Wang, Fu-Min; Shen, Yu-Tian; Tsai, Kuen-Yu; Shieh, Jason J; Chen, Alek C

    2014-01-01

    The Fourier scatterometry model was used to measure the ZEP 520A electron beam resist lines with specific line edge roughness (LER). By obtaining the pupils via an objective lens, the angle-resolved diffraction spectrum was collected efficiently without additional mechanical scanning. The concavity of the pupil was considered as the weight function in specimen recognition. A series of white noises was examined in the model, and the tolerant white noise levels for different system numerical apertures (NAs) were reported. Our numerical results show that the scatterometry model of a higher NA can identify a target with a higher white noise level. Moreover, the fabricated ZEP 520A electron beam resist gratings with LER were measured by using our model, and the fitting results were matched with scanning electron microscope measurements. (paper)

  7. Radiation-induced genetic effects in germ cells of mammals

    International Nuclear Information System (INIS)

    Van der Schans, G.P.

    1993-01-01

    The objectives of the project are a better understanding of the fundamental principles that determine the radiation sensitivity in humans, with specific attention for the role of DNA repair in germ cells. The induction and repair of damage in DNA of germ cells of the Syrian golden hamster exposed to ionizing radiation is studied at biologically relevant doses. It has also been investigated which aspects of DNA sequence or chromosomal organisation are important with respect to their influence on the repairability of DNA damage. (R.P.) 10 refs

  8. Molecular mechanisms governing primordial germ cell migration in zebrafish

    NARCIS (Netherlands)

    Doitsidou, M.

    2005-01-01

    In most sexually reproducing organisms primordial germ cells (pGCs) are specified early in development in places that are distinct from the region where the somatic part of the gonad develops. From their places of specification they have to migrate towards the site where they associate with somatic

  9. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters.

    Science.gov (United States)

    Adriaansen-Tennekes, R; de Vries Reilingh, G; Nieuwland, M G B; Parmentier, H K; Savelkoul, H F J

    2009-09-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based differential immune competence. The parental line of these hens was randomly bred as the control line and was used as well. Recently, we showed that these selection lines differ in their stress reactivity; the low line birds show a higher hypothalamic-pituitary-adrenal (HPA) axis reactivity. To examine maternal effects and neonatal nutritional exposure on nutrient sensitivity, we studied 2 subsequent generations. This also created the opportunity to examine egg production in these birds. The 3 lines were fed 2 different nutritionally complete layer feeds for a period of 22 wk in the first generation. The second generation was fed from hatch with the experimental diets. At several time intervals, parameters reflecting humoral immunity were determined such as specific antibody to Newcastle disease and infectious bursal disease vaccines; levels of natural antibodies binding lipopolysaccharide, lipoteichoic acid, and keyhole limpet hemocyanin; and classical and alternative complement activity. The most pronounced dietary-induced effects were found in the low line birds of the first generation: specific antibody titers to Newcastle disease vaccine were significantly elevated by 1 of the 2 diets. In the second generation, significant differences were found in lipoteichoic acid natural antibodies of the control and low line hens. At the end of the observation period of egg parameters, a significant difference in egg weight was found in birds of the high line. Our results suggest that nutritional differences have immunomodulatory effects on innate and adaptive humoral immune parameters in birds with high HPA axis reactivity and affect egg production in birds with low HPA axis reactivity.

  10. Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis

    International Nuclear Information System (INIS)

    Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus

    2005-01-01

    TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor

  11. Using Regularization to Infer Cell Line Specificity in Logical Network Models of Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Sébastien De Landtsheer

    2018-05-01

    Full Text Available Understanding the functional properties of cells of different origins is a long-standing challenge of personalized medicine. Especially in cancer, the high heterogeneity observed in patients slows down the development of effective cures. The molecular differences between cell types or between healthy and diseased cellular states are usually determined by the wiring of regulatory networks. Understanding these molecular and cellular differences at the systems level would improve patient stratification and facilitate the design of rational intervention strategies. Models of cellular regulatory networks frequently make weak assumptions about the distribution of model parameters across cell types or patients. These assumptions are usually expressed in the form of regularization of the objective function of the optimization problem. We propose a new method of regularization for network models of signaling pathways based on the local density of the inferred parameter values within the parameter space. Our method reduces the complexity of models by creating groups of cell line-specific parameters which can then be optimized together. We demonstrate the use of our method by recovering the correct topology and inferring accurate values of the parameters of a small synthetic model. To show the value of our method in a realistic setting, we re-analyze a recently published phosphoproteomic dataset from a panel of 14 colon cancer cell lines. We conclude that our method efficiently reduces model complexity and helps recovering context-specific regulatory information.

  12. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  13. In vitro germ cell differentiation from cynomolgus monkey embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Kaori Yamauchi

    Full Text Available BACKGROUND: Mouse embryonic stem (ES cells can differentiate into female and male germ cells in vitro. Primate ES cells can also differentiate into immature germ cells in vitro. However, little is known about the differentiation markers and culture conditions for in vitro germ cell differentiation from ES cells in primates. Monkey ES cells are thus considered to be a useful model to study primate gametogenesis in vitro. Therefore, in order to obtain further information on germ cell differentiation from primate ES cells, this study examined the ability of cynomolgus monkey ES cells to differentiate into germ cells in vitro. METHODS AND FINDINGS: To explore the differentiation markers for detecting germ cells differentiated from ES cells, the expression of various germ cell marker genes was examined in tissues and ES cells of the cynomolgus monkey (Macaca fascicularis. VASA is a valuable gene for the detection of germ cells differentiated from ES cells. An increase of VASA expression was observed when differentiation was induced in ES cells via embryoid body (EB formation. In addition, the expression of other germ cell markers, such as NANOS and PIWIL1 genes, was also up-regulated as the EB differentiation progressed. Immunocytochemistry identified the cells expressing stage-specific embryonic antigen (SSEA 1, OCT-4, and VASA proteins in the EBs. These cells were detected in the peripheral region of the EBs as specific cell populations, such as SSEA1-positive, OCT-4-positive cells, OCT-4-positive, VASA-positive cells, and OCT-4-negative, VASA-positive cells. Thereafter, the effect of mouse gonadal cell-conditioned medium and growth factors on germ cell differentiation from monkey ES cells was examined, and this revealed that the addition of BMP4 to differentiating ES cells increased the expression of SCP1, a meiotic marker gene. CONCLUSION: VASA is a valuable gene for the detection of germ cells differentiated from ES cells in monkeys, and the

  14. Targeted disruption of exons 1 to 6 of the Fanconi Anemia group A gene leads to growth retardation, strain-specific microphthalmia, meiotic defects and primordial germ cell hypoplasia.

    Science.gov (United States)

    Wong, Jasmine C Y; Alon, Noa; Mckerlie, Colin; Huang, Jun R; Meyn, M Stephen; Buchwald, Manuel

    2003-08-15

    Fanconi Anemia (FA) is an autosomal recessive disorder characterized by cellular hypersensitivity to DNA cross-linking agents. Recent studies suggest that FA proteins share a common pathway with BRCA proteins. To study the in vivo role of the FA group A gene (Fanca), gene-targeting techniques were used to generate Fanca(tm1Hsc) mice in which Fanca exons 1-6 were replaced by a beta-galactosidase reporter construct. Fanca(tm1.1Hsc) mice were generated by Cre-mediated removal of the neomycin cassette in Fanca(tm1Hsc) mice. Fanca(tm1.1Hsc) homozygotes display FA-like phenotypes including growth retardation, microphthalmia and craniofacial malformations that are not found in other Fanca mouse models, and the genetic background affects manifestation of certain phenotypes. Both male and female mice homozygous for Fanca mutation exhibit hypogonadism, and homozygous females demonstrate premature reproductive senescence and an increased incidence of ovarian cysts. We showed that fertility defects in Fanca(tm1.1Hsc) homozygotes might be related to a diminished population of primordial germ cells (PGCs) during migration into the gonadal ridges. We also found a high level of Fanca expression in pachytene spermatocytes. Fanca(tm1Hsc) homozygous males exhibited an elevated frequency of mispaired meiotic chromosomes and increased apoptosis in germ cells, implicating a role for Fanca in meiotic recombination. However, the localization of Rad51, Brca1, Fancd2 and Mlh1 appeared normal on Fanca(tm1Hsc) homozygous meiotic chromosomes. Taken together, our results suggest that the FA pathway plays a role in the maintenance of reproductive germ cells and in meiotic recombination.

  15. Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.

    Science.gov (United States)

    Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke

    2013-12-15

    The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.

  16. ISP-50 Specifications for a Direct Vessel Injection Line Break Test with the ATLAS

    International Nuclear Information System (INIS)

    Choi, Ki Yong; Baek, Won Pil; Kim, Yeon Sik; Park, Hyun Sik; Cho, Seok; Kang, Kyoung Ho; Choi, Nam Hyun; Min, Kyoung Ho

    2009-06-01

    An OECD/NEA International Standard Problem Exercise (ISP) focussing on a DVI line break simulation result with the ATLAS was approved by the NEA Committee on the Safety of Nuclear Installation (CSNI) meeting in December 2008 and was numbered by ISP-50. The ISP-50 program will be operated by an operating agency, KAERI for three years starting from the physical year 2009. Fourteen international organizations confirmed their participation in the ISP-50, including NRC (USA), JAEA, JNES (Japan), GRS (Germany), KFKI-AEKI (Hungary), EDO Gidropress (Russia), VTT, Fortum (Finland), NRI (Czech Republic), Univ. of Pisa (Italy), KINS, KNF, KOPEC, and KAERI (Korea). In addition, KTH in Sweden and HSE in UK are considering late participation. Recently, NPIC and CIAE in China hope to join the ISP-50. As for the safety analysis codes, nine codes are expected to be used for the ISP-50: MARS-3D, RELAP5- 3D, RELAP5, TRACE, CATHARE, APROS, ATHELET, TRAP, and KORSAR. It is the first ISP exercise in Korea in which a domestic test facility is utilized by international nuclear society and this exercise will contribute to extending our physical understanding on thermal hydraulic phenomena during the DVI line break accidents and to verifying the best-estimate thermal-hydraulic safety analysis codes. This report was prepared to define technical specifications of the ISP-50 exercise according the guideline provided by OECD/CSNI. It includes general objectives, phases, deliverables to participants, parameters required for comparison and the time table

  17. On-Line Monitoring of Instrument Channel Performance: Volume 3: Applications to Nuclear Power Plant Technical Specification Instrumentation

    International Nuclear Information System (INIS)

    Davis, E.; Rasmussen, B.

    2004-01-01

    This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system

  18. Don Germán

    OpenAIRE

    Juan Luis Mejía

    1991-01-01

    El veranillo de San Juan hace soportable el mediodía. Los "chorros d'oro" inundan de amarillo los antejardines del Prado. Las golondrinas veraneras invaden, al atardecer, los alrededores de la Biblioteca Departamental. Los voceadores de la suerte del paseo Bolívar claman a los cuatro vientos el número que cambiará su destino . Pero algo falta definitivamente en esta Barranquilla. De alguna manera la ciudad ya no es la misma. Falta Don Germán.

  19. Don Germán

    Directory of Open Access Journals (Sweden)

    Juan Luis Mejía

    1991-01-01

    Full Text Available El veranillo de San Juan hace soportable el mediodía. Los "chorros d'oro" inundan de amarillo los antejardines del Prado. Las golondrinas veraneras invaden, al atardecer, los alrededores de la Biblioteca Departamental. Los voceadores de la suerte del paseo Bolívar claman a los cuatro vientos el número que cambiará su destino . Pero algo falta definitivamente en esta Barranquilla. De alguna manera la ciudad ya no es la misma. Falta Don Germán.

  20. Stopping the Spread of Germs at Home, Work and School

    Science.gov (United States)

    ... Pandemic Other Stopping the Spread of Germs at Home, Work & School Language: English (US) Español Recommend on Facebook ... everyone from getting germs or spreading germs at home, work, or school. Clean and disinfect surfaces or objects. ...

  1. Multiphoton microscopy imaging of developing tooth germs

    Directory of Open Access Journals (Sweden)

    Pei-Yu Pan

    2014-01-01

    Conclusion: In this study, a novel multiphoton microscopy database of images from developing tooth germs in mice was set up. We confirmed that multiphoton laser microscopy is a powerful tool for investigating the development of tooth germ and is worthy for further application in the study of tooth regeneration.

  2. Generation of organized germ layers from a single mouse embryonic stem cell.

    Science.gov (United States)

    Poh, Yeh-Chuin; Chen, Junwei; Hong, Ying; Yi, Haiying; Zhang, Shuang; Chen, Junjian; Wu, Douglas C; Wang, Lili; Jia, Qiong; Singh, Rishi; Yao, Wenting; Tan, Youhua; Tajik, Arash; Tanaka, Tetsuya S; Wang, Ning

    2014-05-30

    Mammalian inner cell mass cells undergo lineage-specific differentiation into germ layers of endoderm, mesoderm and ectoderm during gastrulation. It has been a long-standing challenge in developmental biology to replicate these organized germ layer patterns in culture. Here we present a method of generating organized germ layers from a single mouse embryonic stem cell cultured in a soft fibrin matrix. Spatial organization of germ layers is regulated by cortical tension of the colony, matrix dimensionality and softness, and cell-cell adhesion. Remarkably, anchorage of the embryoid colony from the 3D matrix to collagen-1-coated 2D substrates of ~1 kPa results in self-organization of all three germ layers: ectoderm on the outside layer, mesoderm in the middle and endoderm at the centre of the colony, reminiscent of generalized gastrulating chordate embryos. These results suggest that mechanical forces via cell-matrix and cell-cell interactions are crucial in spatial organization of germ layers during mammalian gastrulation. This new in vitro method could be used to gain insights on the mechanisms responsible for the regulation of germ layer formation.

  3. Control over the morphology and segregation of Zebrafish germ cell granules during embryonic development

    Directory of Open Access Journals (Sweden)

    Nakkrasae La-Iad

    2008-05-01

    Full Text Available Abstract Background Zebrafish germ cells contain granular-like structures, organized around the cell nucleus. These structures share common features with polar granules in Drosophila, germinal granules in Xenopus and chromatoid bodies in mice germ cells, such as the localization of the zebrafish Vasa, Piwi and Nanos proteins, among others. Little is known about the structure of these granules as well as their segregation in mitosis during early germ-cell development. Results Using transgenic fish expressing a fluorescently labeled novel component of Zebrafish germ cell granules termed Granulito, we followed the morphology and distribution of the granules. We show that whereas these granules initially exhibit a wide size variation, by the end of the first day of development they become a homogeneous population of medium size granules. We investigated this resizing event and demonstrated the role of microtubules and the minus-end microtubule dependent motor protein Dynein in the process. Last, we show that the function of the germ cell granule resident protein the Tudor domain containing protein-7 (Tdrd7 is required for determination of granule morphology and number. Conclusion Our results suggest that Zebrafish germ cell granules undergo a transformation process, which involves germ cell specific proteins as well as the microtubular network.

  4. Second Malignant Neoplasms and Cause of Death in Patients With Germ Cell Cancer

    DEFF Research Database (Denmark)

    Kier, Maria G; Hansen, Merete K; Lauritsen, Jakob

    2016-01-01

    radiotherapy (RT); bleomycin, etoposide, and cisplatin (BEP); or more than 1 line of treatment (MTOL). Main Outcomes and Measures: Cumulative incidence and hazard ratios (HRs) for SMN and death calculated by the Cox proportional hazards model were compared with those of age-matched controls. Results: The study......Importance: Patients given systemic treatment for testicular germ cell cancer (GCC) are at increased risk for a second malignant neoplasm (SMN). Previous studies on SMN and causes of death lacked information on the exact treatment applied or were based on patients receiving former treatment options....... Objective: To evaluate the treatment-specific risks for SMN and death in a nationwide population-based cohort of patients with GCC treated with current standard regimens. Design, Setting, and Participants: This study examined a Danish nationwide cohort of 5190 men with GCC who entered the Danish Testicular...

  5. Isolation of a primate embryonic stem cell line.

    OpenAIRE

    Thomson, J A; Kalishman, J; Golos, T G; Durning, M; Harris, C P; Becker, R A; Hearn, J P

    1995-01-01

    Embryonic stem cells have the ability to remain undifferentiated and proliferate indefinitely in vitro while maintaining the potential to differentiate into derivatives of all three embryonic germ layers. Here we report the derivation of a cloned cell line (R278.5) from a rhesus monkey blastocyst that remains undifferentiated in continuous passage for > 1 year, maintains a normal XY karyotype, and expresses the cell surface markers (alkaline phosphatase, stage-specific embryonic antigen 3, st...

  6. The role of sex chromosomes in mammalian germ cell differentiation: can the germ cells carrying X and Y chromosomes differentiate into fertile oocytes?

    Directory of Open Access Journals (Sweden)

    Teruko Taketo

    2015-06-01

    Full Text Available The sexual differentiation of germ cells into spermatozoa or oocytes is strictly regulated by their gonadal environment, testis or ovary, which is determined by the presence or absence of the Y chromosome, respectively. Hence, in normal mammalian development, male germ cells differentiate in the presence of X and Y chromosomes, and female germ cells do so in the presence of two X chromosomes. However, gonadal sex reversal occurs in humans as well as in other mammalian species, and the resultant XX males and XY females can lead healthy lives, except for a complete or partial loss of fertility. Germ cells carrying an abnormal set of sex chromosomes are efficiently eliminated by multilayered surveillance mechanisms in the testis, and also, though more variably, in the ovary. Studying the molecular basis for sex-specific responses to a set of sex chromosomes during gametogenesis will promote our understanding of meiotic processes contributing to the evolution of sex determining mechanisms. This review discusses the fate of germ cells carrying various sex chromosomal compositions in mouse models, the limitation of which may be overcome by recent successes in the differentiation of functional germ cells from embryonic stem cells under experimental conditions.

  7. ON-Line Monitoring of Instrument Channel Performance: Volume 3: Applications to Nuclear Power Plant Technical Specification Instrumentation

    Energy Technology Data Exchange (ETDEWEB)

    E Davis, B Rasmussen

    2004-12-31

    This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system.

  8. Intracranial germ-cell tumors

    International Nuclear Information System (INIS)

    Baker, L.L.; Kollias, S.S.; Cogen, P.H.; Barkovich, A.J.

    1991-01-01

    This paper reports on the MR characteristics together with the clinical and histologic features of cerebral germ-cell tumors were investigated to augment data regarding this rare, diverse class of neoplasms. Germinomas were homogeneous or heterogeneous masses, predominantly isointense to normal brain on T1-weighted images, and hyperintense and heterogeneous on T2-weighted images; three showed adjacent brain edema. Enhancement was prominent, either homogeneous or heterogeneous. One had spinal drop metastases. Teratomas, more common in young patients, were more heterogeneous than germinomas on T1-weighted and T2-weighted images. Five showed hyper- and hypointense foci on T1-weighted images that corresponded to fat and calcium, respectively, at CT. Teratomas did not enhance or enhanced heterogeneously. Two had intratumoral hemorrhage; there were no metastases. Both patients with choriocarcinoma had hemorrhagic masses

  9. Radiosensitivity of mouse germ cells

    International Nuclear Information System (INIS)

    Matsuda, Yoichi; Takeuchi, Toyoko; Maemori, Mamiko; Seki, Naohiko; Tobari, Izuo

    1991-01-01

    To estimate radiosensitivity of mouse germ cells the analysis of chromosome aberrations was performed at diakinesis-metaphase I of spermatocytes and first-cleavage metaphase of one-cell embryos after exposure to radiations at various stages of primary spermatocytes and spermatids. The result provided evidence that there are two major types of DNA damage in X-irradiated sperm : (1) short-lived DNA lesions ; the lesions are subject to repair inhibition by agents added in G 1 , and are converted into chromosome-type aberrations during G 1 , and (2) long-lived DNA lesions ; the lesions persist until S phase and repair of the lesions is inhibited by caffeine, hydroxyurea and arabinofuranosyl cytosine in G 2 . The characteristic of X-ray damage induced in spermiogenic stage and repair mechanism for the damage in the fertilized egg were discussed comparing with the results with two chemicals, methyl methanesulfonate (MMS) and mitomycin C (MMC). (J.P.N.)

  10. 2-DE analysis of breast cancer cell lines 1833 and 4175 with distinct metastatic organ-specific potentials: Comparison with parental cell line MDA-MB-231

    Czech Academy of Sciences Publication Activity Database

    Selicharová, Irena; Šanda, Miloslav; Mládková, Jana; Ohri, S. S.; Vashishta, A.; Fusek, M.; Jiráček, Jiří; Vetvicka, V.

    2008-01-01

    Roč. 19, č. 5 (2008), s. 1237-1244 ISSN 1021-335X R&D Projects: GA MZd NR8323 Grant - others:NIH(US) ROI CAA082159-03 Institutional research plan: CEZ:AV0Z40550506 Keywords : breast cancer * cell line * 2-DE * organ-specific metastases Subject RIV: CE - Biochemistry Impact factor: 1.524, year: 2008

  11. Light and electron microscopic analyses of Vasa expression in adult germ cells of the fish medaka.

    Science.gov (United States)

    Yuan, Yongming; Li, Mingyou; Hong, Yunhan

    2014-07-15

    Germ cells of diverse animal species have a unique membrane-less organelle called germ plasm (GP). GP is usually associated with mitochondria and contains RNA binding proteins and mRNAs of germ genes such as vasa. GP has been described as the mitochondrial cloud (MC), intermitochondrial cement (IC) and chromatoid body (CB). The mechanism underlying varying GP structures has remained incompletely understood. Here we report the analysis of GP through light and electron microscopy by using Vasa as a marker in adult male germ cells of the fish medaka (Oryzias latipes). Immunofluorescence light microscopy revealed germ cell-specific Vasa expression. Vasa is the most abundant in mitotic germ cells (oogonia and spermatogonia) and reduced in meiotic germ cells. Vasa in round spermatids exist as a spherical structure reminiscent of CB. Nanogold immunoelectron microscopy revealed subcellular Vasa redistribution in male germ cells. Vasa in spermatogonia concentrates in small areas of the cytoplasm and is surrounded by mitochondria, which is reminiscent of MC. Vasa is intermixed with mitochondria to form IC in primary spermatocytes, appears as the free cement (FC) via separation from mitochondria in secondary spermatocyte and becomes condensed in CB at the caudal pole of round spermatids. During spermatid morphogenesis, Vasa redistributes and forms a second CB that is a ring-like structure surrounding the dense fiber of the flagellum in the midpiece. These structures resemble those described for GP in various species. Thus, Vasa identifies GP and adopts varying structures via dynamic reorganization at different stages of germ cell development. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Generation of germ cells in vitro in the era of induced pluripotent stem cells.

    Science.gov (United States)

    Imamura, Masanori; Hikabe, Orie; Lin, Zachary Yu-Ching; Okano, Hideyuki

    2014-01-01

    Induced pluripotent stem cells (iPSCs) are stem cells that can be artificially generated via "cellular reprogramming" using gene transduction in somatic cells. iPSCs have enormous potential in stem-cell biology as they can give rise to numerous cell lineages, including the three germ layers. An evaluation of germ-line competency by blastocyst injection or tetraploid complementation, however, is critical for determining the developmental potential of mouse iPSCs towards germ cells. Recent studies have demonstrated that primordial germ cells obtained by the in vitro differentiation of iPSCs produce functional gametes as well as healthy offspring. These findings illustrate not only that iPSCs are developmentally similar to embryonic stem cells (ESCs), but also that somatic cells from adult tissues can produce gametes in vitro, that is, if they are reprogrammed into iPSCs. In this review, we discuss past and recent advances in the in vitro differentiation of germ cells using pluripotent stem cells, with an emphasis on ESCs and iPSCs. While this field of research is still at a stage of infancy, it holds great promises for investigating the mechanisms of germ-cell development, especially in humans, and for advancing reproductive and developmental engineering technologies in the future. © 2013 Wiley Periodicals, Inc.

  13. Flux line lattice melting transition in YBa2Cu3O6.94 observed in specific heat experiments

    International Nuclear Information System (INIS)

    Roulin, M.; Junod, A.; Walker, E.

    1996-01-01

    When a magnetic field penetrates a type II superconductor, it forms a lattice of thin quantized filaments called magnetic vortices. Resistance, magnetization, and neutron diffraction experiments have shown that the vortex lattice of high-temperature superconductors can melt along a line in the field-temperature plane. The calorimetric signature of melting on this line was observed in a high-accuracy adiabatic specific heat experiment performed on YBa 2 Cu 3 O 6.94 . The specific heat of the vortex liquid was greater than that of the vortex solid. 17 refs., 3 figs

  14. Dearth and Delayed Maturation of Testicular Germ Cells in Fanconi Anemia E Mutant Male Mice.

    Directory of Open Access Journals (Sweden)

    Chun Fu

    Full Text Available After using a self-inactivating lentivirus for non-targeted insertional mutagenesis in mice, we identified a transgenic family with a recessive mutation that resulted in reduced fertility in homozygous transgenic mice. The lentiviral integration site was amplified by inverse PCR. Sequencing revealed that integration had occurred in intron 8 of the mouse Fance gene, which encodes the Fanconi anemia E (Fance protein. Fanconi anemia (FA proteins play pivotal roles in cellular responses to DNA damage and Fance acts as a molecular bridge between the FA core complex and Fancd2. To investigate the reduced fertility in the mutant males, we analyzed postnatal development of testicular germ cells. At one week after birth, most tubules in the mutant testes contained few or no germ cells. Over the next 2-3 weeks, germ cells accumulated in a limited number of tubules, so that some tubules contained germ cells around the full periphery of the tubule. Once sufficient numbers of germ cells had accumulated, they began to undergo the later stages of spermatogenesis. Immunoassays revealed that the Fancd2 protein accumulated around the periphery of the nucleus in normal developing spermatocytes, but we did not detect a similar localization of Fancd2 in the Fance mutant testes. Our assays indicate that although Fance mutant males are germ cell deficient at birth, the extant germ cells can proliferate and, if they reach a threshold density, can differentiate into mature sperm. Analogous to previous studies of FA genes in mice, our results show that the Fance protein plays an important, but not absolutely essential, role in the initial developmental expansion of the male germ line.

  15. Testing for myositis specific autoantibodies: Comparison between line blot and immunoprecipitation assays in 57 myositis sera.

    Science.gov (United States)

    Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco

    2016-06-01

    To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the

  16. DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

    Science.gov (United States)

    Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

    2011-01-01

    Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

  17. Development of an On-Line Surgeon-Specific Operating Room Time Prediction System (Experience with the Michigan Surgical Monitors)

    OpenAIRE

    Brown, Allan C.D.; Schmidt, Nancy M.

    1984-01-01

    The development of a micro-computer application for the on-line prediction of surgeon-specific operating room time using an IBM - PCXT is described. The reasons leading to the project, together with an assessment of the Condor 20 relational database management system as the basis for the application are discussed.

  18. Treatment Option Overview (Ovarian Germ Cell Tumors)

    Science.gov (United States)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  19. Treatment Option Overview (Extragonadal Germ Cell Tumors)

    Science.gov (United States)

    ... Cell Tumors Treatment Testicular Cancer Treatment Age and gender can affect the risk of extragonadal germ cell ... Headache. Change in bowel habits. Feeling very tired. Trouble walking. Trouble in seeing or moving the eyes. ...

  20. General Information about Extragonadal Germ Cell Tumors

    Science.gov (United States)

    ... Cell Tumors Treatment Testicular Cancer Treatment Age and gender can affect the risk of extragonadal germ cell ... Headache. Change in bowel habits. Feeling very tired. Trouble walking. Trouble in seeing or moving the eyes. ...

  1. 7 CFR 1755.397 - RUS performance specification for line concentrators.

    Science.gov (United States)

    2010-01-01

    ... part 51. Copies of these standards are available for inspection during normal business hours at RUS.... (ii) There should be provisions for such types of lines as ground start, loop start, regular... surface of the protectors. Means for easy identification of pairs shall be provided. (v) Protectors shall...

  2. The account of sagging of wires at definition of specific potential factors of air High-Voltage Power Transmission Lines

    Directory of Open Access Journals (Sweden)

    Suslov V.M.

    2005-12-01

    Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.

  3. DAZ Family Proteins, Key Players for Germ Cell Development

    Science.gov (United States)

    Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei

    2015-01-01

    DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution. PMID:26327816

  4. Effect of in vivo γ-irradiation on the binding of wheat germ agglutinin on lymphocyte plasma membranes

    International Nuclear Information System (INIS)

    Moullier, P.; Daveloose, D.; Dubos, M.; Leterrier, F.; Hoebeke, J.

    1986-01-01

    Using quantitative fluorimetry with fluoresceinated wheat germ agglutinin, we have been able to investigate in vivo gamma radiation-induced damage at the outer membrane level of rat splenic lymphocytes, namely damage to the glucosidic moieties of membrane glycoproteins and glycolipids. This paper demonstrates that below an irradiation level of 1 gray (Gy), removal of sialic acid is the major feature leading to new exposed specific binding sites for wheat germ agglutinin, since this lectin is specific for sialic acid and N-acetyl-D-glucosamine. Our studies also suggest that above 1 Gy of irradiation more internal damage occurs, since we observed a striking decrease in wheat germ agglutinin binding sites. (orig.)

  5. Multidimensional representations: The knowledge domain of germs held by students, teachers and medical professionals

    Science.gov (United States)

    Rua, Melissa Jo

    The present study examined the understandings held by 5th, 8th, and 11th-grade students, their teachers and medical professionals about germs. Specifically, this study describes the content and structure of students' and adults' conceptions in the areas of germ contraction, transmission, and treatment of infectious and non-infectious diseases caused by microorganisms. Naturalistic and empirical research methods were used to investigate participants' conceptions. Between and within group similarities were found using data from concept maps on the topic "flu," drawings of germs, a 20 word card sort related to germs and illness, and a semi-structured interview. Concept maps were coded according to techniques by Novak and Gowan (1984). Drawings of germs were coded into four main categories (bacteria, viruses, animal cell, other) and five subcategories (disease, caricature, insect, protozoa, unclassified). Cluster patterns for the card sorts of each group were found using multidimensional scaling techniques. Six coding categories emerged from the interview transcripts: (a) transmission, (b) treatment, (c) effect of weather on illness, (d) immune response, (e) location of germs, and (f) similarities and differences between bacteria and viruses. The findings showed students, teachers and medical professionals have different understandings about bacteria and viruses and the structures of those understandings vary. Gaps or holes in the participants knowledge were found in areas such as: (a) how germs are transmitted, (b) where germs are found, (c) how the body transports and uses medicine, (d) how the immune system functions, (e) the difference between vaccines and non-prescription medicines, (f) differences that exist between bacteria and viruses, and (g) bacterial resistance to medication. The youngest students relied heavily upon personal experiences with germs rather than formal instruction when explaining their conceptions. As a result, the influence of media was

  6. Serum-free media formulations are cell line-specific and require optimization for microcarrier culture.

    Science.gov (United States)

    Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw

    2015-08-01

    Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  7. Screening and Establishment of Human Lung Cancer Cell Lines 
with Organ-specific Metastasis Potential

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU

    2014-03-01

    Full Text Available Background and objective Cancer metastasis is not only the malignant marker and characteristics, but also the main cause of failure to cure and lose their life in the patients with lung cancer. Lung cancer metastasis has organ-specific characteristics. The most common sites of lung cancer metastasis are mediastinal lymph node, brain, bone, liver and adrenal gland. The aim of this study is to screen and establish lung cancer cell model with organ-specific metastasis potential with human high-metastatic large cell lung cancer cell line L9981 established by our laboratory previously, and to provide cell models for studying the mechanisms and signal regulation of organ-specific metastasis of lung cancer. Materials and methods The parent lung cancer cell line, L9981-Luc, was inoculated in the armpit of nude mice. The live animal imaging system, IVIS-200, was used to detect the lung cancer organ-specific metastasis every week. When the organ-specific metastasis were established, the nude mices bearing the lung cancer were sacrificed when they became moribund. Under sterile conditions, the organs (mediastinal lymph nodes, lung, spinal column and brain with lung cancer organ-specific metastasis were removed and the metastasized nodules were dissected free of connective tissue and blood clots, and rinsed twice with medium. The metastasized nodules were finely minced using sterile scalpel blades in medium, and the cells were seeded in tissue culture dishes. Then, the cells with organ-specific metastasis potential were reinoculated into the armpit of nude mice, respectively. This processes were repeated to establish the organ-specific metastatic sublines of L9981-Luc cell line more than 10 times. Finally, the organ-specific metastasis sublines of L9981-Luc were screened and established, which the four cell lines have the characteristics only metastasized to brian, lung, bone and mediastinal lymph node. Results A group of organ-specific metastasis cell

  8. work specification for the construction of 33kv overhead lines across

    African Journals Online (AJOL)

    HOD

    obtained using the standard mathematical equations and the specifications for Aluminium Conductor Steel Reinforce ... systems. The choice of conductor depends on the cost and efficiency. ... Support structure requirements, limitations.

  9. Dnd Is a Critical Specifier of Primordial Germ Cells in the Medaka Fish

    Directory of Open Access Journals (Sweden)

    Ni Hong

    2016-03-01

    Full Text Available Primordial germ cell (PGC specification occurs early in development. PGC specifiers have been identified in Drosophila, mouse, and human but remained elusive in most animals. Here we identify the RNA-binding protein Dnd as a critical PGC specifier in the medaka fish (Oryzias latipes. Dnd depletion specifically abolished PGCs, and its overexpression boosted PGCs. We established a single-cell culture procedure enabling lineage tracing in vitro. We show that individual blastomeres from cleavage embryos at the 32- and 64-cell stages are capable of PGC production in culture. Importantly, Dnd overexpression increases PGCs via increasing PGC precursors. Strikingly, dnd RNA forms prominent particles that segregate asymmetrically. Dnd concentrates in germ plasm and stabilizes germ plasm RNA. Therefore, Dnd is a critical specifier of fish PGCs and utilizes particle partition as a previously unidentified mechanism for asymmetric segregation. These findings offer insights into PGC specification and manipulation in medaka as a lower vertebrate model.

  10. Metastable primordial germ cell-like state induced from mouse embryonic stem cells by Akt activation

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Noriko [Graduate School of Frontier Biosciences, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Kimura, Tohru, E-mail: tkimura@patho.med.osaka-u.ac.jp [Department of Pathology, Medical School, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Watanabe-Kushima, Shoko [Graduate School of Frontier Biosciences, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Shinohara, Takashi [Department of Molecular Genetics, Graduate School of Medicine, Kyoto University, Kyoto 606-8501 (Japan); Nakano, Toru, E-mail: tnakano@patho.med.osaka-u.ac.jp [Graduate School of Frontier Biosciences, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Department of Pathology, Medical School, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan)

    2010-02-12

    Specification to primordial germ cells (PGCs) is mediated by mesoderm-induction signals during gastrulation. We found that Akt activation during in vitro mesodermal differentiation of embryonic stem cells (ESCs) generated self-renewing spheres with differentiation states between those of ESCs and PGCs. Essential regulators for PGC specification and their downstream germ cell-specific genes were expressed in the spheres, indicating that the sphere cells had commenced differentiation to the germ lineage. However, the spheres did not proceed to spermatogenesis after transplantation into testes. Sphere cell transfer to the original feeder-free ESC cultures resulted in chaotic differentiation. In contrast, when the spheres were cultured on mouse embryonic fibroblasts or in the presence of ERK-cascade and GSK3 inhibitors, reversion to the ESC-like state was observed. These results indicate that Akt signaling promotes a novel metastable and pluripotent state that is intermediate to those of ESCs and PGCs.

  11. Primordial germ cell biology at the beginning of the XXI century.

    Science.gov (United States)

    De Felici, Massimo

    2009-01-01

    At the XIV Workshop on the Development and Function of the Reproductive Organs held at the Congress Centre of the University of Rome Tor Vergata, Monteporzio Catone, Rome, Italy, the introduction to the first session entitled Mammalian primordial germ cells dedicated to the memory of Anne McLaren, was the occasion for a concise review of the state of art of research on the biology of primordial germ cells (PGCs). This great, unforgettable scientist, who died in a car accident in July 2007, dedicated most of her studies to this field over the last 25 years. Topics briefly reviewed in this Meeting Report are: 1) how the germ line is determined; 2) what are the mechanisms underlying PGC migration; 3) to what extent PGC survival, proliferation and differentiation are cell autonomous or environmentally controlled processes and 4) how the potential for totipotency is retained in PGCs.

  12. Establishment of the Vertebrate Germ Layers.

    Science.gov (United States)

    Tseng, Wei-Chia; Munisha, Mumingjiang; Gutierrez, Juan B; Dougan, Scott T

    2017-01-01

    The process of germ layer formation is a universal feature of animal development. The germ layers separate the cells that produce the internal organs and tissues from those that produce the nervous system and outer tissues. Their discovery in the early nineteenth century transformed embryology from a purely descriptive field into a rigorous scientific discipline, in which hypotheses could be tested by observation and experimentation. By systematically addressing the questions of how the germ layers are formed and how they generate overall body plan, scientists have made fundamental contributions to the fields of evolution, cell signaling, morphogenesis, and stem cell biology. At each step, this work was advanced by the development of innovative methods of observing cell behavior in vivo and in culture. Here, we take an historical approach to describe our current understanding of vertebrate germ layer formation as it relates to the long-standing questions of developmental biology. By comparing how germ layers form in distantly related vertebrate species, we find that highly conserved molecular pathways can be adapted to perform the same function in dramatically different embryonic environments.

  13. HuB (elavl2 mRNA is restricted to the germ cells by post-transcriptional mechanisms including stabilisation of the message by DAZL.

    Directory of Open Access Journals (Sweden)

    Sophie E Wiszniak

    Full Text Available The ability of germ cells to carry out a gene regulatory program distinct from the surrounding somatic tissue, and their capacity to specify an entire new organism has made them a focus of many studies that seek to understand how specific regulatory mechanisms, particularly post-transcriptional mechanisms, contribute to cell fate. In zebrafish, germ cells are specified through the inheritance of cytoplasmic determinants, termed the germ plasm, which contains a number of maternal mRNAs and proteins. Investigation of several of these messages has revealed that the restricted localisation of these mRNAs to the germ plasm and subsequent germ cells is due to cis-acting sequence elements present in their 3'UTRs. Here we show that a member of the Hu family of RNA-binding proteins, HuB, is maternally provided in the zebrafish embryo and exhibits germ cell specific expression during embryogenesis. Restriction of HuB mRNA to the germ cells is dependent on a number of sequence elements in its 3'UTR, which act to degrade the mRNA in the soma and stabilise it in the germ cells. In addition, we show that the germ cell specific RNA-binding protein DAZL is able to promote HuB mRNA stability and translation in germ cells, and further demonstrate that these activities require a 30 nucleotide element in the 3'UTR. Our study suggests that DAZL specifically binds the HuB 3'UTR and protects the message from degradation and/or enhances HuB translation, leading to the germ cell specific expression of HuB protein.

  14. Standardized orthotopic xenografts in zebrafish reveal glioma cell-line-specific characteristics and tumor cell heterogeneity

    Directory of Open Access Journals (Sweden)

    Alessandra M. Welker

    2016-02-01

    Full Text Available Glioblastoma (GBM is a deadly brain cancer, for which few effective drug treatments are available. Several studies have used zebrafish models to study GBM, but a standardized approach to modeling GBM in zebrafish was lacking to date, preventing comparison of data across studies. Here, we describe a new, standardized orthotopic xenotransplant model of GBM in zebrafish. Dose-response survival assays were used to define the optimal number of cells for tumor formation. Techniques to measure tumor burden and cell spread within the brain over real time were optimized using mouse neural stem cells as control transplants. Applying this standardized approach, we transplanted two patient-derived GBM cell lines, serum-grown adherent cells and neurospheres, into the midbrain region of embryonic zebrafish and analyzed transplanted larvae over time. Progressive brain tumor growth and premature larval death were observed using both cell lines; however, fewer transplanted neurosphere cells were needed for tumor growth and lethality. Tumors were heterogeneous, containing both cells expressing stem cell markers and cells expressing markers of differentiation. A small proportion of transplanted neurosphere cells expressed glial fibrillary acidic protein (GFAP or vimentin, markers of more differentiated cells, but this number increased significantly during tumor growth, indicating that these cells undergo differentiation in vivo. By contrast, most serum-grown adherent cells expressed GFAP and vimentin at the earliest times examined post-transplant. Both cell types produced brain tumors that contained Sox2+ cells, indicative of tumor stem cells. Transplanted larvae were treated with currently used GBM therapeutics, temozolomide or bortezomib, and this resulted in a reduction in tumor volume in vivo and an increase in survival. The standardized model reported here facilitates robust and reproducible analysis of glioblastoma tumor cells in real time and provides a

  15. Radiotherapy of patients with germ cell tumor

    International Nuclear Information System (INIS)

    Inomata, Taisuke; Maeda, Tomoho; Yoshida, Shoji; Ogawa, Yasuhiro; Hamada, Fumio; Imajo, Yoshinari; Gose, Kyuhei; Fujiwara, Kiyoshi.

    1986-01-01

    Twenty-one patients with germ cell tumor who received radiotherapy were discussed. There were eight patients with germinoma, two patients with malignant teratoma, three patients with pineocytoma (out of category of germ cell tumor today) and eight unverified patients. Irradiated dose was mostly from 50 Gy to 60 Gy and local irradiation was performed after whole brain irradiation in many cases. The effect of radiotherapy was not so good in patients with malignant teratoma. On the contrary, it was relatively good in patients with germinoma and five out of eight patients are alive with no symptoms of recurrence. Six out of eight unverified patients are also alive. Among them, several patients with germinoma are considered to be included. Germinoma occupies many cases of germ cell tumor and has a good response to radiotherapy. Against spinal cord metastasis and late recurrence, additional therapy, such as chemotherapy, seems to be useful to improve cure ratio. (author)

  16. Specific sensitivity of small cell lung cancer cell lines to the snake venom toxin taipoxin

    DEFF Research Database (Denmark)

    Poulsen, Thomas T; Pedersen, Nina; Perin, Mark S

    2005-01-01

    and relatively specifically expressed in SCLC, consistent with the neuroendocrine features of this cancer. Normally, NPR is exclusively expressed in neurons, where it associates with the homologous proteins neuronal pentraxins 1 and 2 (NP1 and NP2) in complexes capable of binding the snake venom neurotoxin...

  17. Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research

    NARCIS (Netherlands)

    Tetteh, Paul W.; Kretzschmar, Kai; Begthel, Harry; Van Den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; Van Es, Johan H.; Offerhaus, G. Johan A; Clevers, Hans

    2016-01-01

    Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic

  18. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 5: intercellular junctions and contacts between germs cells and Sertoli cells and their regulatory interactions, testicular cholesterol, and genes/proteins associated with more than one germ cell generation.

    Science.gov (United States)

    Hermo, Louis; Pelletier, R-Marc; Cyr, Daniel G; Smith, Charles E

    2010-04-01

    In the testis, cell adhesion and junctional molecules permit specific interactions and intracellular communication between germ and Sertoli cells and apposed Sertoli cells. Among the many adhesion family of proteins, NCAM, nectin and nectin-like, catenins, and cadherens will be discussed, along with gap junctions between germ and Sertoli cells and the many members of the connexin family. The blood-testis barrier separates the haploid spermatids from blood borne elements. In the barrier, the intercellular junctions consist of many proteins such as occludin, tricellulin, and claudins. Changes in the expression of cell adhesion molecules are also an essential part of the mechanism that allows germ cells to move from the basal compartment of the seminiferous tubule to the adluminal compartment thus crossing the blood-testis barrier and well-defined proteins have been shown to assist in this process. Several structural components show interactions between germ cells to Sertoli cells such as the ectoplasmic specialization which are more closely related to Sertoli cells and tubulobulbar complexes that are processes of elongating spermatids embedded into Sertoli cells. Germ cells also modify several Sertoli functions and this also appears to be the case for residual bodies. Cholesterol plays a significant role during spermatogenesis and is essential for germ cell development. Lastly, we list genes/proteins that are expressed not only in any one specific generation of germ cells but across more than one generation. Copyright 2009 Wiley-Liss, Inc.

  19. Tooth-germ damage by ionizing radiation

    International Nuclear Information System (INIS)

    Sobkowiak, E.M.; Beetke, E.; Bienengraeber, V.; Held, M.; Kittner, K.H.

    1977-01-01

    Experiments on animals (four-week-old dogs) were conducted in an investigation made to study the possibility of dose-dependent tooth-germ damage produced by ionizing radiation. The individual doses were 50 R and 200 R, respectively, and they were administered once to three times at weekly intervals. Hyperemia and edemata could be observed on tooth-germ pulps from 150 R onward. Both of these conditions became more acute as the radiation dose increased (from 150 R to 600 R). Possible damage to both the dentin and enamel is pointed out. (author)

  20. A Tetrameric Peptide Derived from Bovine Lactoferricin Exhibits Specific Cytotoxic Effects against Oral Squamous-Cell Carcinoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Víctor A. Solarte

    2015-01-01

    Full Text Available Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20–254, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90% in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.

  1. A Tetrameric Peptide Derived from Bovine Lactoferricin Exhibits Specific Cytotoxic Effects against Oral Squamous-Cell Carcinoma Cell Lines.

    Science.gov (United States)

    Solarte, Víctor A; Rosas, Jaiver E; Rivera, Zuly J; Arango-Rodríguez, Martha L; García, Javier E; Vernot, Jean-Paul

    2015-01-01

    Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC) cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20-25)4, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90%) in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.

  2. SATB1 regulates SPARC expression in K562 cell line through binding to a specific sequence in the third intron

    International Nuclear Information System (INIS)

    Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.

    2007-01-01

    Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron

  3. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A).

    Science.gov (United States)

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A

    1987-01-01

    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula. PMID:3498590

  4. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A).

    Science.gov (United States)

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A

    1987-08-01

    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula.

  5. Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research.

    Science.gov (United States)

    Tetteh, Paul W; Kretzschmar, Kai; Begthel, Harry; van den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; van Es, Johan H; Offerhaus, G Johan A; Clevers, Hans

    2016-10-18

    Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic anhydrase I (Car1) is a gene expressed uniquely in colonic epithelial cells. We generated a colon-specific inducible Car1 CreER knock-in (KI) mouse with broad Cre activity in epithelial cells of the proximal colon and cecum. Deletion of the tumor suppressor gene Apc using the Car1 CreER KI caused tumor formation in the cecum but did not yield adenomas in the proximal colon. Mutation of both Apc and Kras yielded microadenomas in both the cecum and the proximal colon, which progressed to macroadenomas with significant morbidity. Aggressive carcinomas with some invasion into lymph nodes developed upon combined induction of oncogenic mutations of Apc, Kras, p53, and Smad4 Importantly, no adenomas were observed in the small intestine. Additionally, we observed tumors from differentiated Car1-expressing cells with Apc/Kras mutations, suggesting that a top-down model of intestinal tumorigenesis can occur with multiple mutations. Our results establish the Car1 CreER KI as a valuable mouse model to study colon-specific tumorigenesis and metastasis as well as cancer-cell-of-origin questions.

  6. Stability of wheat germ oil obtained by supercritical carbon dioxide ...

    African Journals Online (AJOL)

    심정은

    accumulated gas volume passing through the apparatus were measured using a gas flow meter. Wheat germ oil was ..... of rancidity in wheat germ analyzed by headspace gas chromatography and sensory analysis. J. Agric. Food Chem.

  7. Position-specific isotope analysis by on-line pyrolysis coupled to IRMS

    Science.gov (United States)

    Gilbert, A.; Suda, K.; Yamada, K.; Ueno, Y.; Yoshida, N.

    2016-12-01

    Position-specific isotopic analyses (PSIA) provide unique information regarding the sources, sinks and processes related to natural molecules. For instance, PSIA of short-chain hydrocarbons could lead to temperature of formation and maturity of natural gas reservoirs [1][2]. In the last decade, quantitative Nuclear Magnetic Resonance (NMR) specrometry has been used for PSIA of organic molecules such as glucose or n-alkanes [3][4]. However, due to its low sensitivity, application to low amount geochemical samples remains challenging. In 1997, Corso & Brenna proposed to adapt a pyrolysis furnace to an isotope ratio mass spectrometer, making it possible the thermal degradation of the target molecule and the subsequent analysis of the d13C values of the fragments formed [5]. Starting from fatty acid methyl esters they demonstrated the absence of rearrangement during pyrolytic degradation and could determine the d13C value of carboxyl C-atom position. We adapted the system for the full characterization of position-specific isotope composition of small molecules (ethanol, acetic acid, alanine, propane). Nanomole amount of sample can be analyzed with a precision on intramolecular d13C values of 1‰ or lower [2]. We recently analyzed abiotic and thermogenic propane samples both from the field and from lab simulations. PSIA of propane shows systematic differences of position-specific isotope composition between thermogenic and abiotic samples. While the former show 13C-depletion on the terminal C-atom position - consistent with thermal cracking kinetic models [6] - abiotic samples show little or no preference for terminal or central 13C-isotopomer. These results emphasize the potential of PSIA to trace the the processes associated with organic molecules production. [1] Piasecki et al. 2016 GCA 188, 58 [2] Gilbert et al. 2016 GCA 177, 205 [3] Gilbert et al. 2012 PNAS, 109, 18204 [4] Gilbert et al. 2013 Org. Geochem, 62, 56 [5] Corso & Brenna 1997 PNAS, 94, 1049 [6] Tang et

  8. Germ plasm localisation of the HELICc of Vasa in Drosophila: analysis of domain sufficiency and amino acids critical for localisation

    Science.gov (United States)

    Wang, Szu-Chieh; Hsu, Hao-Jen; Lin, Gee-Way; Wang, Ting-Fang; Chang, Chun-Che; Lin, Ming-Der

    2015-09-01

    Formation of the germ plasm drives germline specification in Drosophila and some other insects such as aphids. Identification of the DEAD-box protein Vasa (Vas) as a conserved germline marker in flies and aphids suggests that they share common components for assembling the germ plasm. However, to which extent the assembly order is conserved and the correlation between functions and sequences of Vas remain unclear. Ectopic expression of the pea aphid Vas (ApVas1) in Drosophila did not drive its localisation to the germ plasm, but ApVas1 with a replaced C-terminal domain (HELICc) of Drosophila Vas (DmVas) became germ-plasm restricted. We found that HELICc itself, through the interaction with Oskar (Osk), was sufficient for germ-plasm localisation. Similarly, HELICc of the grasshopper Vas could be recruited to the germ plasm in Drosophila. Nonetheless, germ-plasm localisation was not seen in the Drosophila oocytes expressing HELICcs of Vas orthologues from aphids, crickets, and mice. We further identified that glutamine (Gln) 527 within HELICc of DmVas was critical for localisation, and its corresponding residue could also be detected in grasshopper Vas yet missing in the other three species. This suggests that Gln527 is a direct target of Osk or critical to the maintenance of HELICc conformation.

  9. In Vitro Modeling of Human Germ Cell Development Using Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Yuncheng Zhao

    2018-02-01

    Full Text Available Summary: Due to differences across species, the mechanisms of cell fate decisions determined in mice cannot be readily extrapolated to humans. In this study, we developed a feeder- and xeno-free culture protocol that efficiently induced human pluripotent stem cells (iPSCs into PLZF+/GPR125+/CD90+ spermatogonium-like cells (SLCs. These SLCs were enriched with key genes in germ cell development such as MVH, DAZL, GFRα1, NANOS3, and DMRT1. In addition, a small fraction of SLCs went through meiosis in vitro to develop into haploid cells. We further demonstrated that this chemically defined induction protocol faithfully recapitulated the features of compromised germ cell development of PSCs with NANOS3 deficiency or iPSC lines established from patients with non-obstructive azoospermia. Taken together, we established a powerful experimental platform to investigate human germ cell development and pathology related to male infertility. : In this article, Wang and colleagues established a feeder- and xeno-free system to robustly induce human pluripotent stem cells (PSCs into spermatogonia-like cells. This chemically defined induction protocol faithfully recapitulated the features of compromised germ cell development of PSCs with NANOS3 deficiency or iPSC lines established from patients with non-obstructive azoospermia. Keywords: pluripotent stem cells, spermatogonia, infertility, non-obstructive azoospermia

  10. Cell-type-specific responses of RT4 neural cell lines to dibutyryl-cAMP: branch determination versus maturation

    International Nuclear Information System (INIS)

    Droms, K.; Sueoka, N.

    1987-01-01

    This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP

  11. Stages of Childhood Extracranial Germ Cell Tumors

    Science.gov (United States)

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  12. Linearization of germs of hyperbolic vector fields

    NARCIS (Netherlands)

    Bonckaert, P; Naudot, [No Value; Yang, JZ

    2003-01-01

    We develop a normal form to express asymptotically a conjugacy between a germ of resonant vector field and its linear part. We show that such an asymptotic expression can be written in terms of functions of the Logarithmic Mourtada type. To cite this article: P Bonckaert et al., C. R. Acad. Sci.

  13. Influence Of Specific Mechanical Energy On Cornmeal Viscosity Measured By An On-line System During Twin-screw Extrusion

    OpenAIRE

    Chang Y.K.; Martinez-Bustos F.; Park T.S.; Kokini J.L.

    1999-01-01

    The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...

  14. Ovarian mixed germ cell tumor with yolk sac and teratomatous components in a dog.

    Science.gov (United States)

    Robinson, Nicholas A; Manivel, J Carlos; Olson, Erik J

    2013-05-01

    Mixed germ cell tumors of the ovary have rarely been reported in veterinary species. A 3-year-old intact female Labrador Retriever dog was presented for lethargy, abdominal distention, and a midabdominal mass. An exploratory laparotomy revealed a large (23 cm in diameter) left ovarian tumor and multiple small (2-3 cm in diameter) pale tan masses on the peritoneum and abdominal surface of the diaphragm. Histological examination of the left ovary revealed a mixed germ cell tumor with a yolk sac component with rare Schiller-Duval bodies and a teratomatous component comprised primarily of neural differentiation. The abdominal metastases were solely comprised of the yolk sac component. The yolk sac component was diffusely immunopositive for cytokeratin with scattered cells reactive for α-fetoprotein and placental alkaline phosphatase. Within the teratomatous component, the neuropil was diffusely immunopositive for S100, neuron-specific enolase, and neurofilaments with a few glial fibrillary acidic protein immunopositive cells. Ovarian germ cell tumors may be pure and consist of only 1 germ cell element or may be mixed and include more than 1 germ cell element, such as teratoma and yolk sac tumor.

  15. Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms

    DEFF Research Database (Denmark)

    Svingen, T; Jørgensen, Anne; Rajpert-De Meyts, E

    2014-01-01

    to define suitable normalizing genes for specific cells and tissues. Here, we report on the performance of a panel of nine commonly employed normalizing genes in adult human testis and testicular pathologies. Our analyses revealed significant variability in transcript abundance for commonly used normalizers......, highlighting the importance of selecting appropriate normalizing genes as comparative measurements can yield variable results when different normalizing genes are employed. Based on our results, we recommend using RPS20, RPS29 or SRSF4 when analysing relative gene expression levels in human testis...... and associated testicular pathologies. OCT4 and SALL4 can be used with caution as second-tier normalizers when determining changes in gene expression in germ cells and germ cell tumour components, but the relative transcript abundance appears variable between different germ cell tumour types. We further...

  16. Pathobiology of germ cell tumors - applying the gossip test!

    Science.gov (United States)

    Looijenga, Leendert H J; Oosterhuis, J Wolter

    2013-01-01

    Residual mature teratoma, a frequent finding in clinical pathology since the introduction of cisplatin-based chemotherapy, put Wolter Oosterhuis on the track of germ cell tumors (GCTs). These neoplasms in the borderland between developmental biology and oncology have fascinated him ever since. He tells the story on how GCTs brought him in contact with leading investigators in the field like Ivan Damjanov, Peter Andrews, and Niels Skakkebaek. His fruitful line of research was made possible through a longstanding collaboration with Bauke de Jong and, to this day, Leendert Looijenga who joined his group as a student in 1988. Probably their most important contribution to the field of GCTs is an integrated approach to GCTs, combining epidemiology, pathology, (cyto)genetics and molecular biology, that has resulted in a pathobiology-based classification of GCTs in five types. It has clinical relevance and stimulates further research on these intriguing neoplasms and their corresponding animal models.

  17. NANOG priming before full reprogramming may generate germ cell tumours

    Directory of Open Access Journals (Sweden)

    I Grad

    2011-11-01

    Full Text Available Reprogramming somatic cells into a pluripotent state brings patient-tailored, ethical controversy-free cellular therapy closer to reality. However, stem cells and cancer cells share many common characteristics; therefore, it is crucial to be able to discriminate between them. We generated two induced pluripotent stem cell (iPSC lines, with NANOG pre-transduction followed by OCT3/4, SOX2, and LIN28 overexpression. One of the cell lines, CHiPS W, showed normal pluripotent stem cell characteristics, while the other, CHiPS A, though expressing pluripotency markers, failed to differentiate and gave rise to germ cell-like tumours in vivo. Comparative genomic hybridisation analysis of the generated iPS lines revealed that they were genetically more stable than human embryonic stem cell counterparts. This analysis proved to be predictive for the differentiation potential of analysed cells. Moreover, the CHiPS A line expressed a lower ratio of p53/p21 when compared to CHiPS W. NANOG pre-induction followed by OCT3/4, SOX2, MYC, and KLF4 induction resulted in the same tumour-inducing phenotype. These results underline the importance of a re-examination of the role of NANOG during reprogramming. Moreover, this reprogramming method may provide insights into primordial cell tumour formation and cancer stem cell transformation.

  18. Sexual dimorphic expression of dnd in germ cells during sex reversal and its requirement for primordial germ cell survival in protogynous hermaphroditic grouper.

    Science.gov (United States)

    Sun, Zhi-Hui; Zhou, Li; Li, Zhi; Liu, Xiao-Chun; Li, Shui-Sheng; Wang, Yang; Gui, Jian-Fang

    2017-06-01

    Dead end (dnd), vertebrate-specific germ cell marker, had been demonstrated to be essential for primordial germ cell (PGC) migration and survival, and the link between PGC number and sex change had been revealed in some teleost species, but little is known about dnd in hermaphroditic vertebrates. In the present study, a protogynous hermaphroditic orange-spotted grouper (Epinephelus coioides) dnd homologue (Ecdnd) was identified and characterized. Quantitative real-time PCR and in situ hybridization analysis revealed a dynamic and sexually dimorphic expression pattern in PGCs and germ cells of gonads. During sex changing, the Ecdnd transcript sharply increased in early transitional gonad, reached the highest level at late transitional gonad stage, and decreased after testis maturation. Visualization of zebrafish PGCs by injecting with RFP-Ecdnd-3'UTR RNA and GFP-zfnanos3-3'UTR RNA confirmed importance of Ecdnd 3'UTR for the PGC distribution. In addition, knockdown of EcDnd by using antisense morpholinos (MO) caused the ablation of PGCs in orange-spotted grouper. Therefore, the current data indicate that Ecdnd is essential for PGCs survival and may serve as a useful germ cell marker during gametogenesis in hermaphroditic grouper. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Multi-modality treatment in males with advanced malignant germ cell tumours

    International Nuclear Information System (INIS)

    Fossaa, S.D.; Klepp, O.; Ous, S.; Lien, H.; Stenwig, J.T.; Abeler, V.; Eliasson, G.; Hoest, H.

    1984-01-01

    After chemotherapy with cis-platinum, vinblastine and bleomycin, 33 surgical prosedures were performed in 29 patients with advanced malignant germ-cell tumours. The tumour masses could be completely resected macroscopially in 26 patients. Patients with fibros/necrosis or completely resected mature teratoma had an excellent prognosis, whereas only 5 of the 11 patients with vital malignant tumour survived in spite of second-line treatment with chemotherapy/radiotherapy. Preoperatively elevated serum levels of AFP, β-HCG and/or LDH indicated the presence of residual germ cell tumour. Eight of 14 patients were rendered tumour-free by radiotherapy given as second- or third-line treatment. In general, tumour masses, remaining after cis-platinum-based induction chemotherapy should be resected as completely as possible even in the case of mature teratoma or fibrosis/necrosis. Radiotherapy should be considered as second -and thirdline treatment

  20. Prognostic Factors and Treatment Results After Bleomycin, Etoposide, and Cisplatin in Germ Cell Cancer

    DEFF Research Database (Denmark)

    Kier, Maria G; Lauritsen, Jakob; Mortensen, Mette S

    2017-01-01

    BACKGROUND: First-line treatment for patients with disseminated germ cell cancer (GCC) is bleomycin, etoposide, and cisplatin (BEP). A prognostic classification of patients receiving chemotherapy was published by the International Germ Cell Cancer Collaborative Group (IGCCCG) in 1997, but only...... a small proportion of the patients received BEP. OBJECTIVE: To estimate survival probabilities after BEP, evaluate the IGCCCG prognostic classification, and propose new prognostic factors for outcome. DESIGN, SETTING, AND PARTICIPANTS: Of a Danish population-based cohort of GCC patients (1984-2007), 1889...... received first-line BEP, with median follow-up of 15 yr. Covariates evaluated as prognostic factors were age, year of treatment, primary site, non-pulmonary visceral metastases, pulmonary metastases, and tumor markers. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Outcomes measured were 5-yr progression...

  1. Molecular biology of testicular germ cell tumors.

    Science.gov (United States)

    Gonzalez-Exposito, R; Merino, M; Aguayo, C

    2016-06-01

    Testicular germ cell tumors (TGCTs) are the most common solid tumors in young adult men. They constitute a unique pathology because of their embryonic and germ origin and their special behavior. Genetic predisposition, environmental factors involved in their development and genetic aberrations have been under study in many works throughout the last years trying to explain the susceptibility and the transformation mechanism of TGCTs. Despite the high rate of cure in this type of tumors because its particular sensitivity to cisplatin, there are tumors resistant to chemotherapy for which it is needed to find new therapies. In the present work, it has been carried out a literature review on the most important molecular aspects involved in the onset and development of such tumors, as well as a review of the major developments regarding prognostic factors, new prognostic biomarkers and the possibility of new targeted therapies.

  2. Overview of the Graphical User Interface for the GERM Code (GCR Event-Based Risk Model

    Science.gov (United States)

    Kim, Myung-Hee; Cucinotta, Francis A.

    2010-01-01

    The descriptions of biophysical events from heavy ions are of interest in radiobiology, cancer therapy, and space exploration. The biophysical description of the passage of heavy ions in tissue and shielding materials is best described by a stochastic approach that includes both ion track structure and nuclear interactions. A new computer model called the GCR Event-based Risk Model (GERM) code was developed for the description of biophysical events from heavy ion beams at the NASA Space Radiation Laboratory (NSRL). The GERM code calculates basic physical and biophysical quantities of high-energy protons and heavy ions that have been studied at NSRL for the purpose of simulating space radiobiological effects. For mono-energetic beams, the code evaluates the linear-energy transfer (LET), range (R), and absorption in tissue equivalent material for a given Charge (Z), Mass Number (A) and kinetic energy (E) of an ion. In addition, a set of biophysical properties are evaluated such as the Poisson distribution of ion or delta-ray hits for a specified cellular area, cell survival curves, and mutation and tumor probabilities. The GERM code also calculates the radiation transport of the beam line for either a fixed number of user-specified depths or at multiple positions along the Bragg curve of the particle. The contributions from primary ion and nuclear secondaries are evaluated. The GERM code accounts for the major nuclear interaction processes of importance for describing heavy ion beams, including nuclear fragmentation, elastic scattering, and knockout-cascade processes by using the quantum multiple scattering fragmentation (QMSFRG) model. The QMSFRG model has been shown to be in excellent agreement with available experimental data for nuclear fragmentation cross sections, and has been used by the GERM code for application to thick target experiments. The GERM code provides scientists participating in NSRL experiments with the data needed for the interpretation of their

  3. Characterization of a human cell line stably over-expressing the candidate oncogene, dual specificity phosphatase 12.

    Directory of Open Access Journals (Sweden)

    Erica L Cain

    2011-04-01

    Full Text Available Analysis of chromosomal rearrangements within primary tumors has been influential in the identification of novel oncogenes. Identification of the "driver" gene(s within cancer-derived amplicons is, however, hampered by the fact that most amplicons contain many gene products. Amplification of 1q21-1q23 is strongly associated with liposarcomas and microarray-based comparative genomic hybridization narrowed down the likely candidate oncogenes to two: the activating transcription factor 6 (atf6 and the dual specificity phosphatase 12 (dusp12. While atf6 is an established transcriptional regulator of the unfolded protein response, the potential role of dusp12 in cancer remains uncharacterized.To evaluate the oncogenic potential of dusp12, we established stable cell lines that ectopically over-express dusp12 in isolation and determined whether this cell line acquired properties frequently associated with transformed cells. Here, we demonstrate that cells over-expressing dusp12 display increased cell motility and resistance to apoptosis. Additionally, over-expression of dusp12 promoted increased expression of the c-met proto-oncogene and the collagen and laminin receptor intergrin alpha 1 (itga1 which is implicated in metastasis.Collectively, these results suggest that dusp12 is oncologically relevant and exposes a potential association between dusp12 and established oncogenes that could be therapeutically targeted.

  4. DNA repair studies in mammalian germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.; Owens, J.G.

    1984-01-01

    In submammalian test systems, nitrosocarbamates (NEC) are 100-fold more mutagenic than are their corresponding nitrosourea homologues. To learn more about its interaction with germ-cell DNA in the mouse testis, male mice were given i.p. injections of NEC. Testicular injections of [ 3 H]dThd were given along with the NEC. Sixteen days after treatment, sperm were recovered from the caudal epididymides and assayed for an unscheduled-DNA-synthesis

  5. Irinotecan in patients with relapsed or cisplatin-refractory germ cell cancer: a phase II study of the German Testicular Cancer Study Group

    OpenAIRE

    Kollmannsberger, C; Rick, O; Klaproth, H; Kubin, T; Sayer, H G; Hentrich, M; Welslau, M; Mayer, F; Kuczyk, M; Spott, C; Kanz, L; Bokemeyer, C

    2002-01-01

    Despite generally high cure rates in patients with metastatic germ cell cancer, patients with progressive disease on first-line cisplatin-based chemotherapy or with relapsed disease following high-dose salvage therapy exhibit a very poor prognosis. Irinotecan has shown antitumour activity in human testicular tumour xenografts in nude mice. We have performed a phase II study examining the single agent activity of irinotecan in patients with metastatic relapsed or cisplatin-refractory germ cell...

  6. Radiation Therapy of Suprasellar Germ Cell Tumors

    International Nuclear Information System (INIS)

    Park, Woo Yoon; Choi, Doo Ho; Choi, Eun Kyung; Kim, Il Han; Ha, Sung Whan; Park, Charn Il

    1988-01-01

    A retrospective study was performed on 15 patients with suprasellar germ cell tumors treated by megavoltage external beam irradiation between Feb. 1979 and Dec. 1985. Follow-up period of survivors was 30 to 91 months. Histologic diagnosis was obtained before radiation therapy in 10 patients (9 germinomas and 1 mixed). Five patients were treated without histologic verification. In 9 patients with biopsy-proven germinomas radiation therapy was delivered to the craniospinal axis in 6, to the whole brain in 3. In 5 patients with mixed germ cell tumor or elevated tumor marker, irradiation was delivered to the craniospinal axis in 2, to the whole brain in 2, and to the primary site only in 1. Total doses ranged from 5,000 to 5,500 cGy to the primary site, 3,000 to 4,400 cGy to the whole brain, and 1,300 to 3,000 cGy to the spine. In these 14, local tumor was controlled and primary or spinal failure was not observed. One patient without elevated tumor marker was treated to the whole brain, The tumor was not controlled and he had spinal recurrence. It is proven that radiation therapy is an effective treatment for suprasellar germ cell tumors. The neuroendocrinologic presentation, tumor marker status, early response to radiation measured on CT seem to be useful means for selecting patients for radiation therapy when tissue diagnosis is not available

  7. Upregulation of meiosis-specific genes in lymphoma cell lines following genotoxic insult and induction of mitotic catastrophe

    International Nuclear Information System (INIS)

    Kalejs, Martins; Ivanov, Andrey; Plakhins, Gregory; Cragg, Mark S; Emzinsh, Dzintars; Illidge, Timothy M; Erenpreisa, Jekaterina

    2006-01-01

    We have previously reported that p53 mutated radioresistant lymphoma cell lines undergo mitotic catastrophe after irradiation, resulting in metaphase arrest and the generation of endopolyploid cells. A proportion of these endopolyploid cells then undergo a process of de-polyploidisation, stages of which are partially reminiscent of meiotic prophase. Furthermore, expression of meiosis-specific proteins of the cancer/testis antigens group of genes has previously been reported in tumours. We therefore investigated whether expression of meiosis-specific genes was associated with the polyploidy response in our tumour model. Three lymphoma cell lines, Namalwa, WI-L2-NS and TK6, of varying p53 status were exposed to a single 10 Gy dose of gamma radiation and their responses assessed over an extended time course. DNA flow cytometry and mitotic counts were used to assess the kinetics and extent of polyploidisation and mitotic progression. Expression of meiotic genes was analysed using RT-PCR and western blotting. In addition, localisation of the meiotic cohesin REC8 and its relation to centromeres was analysed by immunofluorescence. The principal meiotic regulator MOS was found to be significantly post-transcriptionally up-regulated after irradiation in p53 mutated but not p53 wild-type lymphoma cells. The maximum expression of MOS coincided with the maximal fraction of metaphase arrested cells and was directly proportional to both the extent of the arrest and the number of endopolyploid cells that subsequently emerged. The meiotic cohesin REC8 was also found to be up-regulated after irradiation, linking sister chromatid centromeres in the metaphase-arrested and subsequent giant cells. Finally, RT-PCR revealed expression of the meiosis-prophase genes, DMC1, STAG3, SYCP3 and SYCP1. We conclude that multiple meiotic genes are aberrantly activated during mitotic catastrophe in p53 mutated lymphoma cells after irradiation. Furthermore, we suggest that the coordinated expression

  8. Plasmodium falciparum parasites expressing pregnancy-specific variant surface antigens adhere strongly to the choriocarcinoma cell line BeWo

    DEFF Research Database (Denmark)

    Haase, Rikke N; Megnekou, Rosette; Lundquist, Maja

    2006-01-01

    Placenta-sequestering Plasmodium falciparum parasites causing pregnancy-associated malaria express pregnancy-specific variant surface antigens (VSA(PAM)). We report here that VSA(PAM)-expressing patient isolates adhere strongly to the choriocarcinoma cell line BeWo and that the BeWo line can...... be used to efficiently select for VSA(PAM) expression in vitro....

  9. Ghrelin modulates testicular germ cells apoptosis and proliferation in adult normal rats

    International Nuclear Information System (INIS)

    Kheradmand, Arash; Dezfoulian, Omid; Alirezaei, Masoud; Rasoulian, Bahram

    2012-01-01

    Highlights: ► Spermatogenesis is closely associated with the balance between germ cells proliferation and apoptosis. ► Numerous studies have documented the direct action of ghrelin in the modulation of apoptosis in different cell types. ► Ghrelin may be considered as a modulator of spermatogenesis in normal adult rats. ► Ghrelin may be potentially implicated for abnormal spermatogenesis in some testicular germ cell tumors. -- Abstract: Under normal condition in the most mammals, spermatogenesis is closely associated with the balance between germ cells proliferation and apoptosis. The present study was designed to determine the effects of ghrelin treatment on in vivo quality and quantity expression of apoptosis and proliferation specific indices in rat testicular germ cells. Twenty eight adult normal rats were subdivided into equal control and treatment groups. Treatment group received 3 nmol of ghrelin as subcutaneous injection for 30 consecutive days or vehicle to the control animals. The rats from each group (n = 7) were killed on days 10 and 30 and their testes were taken for immunocytochemical evaluation and caspase-3 assay. Immunohistochemical analysis indicated that the accumulations of Bax and PCNA peptides are generally more prominent in spermatocytes and spermatogonia of both groups. Likewise, the mean percentage of immunoreactive spermatocytes against Bax increased (P 0.05). Upstream of Bax substance parallel to down-regulation of PCNA demonstrate that ghrelin may prevent massive accumulation of germ cells during normal spermatogenesis. These observations also indicate that ghrelin may be considered as a modulator of spermatogenesis in normal adult rats and could be potentially implicated for abnormal spermatogenesis in some testicular germ cell tumors.

  10. Cross-talk between miR-471-5p and autophagy component proteins regulates LC3-associated phagocytosis (LAP) of apoptotic germ cells.

    Science.gov (United States)

    Panneerdoss, Subbarayalu; Viswanadhapalli, Suryavathi; Abdelfattah, Nourhan; Onyeagucha, Benjamin C; Timilsina, Santosh; Mohammad, Tabrez A; Chen, Yidong; Drake, Michael; Vuori, Kristiina; Kumar, T Rajendra; Rao, Manjeet K

    2017-09-19

    Phagocytic clearance of apoptotic germ cells by Sertoli cells is vital for germ cell development and differentiation. Here, using a tissue-specific miRNA transgenic mouse model, we show that interaction between miR-471-5p and autophagy member proteins regulates clearance of apoptotic germ cells via LC3-associated phagocytosis (LAP). Transgenic mice expressing miR-471-5p in Sertoli cells show increased germ cell apoptosis and compromised male fertility. Those effects are due to defective engulfment and impaired LAP-mediated clearance of apoptotic germ cells as miR-471-5p transgenic mice show lower levels of Dock180, LC3, Atg12, Becn1, Rab5 and Rubicon in Sertoli cells. Our results reveal that Dock180 interacts with autophagy member proteins to constitute a functional LC3-dependent phagocytic complex. We find that androgen regulates Sertoli cell phagocytosis by controlling expression of miR-471-5p and its target proteins. These findings suggest that recruitment of autophagy machinery is essential for efficient clearance of apoptotic germ cells by Sertoli cells using LAP.Although phagocytic clearance of apoptotic germ cells by Sertoli cells is essential for spermatogenesis, little of the mechanism is known. Here the authors show that Sertoli cells employ LC3-associated phagocytosis (LAP) by recruiting autophagy member proteins to clear apoptotic germ cells.

  11. ENDOCARDITIS WITH AN UNCOMMON GERM

    Directory of Open Access Journals (Sweden)

    M. Gharouni

    2006-07-01

    Full Text Available Enterococci are normal inhabitants of gastrointestinal tract, being responsible for 5 to 18% of infective endocarditis and the incidence appears to be increasing. Eleven patients with enterococcal endocarditis were studied. In a case series group, 10 men (average 57 years and one woman (37 years were studied. Two patients had rheumatic heart disease, 5 patients arteriosclerotic disease and one patient chronic renal failure on hemodialysis. Ten patients were treated with ampicillin and gentamycin. Valve replacement was performed in 3 patients with aortic valve endocarditis, one on 8th day and two at the end of the treatment. Overall clinical cure was achieved in 9 patients. Two relapses occurred and 2 patients died as a result of refractory congestive heart failure and cerebral emboli. All of the enterococcal endocarditis cases were community acquired. In conclusion, infective endocarditis in patients with preexistent valvular heart disease, community acquisition and non specific symptoms with bacteriuria should be considered as enterococcal endocarditis.

  12. Germ Cell Cancer and Multiple Relapses: Toxicity and Survival

    DEFF Research Database (Denmark)

    Lauritsen, Jakob; Kier, Maria G.G.; Mortensen, Mette S.

    2015-01-01

    Purpose: A small number of patients with germ cell cancer (GCC) receive more than one line of treatment for disseminated disease. The purpose of this study was to evaluate late toxicity and survival in an unselected cohort of patients who experienced relapse after receiving first-line treatment...... for disseminated disease. Methods: From the Danish Testicular Cancer database, we identified all patients who received more than one line of treatment for disseminated disease. Information about late toxicity and mortality was obtained by means of linkage to national registers. Prognostic factors for relapse......, compared with patients treated with only orchiectomy, had an increased risk for a second cancer (hazard ratio [HR], 3.2; 95% CI, 1.9 to 5.5), major cardiovascular disease (HR, 1.9; 95% CI, 1.0 to 3.3), pulmonary disease (HR, 2.0; 95% CI, 1.0 to 3.8), GI disease (HR, 7.3; 95% CI, 3.6 to 14.8), renal...

  13. Ovarian germ cell tumors with rhabdomyosarcomatous components and later development of growing teratoma syndrome: a case report

    Directory of Open Access Journals (Sweden)

    Al-Jumaily Usama

    2012-01-01

    Full Text Available Abstract Introduction Development of a sarcomatous component in a germ cell tumor is an uncommon phenomenon. Most cases reported have a grim prognosis. Growing teratoma syndrome is also an uncommon phenomenon and occurs in approximately 2% to 7% of non seminomatous germ cell tumors and should be treated surgically. Case presentation We report the case of a 12-year-old Asian girl with an ovarian mixed germ cell tumor containing a rhabdomyosarcomatous component. She was treated with a germ cell tumor chemotherapy regimen and rhabdomyosarcoma-specific chemotherapy. Towards the end of her treatment, she developed a retroperitoneal mass that was increasing in size. It was completely resected, revealing a mature teratoma, consistent with growing teratoma syndrome. She is still in complete remission approximately three years after presentation. Conclusion The presence of rhabdomyosarcoma in a germ cell tumor should be treated by a combined chemotherapy regimen (for germ cell tumor and rhabdomyosarcoma. In addition, development of a mass during or after therapy with normal serum markers should raise the possibility of growing teratoma syndrome that should be treated surgically.

  14. New Method for Simultaneous Species-Specific Identification of Equine Strongyles (Nematoda, Strongylida) by Reverse Line Blot Hybridization▿

    Science.gov (United States)

    Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.

    2007-01-01

    The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168

  15. On-line analysis of biosignals for the automation of total and specific sleep deprivation in the rat

    Directory of Open Access Journals (Sweden)

    ENNIO A VIVALDI

    2008-12-01

    Full Text Available A computer-based system that automates sleep studies, including sleep deprivation paradigms, is described. The system allows for total or REM-specific sleep deprivation and is based on a reliable, fast-responding, on-line state detection algorithm linked to a dependable intervention device. Behavioral state detection is achieved by dimensión reduction of short-term EEG power spectrum. Interventions are made by serial outputs to servomotors that move a cage with different patterns and variable intensity. The system can adapt itself to individual characteristics and to changes in recording conditions. Customized protocols can be designed by defining the states or stages to be deprived, including scheduling temporal patterns. A detailed analysis of the relevant signáis during and after deprivation is readily available. Data is presented from two experimental designs in rats. One consisted of specific REM-sleep short-term deprivation and the other of 10-hour total sleep deprivation. An outline of conceptual and practical considerations involved in the automation of laboratory set-ups oriented to biosignal analysis is provided. Careful monitoring of sleep EEG variables during sleep deprivation suggests peculiarities of brain functioning in that condition. A corollary is that sleep deprivation should not be considered to be merely a forced prolonged wakefulness.

  16. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))

    1988-09-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.

  17. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    International Nuclear Information System (INIS)

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.

    1988-01-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression

  18. Melting of the flux line lattice observed by specific heat experiments in YBa2Cu3O7-δ

    International Nuclear Information System (INIS)

    Roulin, M.; Junod, A.; Erb, A.; Walker, E.

    1996-01-01

    High resolution adiabatic specific heat experiments on YBa 2 Cu 3 O 7-δ (0≤δ≤0.05) are performed in magnetic fields from 0 to 14 T (B parallel c and B perpendicular c). In a 0.3 gram, twinned crystal with strong pinning, a step is consistently observed at the melting temperature T m of the vortex solid up to a critical point that depends on δ. The field B m and step temperature T m obey the relation B m =B m0 (δ)(1-T m /T c ) ∼4/3 . The anisotropy of B m and that of the upper critical field B c2 are found to be equal. Alternatively, in a 18 mg, twinned crystal of high purity with low pinning, first-order-like specific heat peaks are observed on the melting line from 8 to 14 T. The entropy under these peaks is ∼0.5 k B /vortex/bilayer. These characteristic features are attributed to the melting of a vortex glass in the former case and that of a vortex lattice in the latter case

  19. Ghrelin modulates testicular germ cells apoptosis and proliferation in adult normal rats

    Energy Technology Data Exchange (ETDEWEB)

    Kheradmand, Arash, E-mail: arashkheradmand@yahoo.com [Department of Clinical Sciences, School of Veterinary Medicine, Lorestan University, P.O. Box: 465, Khorram Abad (Iran, Islamic Republic of); Dezfoulian, Omid [Department of Pathobiology, School of Veterinary Medicine, Lorestan University, Khorram Abad (Iran, Islamic Republic of); Alirezaei, Masoud [Division of Biochemistry, School of Veterinary Medicine, Lorestan University, P.O. Box: 465, Khorram Abad (Iran, Islamic Republic of); Rasoulian, Bahram [Razi Herbal Medicine Research Center, Lorestan University of Medical Sciences, Khorram Abad (Iran, Islamic Republic of)

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer Spermatogenesis is closely associated with the balance between germ cells proliferation and apoptosis. Black-Right-Pointing-Pointer Numerous studies have documented the direct action of ghrelin in the modulation of apoptosis in different cell types. Black-Right-Pointing-Pointer Ghrelin may be considered as a modulator of spermatogenesis in normal adult rats. Black-Right-Pointing-Pointer Ghrelin may be potentially implicated for abnormal spermatogenesis in some testicular germ cell tumors. -- Abstract: Under normal condition in the most mammals, spermatogenesis is closely associated with the balance between germ cells proliferation and apoptosis. The present study was designed to determine the effects of ghrelin treatment on in vivo quality and quantity expression of apoptosis and proliferation specific indices in rat testicular germ cells. Twenty eight adult normal rats were subdivided into equal control and treatment groups. Treatment group received 3 nmol of ghrelin as subcutaneous injection for 30 consecutive days or vehicle to the control animals. The rats from each group (n = 7) were killed on days 10 and 30 and their testes were taken for immunocytochemical evaluation and caspase-3 assay. Immunohistochemical analysis indicated that the accumulations of Bax and PCNA peptides are generally more prominent in spermatocytes and spermatogonia of both groups. Likewise, the mean percentage of immunoreactive spermatocytes against Bax increased (P < 0.01) in the ghrelin-treated group on day 10, while despite of 30% increment in the Bax level of spermatocytes in the treated rats on day 30, however, it was not statistically significant. During the experimental period, only a few spermatogonia represented Bax expression and the changes of Bax immunolabling cells were negligible upon ghrelin treatment. Likewise, there were immunostaining cells against Bcl-2 in each germ cell neither in the control nor in the treated animals. In fact

  20. Generation and characterization of peptide-specific, MHC-restricted cytotoxic T lymphocyte (CTL) and helper T cell lines from unprimed T cells under microculture conditions.

    Science.gov (United States)

    Sambhara, S R; Upadhya, A G; Miller, R G

    1990-06-12

    We describe a microculture system for the generation of CTL and T helper cells against peptides. Tryptic digest and cyanogen bromide fragments of chicken ovalbumin and synthetic peptides of ovalbumin (323-339) and influenza virus (NP 365-380) were used to generate CTL and T helper lines from unprimed T cells. These lines were both peptide-specific and MHC-restricted. The relative ease of generating peptide-specific, MHC-restricted CTL and helper T cell lines with as few as 10(6) unprimed lymphocytes can be an efficient method of detecting potential immunogenic determinants of an antigen.

  1. Lipase inactivation in wheat germ by gamma irradiation

    International Nuclear Information System (INIS)

    Jha, Pankaj Kumar; Kudachikar, V.B.; Kumar, Sourav

    2013-01-01

    An attempt was made to improve the shelf life of wheat germ by optimizing processing conditions involving γ-irradiation. Studies were carried out to investigate the effect of γ-irradiation (0–30 kGy doses) on the chemical composition of wheat germ with respect to variation in moisture, total ash, crude fat, free fatty acid, protein and lipase activity. The results demonstrate that shelf stability of wheat germ was achieved by inactivation of lipase at doses of γ-irradiation greater than 12 kGy. - Highlights: Ø γ-irradiation was found to inactivate Lipase present in Wheat Germ. Ø The treatment did not result in significant changes in Total Ash, Moisture and Protein Content of Wheat Germ. Ø The irradiation at 30 kGy resulted in 31.2 % inactivation of Lipase in Wheat Germ

  2. Lin28a regulates germ cell pool size and fertility

    Science.gov (United States)

    Shinoda, Gen; de Soysa, T. Yvanka; Seligson, Marc T.; Yabuuchi, Akiko; Fujiwara, Yuko; Huang, Pei Yi; Hagan, John P.; Gregory, Richard I.; Moss, Eric G.; Daley, George Q.

    2013-01-01

    Overexpression of LIN28A is associated with human germ cell tumors and promotes primordial germ cell (PGC) development from embryonic stem cells in vitro and in chimeric mice. Knockdown of Lin28a inhibits PGC development in vitro, but how constitutional Lin28a deficiency affects the mammalian reproductive system in vivo remains unknown. Here, we generated Lin28a knockout (KO) mice and found that Lin28a deficiency compromises the size of the germ cell pool in both males and females by affecting PGC proliferation during embryogenesis. Interestingly however, in Lin28a KO males the germ cell pool partially recovers during postnatal expansion, while fertility remains impaired in both males and females mated to wild type mice. Embryonic overexpression of let-7, a microRNA negatively regulated by Lin28a, reduces the germ cell pool, corroborating the role of the Lin28a/let-7 axis in regulating the germ lineage. PMID:23378032

  3. Epithelial cell specific properties and genetic complementation in a delta F508 cystic fibrosis nasal polyp cell line.

    Science.gov (United States)

    Kunzelmann, K; Lei, D C; Eng, K; Escobar, L C; Koslowsky, T; Gruenert, D C

    1995-09-01

    Analysis of vectorial ion transport and protein trafficking in transformed cystic fibrosis (CF) epithelial cells has been limited because the cells tend to lose their tight junctions with multiple subcultures. To elucidate ion transport and protein trafficking in CF epithelial cells, a polar cell line with apical and basolateral compartments will facilitate analysis of the efficacy of different gene therapy strategies in a "tight epithelium" in vitro. This study investigates the genotypic and phenotypic properties of a CF nasal polyp epithelial, delta F508 homozygote, cell line that has tight junctions pre-crisis. The cells (sigma CFNPE14o-) were transformed with an origin-of-replication defective SV40 plasmid. They develop transepithelial resistance in Ussing chambers and are defective in cAMP-dependent Cl- transport as measured by efflux of radioactive Cl-, short circuit current (Isc), or whole-cell patch clamp. Stimulation of the cells by bradykinin, histamine, or ATP seems to activate both K(+)- and Ca(+2)-dependent Cl- transport. Measurement of 36Cl- efflux following stimulation with A23187 and ionomycin indicate a Ca(+2)-dependent Cl- transport. Volume regulatory capacity of the cells is indicated by cell swelling conductance. Expression of the CF transmembrane conductance regulator mRNA was indicated by RT-PCR amplification. When cells are grown at 26 degrees C for 48 h there is no indication of cAMP-dependent Cl- as has been previously indicated in heterologous expression systems. Antibodies specific for secretory cell antigens indicate the presence of antigens found in goblet, serous, and mucous cells; in goblet and serous cells; or in goblet and mucous cells; but not antigens found exclusively in mucous or serous cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  5. Germ Plasm Biogenesis--An Oskar-Centric Perspective.

    Science.gov (United States)

    Lehmann, Ruth

    2016-01-01

    Germ granules are the hallmark of all germ cells. These membrane-less, electron-dense structures were first observed over 100 years ago. Today, their role in regulating and processing transcripts critical for the establishment, maintenance, and protection of germ cells is well established, and pathways outlining the biochemical mechanisms and physical properties associated with their biogenesis are emerging. © 2016 Elsevier Inc. All rights reserved.

  6. Assessment of General and Specific Combining Ability and Heterosis of Some Cucumber (Cucumis sativus L. Lines for Vegetative Traits

    Directory of Open Access Journals (Sweden)

    Fatemeh Moradipour

    2017-10-01

    Full Text Available Introduction: Cucumber (Cucumis sativus L. is one of the most widely cultivated vegetables. Plant length is a quantitative trait is controlled by many genes. These traits are difficult to study due to the complex nature of their inheritance. The combining ability estimation is useful in determining the breeding value of cucumber lines by suggesting the appropriate use in a breeding program. In studying combining ability, the most commonly utilized experimental approach is the diallel design. General combining ability is a measure of additive genetic action; and specific combining ability (SCA is deviation from additivity. General combining ability is a main effect and SCA is an interaction. The aim is to determine the breeding value of the cross. Heterosis has been utilized to exploit dominance variance through production of hybrids. There are reports on positive and negative heterosis in cucumber however, there are differences between reports. This research was conducted to estimate general and specific combining ability and heterosis in cucumber inbred lines and hybrids to produce hybrids with high yield and quality. Material and Methods: In the spring of 2014, the seven parental lines and their 21 F1 hybrid were planted at the University of Guilan, in loamy sand field. Three replications were arranged in a randomized complete block design. The sandy loam soil was prepared by plowing and disking and formed into raised beds by plowed and harrow prior to plant establishment. Rows were on 1 m centers and plants were about 25 cm apart in the row. Prior to planting 150 kg·ha-1 of nitrogen from urea and 100 kg·ha-1 of phosphorous from triple superphosphate and 80 kg·ha-1 of potassium sulfate was applied. Side dressing with the same amount of nitrogen and phosphorus occurred at 50% flowering stage. Irrigation with 250 m3·ha-1, three times weekly, was begun at plant first flowering. In each replication, 12 individuals of each line or hybrid were

  7. Cytokeratin expression in mouse lacrimal gland germ epithelium.

    Science.gov (United States)

    Hirayama, Masatoshi; Liu, Ying; Kawakita, Tetsuya; Shimmura, Shigeto; Tsubota, Kazuo

    2016-05-01

    The lacrimal gland secretes tear fluids that protect the ocular surface epithelium, and its dysfunction leads to dry eye disease (DED). The functional restoration of the lacrimal gland by engraftment of a bioengineered lacrimal gland using lacrimal gland germ epithelial cells has been proposed to cure DED in mice. Here, we investigate the expression profile of cytokeratins in the lacrimal gland germ epithelium to clarify their unique characteristics. We performed quantitative polymerase chain reaction (Q-PCR) and immunohistochemistry (IHC) analysis to clarify the expression profile of cytokeratin in the lacrimal gland germ epithelium. The mRNA expression of keratin (KRT) 5, KRT8, KRT14, KRT15, and KRT18 in the lacrimal gland germ epithelium was increased compared with that in mouse embryonic stem cells and the lacrimal gland germ mesenchyme, as analyzed by Q-PCR. The expression level of KRT15 increased in the transition from stem cells to lacrimal gland germ epithelium, then decreased as the lacrimal gland matured. IHC revealed that the expression set of these cytokeratins in the lacrimal gland germ epithelium was different from that in the adult lacrimal gland. The expression of KRT15 was observed in the lacrimal gland germ epithelium, and it segmentalized into some of the basal cells in the intercanulated duct in mature gland. We determined the expression profile of cytokeratins in the lacrimal gland epithelium, and identified KRT15 as a candidate unique cellular marker for the lacrimal gland germ epithelium. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Testicular germ cell tumours and parental occupational exposure to pesticides

    DEFF Research Database (Denmark)

    Le Cornet, Charlotte; Fervers, Béatrice; Oksbjerg Dalton, Susanne

    2015-01-01

    OBJECTIVES: A potential impact of exposure to endocrine disruptors, including pesticides, during intrauterine life, has been hypothesised in testicular germ cell tumour (TGCT) aetiology, but exposure assessment is challenging. This large-scale registry-based case-control study aimed to investigate...... controls per case were randomly selected from the general national populations, matched on year of birth. Information on parental occupation was collected through censuses or Pension Fund information and converted into a pesticide exposure index based on the Finnish National Job-Exposure Matrix. RESULTS......: A total of 9569 cases and 32 028 controls were included. No overall associations were found for either maternal or paternal exposures and TGCT risk in their sons, with ORs of 0.83 (95% CI 0.56 to 1.23) and of 1.03 (0.92 to 1.14), respectively. Country-specific estimates and stratification by birth cohorts...

  9. Generation of a Tph2 Conditional Knockout Mouse Line for Time- and Tissue-Specific Depletion of Brain Serotonin

    Science.gov (United States)

    Migliarini, Sara; Pacini, Giulia; Pasqualetti, Massimo

    2015-01-01

    Serotonin has been gaining increasing attention during the last two decades due to the dual function of this monoamine as key regulator during critical developmental events and as neurotransmitter. Importantly, unbalanced serotonergic levels during critical temporal phases might contribute to the onset of neuropsychiatric disorders, such as schizophrenia and autism. Despite increasing evidences from both animal models and human genetic studies have underpinned the importance of serotonin homeostasis maintenance during central nervous system development and adulthood, the precise role of this molecule in time-specific activities is only beginning to be elucidated. Serotonin synthesis is a 2-step process, the first step of which is mediated by the rate-limiting activity of Tph enzymes, belonging to the family of aromatic amino acid hydroxylases and existing in two isoforms, Tph1 and Tph2, responsible for the production of peripheral and brain serotonin, respectively. In the present study, we generated and validated a conditional knockout mouse line, Tph2 flox/flox, in which brain serotonin can be effectively ablated with time specificity. We demonstrated that the Cre-mediated excision of the third exon of Tph2 gene results in the production of a Tph2 null allele in which we observed the near-complete loss of brain serotonin, as well as the growth defects and perinatal lethality observed in serotonin conventional knockouts. We also revealed that in mice harbouring the Tph2 null allele, but not in wild-types, two distinct Tph2 mRNA isoforms are present, namely Tph2Δ3 and Tph2Δ3Δ4, with the latter showing an in-frame deletion of amino acids 84–178 and coding a protein that could potentially retain non-negligible enzymatic activity. As we could not detect Tph1 expression in the raphe, we made the hypothesis that the Tph2Δ3Δ4 isoform can be at the origin of the residual, sub-threshold amount of serotonin detected in the brain of Tph2 null/null mice. Finally, we set

  10. Quantification of healthy and atretic germ cells and follicles in the developing and post-natal ovary of the South American plains vizcacha, Lagostomus maximus: evidence of continuous rise of the germinal reserve.

    Science.gov (United States)

    Inserra, P I F; Leopardo, N P; Willis, M A; Freysselinard, A L; Vitullo, A D

    2014-02-01

    The female germ line in mammals is subjected to massive cell death that eliminates 60-85% of the germinal reserve by birth and continues from birth to adulthood until the exhaustion of the germinal pool. Germ cell demise occurs mainly through apoptosis by means of a biased expression in favour of pro-apoptotic members of the BCL2 gene family. By contrast, the South American plains vizcacha, Lagostomus maximus, exhibits sustained expression of the anti-apoptotic BCL2 gene throughout gestation and a low incidence of germ cell apoptosis. This led to the proposal that, in the absence of death mechanisms other than apoptosis, the female germ line should increase continuously from foetal life until after birth. In this study, we quantified all healthy germ cells and follicles in the ovaries of L. maximus from early foetal life to day 60 after birth using unbiased stereological methods and detected apoptosis by labelling with TUNEL assay. The healthy germ cell population increased continuously from early-developing ovary reaching a 50 times higher population number by the end of gestation. TUNEL-positive germ cells were develops in the absence of constitutive massive germ cell elimination.

  11. Germ cell differentiation and proliferation in the developing testis of the South American plains viscacha, Lagostomus maximus (Mammalia, Rodentia).

    Science.gov (United States)

    Gonzalez, C R; Muscarsel Isla, M L; Fraunhoffer, N A; Leopardo, N P; Vitullo, A D

    2012-08-01

    Cell proliferation and cell death are essential processes in the physiology of the developing testis that strongly influence the normal adult spermatogenesis. We analysed in this study the morphometry, the expression of the proliferation cell nuclear antigen (PCNA), cell pluripotency marker OCT-4, germ cell marker VASA and apoptosis in the developing testes of Lagostomus maximus, a rodent in which female germ line develops through abolished apoptosis and unrestricted proliferation. Morphometry revealed an increment in the size of the seminiferous cords with increasing developmental age, arising from a significant increase of PCNA-positive germ cells and a stable proportion of PCNA-positive Sertoli cells. VASA showed a widespread cytoplasmic distribution in a great proportion of proliferating gonocytes that increased significantly at late development. In the somatic compartment, Leydig cells increased at mid-development, whereas peritubular cells showed a stable rate of proliferation. In contrast to other mammals, OCT-4 positive gonocytes increased throughout development reaching 90% of germ cells in late-developing testis, associated with a conspicuous increase in circulating FSH from mid- to late-gestation. TUNEL analysis was remarkable negative, and only a few positive cells were detected in the somatic compartment. These results show that the South American plains viscacha displays a distinctive pattern of testis development characterized by a sustained proliferation of germ cells throughout development, with no signs of apoptosis cell demise, in a peculiar endocrine in utero ambiance that seems to promote the increase of spermatogonial number as a primary direct effect of FSH.

  12. Depletion of endogenous germ cells in tree shrews in preparation for spermatogonial transplantation.

    Science.gov (United States)

    Liu, Tingting; Guo, Ying; Yan, Lanzhen; Sun, Bin; Zheng, Ping; Zhao, Xudong

    2017-09-01

    To achieve successful spermatogonial transplantation, endogenous germ cells must be depleted in recipient animals to allow donor germ cells to colonize efficiently. Busulfan is commonly used for the depletion of endogenous germ cells in recipient males. However, the optimal dose of busulfan is species-specific, and the optimal dose in tree shrews is yet to be determined. The current study aimed to determine the optimal dose of busulfan for effective suppression of endogenous spermatogenesis in tree shrews. Different doses (15, 20, 25, 30, 35, 40 and 45 mg/kg) of busulfan were injected into tree shrews intraperitoneally. Survival rates of the different treatment groups were calculated at 2 weeks and body weights were measured at 4, 6, 8, 10 and 28 weeks post-busulfan treatment. The testes were also removed and weighed at 4, 6, 8, 10 and 28 weeks post-treatment, and the cross and longitude diameters of the testes and diameters of the seminiferous tubules were measured and histologically evaluated. It was observed that there were no significant differences in the survival rates between the 15-35 mg/kg treatment groups and the control group (P>0.05), while the survival rate of the 40 mg/kg treatment group significantly decreased relative to the control group (Pendogenous germ cells in tree shrews. This dose led to maximum suppression of endogenous spermatogenesis while maintaining an acceptable survival rate of >50% of the lethal dose of busulfan for tree shrews.

  13. Exposure to endocrine disruptor induces transgenerational epigenetic deregulation of microRNAs in primordial germ cells.

    Directory of Open Access Journals (Sweden)

    Miguel A Brieño-Enríquez

    Full Text Available In mammals, germ cell differentiation is initiated in the Primordial Germ Cells (PGCs during fetal development. Prenatal exposure to environmental toxicants such as endocrine disruptors may alter PGC differentiation, development of the male germline and induce transgenerational epigenetic disorders. The anti-androgenic compound vinclozolin represents a paradigmatic example of molecule causing transgenerational effects on germ cells. We performed prenatal exposure to vinclozolin in mice and analyzed the phenotypic and molecular changes in three successive generations. A reduction in the number of embryonic PGCs and increased rate of apoptotic cells along with decrease of fertility rate in adult males were observed in F1 to F3 generations. Blimp1 is a crucial regulator of PGC differentiation. We show that prenatal exposure to vinclozolin deregulates specific microRNAs in PGCs, such as miR-23b and miR-21, inducing disequilibrium in the Lin28/let-7/Blimp1 pathway in three successive generations of males. As determined by global maps of cytosine methylation, we found no evidence for prominent changes in DNA methylation in PGCs or mature sperm. Our data suggest that embryonic exposure to environmental endocrine disruptors induces transgenerational epigenetic deregulation of expression of microRNAs affecting key regulatory pathways of germ cells differentiation.

  14. Esrp1 is a marker of mouse fetal germ cells and differentially expressed during spermatogenesis.

    Directory of Open Access Journals (Sweden)

    Shaghayegh Saeidi

    Full Text Available ESRP1 regulates alternative splicing, producing multiple transcripts from its target genes in epithelial tissues. It is upregulated during mesenchymal to epithelial transition associated with reprogramming of fibroblasts to iPS cells and has been linked to pluripotency. Mouse fetal germ cells are the founders of the adult gonadal lineages and we found that Esrp1 mRNA was expressed in both male and female germ cells but not in gonadal somatic cells at various stages of gonadal development (E12.5-E15.5. In the postnatal testis, Esrp1 mRNA was highly expressed in isolated cell preparations enriched for spermatogonia but expressed at lower levels in those enriched for pachytene spermatocytes and round spermatids. Co-labelling experiments with PLZF and c-KIT showed that ESRP1 was localized to nuclei of both Type A and B spermatogonia in a speckled pattern, but was not detected in SOX9+ somatic Sertoli cells. No co-localization with the nuclear speckle marker, SC35, which has been associated with post-transcriptional splicing, was observed, suggesting that ESRP1 may be associated with co-transcriptional splicing or have other functions. RNA interference mediated knockdown of Esrp1 expression in the seminoma-derived Tcam-2 cell line demonstrated that ESRP1 regulates alternative splicing of mRNAs in a non-epithelial cell germ cell tumour cell line.

  15. Critical Function of PRDM2 in the Neoplastic Growth of Testicular Germ Cell Tumors

    Directory of Open Access Journals (Sweden)

    Erika Di Zazzo

    2016-12-01

    Full Text Available Testicular germ cell tumors (TGCTs derive from primordial germ cells. Their maturation is blocked at different stages, reflecting histological tumor subtypes. A common genetic alteration in TGCT is a deletion of the chromosome 1 short arm, where the PRDM2 gene, belonging to the Positive Regulatory domain gene (PRDM family, is located. Expression of PRDM2 gene is shifted in different human tumors, where the expression of the two principal protein forms coded by PRDM2 gene, RIZ1 and RIZ2, is frequently unbalanced. Therefore, PRDM2 is actually considered a candidate tumor suppressor gene in different types of cancer. Although recent studies have demonstrated that PRDM gene family members have a pivotal role during the early stages of testicular development, no information are actually available on the involvement of these genes in TGCTs. In this article we show by qRT-PCR analysis that PRDM2 expression level is modulated by proliferation and differentiation agents such as estradiol, whose exposure during fetal life is probably an important risk factor for TGCTs development in adulthood. Furthermore in normal and cancer germ cell lines, PRDM2 binds estradiol receptor α (ERα and influences proliferation, survival and apoptosis, as previously reported using MCF-7 breast cancer cell line, suggesting a potential tumor-suppressor role in TGCT formation.

  16. Brief report: benchmarking human pluripotent stem cell markers during differentiation into the three germ layers unveils a striking heterogeneity: all markers are not equal.

    Science.gov (United States)

    Ramirez, Jean-Marie; Gerbal-Chaloin, Sabine; Milhavet, Ollivier; Qiang, Bai; Becker, Fabienne; Assou, Said; Lemaître, Jean-Marc; Hamamah, Samir; De Vos, John

    2011-09-01

    Pluripotent stem cells (PSC) are functionally characterized by their capacity to differentiate into all the cell types from the three germ layers. A wide range of markers, the expression of which is associated with pluripotency, has been used as surrogate evidence of PSC pluripotency, but their respective relevance is poorly documented. Here, we compared by polychromatic flow cytometry the kinetics of loss of expression of eight widely used pluripotency markers (SSEA3, SSEA4, TRA-1-60, TRA-1-81, CD24, OCT4, NANOG, and alkaline phosphatase [AP]) at days 0, 5, 7, and 9 after induction of PSC differentiation into cells representative of the three germ layers. Strikingly, each marker showed a different and specific kinetics of disappearance that was similar in all the PSC lines used and for all the induced differentiation pathways. OCT4, SSEA3, and TRA-1-60 were repeatedly the first markers to be downregulated, and their expression was completely lost at day 9. By contrast, AP activity, CD24, and NANOG proteins were still detectable at day 9. In addition, we show that differentiation markers are coexpressed with pluripotency markers before the latter begin to disappear. These results suggest that OCT4, SSEA3, and TRA-1-60 might be better to trace in vitro the emergence of pluripotent cells during reprogramming. Copyright © 2011 AlphaMed Press.

  17. Radiation- induced aneuploidy in mammalian germ cells

    International Nuclear Information System (INIS)

    Tease, C.

    1989-01-01

    The ability of ionizing radiation to induce aneuploidy in mammalian germ cells has been investigated experimentally in the laboratory mouse using a variety of cytogenetic and genetic methods. These studies have provided unambiguous evidence of induced nondisjunction in both male and female germ cells when the effect of irradiation is screened in meiotic cells or preimplantation embryos. In contrast, however, cytogenetic analyses of post-implantation embryos and genetic assays for induced chromosome gains have not found a significant radiation effect. These apparently contradictory findings may be reconciled if (a) radiation induces tertiary rather than primary trisomy, or (b) induces embryo-lethal genetic damage, such as deletions, in addition to numerical anomalies. Either or both of these explanations may account for the apparent loss during gestation of radiation-induced trisomic embryos. Extrapolating from the information so far available, it seems unlikely that environmental exposure to low doses if low dose rate radiation will result in a detectable increase in the rate of aneuploidy in the human population. (author)

  18. Intestinal obstruction in germ-free dogs.

    Science.gov (United States)

    Heneghan, J B; Robinson, J W; Menge, H; Winistörfer, B

    1981-08-01

    Mechanical occlusions were created in the intestines of four germ-free dogs. At the time of the operation, a control loop of mid-intestine was perfused in vivo and then excised for examinations in vitro, which included the determination of the equilibrium uptake of phenylalanine and of beta-methyl-glucoside, the influx kinetics of phenylalanine and morphometric analysis of the mucosa by microdissection and stereological techniques. Seven days after establishment of the occlusion the abdomen was reopened, and loops above and below the occlusion were perfused, and then excised for the same tests in vitro. Unlike occluded loops of conventional dogs, the intestine of the germ-free animal above the occlusion does not secrete water and electrolytes into the lumen. Its transport properties in vitro do not differ from those of the control loop, and the morphometric analyses reveal only slight changes in villus structure. The loop below the obstruction undergoes marked atrophy, as has been observed in conventional dogs. The results suggest that the copious secretion that occurs above an intestinal obstruction in normal animals is due to the presence of an abundant bacterial population in the obstruction fluid.

  19. Primordial germ cells and amnion development in the avian embryo

    NARCIS (Netherlands)

    De Melo Bernardo, Ana

    2016-01-01

    Primordial germ cells (PGCs) are the progenitors of the gametes, responsible for transmitting genetic information from generation to generation. Although there is a long history of gamete biology research, there is still a lot to be learned about many of the mechanisms underlying germ cell

  20. Childhood Central Nervous System Germ Cell Tumors Treatment

    Science.gov (United States)

    ... make hormones. Yolk sac tumors make the hormone alpha-fetoprotein (AFP). Mixed germ cell tumors are made of ... used to diagnose some CNS germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). Blood ...

  1. Is Tobacco Smoke a Germ-Cell Mutagen?

    Science.gov (United States)

    Although no international organization exists to declare whether an agent is a germ-cell mutagen, tobacco smoke may be a human germ-cell mutagen. In the mouse, tobacco smoke induces a significant increase in the mutation frequency at an expanded simple tandem repeat (ESTR) locus....

  2. Germ cell transplantation in an azoospermic Klinefelter bull.

    Science.gov (United States)

    Joerg, Hannes; Janett, Fredi; Schlatt, Stefan; Mueller, Simone; Graphodatskaya, Daria; Suwattana, Duangsmorn; Asai, Mika; Stranzinger, Gerald

    2003-12-01

    Germ cell transplantation is a technique that transfers donor testicular cells into recipient testes. A population of germ cells can colonize the recipient testis, initiate spermatogenesis, and produce sperm capable of fertilization. In the present study, a nonmosaic Klinefelter bull was used as a germ cell recipient. The donor cell suspension was introduced into the rete testis using ultrasound-guided puncture. A pulsatile administration of GnRH was performed to stimulate spermatogenesis. The molecular approach to detect donor cells was done by a quantitative polymerase chain reaction with allele discrimination based on a genetic mutation between donor and recipient. Therefore, a known genetic mutation, associated with coat-color phenotype, was used to calculate the ratio of donor to recipient cells in the biopsy specimens and ejaculates for 10 mo. After slaughtering, meiotic preparations were performed. The injected germ cells did not undergo spermatogenesis. Six months after germ cell transplantation, the donor cells were rejected, which indicates that the donor cells could not incorporate in the testis. The hormone stimulation showed that the testosterone-producing Leydig cells were functionally intact. Despite subfertility therapy, neither the recipient nor the donor cells underwent spermatogenesis. Therefore, nonmosaic Klinefelter bulls are not suitable as germ cell recipients. Future germ cell recipients in cattle could be mosaic Klinefelters, interspecies hybrids, bulls with Sertoli cell-only syndrome, or bulls with disrupted germ cell migration caused by RNA interference.

  3. Editorial Introduction [to Female Germ Cells: Biology and Genetic Risk

    Science.gov (United States)

    This is an editorial introduction to the special issue of utation Research, titled, emale Germ Cells: Biology and Genetic isk, which is an attempt to present a collection of papers that emphasize the distinct properties of female germ cells and their characteristic response to mu...

  4. Diet Matters: Endotoxin in the Diet Impacts the Level of Allergic Sensitization in Germ-Free Mice.

    Directory of Open Access Journals (Sweden)

    Martin Schwarzer

    Full Text Available Germ-free animals have been used to define the vital role of commensal bacteria on the maturation of the host immune system. However, the role of bacterial residues in diet in this setting is poorly understood. Here we investigated the effect of bacterial contamination in sterile diet on the level of allergic sensitization in germ-free mice. Sterile grain-based diets ST1 and R03 were tested for the level of bacterial contamination. ST1 contained higher amount of bacterial DNA, approximately ten times more endotoxin, and induced higher, TLR4-dependent, cytokine production in dendritic cells compared to R03. In a germ-free mouse model of sensitization to the major birch pollen allergen Bet v 1, feeding on ST1 for at least two generations was associated with decreased production of allergen-specific IgE and IgG1 antibodies in sera in comparison to R03. Furthermore, reduced levels of allergen-specific and ConA-induced cytokines IL-4, IL-5 and IL-13 accompanied by increased levels of IFN-γ were detected in splenocytes cultures of these mice. Our results show that contamination of experimental diet with bacterial residues, such as endotoxin, significantly affects the development of allergic sensitization in germ-free mice. Therefore, careful selection of sterile food is critical for the outcomes of germ-free or gnotobiotic experimental models of immune-deviated diseases.

  5. AZFa protein DDX3Y is differentially expressed in human male germ cells during development and in testicular tumours

    DEFF Research Database (Denmark)

    Gueler, B; Sonne, S B; Zimmer, J

    2012-01-01

    are believed to originate from fetal gonocytes.METHODSDDX3Y protein expression was analysed during development in different tissues by western blotting. The localization of DDX3Y in normal fetal and prepubertal testis tissue of different ages as well as in a series of distinct TGCT tissue samples (CIS......, classical seminoma, spermatocytic seminoma, teratoma and embryonal carcinoma) was performed by immunohistochemistry.RESULTSGerm cell-specific expression of DDX3Y protein was revealed in fetal prospermatogonia but not in gonocytes and not before the 17th gestational week. After birth, DDX3Y was expressed......, but not in somatically differentiated non-seminomas, consistent with its germ-cell specific function.CONCLUSIONSThe fetal germ cell DDX3Y expression suggests a role in early spermatogonial proliferation and implies that, in men with AZFa deletion, germ cell depletion may begin prenatally. The strong expression of DDX3Y...

  6. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 4: intercellular bridges, mitochondria, nuclear envelope, apoptosis, ubiquitination, membrane/voltage-gated channels, methylation/acetylation, and transcription factors.

    Science.gov (United States)

    Hermo, Louis; Pelletier, R-Marc; Cyr, Daniel G; Smith, Charles E

    2010-04-01

    As germ cells divide and differentiate from spermatogonia to spermatozoa, they share a number of structural and functional features that are common to all generations of germ cells and these features are discussed herein. Germ cells are linked to one another by large intercellular bridges which serve to move molecules and even large organelles from the cytoplasm of one cell to another. Mitochondria take on different shapes and features and topographical arrangements to accommodate their specific needs during spermatogenesis. The nuclear envelope and pore complex also undergo extensive modifications concomitant with the development of germ cell generations. Apoptosis is an event that is normally triggered by germ cells and involves many proteins. It occurs to limit the germ cell pool and acts as a quality control mechanism. The ubiquitin pathway comprises enzymes that ubiquitinate as well as deubiquitinate target proteins and this pathway is present and functional in germ cells. Germ cells express many proteins involved in water balance and pH control as well as voltage-gated ion channel movement. In the nucleus, proteins undergo epigenetic modifications which include methylation, acetylation, and phosphorylation, with each of these modifications signaling changes in chromatin structure. Germ cells contain specialized transcription complexes that coordinate the differentiation program of spermatogenesis, and there are many male germ cell-specific differences in the components of this machinery. All of the above features of germ cells will be discussed along with the specific proteins/genes and abnormalities to fertility related to each topic. Copyright 2009 Wiley-Liss, Inc.

  7. PRDM14 is expressed in germ cell tumors with constitutive overexpression altering human germline differentiation and proliferation

    Directory of Open Access Journals (Sweden)

    Joanna J. Gell

    2018-03-01

    Full Text Available Germ cell tumors (GCTs are a heterogeneous group of tumors occurring in gonadal and extragonadal locations. GCTs are hypothesized to arise from primordial germ cells (PGCs, which fail to differentiate. One recently identified susceptibility loci for human GCT is PR (PRDI-BF1 and RIZ domain proteins 14 (PRDM14. PRDM14 is expressed in early primate PGCs and is repressed as PGCs differentiate. To examine PRDM14 in human GCTs we profiled human GCT cell lines and patient samples and discovered that PRDM14 is expressed in embryonal carcinoma cell lines, embryonal carcinomas, seminomas, intracranial germinomas and yolk sac tumors, but is not expressed in teratomas. To model constitutive overexpression in human PGCs, we generated PGC-like cells (PGCLCs from human pluripotent stem cells (PSCs and discovered that elevated expression of PRDM14 does not block early PGC formation. Instead, we show that elevated PRDM14 in PGCLCs causes proliferation and differentiation defects in the germline. Keywords: Germ cell tumor, PRDM14, Cell differentiation, Primordial germ cell, Proliferation

  8. Developmental arrest of germ cells in the pathogenesis of germ cell neoplasia

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, E; Jørgensen, N; Brøndum-Nielsen, K

    1998-01-01

    Clinical observations and epidemiological evidence suggest that important aetiopathological events that cause neoplastic transformation of the male germ cell may occur in fetal life or early infancy. The incidence of germ cell neoplasia is high in individuals with various disorders of gonadal...... development and sexual differentiation, such as gonadal dysgenesis or androgen insensitivity syndrome. Increased risk has also been noted in individuals with trisomy 21, idiopathic infertility and low birth weight. Infertility is sometimes associated with small aberrations of sex chromosomes (e.g. low...... frequency mosaicism XY/XO) which can also be found in patients with testicular cancer. The variety of conditions that predispose to testicular neoplasia and the rise in its incidence in many countries speaks for the influence of environmental factors which may affect genetically predisposed individuals. We...

  9. Derivation of transplantable 7,12-dimethylbenz[a]anthracene-induced chicken fibrosarcoma lines: differences in metastasizing properties and organ specificity

    International Nuclear Information System (INIS)

    Galton, J.E.; Xue, B.; Hochwald, G.M.; Thorbecke, G.J.

    1982-01-01

    Transplantable 7,12-dimethylbenz[a]anthracene-induced SC chicken fibrosarcoma (CHCT-NYU) lines were studied for their ability to grow in internal organs after iv injection (artificial metastases) into 1- to 3-week-old chickens. Some tumor lines were recently derived, whereas others were studied after many serial subcutaneous transplantations. Artificial metastases were seen in the stomach, pancreas, lungs, heart, and muscle, and occasionally in the kidneys and liver. Agammaglobulinemic recipients showed more extensive organ involvement than normal recipients of the same age. Whole-body ν-irradiation enhanced the incidence of artificial metastases, particularly in lungs. Antibody from the serum of a primary tumor-bearing host reduced the growth of the corresponding tumor in many organs. The metastatic pattern of line CHCT-NYU4 was a relatively stable property. However, intravenous transplantation of tumor cells from line CHCT-NYU4 taken from the liver, lungs, and pancreas of a single recipient established sublines with changes in organ specificity. After a few such serial transplants of liver-derived tumor, a line was derived that grew virtually in the liver alone. A subline with preference for growth in lungs was also obtained, but its ability to grow in the pancreas persisted. A pancreas-derived tumor line also grew in the liver and lungs. Subcutaneous transplants of tissue fragments of the lung-derived tumor line caused the appearance of spontaneous metastases in lungs. The incidence of spontaneous metastases with the lung-derived line was much greater than that with the liver-derived line or with the original CHCT-NYU4 line

  10. Generation of a human induced pluripotent stem cell line (MUSIi001-A from caesarean section scar fibroblasts using Sendai viral vectors

    Directory of Open Access Journals (Sweden)

    Methichit Wattanapanitch

    2018-03-01

    Full Text Available We generated a human induced pluripotent stem cell (iPSC line from caesarean section scar fibroblasts of a 33-year-old healthy woman using transgene-free Sendai viral vectors under feeder-free condition. The established iPSC line, designated as MUSIi001-A, exhibited a normal karyotype, expressed pluripotent markers, differentiated into cells of three embryonic germ layers. Further analyses showed that the Sendai viral genome was absent at passage 25. The MUSIi001-A line can serve as a control for studying developmental biology and phenotypic comparison with disease-specific iPSCs.

  11. MRI of intracranial germ cell tumours

    International Nuclear Information System (INIS)

    Sumida, M.; Uozumi, T.; Kiya, K.; Mukada, K.; Arita, K.; Kurisu, K.; Sugiyama, K.; Onda, J.; Satoh, H.; Ikawa, F.; Migita, K.

    1995-01-01

    We reviewed MRI findings in proven intracranial germ cell tumours in 22 cases, 12 of whom received Gd-DTPA. On T1-weighted images, the signal intensity of the tumour parenchyma was moderately low in 19 cases and isointense in 3; on T2-weighted images, it was high in all cases. Regions of different intensity thought to be cysts were found in 17 (77 %): 7 of 12 patients with germinoma (58 %) and in all other cases. Of the 13 patients with pineal lesions T1-weighted sagittal images showed the aqueduct to be obstructed in 5, stenotic in 7 and normal in 1. Strong contrast enhancement was observed in all 12 cases. Of the 14 patients with suprasellar lesions, 5 were found to have an intrasellar extension, and in 3 of these, the normal pituitary gland, which could be distinguished from the tumour, was displaced anteriorly. Ten patients (45 %) had multiple lesions. (orig.)

  12. Tritium effects on germ cells and fertility

    International Nuclear Information System (INIS)

    Dobson, R.L.; Kwan, T.C.; Straume, T.

    1982-01-01

    Primordial oocytes in juvenile mice show acute gamma-ray LD 50 as low as 6 rad. This provides opportunities for determining dose-response relations at low doses and chronic exposure in the intact animal - conditions of particular interest for hazard evaluation. Examined in this way, 3 HOH in body water is found to kill murine oocytes exponentially with dose, the LD 50 level for chronic exposure being only 2μCi/ml (delivering 0.4 rad/day). At very low doses and dose rates, where comparisons between tritium and other radiations are of special significance for radiological protection, the RBE of tritium compared with 60 Co gamma radiation reaches approximately 3. Effects on murine fertility from tritium-induced oocyte loss have been quantified by reproductive capacity measurements. Chronic low-level exposure has been examined also in three primate species - squirrel, rhesus, and bonnet monkeys. In squirrel monkeys the ovarian germ-cell supply is 99% destroyed by the time of birth from prenatal exposure to body-water levels of 3 HOH (administered in maternal drinking water) of only 3 μCi/ml, the LD 50 level being 0.5 μCi/ml (giving 0.1 rad/day), one fourth that in mice. Though not completely ruled out, similar high sensitivity of female germ cells has not been found in macaques; and it probably does not occur in man. The exquisite radiosensitivity of primordial oocytes in mice is apparently due to vulnerability of the plasma membrane (or something of similar geometry and location), not DNA. Evidence for this comes from tritium data as well as neutron studies. Tritium administered as 3 HOH, and therefore generally distributed, is much more effective in killing murine oocytes than is tritium administered as 3 H-TdR, localized in the nucleus. This situation in the mouse may have implications for estimating radiation genetic risk in the human female

  13. Anti-Inflammatory Activity of Citric Acid-Treated Wheat Germ Extract in Lipopolysaccharide-Stimulated Macrophages.

    Science.gov (United States)

    Jeong, Hee-Yeong; Choi, Yong-Seok; Lee, Jae-Kang; Lee, Beom-Joon; Kim, Woo-Ki; Kang, Hee

    2017-07-10

    Until recently, fermentation was the only processing used to improve the functionality of wheat germ. The release of 2,6-dimethoxy-1,4-benzoquinone (DMBQ) from hydroquinone glycosides during the fermentation process is considered a marker of quality control. Here, we treated wheat germ extract with citric acid (CWG) to release DMBQ and examined the anti-inflammatory activity of this extract using a lipopolysaccharide-activated macrophage model. Treatment of wheat germ with citric acid resulted in detectable release of DMBQ but reduced total phenolic and total flavonoid contents compared with untreated wheat germ extract (UWG). CWG inhibited secretion of the pro-inflammatory cytokines tumor necrosis factor-α, interleukin (IL)-6, and IL-12 and the synthesis of cyclooxygenase-2, while UWG only decreased IL-12 production. CWG and UWG induced high levels of anti-inflammatory IL-10 and heme oxygenase-1. CWG specifically inhibited phosphorylation of NF-κB p65 and p38 kinase at 15 min after LPS stimulation. Our study showed that citric acid treatment enhanced the anti-inflammatory activity of wheat germ extract.

  14. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  15. Flexible adaptation of male germ cells from female iPSCs of endangered Tokudaia osimensis.

    Science.gov (United States)

    Honda, Arata; Choijookhuu, Narantsog; Izu, Haruna; Kawano, Yoshihiro; Inokuchi, Mizuho; Honsho, Kimiko; Lee, Ah-Reum; Nabekura, Hiroki; Ohta, Hiroshi; Tsukiyama, Tomoyuki; Ohinata, Yasuhide; Kuroiwa, Asato; Hishikawa, Yoshitaka; Saitou, Mitinori; Jogahara, Takamichi; Koshimoto, Chihiro

    2017-05-01

    In mammals, the Y chromosome strictly influences the maintenance of male germ cells. Almost all mammalian species require genetic contributors to generate testes. An endangered species, Tokudaia osimensis , has a unique sex chromosome composition XO/XO, and genetic differences between males and females have not been confirmed. Although a distinctive sex-determining mechanism may exist in T. osimensis , it has been difficult to examine thoroughly in this rare animal species. To elucidate the discriminative sex-determining mechanism in T. osimensis and to find a strategy to prevent its possible extinction, we have established induced pluripotent stem cells (iPSCs) and derived interspecific chimeras using mice as the hosts and recipients. Generated iPSCs are considered to be in the so-called "true naïve" state, and T. osimensis iPSCs may contribute as interspecific chimeras to several different tissues and cells in live animals. Surprisingly, female T. osimensis iPSCs not only contributed to the female germ line in the interspecific mouse ovary but also differentiated into spermatocytes and spermatids that survived in the adult interspecific mouse testes. Thus, T. osimensis cells have high sexual plasticity through which female somatic cells can be converted to male germline cells. These findings suggest flexibility in T. osimensis cells, which can adapt their germ cell sex to the gonadal niche. The probable reduction of the extinction risk of an endangered species through the use of iPSCs is indicated by this study.

  16. Stereotactic radiotherapy for pediatric intracranial germ cell tumors

    International Nuclear Information System (INIS)

    Zissiadis, Yvonne; Dutton, Sharon; Kieran, Mark; Goumnerova, Liliana; Scott, R. Michael; Kooy, Hanne M.; Tarbell, Nancy J.

    2001-01-01

    Purpose: Intracranial germ cell tumors are rare, radiosensitive tumors seen most commonly in the second and third decades of life. Radiotherapy alone has been the primary treatment modality for germinomas, and is used with chemotherapy for nongerminomatous tumors. Stereotactic radiotherapy techniques minimize the volume of surrounding normal tissue irradiated and, hence, the late radiation morbidity. This study reports our experience with stereotactic radiotherapy in this group of tumors. Methods and Materials: Between December 1992 and December 1998, 18 patients with intracranial germ cell tumors were treated with stereotactic radiotherapy. A total of 23 histologically proven tumors were treated. Thirteen patients had a histologic diagnosis of germinoma, and 5 patients had germinoma with nongerminomatous elements. Of those patients with a histologic diagnosis of germinoma, 5 had multiple midline tumors. The median age of the patients was 12.9 years (range, 5.6-17.5 years). Results: A boost using stereotactic radiotherapy was delivered to 19 tumors following whole-brain radiation in 8 cases and craniospinal radiation in 11 cases. Three tumors were treated with stereotactic radiotherapy to the tumor volume alone following chemotherapy, and 1 tumor received a boost using stereotactic radiosurgery following craniospinal radiation. A median dose of 2520 cGy (range, 1500-3600) cGy was given to the whole brain, and a median dose of 2160 (range, 2100-2600) cGy was given to the spinal field. The median boost dose to the tumor was 2600 (range, 2160-3600) cGy, given by stereotactic radiotherapy delivered to the 95% isodose line. At a median follow-up time of 40 (range, 12-73) months, no local or marginal recurrences were reported in patients with germinoma. Two patients with nongerminomatous tumors have relapsed. One had elevation of tumor markers only at 37 months following treatment, and the other had persistent disease following chemotherapy and radiation therapy. Eight

  17. Expression of germline markers in three species of amphioxus supports a preformation mechanism of germ cell development in cephalochordates

    Science.gov (United States)

    2013-01-01

    Background In a previous study, we showed that the cephalochordate amphioxus Branchiostoma floridae has localized maternal transcripts of conserved germ cell markers Vasa and Nanos in its early embryos. These results provided strong evidence to support a preformation mechanism for primordial germ cell (PGC) development in B. floridae. Results In this study, we further characterize the expression of B. floridae homologs of Piwi and Tudor, which play important roles in germline development in diverse metazoan animals. We show that maternal mRNA of one of the identified Piwi-like homologs, Bf-Piwil1, also colocalizes with Vasa in the vegetal germ plasm and has zygotic expression in both the putative PGCs and the tail bud, suggesting it may function in both germline and somatic stem cells. More interestingly, one Tudor family gene, Bf-Tdrd7, is only expressed maternally and colocalizes with Vasa in germ plasm, suggesting that it may function exclusively in germ cell specification. To evaluate the conservation of the preformation mechanism among amphioxus species, we further analyze Vasa, Nanos, Piwil1, and Tdrd7 expression in two Asian amphioxus species, B. belcheri and B. japonicum. Their maternal transcripts all localize in similar patterns to those seen in B. floridae. In addition, we labeled putative PGCs with Vasa antibody to trace their dynamic distribution in developing larvae. Conclusions We identify additional germ plasm components in amphioxus and demonstrate the molecular distinction between the putative germline stem cells and somatic stem cells. Moreover, our results suggest that preformation may be a conserved mechanism for PGC specification among Branchiostoma species. Our Vasa antibody staining results suggest that after the late neurula stage, amphioxus PGCs probably proliferate with the tail bud cells during posterior elongation and are deposited near the forming myomere boundaries. Subsequently, these PGCs would concentrate at the ventral tip of the

  18. [Study of enzymes of xenobiotic metabolism in the evaluation of quality of protein-containing wheat germ flakes and wallpaper flour].

    Science.gov (United States)

    Martinchuk, A N; E En Gyn; Safronova, A M; Peskova, E V

    1991-01-01

    Intake of wheat upholstery meal by growing rats was attended by a sharp decrease in the content and activity of xenobiotic metabolism enzymes in the hepatic microsomes, that was caused by the low biological value of the meal proteins. Hepatic microsomes of the rats that were fed with wheat germ flakes showed increased specific content of cytochromes P-450 and b5, but the total blood protein content per 100 g of body mass was lower than during casein consumption. No significant changes were detected in hydroxylation rate of benz(a)pyrene, aniline and ethylmorphine. During consumption of wheat germ flakes induction of UDP-glucuronide-transferase was detected in hepatic microsomes. Wheat germ flakes induced a 5-fold increase of Se-dependent glutathione peroxidase activity. Wheat germ flakes produced no significant effect on glutathione-S-aryltransferase and glutathione reductase activity.

  19. Homotypic aggregation of human cell lines by HLA class II-, class Ia- and HLA-G-specific monoclonal antibodies

    DEFF Research Database (Denmark)

    Odum, Niels; Ledbetter, J A; Martin, P

    1991-01-01

    Major histocompatibility complex (MHC) class II molecules have been implicated in cell adhesion in two ways. In addition to the well-established role of class II antigens in low-affinity adhesion provided by interactions between class II and CD4, recent data indicated that class II may also induce...... adhesion between T and B cells by activating the CD18/CD11a (LFA-1) adhesion pathway. Here we report that monoclonal antibodies (mAb) against HLA-DR (L243, p4.1, HB10a, VI15) and certain broad class II reacting mAb (TU35, TU39), but not anti-DQ (TU22, Leu-10) mAb, induced homotypic aggregation of human...... class II-positive monocytic (I937) and T leukemic (HUT78) tumor cell lines and Epstein-Barr virus (EBV) transformed B-lymphoid cell lines (EBV-LCL). Class II-negative cell lines (U-937 and the EBV-LCL mutant line 616) were not induced to aggregate. An HLA-G-transfected EBV-LCL, 221-AGN...

  20. From embryonic stem cells to testicular germ cell cancer-- should we be concerned?

    DEFF Research Database (Denmark)

    Almstrup, Kristian; Sonne, Si Brask; Hoei-Hansen, Christina E

    2006-01-01

    that initial hypothesis but also indicating that CIS cells have a striking phenotypic similarity to embryonic stem cells (ESC). Many cancers have been proposed to originate from tissue-specific stem cells [so-called 'cancer stem cells' (CSC)] and we argue that CIS may be a very good example of a CSC......, but with exceptional features due to the retention of embryonic pluripotency. In addition, considering the fact that pre-invasive CIS cells are transformed from early fetal cells, possibly due to environmentally induced alterations of the niche, we discuss potential risks linked to the uncontrolled therapeutic use......Since the discovery of testicular carcinoma in situ (CIS) -- the precursor cell for the vast majority of germ cell tumours -- it has been proposed that CIS cells could be derived from transformed primordial germ cells or gonocytes. Here, we review recent discoveries not only substantiating...

  1. Germ Cell Origins of Posttraumatic Stress Disorder Risk: The Transgenerational Impact of Parental Stress Experience.

    Science.gov (United States)

    Rodgers, Ali B; Bale, Tracy L

    2015-09-01

    Altered stress reactivity is a predominant feature of posttraumatic stress disorder (PTSD) and may reflect disease vulnerability, increasing the probability that an individual will develop PTSD following trauma exposure. Environmental factors, particularly prior stress history, contribute to the developmental programming of the hypothalamic-pituitary-adrenal stress axis. Critically, the consequences of stress experiences are transgenerational, with parental stress exposure impacting stress reactivity and PTSD risk in subsequent generations. Potential molecular mechanisms underlying this transmission have been explored in rodent models that specifically examine the paternal lineage, identifying epigenetic signatures in male germ cells as possible substrates of transgenerational programming. Here, we review the role of these germ cell epigenetic marks, including posttranslational histone modifications, DNA methylation, and populations of small noncoding RNAs, in the development of offspring stress axis sensitivity and disease risk. Copyright © 2015 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  2. Project W-314 specific test and evaluation plan for SN-635 transfer line (241-AY-01A to 241-AY-02A) and SN-633 transfer line tie in

    International Nuclear Information System (INIS)

    Hays, W.H.

    1998-01-01

    This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the installation of the SN-635 transfer line for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-635 transfer line and the tie in of SN-633 to the AY-02A pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)

  3. Localization of early germ cells in a stony coral, Euphyllia ancora: potential implications for a germline stem cell system in coral gametogenesis

    Science.gov (United States)

    Shikina, Shinya; Chung, Yi-Jou; Wang, Hsiang-Ming; Chiu, Yi-Ling; Shao, Zih-Fang; Lee, Yan-Horn; Chang, Ching-Fong

    2015-06-01

    Most corals exhibit annual or multiple gametogenic cycles. Thus far, coral gametogenesis has been studied in many species and locations during the past three decades; however, currently, only a few papers exist that describe the origin of germ cells, such as germline stem cells (GSCs), which support the continuous production of gametes in every reproductive cycle. To address this issue, in this study, we focused on and identified piwi gene, which has been used as a marker of germline cells, including GSCs, in various metazoans, in a scleractinian coral, Euphyllia ancora. Reverse-transcription PCR and Western blotting analyses revealed that E. ancora piwi-like ( Eapiwi) is expressed in mesentery tissues where the sites of gametogenesis are located for both sexes. Immunohistochemistry with a specific antibody against Eapiwi revealed strong immunoreactivity in the spermatogonia in males and in the oogonia and early oocytes in females, demonstrating that Eapiwi could be used as an early germ cell marker in E. ancora. Subsequent immunohistochemical analyses regarding the spatial and temporal distribution patterns of early germ cells in mesentery tissues revealed that early germ cells were present throughout the year in the mesentery tissue we examined, regardless of the sexual reproductive cycle. In particular, small numbers of early germ cells were observed in specific sites of mesentery tissues with fully matured gonads in both sexes. These early germ cells were not released together with mature gametes during the spawning period and remained in the mesentery tissues. These results suggested that these early germ cells most likely serve as a reservoir of germline cells and that some of these cells would produce differentiated germ cells for the upcoming sexual reproduction period; hence, these cells would function as GSCs. Our data provide new information for understanding continuous gamete production in corals.

  4. Lipid phosphate phosphatase activity regulates dispersal and bilateral sorting of embryonic germ cells in Drosophila

    Science.gov (United States)

    Renault, Andrew D.; Kunwar, Prabhat S.; Lehmann, Ruth

    2010-01-01

    In Drosophila, germ cell survival and directionality of migration are controlled by two lipid phosphate phosphatases (LPP), wunen (wun) and wunen-2 (wun2). wun wun2 double mutant analysis reveals that the two genes, hereafter collectively called wunens, act redundantly in primordial germ cells. We find that wunens mediate germ cell-germ cell repulsion and that this repulsion is necessary for germ cell dispersal and proper transepithelial migration at the onset of migration and for the equal sorting of the germ cells between the two embryonic gonads during their migration. We propose that this dispersal function optimizes adult fecundity by assuring maximal germ cell occupancy of both gonads. Furthermore, we find that the requirement for wunens in germ cell survival can be eliminated by blocking germ cell migration. We suggest that this essential function of Wunen is needed to maintain cell integrity in actively migrating germ cells. PMID:20431117

  5. Treatment Options By Stage (Ovarian Germ Cell Tumors)

    Science.gov (United States)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  6. Germ Cells are Made Semiotically Competent During Evolution

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2016-01-01

    Germ cells are cross-roads of development and evolution. They define the origin of every new generation and, at the same time, represent the biological end-product of any mature organism. Germ cells are endowed with the following capacities: (1) to store a self-descriptive program, (2......) to accumulate a protein-synthesizing machinery (ribosomes), and (3) to incorporate enough nourishment to sustain embryonic development (yolk). To accomplish this goal, germ cells do not simply unfold a pre-determined program or realize a sole instructive role. On the contrary, due to the complexity...... milieu and experience the compatibility of selected developmental sequences. The question of which signaling pathways are activated at each developmental stage does not result from a strictly predetermined program instructing germ cell stemness. Rather, each developmental sequence is an open...

  7. A large-scale analysis of tissue-specific pathology and gene expression of human disease genes and complexes

    DEFF Research Database (Denmark)

    Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart

    2008-01-01

    to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...

  8. Primary pleuro-pulmonary malignant germ cell tumours.

    Directory of Open Access Journals (Sweden)

    Vaideeswar P

    2002-01-01

    Full Text Available Lungs and pleura are rare sites for malignant germ-cell tumours. Two cases, pure yolk-sac tumour and yolk sac-sac tumour/embryonal carcinoma are described in young males who presented with rapid progression of respiratory symptoms. The malignant mixed germ cell tumour occurred in the right lung, while the yolk-sac tumour had a pseudomesotheliomatous growth pattern suggesting a pleural origin. Alpha-foetoprotein was immunohistochemically demonstrated in both.

  9. Electron microscopic observation of 137Cs-irradiated rat testis. Production of basal laminae for germ cells, despite their absence

    International Nuclear Information System (INIS)

    Sawada, Hajime; Esaki, Michiyo

    2003-01-01

    Whole body γ-ray irradiation of rats with caesium-137 ( 137 Cs) at embryonic day 20 induced marked reduction of the weight of the testis. Body weight and other tissues, however, seemed to remain normal. By light microscopy, complete loss of germ cells was observed in the testis. Other components, such as Sertoli cells and interstitial cells, seemed to be normal. The testes from day 8 postpartum rats contained very few spermatogonia compared with newborn rats, indicating loss of germ cells between days 0 and 8. In the adult, 137 Cs-irradiated testes showed two conspicuous features other than the loss of germ cells: empty vacuolar spaces between Sertoli cells and multilayered seminiferous tubule basal laminae (lamina densa). The junctional structures (ectoplasmic specializations) between Sertoli cells, however, seemed normal. The thickness of each layer of multilayered basal laminae was the same as that of normal rats and electron-lucent layers similar to lamina lucida were interposed between them. Of the empty vacuolar spaces between Sertoli cells, basal laminae bridge the gap. The basal laminae contained laminin, type IV collagen and heparan sulphate proteoglycan evenly distributed among layers, suggesting a normal composition. Rough estimation of the amount of basal laminae deposited in 137 Cs-irradiated rats indicates that it is within a range similar to that in normal testis. These features imply that Sertoli cells are, in part, determined perinatally to produce basal laminae for germ-line cells. (author)

  10. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  11. Preconception exposures to potential germ-cell mutagens

    International Nuclear Information System (INIS)

    Draper, G.

    2008-01-01

    Radiation and other agents can cause germ-cell mutations in animal systems. No human germ-cell mutagen has been identified, but this does not mean that human germ-cells are not vulnerable to mutagenesis. There has been particular concern about the possible health effects on offspring following parental preconception exposure to ionizing radiation - both occupational and therapeutic. A strong association with preconception radiation exposure in the fathers of the cases was found in a case-control study of young people with leukaemia living near the Sellafield nuclear plant in the UK. Subsequent studies of workers occupationally exposed to ionizing radiation have failed to confirm these findings. No statistically significant effects have been reported from studies of possible indicators of germ-cell mutagenesis in the A-bomb survivors. Studies of offspring of cancer survivors who receive radiotherapy and mutagenic chemotherapy have found no evidence of germ-cell mutagenesis. Failure to detect human germ-cell mutagenic agents may be a consequence of inadequate study sizes or insufficiently sensitive laboratory techniques. (authors)

  12. Baldness, acne and testicular germ cell tumors

    Science.gov (United States)

    Trabert, Britton; Sigurdson, Alice J.; Sweeney, Anne M.; Amato, Robert J.; Strom, Sara S.; McGlynn, Katherine A.

    2013-01-01

    Androgen levels during critical periods of testicular development may be involved in the etiology of testicular germ cell tumors (TGCT). We evaluated the roles of adolescent and early adult life correlates of androgen exposure and TGCT in a hospital-based case control study. TGCT cases (n=187) and controls (n=148), matched on age, race and state of residence, participated in the study. Unconditional logistic regression was used to estimate associations between TGCT and male pattern baldness, severe acne, markers of puberty onset and body size. Cases were significantly less likely to report hair loss than controls (OR, 0.6; 95% CI, 0.4, 1.0). Amount of hair loss, increasing age at onset and increasing rate of loss were all inversely associated with TGCT (rate of hair loss: p-trend=0.03; age at onset: p-trend=0.03; amount of hair loss: p-trend=0.01). History of severe acne was inversely associated with TGCT (OR, 0.5; 95% CI, 0.3, 0.9) and height was positively associated with TGCT (p-trend=0.02). Increased endogenous androgen levels during puberty and early adulthood may be associated with decreased risk of TGCT. Additional studies of endogenous hormone levels during puberty and early adult life are warranted, especially studies evaluating the role of androgen synthesis, metabolism and uptake. PMID:21128977

  13. MRI of intracranial germ-cell tumours

    International Nuclear Information System (INIS)

    Liang, L.; Korogi, Y.; Sugahara, T.; Ikushima, I.; Shigematsu, Y.; Okuda, T.; Takahashi, M.; Kochi, M.; Ushio, Y.

    2002-01-01

    Abstract. Our aim was to review the MRI appearances of primary intracranial germ-cell tumours (GCT). We reviewed the MRI studies of 32 patients: 19 with germinomas, five with teratomas, one with an embryonal carcinoma, five with mixed and two with malignant nongerminomatous GCT. Eleven were in the pineal region, 12 suprasellar, five in the both sites, two in the basal ganglia and two in the corpus callosum. Contrast-enhanced images were available for 27 patients. The solid parts of GCT were nearly isointense with grey matter on both T1- and T2-weighted images. In seven patients with nongerminomatous GCT high-signal components were found on T1-weighted images, representing haemorrhage, high-protein fluid or fat. Cystic components were detected in 17 of 27 patients; eight germinomas and all nine nongerminomatous GCT had cysts. The solid components of germinomas enhanced homogeneously in eight cases and heterogeneously in 10, while all nongerminomatous GCT showed heterogeneous enhancement. MRI features tumours can facilitate correct diagnosis of GCT, including histological subtypes. (orig.)

  14. Different Expression and Localization of Phosphoinositide Specific Phospholipases C in Human Osteoblasts, Osteosarcoma Cell Lines, Ewing Sarcoma and Synovial Sarcoma

    Directory of Open Access Journals (Sweden)

    V.Vasco

    2017-06-01

    Full Text Available Background: Bone hardness and strength depends on mineralization, which involves a complex process in which calcium phosphate, produced by bone-forming cells, was shed around the fibrous matrix. This process is strictly regulated, and a number of signal transduction systems were interested in calcium metabolism, such as the phosphoinositide (PI pathway and related phospholipase C (PLC enzymes. Objectives: Our aim was to search for common patterns of expression in osteoblasts, as well as in ES and SS. Methods: We analysed the PLC enzymes in human osteoblasts and osteosarcoma cell lines MG-63 and SaOS-2. We compared the obtained results to the expression of PLCs in samples of patients affected with Ewing sarcoma (ES and synovial sarcoma (SS. Results: In osteoblasts, MG-63 cells and SaOS-2 significant differences were identified in the expression of PLC δ4 and PLC η subfamily isoforms. Differences were also identified regarding the expression of PLCs in ES and SS. Most ES and SS did not express PLCB1, which was expressed in most osteoblasts, MG-63 and SaOS-2 cells. Conversely, PLCB2, unexpressed in the cell lines, was expressed in some ES and SS. However, PLCH1 was expressed in SaOS-2 and inconstantly expressed in osteoblasts, while it was expressed in ES and unexpressed in SS. The most relevant difference observed in ES compared to SS regarded PLC ε and PLC η isoforms. Conclusion: MG-63 and SaOS-2 osteosarcoma cell lines might represent an inappropriate experimental model for studies about the analysis of signal transduction in osteoblasts

  15. Critical role of CCDC6 in the neoplastic growth of testicular germ cell tumors

    International Nuclear Information System (INIS)

    Staibano, Stefania; Fusco, Alfredo; Chieffi, Paolo; Celetti, Angela; Ilardi, Gennaro; Leone, Vincenza; Luise, Chiara; Merolla, Francesco; Esposito, Francesco; Morra, Francesco; Siano, Maria; Franco, Renato

    2013-01-01

    DNA damage response has been clearly described as an anti-cancer barrier in early human tumorigenesis. Moreover, interestingly, testicular germ cell tumors (TGCTs) have been reported to lack the DNA Damage Response (DDR) pathway activation. CCDC6 is a pro-apoptotic phosphoprotein substrate of the kinase ataxia telangectasia mutated (ATM) able to sustain DNA damage checkpoint in response to genotoxic stress and is commonly rearranged in malignancies upon fusion with different partners. In our study we sought to determine whether CCDC6 could have a role in the patho-genesis of testicular germ cell tumors. To achieve this aim, analysis for CCDC6 expression has been evaluated on serial sections of the mouse testis by immunohistochemistry and on separate populations of murine testicular cells by western blot. Next, the resistance to DNA damage-induced apoptosis and the production of reactive oxygen species has been investigated in GC1 cells, derived from immortalized type B murine germ cells, following CCDC6 silencing. Finally, the CCDC6 expression in normal human testicular cells, in Intratubular Germ Cell Neoplasia Unclassified (IGCNU), in a large series of male germ cell tumours and in the unique human seminoma TCam2 cell line has been evaluated by immunohistochemistry and by Western Blot analyses. The analysis of the CCDC6 expression revealed its presence in Sertoli cells and in spermatogonial cells. CCDC6 loss was the most consistent feature among the primary tumours and TCam2 cells. Interestingly, following treatment with low doses of H 2 O 2 , the silencing of CCDC6 in GC1 cells caused a decrease in the oxidized form of cytochrome c and low detection of Bad, PARP-1 and Caspase 3 proteins. Moreover, in the silenced cells, upon oxidative damage, the cell viability was protected, the γH2AX activation was impaired and the Reactive Oxygen Species (ROS) release was decreased. Therefore, our results suggest that the loss of CCDC6 could aid the spermatogonial cells to

  16. Exposure to Brefeldin A promotes initiation of meiosis in murine female germ cells.

    Science.gov (United States)

    Zhang, Lian-Jun; Chen, Bo; Feng, Xin-Lei; Ma, Hua-Gang; Sun, Li-Lan; Feng, Yan-Min; Liang, Gui-Jin; Cheng, Shun-Feng; Li, Lan; Shen, Wei

    2015-01-01

    In mammals, ontogenesis starts from a fusion of spermatozoon and oocyte, which are produced by reductive nuclear division of a diploid germ cell in a specialised but complex biological process known as meiosis. However, little is known about the mechanism of meiotic initiation in germ cells, although many factors may be responsible for meiosis both in male and female gonads. In this study, 11.5 days post coitum (dpc) female fetal mouse genital ridges were cultured in vitro with exposure to Brefeldin A (BFA) for 6h, and the changes in meiosis were detected. Synaptonemal-complex analysis implied that BFA played a positive role in meiosis initiation and this hypothesis was confirmed by quantitative PCR of meiosis-specific genes: stimulated by retinoic acid gene 8 (Stra8) and deleted in a zoospermia-like (DAZL). At the same time, mRNA expression of retinoic acid synthetase (Raldh2) and retinoic acid (RA) receptors increased in female gonads with in vitro exposure to BFA. Transplanting genital ridges treated with BFA into the kidney capsule of immunodeficient mice demonstrated that the development capacity of female germ cells was normal, while formation of primordial follicles was seen to be a result of accelerated meiosis after exposure to BFA. In conclusion, the study indicated that BFA stimulated meiosis initiation partly by RA signalling and then promoted the development of follicles.

  17. Treatment with some anti-inflammatory drugs reduces germ tube formation in Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Elena Rusu

    2014-12-01

    Full Text Available Candida albicans is an opportunistic dimorphic fungus that inhabits various host mucosal sites. It can cause both superficial and serious systemic disease. Conversion from the yeast to the hyphal form has been associated with increased virulence and mucosal invasiveness. The aim of this study was to investigate the effect of sodium diclofenac and aspirin on germs tube formation of different Candida albicans strains. Prostaglandins may play an important role in fungal colonization. Nonsteroidal anti-inflammatory drugs are inhibitors of the cyclooxygenase isoenzymes. These drugs specifically block the biosynthesis of mammalian prostaglandins by inhibiting one or both of cyclooxygenase isoenzymes. In tests for germ tube formation sodium diclofenac reduced the filamentation to the 12.5%- 5.1%. In the presence of aspirin the filamentation was reduced up to 85-45% depending on the tested strain. Our results suggest that cyclooxygenase-depending synthesis of fungal prostaglandins is important for morphogenesis and fungal virulence. Inhibitors of cyclooxygenase isoensymes (aspirin and diclofenac are effective in decreasing germ tube formation of Candida albicans.

  18. SOX4 regulates gonad morphogenesis and promotes male germ cell differentiation in mice.

    Science.gov (United States)

    Zhao, Liang; Arsenault, Michel; Ng, Ee Ting; Longmuss, Enya; Chau, Tevin Chui-Ying; Hartwig, Sunny; Koopman, Peter

    2017-03-01

    The group C SOX transcription factors SOX4, -11 and -12 play important and mutually overlapping roles in development of a number of organs. Here, we examined the role of SoxC genes during gonadal development in mice. All three genes were expressed in developing gonads of both sexes, predominantly in somatic cells, with Sox4 being most strongly expressed. Sox4 deficiency resulted in elongation of both ovaries and testes, and an increased number of testis cords. While female germ cells entered meiosis normally, male germ cells showed reduced levels of differentiation markers Nanos2 and Dnmt3l and increased levels of pluripotency genes Cripto and Nanog, suggesting that SOX4 may normally act to restrict the pluripotency period of male germ cells and ensure their proper differentiation. Finally, our data reveal that SOX4 (and, to a lesser extent, SOX11 and -12) repressed transcription of the sex-determining gene Sox9 via an upstream testis-specific enhancer core (TESCO) element in fetal gonads, raising the possibility that SOXC proteins may function as transcriptional repressors in a context-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Germ Plasm Anchoring Is a Dynamic State that Requires Persistent Trafficking

    Directory of Open Access Journals (Sweden)

    Kristina S. Sinsimer

    2013-12-01

    Full Text Available Localized cytoplasmic determinants packaged as ribonucleoprotein (RNP particles direct embryonic patterning and cell fate specification in a wide range of organisms. Once established, the asymmetric distributions of such RNP particles must be maintained, often over considerable developmental time. A striking example is the Drosophila germ plasm, which contains RNP particles whose localization to the posterior of the egg during oogenesis results in their asymmetric inheritance and segregation of germline from somatic fates in the embryo. Although actin-based anchoring mechanisms have been implicated, high-resolution live imaging revealed persistent trafficking of germ plasm RNP particles at the posterior cortex of the Drosophila oocyte. This motility relies on cortical microtubules, is mediated by kinesin and dynein motors, and requires coordination between the microtubule and actin cytoskeletons. Finally, we show that RNP particle motility is required for long-term germ plasm retention. We propose that anchoring is a dynamic state that renders asymmetries robust to developmental time and environmental perturbations.

  20. Gene expression-signature of belinostat in cell lines is specific for histone deacetylase inhibitor treatment, with a corresponding signature in xenografts

    DEFF Research Database (Denmark)

    Monks, A.; Hose, C.D.; Pezzoli, P.

    2009-01-01

    gene modulation were significantly correlated. A belinostat-gene profile was specific for HDACi in three cell lines when compared with equipotent concentrations of four mechanistically different chemotherapeutic agents: 5-fluorouracil, cisplatin, paclitaxel, and thiotepa. Belinostat- and trichostatin...... in a drug-sensitive tumor than a more resistant model. We have demonstrated a gene signature that is selectively regulated by HDACi when compared with other clinical agents allowing us to distinguish HDACi responses from those related to other mechanisms Udgivelsesdato: 2009/9...

  1. Sexual Fate Change of XX Germ Cells Caused by the Deletion of SMAD4 and STRA8 Independent of Somatic Sex Reprogramming.

    Directory of Open Access Journals (Sweden)

    Quan Wu

    2016-09-01

    Full Text Available The differential programming of sperm and eggs in gonads is a fundamental topic in reproductive biology. Although the sexual fate of germ cells is believed to be determined by signaling factors from sexually differentiated somatic cells in fetal gonads, the molecular mechanism that determines germ cell fate is poorly understood. Herein, we show that mothers against decapentaplegic homolog 4 (SMAD4 in germ cells is required for female-type differentiation. Germ cells in Smad4-deficient ovaries respond to retinoic acid signaling but fail to undergo meiotic prophase I, which coincides with the weaker expression of genes required for follicular formation, indicating that SMAD4 signaling is essential for oocyte differentiation and meiotic progression. Intriguingly, germline-specific deletion of Smad4 in Stra8-null female germ cells resulted in the up-regulation of genes required for male gonocyte differentiation, including Nanos2 and PLZF, suggesting the initiation of male-type differentiation in ovaries. Moreover, our transcriptome analyses of mutant ovaries revealed that the sex change phenotype is achieved without global gene expression changes in somatic cells. Our results demonstrate that SMAD4 and STRA8 are essential factors that regulate the female fate of germ cells.

  2. Sexual Fate Change of XX Germ Cells Caused by the Deletion of SMAD4 and STRA8 Independent of Somatic Sex Reprogramming

    Science.gov (United States)

    Wu, Quan; Fukuda, Kurumi; Kato, Yuzuru; Zhou, Zhi; Deng, Chu-Xia; Saga, Yumiko

    2016-01-01

    The differential programming of sperm and eggs in gonads is a fundamental topic in reproductive biology. Although the sexual fate of germ cells is believed to be determined by signaling factors from sexually differentiated somatic cells in fetal gonads, the molecular mechanism that determines germ cell fate is poorly understood. Herein, we show that mothers against decapentaplegic homolog 4 (SMAD4) in germ cells is required for female-type differentiation. Germ cells in Smad4-deficient ovaries respond to retinoic acid signaling but fail to undergo meiotic prophase I, which coincides with the weaker expression of genes required for follicular formation, indicating that SMAD4 signaling is essential for oocyte differentiation and meiotic progression. Intriguingly, germline-specific deletion of Smad4 in Stra8-null female germ cells resulted in the up-regulation of genes required for male gonocyte differentiation, including Nanos2 and PLZF, suggesting the initiation of male-type differentiation in ovaries. Moreover, our transcriptome analyses of mutant ovaries revealed that the sex change phenotype is achieved without global gene expression changes in somatic cells. Our results demonstrate that SMAD4 and STRA8 are essential factors that regulate the female fate of germ cells. PMID:27606421

  3. BAX-mediated cell death affects early germ cell loss and incidence of testicular teratomas in Dnd1(Ter/Ter) mice.

    Science.gov (United States)

    Cook, Matthew S; Coveney, Douglas; Batchvarov, Iordan; Nadeau, Joseph H; Capel, Blanche

    2009-04-15

    A homozygous nonsense mutation (Ter) in murine Dnd1 (Dnd1(Ter/Ter)) results in a significant early loss of primordial germ cells (PGCs) prior to colonization of the gonad in both sexes and all genetic backgrounds tested. The same mutation also leads to testicular teratomas only on the 129Sv/J background. Male mutants on other genetic backgrounds ultimately lose all PGCs with no incidence of teratoma formation. It is not clear how these PGCs are lost or what factors directly control the strain-specific phenotype variation. To determine the mechanism underlying early PGC loss we crossed Dnd1(Ter/Ter) embryos to a Bax-null background and found that germ cells were partially rescued. Surprisingly, on a mixed genetic background, rescued male germ cells also generated fully developed teratomas at a high rate. Double-mutant females on a mixed background did not develop teratomas, but were fertile and produced viable off-spring. However, when Dnd1(Ter/Ter) XX germ cells developed in a testicular environment they gave rise to the same neoplastic clusters as mutant XY germ cells in a testis. We conclude that BAX-mediated apoptosis plays a role in early germ cell loss and protects from testicular teratoma formation on a mixed genetic background.

  4. TGF-b and a specific TGF-b inhibitor regulate pericentrin B and MYH9 in glioma cell lines

    Directory of Open Access Journals (Sweden)

    Óscar Álzate

    2006-01-01

    Full Text Available Malignant gliomas are heterogeneous, highly invasive vascular tumours. The multifunctional cytokine, transforming growth factor-beta (TGF-P, is expressed by grade III/IV gliomas and promotes tumour angiogenesis, invasión and immune escape. It has been shown previously that a small TGF-P receptor type I (TGF-(3-RI molecule inhibitor (SB-431542 blocks TGF-(3-mediated signal transduction, induction of angiogenic factor expression and cellular motility. As glioma cell lines display differential sensitivity to TGF-P, it was expected that they would also be differentially impacted by disruption of TGF-P signalling. Differential in gel expression (DIGE analysis and mass spectrometry was used in this work for determining protein regulation effects of both TGF-P and SB-431542 on human glioma cell lines. It was found that pericentrin B and non muscle myosin were differentially expressed in fragments which likely resulted from protease activation by the tumour growth mechanism. These results suggest that both pericentrin B and non-muscle myosin might be potential glioma biomarkers. Key words: DIGE, proteomics, glioma, TGF-P, mass spectrometry, non muscle myosin, pericentrin B.

  5. The origin and migration of primordial germ cells in sturgeons.

    Directory of Open Access Journals (Sweden)

    Taiju Saito

    Full Text Available Primordial germ cells (PGCs arise elsewhere in the embryo and migrate into developing gonadal ridges during embryonic development. In several model animals, formation and migration patterns of PGCs have been studied, and it is known that these patterns vary. Sturgeons (genus Acipenser have great potential for comparative and evolutionary studies of development. Sturgeons belong to the super class Actinoptergii, and their developmental pattern is similar to that of amphibians, although their phylogenetic position is an out-group to teleost fishes. Here, we reveal an injection technique for sturgeon eggs allowing visualization of germplasm and PGCs. Using this technique, we demonstrate that the PGCs are generated at the vegetal pole of the egg and they migrate on the yolky cell mass toward the gonadal ridge. We also provide evidence showing that PGCs are specified by inheritance of maternally supplied germplasm. Furthermore, we demonstrate that the migratory mechanism is well-conserved between sturgeon and other remotely related teleosts, such as goldfish, by a single PGCs transplantation (SPT assay. The mode of PGCs specification in sturgeon is similar to that of anurans, but the migration pattern resembles that of teleosts.

  6. Power lines and birds. A summary of general and grid-specific issues; Kraftledninger og fugl. Oppsummering av generelle og nettspesifikke prob-lemstillinger

    Energy Technology Data Exchange (ETDEWEB)

    Bevanger, Kjetil

    2011-02-15

    To achieve European-level policy goals on climate change challenges, as well securing the electricity supply within Norway, it will be necessary to increase power line construction efforts significantly, as well as to upgrade the existing grid. Statnett have estimated an approximately 40 billion NOK investment over the next 10 years will be required for the central grid. Although this is a huge investment, the length of the new transmission lines constructed will only comprise a small part of the Norwegian grid. Of approximately 193 000 km of overhead power lines in Norway the distribution grid (i.e. up to 24 kV) comprises 85%. In this report we discuss the ornithological challenges connected to the different elements of the Norwegian grid. All overhead wires pose a potential risk to flying birds; however, the risk increases with the number of lines and wire length per unit of land area. The central and regional grid, in general, represents no electrocution threat, as the distances between the phase conductors and/or the distance between a phase conductor and an earthed device is rather wide. Thus the electrocution problem is a distribution grid specific problem. Both the collision and the electrocution risk are highly species specific problems. Over the last years several research projects have collected data enabling an identification of the bird species and bird species groups facing a particular risk. However, there is still a lack of know-ledge in several respects, for example why the number of collisions is not evenly distributed along a power line section, but is frequently concentrated at a few spots. This type of knowledge is crucial to contribute to the selection of as environmentally friendly power line routing as possible when new power lines are constructed. This is also stressed in the new Energy Act of 2009. With respect to both upgrading, and to new power line constructions, underground cabling should be used to a much greater extent. This will

  7. Project W-314 specific test and evaluation plan for SN-633 transfer line (241-AX-B to 241-AY-02A)

    International Nuclear Information System (INIS)

    Hays, W.H.

    1998-01-01

    The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation

  8. Temporally and spatially dynamic germ cell niches in Botryllus schlosseri revealed by expression of a TGF-beta family ligand and vasa

    Directory of Open Access Journals (Sweden)

    Adam D. Langenbacher

    2016-04-01

    Full Text Available Abstract Background Germ cells are specified during early development and are responsible for generating gametes in the adult. After germ cells are specified, they typically migrate to a particular niche in the organism where they reside for the remainder of its lifetime. For some model organisms, the specification and migration of germ cells have been extensively studied, but how these events occur in animals that reproduce both sexually and asexually is not well understood. Results We have identified a novel TGF-β family member in Botryllus schlosseri, tgfβ-f, and found that it is expressed by follicle cell progenitors and the differentiated follicle and support cells surrounding the maturing gametes. Using the expression of tgfβ-f and the germ cell marker vasa, we have found that nearly all germ cells in Botryllus are associated with tgfβ-f-expressing follicle progenitors in clusters consisting solely of those two cell types. These clusters were mostly small, consisting of ten or fewer cells, and generally contained between a 2:1 and 1:1 ratio of follicle progenitors to germ cells. Clusters of germ and follicle progenitor cells were primarily localized to niches in the primary and secondary buds, but could also be found in other locations including the vasculature. We analyzed the location of germ cell clusters throughout the asexual life cycle of Botryllus and found that at the stage when germ cells are first detected in the secondary bud niche, a dramatic change in the size and location of germ/follicle cell clusters also occurred. Conclusions Our findings suggest that germ/follicle cell clusters have predictable migratory patterns during the weekly asexual developmental cycle in Botryllus. An increased number of small clusters and the presence of clusters in the vasculature coinciding with the appearance of clusters in the secondary bud suggest that fragmentation of clusters and the migration of smaller clusters through the vasculature

  9. First line treatment of advanced non-small-cell lung cancer – specific focus on albumin bound paclitaxel

    Directory of Open Access Journals (Sweden)

    Gupta N

    2013-12-01

    Full Text Available Neha Gupta, Hassan Hatoum, Grace K DyDepartment of Medicine, Roswell Park Cancer Institute, Buffalo, NY, USAAbstract: Lung cancer is the leading cause of cancer mortality worldwide in both men and women. Non-small-cell lung cancer (NSCLC is the most common type of lung cancer, accounting for more than 80% of cases. Paclitaxel has a broad spectrum of activity against various malignancies, including NSCLC. Paclitaxel is poorly soluble in water and thus, until recently, its commercially available preparations contained a non-ionic solvent Cremophor EL®. Cremophor EL® improves the solubility of paclitaxel and allows its intravenous administration. However, certain side-effects associated with paclitaxel, such as hypersensitivity reactions, myelosuppression, and peripheral neuropathy, are known to be worsened by Cremophor®. Nanoparticle albumin-bound paclitaxel ([nab-paclitaxel] ABRAXANE® ABI-007 is a new generation formulation of paclitaxel that obviates the need for Cremophor®, resulting in a safer and faster infusion without requiring the use of premedications to avoid hypersensitivity. Albumin-binding receptor-mediated delivery and lack of sequestering Cremophor® micelles allow higher intratumoral concentration of pharmacologically active paclitaxel. Multiple clinical trials have demonstrated a superior tolerability profile of nab-paclitaxel in comparison to solvent-bound paclitaxel (sb-paclitaxel. A recent Phase III trial compared the effects of weekly nab-paclitaxel in combination with carboplatin versus sb-paclitaxel in combination with carboplatin given every 3 weeks for first line treatment of NSCLC. This trial highlights the weekly nab-paclitaxel combination as an alternate treatment option for NSCLC, with higher response rate in squamous cell NSCLC and longer survival in elderly patients. This review will focus on the properties of nab-paclitaxel and its use in the first line treatment of NSCLC.Keywords: ABI-007, Abraxane, nab

  10. Maternal smoking and testicular germ cell tumors.

    Science.gov (United States)

    McGlynn, Katherine A; Zhang, Yawei; Sakoda, Lori C; Rubertone, Mark V; Erickson, Ralph L; Graubard, Barry I

    2006-10-01

    Testicular germ cell tumors (TGCT) are the most common cancer among men ages 15 to 35 years in the United States. The well-established TGCT risk factors cryptorchism, prior diagnosis of TGCT, and family history of testicular cancer indicate that exposures in early life and/or in the familial setting may be critical to determining risk. Previous reports of familial clustering of lung cancer in mothers and testicular cancers in sons suggest that passive smoking in childhood may be such an exposure. To clarify the relationship of passive smoking exposure to TGCT risk, data from 754 cases and 928 controls enrolled in the Servicemen's Testicular Tumor Environmental and Endocrine Determinants study were analyzed. Data from 1,086 mothers of the cases and controls were also examined. Overall, there was no relationship between maternal [odds ratio (OR), 1.1; 95% confidence interval (95% CI), 0.9-1.3] or paternal smoking (OR, 1.0; 95% CI, 0.8-1.3) and TGCT risk. Although living with a non-parent smoker was marginally related to risk (OR, 1.4; 95% CI, 1.0-2.1), there was no relationship with number of smokers, amount smoked, or duration of smoking. Responses from both case-control participants and mothers also revealed no relationship between either maternal smoking while pregnant or while breast-feeding. Results did not differ by TGCT histology (seminoma, non-seminoma). These results do not support the hypothesis that passive smoking, either in utero or in childhood, is related to risk of TGCT. Other early life exposures, however, may explain the familial clustering of lung cancer in mothers and TGCT in sons.

  11. Fidaxomicin versus Vancomycin as a First-Line Treatment for Clostridium difficile-Associated Diarrhea in Specific Patient Populations: A Pharmacoeconomic Evaluation.

    Science.gov (United States)

    Reveles, Kelly R; Backo, Jennifer L; Corvino, Frank A; Zivkovic, Marko; Broderick, Kelly C

    2017-12-01

    The reduction in recurrent Clostridium difficile-associated diarrhea (CDAD) with fidaxomicin therapy may reduce hospital readmissions and lead to lower overall CDAD costs. However, studies assessing the cost-effectiveness of fidaxomicin as first-line therapy from the U.S. hospital perspective are lacking. This study evaluated the costs associated with utilizing fidaxomicin or vancomycin as a first-line therapy for CDAD in specific patient populations from a U.S. hospital perspective. A decision-analytic model was developed to estimate total costs (hospitalization and drug costs) associated with using fidaxomicin or vancomycin as first-line therapy for a first episode and up to two recurrences of CDAD in five patient populations: general population, elderly, patients receiving concomitant antibiotics, and patients with renal impairment or cancer. The total cost of CDAD treatment using fidaxomicin first line in the general population was $14,442 per patient versus $14,179 per patient with vancomycin first line. In subgroup analyses, fidaxomicin use resulted in total hospital cost savings of $616 per patient in patients with cancer and $312 in patients with concomitant antibiotic use; vancomycin use was associated with total hospital cost savings of $243 per patient in the elderly and $371 in patients with renal impairment. Fidaxomicin as first-line CDAD therapy is associated with similar total costs as compounded vancomycin oral solution in the general population. In elderly and renally impaired patients, slight increases in hospital cost were observed with fidaxomicin therapy, and in patients with cancer or concomitant antibiotic use, hospital cost savings were observed. © 2017 Pharmacotherapy Publications, Inc.

  12. Endogenous DNA Damage and Risk of Testicular Germ Cell Tumors

    Energy Technology Data Exchange (ETDEWEB)

    Cook, M B; Sigurdson, A J; Jones, I M; Thomas, C B; Graubard, B I; Korde, L; Greene, M H; McGlynn, K A

    2008-01-18

    Testicular germ cell tumors (TGCT) are comprised of two histologic groups, seminomas and nonseminomas. We postulated that the possible divergent pathogeneses of these histologies may be partially explained by variable endogenous DNA damage. To assess our hypothesis, we conducted a case-case analysis of seminomas and nonseminomas using the alkaline comet assay to quantify single-strand DNA breaks and alkali-labile sites. The Familial Testicular Cancer study and the U.S. Radiologic Technologists cohort provided 112 TGCT cases (51 seminomas & 61 nonseminomas). A lymphoblastoid cell line was cultured for each patient and the alkaline comet assay was used to determine four parameters: tail DNA, tail length, comet distributed moment (CDM) and Olive tail moment (OTM). Odds ratios (OR) and 95% confidence intervals (95%CI) were estimated using logistic regression. Values for tail length, tail DNA, CDM and OTM were modeled as categorical variables using the 50th and 75th percentiles of the seminoma group. Tail DNA was significantly associated with nonseminoma compared to seminoma (OR{sub 50th percentile} = 3.31, 95%CI: 1.00, 10.98; OR{sub 75th percentile} = 3.71, 95%CI: 1.04, 13.20; p for trend=0.039). OTM exhibited similar, albeit statistically non-significant, risk estimates (OR{sub 50th percentile} = 2.27, 95%CI: 0.75, 6.87; OR{sub 75th percentile} = 2.40, 95%CI: 0.75, 7.71; p for trend=0.12) whereas tail length and CDM showed no association. In conclusion, the results for tail DNA and OTM indicate that endogenous DNA damage levels are higher in patients who develop nonseminoma compared with seminoma. This may partly explain the more aggressive biology and younger age-of-onset of this histologic subgroup compared with the relatively less aggressive, later-onset seminoma.

  13. MIWI2 as an Effector of DNA Methylation and Gene Silencing in Embryonic Male Germ Cells

    Directory of Open Access Journals (Sweden)

    Kanako Kojima-Kita

    2016-09-01

    Full Text Available During the development of mammalian embryonic germ cells, global demethylation and de novo DNA methylation take place. In mouse embryonic germ cells, two PIWI family proteins, MILI and MIWI2, are essential for the de novo DNA methylation of retrotransposons, presumably through PIWI-interacting RNAs (piRNAs. Although piRNA-associated MIWI2 has been reported to play critical roles in the process, its molecular mechanisms have remained unclear. To identify the mechanism, transgenic mice were produced; they contained a fusion protein of MIWI2 and a zinc finger (ZF that recognized the promoter region of a type A LINE-1 gene. The ZF-MIWI2 fusion protein brought about DNA methylation, suppression of the type A LINE-1 gene, and a partial rescue of the impaired spermatogenesis of MILI-null mice. In addition, ZF-MIWI2 was associated with the proteins involved in DNA methylation. These data indicate that MIWI2 functions as an effector of de novo DNA methylation of the retrotransposon.

  14. Intracranial germ cell tumors in adults. A retrospective study of 19 cases

    International Nuclear Information System (INIS)

    Agranat, P.; Jedynak, P.; Epardeau, B.; Mignot, L.; Extra, J.M.

    1995-01-01

    The authors report on the retrospective analysis of 19 patients with primary cerebral germ cell tumors which were treated between 1965 and 1993. Median age is 18 years (extremes: 16-55 years). There were 16 men and three women. The location of the primary tumor was the pineal area in six patients, suprasellar and hypothalamic area in five patients and other areas in eight patients. The histological pattern was non seminoma in six patients, dysgerminoma in eight; however no histological sample was obtained in five patients who did not have any particular characteristics (either cytological abnormalities or elevated tumor marker level). Three patients were treated by surgery only, eight patients received exclusive radiotherapy and eight patients had first line chemotherapy and further cranial irradiation. One was lost to follow up. Six of eight assessable patients with dysgerminoma are alive with non evolutive disease (NED) after 15 to 176 month of follow-up. One out of five assessable patients with non seminomatous tumor in NED (163 month of follow-up). Finally all five patients who have no histological subtyping are alive with NED at 24 to 138 months. The standard treatment of dysgerminoma is currently first line chemotherapy followed by relatively low-dose and limited irradiation; the standard treatment of non-seminomatous cerebral germ cell tumor is chemotherapy, the study of which is warranted with the aim to decrease the toxicity and to increase the efficacy. (authors). 36 refs., 7 tabs

  15. Immunofluorescence Analysis of Testicular Biopsies With Germ Cell and Sertoli Cell Markers Shows Significant MVH Negative Germ Cell Depletion With Older Age of Orchidopexy

    DEFF Research Database (Denmark)

    Li, Ruili; Thorup, Jørgen Mogens; Sun, Cong

    2014-01-01

    Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses ...... age of orchidopexy using a germ cell marker and a Sertoli cell marker on testicular biopsies.......Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses...

  16. Extracellular concentration of homocysteine in human cell lines is influenced by specific inhibitors of cyst(e)ine transport.

    Science.gov (United States)

    Hultberg, Björn

    2004-04-01

    Despite the growing evidence that plasma homocysteine is a cardiovascular risk factor, the mechanism behind the vascular injuries is still unknown. Studies of the cellular uptake systems for homocysteine are scarce, but membrane transporters of cyst(e)ine seem to be involved. In the present study the cellular uptake of extracellular homocysteine in HeLa and hepatoma cell lines is investigated by using several different transport inhibitors for cellular uptake of cyst(e)ine. It is shown that systems A and Xc- are the main transport systems for homocysteine uptake in HeLa cells. It is also confirmed that the magnitude of homocysteine uptake in hepatoma cells is lower than in HeLa cells. However, in the presence of high amounts of extracellular homocysteine both cell types exhibited a high elimination of homocysteine, which was inhibited by the presence of inhibitors of systems A or Xc-. It is possible that there is normally a high turnover of homocysteine in cell cultures, which is not detected by occasional determinations of homocysteine concentrations. The complex pattern of homocysteine production, release, uptake and distribution between different cells in the body is important to examine further in order to possibly be able to modulate the elimination of homocysteine from circulation and thereby lower the risk of cardiovascular disease.

  17. Tissue-specific signatures in the transcriptional response to Anaplasma phagocytophilum infection of Ixodes scapularis and Ixodes ricinus tick cell lines

    Directory of Open Access Journals (Sweden)

    Pilar eAlberdi

    2016-02-01

    Full Text Available Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum

  18. ATTEMPT TO APPLY STABILIZED WHEAT GERM FOR BREAD SUPPLEMENTATION

    Directory of Open Access Journals (Sweden)

    Halina Gambuś

    2015-02-01

    Full Text Available The increased interest in rational nutrition causes, that from many years is observed a growing consumption of bread, and novel food supplemented with health promoting components. For the bread production in Poland mainly wheat and rye cake flours are used, depleted of a many valuable nutrients such as protein, dietary fibre, minerals and vitamins. Because of their unique chemical composition wheat germs are a particularly valuable resource, both for direct consumption and to enhance the nutritional value of food products. The aim of the study was to prepare wheat bread with a 10% addition of commercial stabilized wheat germs. Based on the obtained results, it was found that wheat germs, due to their unique chemical composition, were a particularly valuable resource to supplement the nutritional value of bread. However, germs had detrimental effect on mechanical properties of dough, and on bread quality. Texture of bread crumb and its chemical composition were analysed. It was shown, that germs subjected to fermentation process could be used in wheat bread production as dietary fibre and mineral compound supplement.

  19. Functional anatomy of the hair follicle: The Secondary Hair Germ.

    Science.gov (United States)

    Panteleyev, Andrey A

    2018-07-01

    The secondary hair germ (SHG)-a transitory structure in the lower portion of the mouse telogen hair follicle (HF)-is directly involved in anagen induction and eventual HF regrowth. Some crucial aspects of SHG functioning and ontogenetic relations with other HF parts, however, remain undefined. According to recent evidence (in contrast to previous bulge-centric views), the SHG is the primary target of anagen-inducing signalling and a source of both the outer root sheath (ORS) and ascending HF layers during the initial (morphogenetic) anagen subphase. The SHG is comprised of two functionally distinct cell populations. Its lower portion (originating from lower HF cells that survived catagen) forms all ascending HF layers, while the upper SHG (formed by bulge-derived cells) builds up the ORS. The predetermination of SHG cells to a specific morphogenetic fate contradicts their attribution to the "stem cell" category and supports SHG designation as a "germinative" or a "founder" cell population. The mechanisms of this predetermination driving transition of the SHG from "refractory" to the "competent" state during the telogen remain unknown. Functionally, the SHG serves as a barrier, protecting the quiescent bulge stem cell niche from the extensive follicular papilla/SHG signalling milieu. The formation of the SHG is a prerequisite for efficient "precommitment" of these cells and provides for easier sensing and a faster response to anagen-inducing signals. In general, the formation of the SHG is an evolutionary adaptation, which allowed the ancestors of modern Muridae to acquire a specific, highly synchronized pattern of hair cycling. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Regulation of mitosis-meiosis transition by the ubiquitin ligase β-TrCP in male germ cells.

    Science.gov (United States)

    Nakagawa, Tadashi; Zhang, Teng; Kushi, Ryo; Nakano, Seiji; Endo, Takahiro; Nakagawa, Makiko; Yanagihara, Noriko; Zarkower, David; Nakayama, Keiko

    2017-11-15

    The mitosis-meiosis transition is essential for spermatogenesis. Specific and timely downregulation of the transcription factor DMRT1, and consequent induction of Stra8 expression, is required for this process in mammals, but the molecular mechanism has remained unclear. Here, we show that β-TrCP, the substrate recognition component of an E3 ubiquitin ligase complex, targets DMRT1 for degradation and thereby controls the mitosis-meiosis transition in mouse male germ cells. Conditional inactivation of β-TrCP2 in male germ cells of β-TrCP1 knockout mice resulted in sterility due to a lack of mature sperm. The β-TrCP-deficient male germ cells did not enter meiosis, but instead underwent apoptosis. The induction of Stra8 expression was also attenuated in association with the accumulation of DMRT1 at the Stra8 promoter in β-TrCP-deficient testes. DMRT1 contains a consensus β-TrCP degron sequence that was found to bind β-TrCP. Overexpression of β-TrCP induced the ubiquitylation and degradation of DMRT1. Heterozygous deletion of Dmrt1 in β-TrCP-deficient spermatogonia increased meiotic cells with a concomitant reduction of apoptosis. Collectively, our data indicate that β-TrCP regulates the transition from mitosis to meiosis in male germ cells by targeting DMRT1 for degradation. © 2017. Published by The Company of Biologists Ltd.

  1. "Mixed germ cell testicular tumor" in an adult female

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available The androgen insensitivity (testicular feminization syndrome was described by Morris in phenotypic females with 46XY karyotype, presenting with primary amenorrhea, adequate breast development, and absent or scanty pubic or axillary hair. Gonads consist usually of seminiferous tubules without spermatogenesis. These patients have a 5-10% risk of developing germ cell tumors, usually after the complete development of secondary female sexual characteristics. We hereby report a case considered as a female with married life of 15 years, who was operated for severe abdominal pain. Phenotype characters were that of female. Microscopic examination of the tumor from the abdomen revealed germinoma and yolk sac tumor with adjacent seminiferous tubules. Karyotyping showed 46XY. Final diagnosis of malignant mixed germ cell tumor in androgen insensitivity syndrome was made. Surveillance may be the most appropriate option when these conditions are initially diagnosed in adulthood to prevent development of germ cell tumors.

  2. Germ cell neoplasia in situ (GCNIS)

    DEFF Research Database (Denmark)

    Berney, Daniel M; Looijenga, Leendert H J; Idrees, Muhammad

    2016-01-01

    The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity and disagr......The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity...... and disagreement on its name. Initially termed 'carcinoma in situ' (CIS), it has also been known as 'intratubular germ cell neoplasia, unclassified' (IGCNU) and 'testicular intraepithelial neoplasia' (TIN). In this paper, we review the history of discovery and controversy concerning these names and introduce...

  3. Caenorhabditis elegans ATPase inhibitor factor 1 (IF1 MAI-2 preserves the mitochondrial membrane potential (Δψm and is important to induce germ cell apoptosis.

    Directory of Open Access Journals (Sweden)

    L P Fernández-Cárdenas

    Full Text Available When the electrochemical proton gradient is disrupted in the mitochondria, IF1 (Inhibitor Factor-1 inhibits the reverse hydrolytic activity of the F1Fo-ATP synthase, thereby allowing cells to conserve ATP at the expense of losing the mitochondrial membrane potential (Δψm. The function of IF1 has been studied mainly in different cell lines, but these studies have generated contrasting results, which have not been helpful to understand the real role of this protein in a whole organism. In this work, we studied IF1 function in Caenorhabditis elegans to understand IF1´s role in vivo. C. elegans has two inhibitor proteins of the F1Fo-ATPase, MAI-1 and MAI-2. To determine their protein localization in C. elegans, we generated translational reporters and found that MAI-2 is expressed ubiquitously in the mitochondria; conversely, MAI-1 was found in the cytoplasm and nuclei of certain tissues. By CRISPR/Cas9 genome editing, we generated mai-2 mutant alleles. Here, we showed that mai-2 mutant animals have normal progeny, embryonic development and lifespan. Contrasting with the results previously obtained in cell lines, we found no evident defects in the mitochondrial network, dimer/monomer ATP synthase ratio, ATP concentration or respiration. Our results suggest that some of the roles previously attributed to IF1 in cell lines could not reflect the function of this protein in a whole organism and could be attributed to specific cell lines or methods used to silence, knockout or overexpress this protein. However, we did observe that animals lacking IF1 had an enhanced Δψm and lower physiological germ cell apoptosis. Importantly, we found that mai-2 mutant animals must be under stress to observe the role of IF1. Accordingly, we observed that mai-2 mutant animals were more sensitive to heat shock, oxidative stress and electron transport chain blockade. Furthermore, we observed that IF1 is important to induce germ cell apoptosis under certain types of

  4. Expression of arf tumor suppressor in spermatogonia facilitates meiotic progression in male germ cells.

    Directory of Open Access Journals (Sweden)

    Michelle L Churchman

    2011-07-01

    Full Text Available The mammalian Cdkn2a (Ink4a-Arf locus encodes two tumor suppressor proteins (p16(Ink4a and p19(Arf that respectively enforce the anti-proliferative functions of the retinoblastoma protein (Rb and the p53 transcription factor in response to oncogenic stress. Although p19(Arf is not normally detected in tissues of young adult mice, a notable exception occurs in the male germ line, where Arf is expressed in spermatogonia, but not in meiotic spermatocytes arising from them. Unlike other contexts in which the induction of Arf potently inhibits cell proliferation, expression of p19(Arf in spermatogonia does not interfere with mitotic cell division. Instead, inactivation of Arf triggers germ cell-autonomous, p53-dependent apoptosis of primary spermatocytes in late meiotic prophase, resulting in reduced sperm production. Arf deficiency also causes premature, elevated, and persistent accumulation of the phosphorylated histone variant H2AX, reduces numbers of chromosome-associated complexes of Rad51 and Dmc1 recombinases during meiotic prophase, and yields incompletely synapsed autosomes during pachynema. Inactivation of Ink4a increases the fraction of spermatogonia in S-phase and restores sperm numbers in Ink4a-Arf doubly deficient mice but does not abrogate γ-H2AX accumulation in spermatocytes or p53-dependent apoptosis resulting from Arf inactivation. Thus, as opposed to its canonical role as a tumor suppressor in inducing p53-dependent senescence or apoptosis, Arf expression in spermatogonia instead initiates a salutary feed-forward program that prevents p53-dependent apoptosis, contributing to the survival of meiotic male germ cells.

  5. Effects of chemical-induced DNA damage on male germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Holme, J.A.; Bjoerge, C.; Trbojevic, M.; Olsen, A.K.; Brunborg, G.; Soederlund, E.J. [National Inst. of Public Health, Oslo (Norway). Dept. of Environmental Medicine; Bjoeras, M.; Seeberg, E. [National Hospital, Oslo (Norway). Dept. of Microbiology; Scholz, T.; Dybing, E.; Wiger, R. [National Hospital, Oslo (Norway). Inst. for Surgical Research and Surgical Dept. B

    1998-12-31

    Several recent studies indicate declines in sperm production, as well as increases in the incidence of genitourinary abnormalities such as testicular cancer, cryptorchidism and hypospadias. It is not known if these effects are due to exposure to chemical pollutants or if other ethiological factors are involved. Animal studies indicate that chemicals will induce such effects by various genetic, epigenetic or non-genetic mechanisms. Recently, much attention has been focused on embryonic/fetal exposure to oestrogen-mimicking chemicals (Toppari et al., 1996). However, the possibility that chemicals may cause reproductive toxicity by other mechanisms such as interactions with DNA, should not be ignored. DNA damage in germ cells may lead to the production of mutated spermatozoa, which in turn may result in spontaneous abortions, malformations and/or genetic defects in the offspring. Regarding the consequences of DNA alterations for carcinogenesis it is possible that genetic damage may occur germ cells, but the consequences are not expressed until certain genetic events occur in postnatal life. Transmission of genetic risk is best demonstrated by cancer-prone disorders such as hereditary retinoblastoma and the Li-Fraumeni syndrome. A number of experiments indicate that germ cells and proliferating cells may be particularly sensitive to DNA damaging agents compared to other cells. Furthermore, several lines of evidence have indicated that one of the best documented male reproductive toxicants, 1,2-dibrome-3-chloropropane (DBCP), causes testicular toxicity through DNA damage. It is possible that testicular cells at certain maturational stages are more subject to DNA damage, have less efficient DNA repair, or have different thresholds for initiating apoptosis following DNA damage than other cell types. (orig.)

  6. The influence of specific mechanical energy on cornmeal viscosity measured by an on-line system during twin-screw extrusion

    OpenAIRE

    CHANG, Y. K.; MARTINEZ-BUSTOS, F.; PARK, T. S.; KOKINI, J .L.

    1999-01-01

    The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...

  7. Reduction of the number of germs in spices by radappertization

    International Nuclear Information System (INIS)

    Beczner, Laszlone; Kiss, Istvan

    1983-01-01

    The sterilization by fumigation with ethylene oxide and propylene oxide of ground paprika and spice mixtures used in preserves and meat industry was compared with the radappertization of the same spices. The number of germs including that of spores and moulds was determined. It can be established that irradiation with ionizing radiation (5 kGy) has the same effect on the reduction of the number of germs as sterilization by ethylene oxide. In addition, the side effects of sterilization can be avoided. (V.N.)

  8. Two new routes to make blood: Hematopoietic specification from pluripotent cell lines versus reprogramming of somatic cells.

    Science.gov (United States)

    Singbrant, Sofie; van Galen, Peter; Lucas, Daniel; Challen, Grant; Rossi, Derrick J; Daley, George Q

    2015-09-01

    Transplantation of hematopoietic stem cells (HSCs) to treat hematologic disorders is routinely used in the clinic. However, HSC therapy is hindered by the requirements of finding human leukocyte antigen (HLA)-matched donors and attaining sufficient numbers of long-term HSCs in the graft. Therefore, ex vivo expansion of transplantable HSCs remains one of the "holy grails" of hematology. Without the ability to maintain and expand human HSCs in vitro, two complementary approaches involving cellular reprogramming to generate transplantable HSCs have emerged. Reprogrammed HSCs represent a potentially inexhaustible supply of autologous tissue. On March 18th, 2015, Dr. George Q. Daley and Dr. Derrick J. Rossi, two pioneers in the field, presented and discussed their most recent research on these topics in a webinar organized by the International Society for Experimental Hematology (ISEH). Here, we summarize these seminars and discuss the possibilities and challenges in the field of hematopoietic specification. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  9. Assembled genomic and tissue-specific transcriptomic data resources for two genetically distinct lines of Cowpea ( Vigna unguiculata (L.) Walp).

    Science.gov (United States)

    Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna

    2018-02-09

    Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata  v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.

  10. Identification of rat serum alkaline phosphatase isoenzyme by means of wheat germ agglutinin.

    Science.gov (United States)

    Wada, H; Niwa, N; Hayakawa, T; Tsuge, H

    1997-01-01

    Wheat germ agglutinin (WGA) precipitates bone type serum alkaline phosphatase (sALP) isoenzyme specifically. The precipitates are composed of the macromolecules of WGA and "bone type sALP" (WGA-ALP complex). In order to use bone type sALP as a marker in polyacrylamide gel electrophoresis (PAGE), a method to separate "bone type sALP" from the "WGA-ALP complex" was established by using N-acetyl-D-glucosamine (GlcNAc)-Sepharose 6E column chromatography. It was concluded that this method is useful for clinical examination in the rat.

  11. Generation of six multiple sclerosis patient-derived induced pluripotent stem cell lines.

    Science.gov (United States)

    Miquel-Serra, L; Duarri, A; Muñoz, Y; Kuebler, B; Aran, B; Costa, C; Martí, M; Comabella, M; Malhotra, S; Montalban, X; Veiga, A; Raya, A

    2017-10-01

    Multiple sclerosis (MS) is considered a chronic autoimmune disease of the central nervous system that leads to gliosis, demyelination, axonal damage and neuronal death. The MS disease aetiology is unknown, though a polymorphism of the TNFRSF1A gene, rs1800693, is known to confer an increased risk for MS. Using retroviral delivery of reprogramming transgenes, we generated six MS patient-specific iPSC lines with two distinct genotypes, CC or TT, of the polymorphism rs1800693. iPSC lines had normal karyotype, expressed pluripotency genes and differentiated into the three germ layers. These lines offer a good tool to study MS pathomechanisms and for drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Derivation of the human embryonic stem cell line RCM1

    Directory of Open Access Journals (Sweden)

    P.A. De Sousa

    2016-03-01

    Full Text Available The human embryonic stem cell line RCM-1 was derived from a failed to fertilise egg undergoing parthenogenetic stimulation. The cell line shows normal pluripotency marker expression and differentiation to three germ layers in vitro and in vivo. It has a normal 46XX female karyotype and microsatellite PCR identity, HLA and blood group typing data is available.

  13. Experiment Operating Specification for the Semiscale MOD-2C feedwater and steam line break experiment series. Appendix S-FS-6 and 7

    International Nuclear Information System (INIS)

    Boucher, T.J.; Owca, W.A.

    1985-05-01

    This document is the Semiscale MOD-2C feedwater and steam line break experiment series Experiment Operating Specification Appendix for tests S-FS-6 and S-FS-7. Test S-FS-6 is the third test in the series and simulates a 100% break in a steam generator bottom feedwater line downstream of the check valve accompanied by compounding factors (such as check valve failure, loss-of-offsite power at SIS and SIS delayed until low steam generator pressure signal). The test is terminated after plant stabilization and recovery procedures including unaffected loop steam and feed, pressurizer heater operation, pressurizer auxiliary spray operation, and normal charging/letdown operation. Test S-FS-7 is the fourth test in the series and simulates a 14.3% break in a steam generator bottom feedwater line downstream of the check valve, accompanied by compounding factors. The test is terminated after plant stabilization procedures including unaffected loop steam and feed, pressurizer heater operation, and normal charging/letdown operation. The test was followed by an affected loop secondary refill after isolating the break. The Appendix contains information on the major fluid systems, initial experiment conditions, experiment boundary conditions, and sequence of experiment events. Also included is a discussion of the scaling criteria and philosophy used to develop the experiment initial and boundary conditions and system configuration

  14. Cancer-specific SNPs originate from low-level heteroplasmic variants in human mitochondrial genomes of a matched cell line pair.

    Science.gov (United States)

    Hedberg, Annica; Knutsen, Erik; Løvhaugen, Anne Silje; Jørgensen, Tor Erik; Perander, Maria; Johansen, Steinar D

    2018-04-19

    Low-level mitochondrial heteroplasmy is a common phenomenon in both normal and cancer cells. Here, we investigate the link between low-level heteroplasmy and mitogenome mutations in a human breast cancer matched cell line by high-throughput sequencing. We identified 23 heteroplasmic sites, of which 15 were common between normal cells (Hs578Bst) and cancer cells (Hs578T). Most sites were clustered within the highly conserved Complex IV and ribosomal RNA genes. Two heteroplasmic variants in normal cells were found as fixed mutations in cancer cells. This indicates a positive selection of these variants in cancer cells. RNA-Seq analysis identified upregulated L-strand specific transcripts in cancer cells, which include three mitochondrial long non-coding RNA molecules. We hypothesize that this is due to two cancer cell-specific mutations in the control region.

  15. Development of space-fertilized eggs and formation of primordial germ cells in the embryos of medaka fish

    Science.gov (United States)

    Ijiri, K.

    In the second International Microgravity Laboratory (IML-2) mission in 1994, four small Japanese killifish (Medaka, Oryzias latipes) made a space travel of 15 days aboard a space shuttle. These four adult Medaka fish successfully mated in space for the first time among vertebrate animals. Moreover, the eggs they laid developed normally, at least in their external appearance, hatching as fry (baby fish) in space. Fish mated and laid eggs every day during the first week. Near the end of the mission most of the eggs had a well-developed body with two pigmented eyes. In total, 43 eggs were laid (detected), out of which 8 fry hatched in space, as truly `space-originated' babies. A further 30 fry hatched within 3 days after landing. This is the normal hatching rate, compared with the ground-based data. Among the 8 space-originated fry, four were killed for histological sections, and germ cells at the gonadal region were counted for each fry. Their numbers were in the range of the germ cells of the normal control fry (ground-kept samples). Thus, as embryos developed normally in their external appearance, inside the embryos the formation of primordial germ cells took place normally in space, and their migration to the genital ridges was not hindered by microgravity. The two of the remaining space-originated fry have grown up and been creating their offspring in the laboratory. This proved that the primordial germ cells formed in space were also normal from a functional point of view. The four space-travelled adult fish re-started mating and laying eggs on the 7th day after landing and continued to do so every day afterward. Fertilization rate and hatchability of these eggs were as high as the eggs laid by the laboratory-kept fish. This fact implies that in gametogenesis of adult fish, there are no specific stages of germ cells extremely susceptible to microgravity.

  16. Improvement of the design and generation of highly specific plant knockdown lines using primary synthetic microRNAs (pri-smiRNAs

    Directory of Open Access Journals (Sweden)

    Alves Leonardo

    2010-03-01

    Full Text Available Abstract Background microRNAs (miRNAs are endogenous small non-coding RNAs that post-transcriptionally regulate gene expression. In plants, they typically show high complementarity to a single sequence motif within their target mRNAs and act by catalyzing specific mRNA cleavage and degradation. miRNAs are processed from much longer primary transcripts via precursor miRNAs containing fold-back structures. Leaving these secondary structures intact, miRNAs can be re-designed experimentally to target mRNAs of choice. Results We designed primary synthetic miRNAs (pri-smiRNAs on the basis of the primary transcript of the Arabidopsis MIR159A gene by replacing the original miR159a and the corresponding miR159a* with novel sequences, keeping the overall secondary structure as predicted by the program RNAfold. We used the program RNAhybrid to optimize smiRNA design and to screen the complete Arabidopsis transcriptome for potential off-targets. To improve the molecular cloning of the pri-smiRNA we inserted restriction sites in the original MIR159A primary transcript to easily accommodate the smiRNA/smiRNA* DNA fragment. As a proof-of-concept, we targeted the single gene encoding chalcone synthase (CHS in Arabidopsis. We demonstrate smiRNA(CHS expression and CHS mRNA cleavage in different transgenic lines. Phenotypic changes in these lines were observed for seed color and flavonol derivatives, and quantified with respect to anthocyanin content. We also tested the effect of mismatches and excess G:U base pairs on knockdown efficiency. Conclusions RNAhybrid-assisted design of smiRNAs and generation of pri-smiRNAs using a novel vector containing restriction sites greatly improves specificity and speed of the generation of stable knockdown lines for functional analyses in plants.

  17. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    Science.gov (United States)

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered

  18. Comparative radiation genetics. What we learnt from our studies on Medaka germ cell mutagenesis

    International Nuclear Information System (INIS)

    Shima, Akihiro

    2004-01-01

    Having been interested in studying germ cell mutagenesis from the biodiversity viewpoint, in 1985 we started developing a nonmammalian specific-locus test (SLT) system using the Medaka, Oryzias latipes. The tester strain with five marker loci, which is a prerequisite for SLT, was established by consecutive crossings of five spontaneous single mutants followed by selection based on the phenotype of each mutant. The genetic endpoints available were dominant lethal mutations (DLM), total specific-locus mutations (TSLM) and viable specific-locus mutations. Using γ-rays, ethylnitrosourea and Fe-ion beam as mutagens to which wild type males or females were exposed, we screened approx. 1.6 million F1 embryos that correspond to approx. 4.7 million loci. In an attempt to best express the comparative sensitivity of Medaka germ cells to the genetic effects of γ-rays, the gametic doubling doses for acute and high-dose γ-rays were estimated. Extensive sex differences within the wild type (HNI) strain as well as strain differences in male germ cells between the two wild type strains (HNI and Sakura) were notably found in doubling doses for DLM and TSLM. Interestingly, among these values, the doubling dose for TSLM in spermatogonia of the HNI strain (0.33 Gy) nearly coincided with that estimated from the Russell 7-locus system of mice (0.44 Gy). Our data also suggested that the initial genomic changes induced in male germ cells would not straightforwardly manifest themselves as phenotypic effects in F1 progeny, but that twofold checks, one a prefertilization check in the gonads against genomic alterations using DNA repair machinery as well as apoptotic response, and the other postfertilization check in developing embryos through dominant lethal effects. should operate to restore or ameliorate those genomic changes. More mechanistically, AP/PCR-RAPD DNA fingerprinting was employed in order to scan as wider regions of the zygotic genome as possible. These anonymous DNA markers

  19. Autoimmune Regulator (AIRE) Is Expressed in Spermatogenic Cells, and It Altered the Expression of Several Nucleic-Acid-Binding and Cytoskeletal Proteins in Germ Cell 1 Spermatogonial (GC1-spg) Cells.

    Science.gov (United States)

    Radhakrishnan, Karthika; Bhagya, Kongattu P; Kumar, Anil Tr; Devi, Anandavalli N; Sengottaiyan, Jeeva; Kumar, Pradeep G

    2016-08-01

    Autoimmune regulator (AIRE) is a gene associated with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). AIRE is expressed heavily in the thymic epithelial cells and is involved in maintaining self-tolerance through regulating the expression of tissue-specific antigens. The testes are the most predominant extrathymic location where a heavy expression of AIRE is reported. Homozygous Aire-deficient male mice were infertile, possibly due to impaired spermatogenesis, deregulated germ cell apoptosis, or autoimmunity. We report that AIRE is expressed in the testes of neonatal, adolescent, and adult mice. AIRE expression was detected in glial cell derived neurotrophic factor receptor alpha (GFRα)(+) (spermatogonia), GFRα(-)/synaptonemal complex protein (SCP3)(+) (meiotic), and GFRα(-)/Phosphoglycerate kinase 2 (PGK2)(+) (postmeiotic) germ cells in mouse testes. GC1-spg, a germ-cell-derived cell line, did not express AIRE. Retinoic acid induced AIRE expression in GC1-spg cells. Ectopic expression of AIRE in GC1-spg cells using label-free LC-MS/MS identified a total of 371 proteins that were differentially expressed. 100 proteins were up-regulated, and 271 proteins were down-regulated. Data are available via ProteomeXchange with identifier PXD002511. Functional analysis of the differentially expressed proteins showed increased levels of various nucleic-acid-binding proteins and transcription factors and a decreased level of various cytoskeletal and structural proteins in the AIRE overexpressing cells as compared with the empty vector-transfected controls. The transcripts of a select set of the up-regulated proteins were also elevated. However, there was no corresponding decrease in the mRNA levels of the down-regulated set of proteins. Molecular function network analysis indicated that AIRE influenced gene expression in GC1-spg cells by acting at multiple levels, including transcription, translation, RNA processing, protein transport, protein

  20. A Small RNA-Based Immune System Defends Germ Cells against Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Astrid D. Haase

    2016-01-01

    Full Text Available Transposons are mobile genetic elements that threaten the survival of species by destabilizing the germline genomes. Limiting the spread of these selfish elements is imperative. Germ cells employ specialized small regulatory RNA pathways to restrain transposon activity. PIWI proteins and Piwi-interacting RNAs (piRNAs silence transposons at the transcriptional and posttranscriptional level with loss-of-function mutant animals universally exhibiting sterility often associated with germ cell defects. This short review aims to illustrate basic strategies of piRNA-guided defense against transposons. Mechanisms of piRNA silencing are most readily studied in Drosophila melanogaster, which serves as a model to delineate molecular concepts and as a reference for mammalian piRNA systems. PiRNA pathways utilize two major strategies to handle the challenges of transposon control: (1 the hard-wired molecular memory of prior transpositions enables recognition of mobile genetic elements and discriminates transposons from host genes; (2 a feed-forward adaptation mechanism shapes piRNA populations to selectively combat the immediate threat of transposon transcripts. In flies, maternally contributed PIWI-piRNA complexes bolster both of these lines of defense and ensure transgenerational immunity. While recent studies have provided a conceptual framework of what could be viewed as an ancient immune system, we are just beginning to appreciate its many molecular innovations.

  1. File list: Oth.Gon.20.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.20.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.20.AllAg.Testicular_germ_cells.bed ...

  2. File list: Oth.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.10.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.10.AllAg.Testicular_germ_cells.bed ...

  3. File list: Pol.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.05.AllAg.Testicular_germ_cells mm9 RNA polymerase Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.05.AllAg.Testicular_germ_cells.bed ...

  4. File list: DNS.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.05.AllAg.Testicular_germ_cells mm9 DNase-seq Gonad Testicular germ cells ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.05.AllAg.Testicular_germ_cells.bed ...

  5. Adult Immunohistochemical Markers Fail to Detect Intratubular Germ Cell Neoplasia in Prepubertal Boys with Cryptorchidism

    DEFF Research Database (Denmark)

    Kvist, Kolja; Clasen-Linde, Erik; Cortes, Dina

    2013-01-01

    Intratubular germ cell neoplasia (ITGCN) is a precursor to testicular germ cell cancer. It is characterized by large germ cells with large nuclei with a hyperchromatic, coarse chromatin pattern, large prominent nucleoli and abundant pale cytoplasm. In prepubertal boys these cells are located both...

  6. Carcinoma in situ testis displays permissive chromatin modifications similar to immature foetal germ cells

    DEFF Research Database (Denmark)

    Almstrup, K; Nielsen, J E; Mlynarska, O

    2010-01-01

    The majority of testicular germ cell cancers develop through a pre-invasive carcinoma in situ (CIS) stage. The CIS cell is a neoplastic counterpart of foetal germ cells. During their development, foetal germ cells undergo extensive and essential epigenetic modifications, but little is known about...

  7. Childhood Central Nervous System Germ Cell Tumors Treatment (PDQ®)—Patient Version

    Science.gov (United States)

    Childhood central nervous system (CNS) germ cell tumors form from germ cells (a type of cell that forms as a fetus develops and later becomes sperm in the testicles or eggs in the ovaries). Learn about the signs, tests to diagnose, and treatment of pediatric germ cell tumors in the brain in this expert-reviewed summary.

  8. Stability of wheat germ oil obtained by supercritical carbon dioxide ...

    African Journals Online (AJOL)

    심정은

    For determination of stability, wheat germ oil obtained by ethanolysis reactants was characterized by ... extract non polar lipids with lipid soluble bioactive com- pounds from different sources (Esquivel et al., 1997; ... thin layer of cotton was placed at the bottom of the extraction vessel. Before plugging with cap another layer of ...

  9. Genetic analysis of neonatal and infantile germ cell tumours.

    NARCIS (Netherlands)

    Veltman, I.M.

    2006-01-01

    Human germ cell tumours (GCTs) can be classified into five distinct types, based on differences in anatomical location, histology, clinical outcome, age and genotype. The first type, the type I GCTs primarily occur in neonates and infants under the age of five years and include teratomas and yolk

  10. Germ cell tumours in neonates and infants: a distinct subgroup?

    NARCIS (Netherlands)

    Veltman, I.M.; Schepens, M.T.M.; Looijenga, L.H.J.; Strong, L.C.; Geurts van Kessel, A.H.M.

    2003-01-01

    Human germ cell tumours (GCTs) constitute a heterogeneous group of tumours that can be classified into four major subgroups. One of these subgroups encompasses (immature) teratomas and yolk sac tumours of patients under the age of 5 years. In this paper we review the various clinical, histological

  11. Mutability of germ cells of descedants of irradiated drosophila males

    International Nuclear Information System (INIS)

    Fokina, T.L.; Vorobtsova, I.E.

    1987-01-01

    The increased frequency of random and radiation-induced mutation was registered in germ cells of drosophila irradiated male descendants of the first generation. The effect observed depended on of radiation dose delivered to parent males, test dose to posterity, type of mutation registered, and sex of the descendants under study

  12. Treatment Options for Childhood Extracranial Germ Cell Tumors

    Science.gov (United States)

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  13. General Information about Childhood Extracranial Germ Cell Tumors

    Science.gov (United States)

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  14. Dynamics of germs responsible for acute bacterial meningitis in ...

    African Journals Online (AJOL)

    The aim of this study was to analyze ten (10) years of epidemiological surveillance data of meningitis in Burkina Faso for high risk germs patterns identification in order to contribute to the strengthening of prevention strategies. A retrospective study of the past decade (2005- 2014) of cases of acute bacterial meningitis ...

  15. 10 original article dynamics of germs responsible for acute bacterial ...

    African Journals Online (AJOL)

    boaz

    The aim of this study was to analyze ten (10) years of epidemiological surveillance data of meningitis in Burkina Faso for high risk germs patterns identification in order to contribute to the strengthening of prevention strategies. A retrospective study of the past decade (2005- 2014) of cases of acute bacterial meningitis ...

  16. Wheat Germ Oil Attenuates Gamma Radiation-Induced Skeletal ...

    African Journals Online (AJOL)

    Muscular strength is important in sport as well as in daily activities. Exposure to ionizing radiation is thought to increase oxidative stress and damage muscle tissue. Wheat germ oil is a natural unrefined vegetable oil. It is an excellent source of vitamin E, octacosanol, linoleic and linolenic essential fatty acids, which may be ...

  17. Towards Optimal Diagnosis of Type II Germ Cell Tumors

    NARCIS (Netherlands)

    J.A. Stoop (Hans)

    2011-01-01

    textabstractThe aim of the work described in this thesis is to improve the understanding of the pathobiology of testicular cancer (type II Germ Cell Tumors) to create possibilities for optimalization of diagnosis for this type of malignancy in routine pathology laboratories. The different studies

  18. Clinical and genetic aspects of testicular germ cell tumours

    NARCIS (Netherlands)

    Holzik, Martijn F. Lutke; Sijmons, Rolf H.; Hoekstra-Weebers, Josette E. H. M.; Sleijfer, Dirk Th.; Hoekstra, Harald J.

    2008-01-01

    In this paper we review clinical and genetic aspects of testicular germ cell tumours (TGCTs). TGCT is the most common type of malignant disorder in men aged 15-40 years. Its incidence has increased sharply in recent years. Fortunately, survival of patients with TGCT has improved enormously, which

  19. A comparison between hominy chop and defatted maize germ meal ...

    African Journals Online (AJOL)

    Defatted maize germ meal (DMG) is arbitrarily rated at a lower economic value than maize meal or hominy chop (HC). Five treatments with 15 steers each were fed different inclusion levels of DMG (0%, 25%, 50%, 75% and 100%), replacing hominy chop during the fattening period. Slaughter data were collected for carcass ...

  20. EXAMINATION OF THE GERM CELL CHIMERA FORMING POTENTIAL OF MOUSE EMBRYONIC STEM CELLS

    Directory of Open Access Journals (Sweden)

    V.B. CÂRSTEA

    2007-05-01

    Full Text Available The aim of this study was to examine the factors, which influence the chimeraforming potential of mouse embryonic stem cells (ES cells. In our work, we examinethe chimera producing ability of R1 and R1/E mouse ES cell lines. We found that thepassage number affects chimera-forming capability of the ES cells. With theincreasing of the passage number, it could be getting less chimera animal, and onlythe R1/E ES cell line derived cells could contribute to the germ cells. At first, wecompared the marker of pluripotency using immunostaining and RT PCR, but wecould not find any difference between the R1 and R1/E cell in this way. Atchromosome analysis, we found, that the number of aneuploid cells, in R1 ES cellline, dramatically increased after 10 passages. We thought that the reason is thatduring the cell division Y chromosome could not arrange correctly between the twonewly derived progeny cells. To prove our conception, we made X and YchromosomeFISH analyses. We found, that the aneuploid R1 and R1/E ES cellscontain only one X and one Y chromosome, so not the loss of Y chromosome causethe problem at the germ cell formation. At last, we made the karyotypeanalysis of R1 and R1/E ES cells at different passages. The karyotype analysisdemonstrated that in the case of R1 ES cell line, the 41 and 42-chromosomecontaining cells hold trisomy. With the increasing of the passages number, thenumber of trisomy containing aneuploid cells increased. The aneuploid ES cells cancontribute to the different tissuses of chimera animals, but cannot form viable germcells.

  1. EXAMINATION OF THE GERM CELL CHIMERA FORMING POTENTIAL OF MOUSE EMBRYONIC STEM CELLS

    Directory of Open Access Journals (Sweden)

    CÂRSTEA V. B

    2007-01-01

    Full Text Available The aim of this study was to examine the factors, which influence the chimeraforming potential of mouse embryonic stem cells (ES cells. In our work, we examinethe chimera producing ability of R1 and R1/E mouse ES cell lines. We found that thepassage number affects chimera-forming capability of the ES cells. With theincreasing of the passage number, it could be getting less chimera animal, and onlythe R1/E ES cell line derived cells could contribute to the germ cells. At first, wecompared the marker of pluripotency using immunostaining and RT PCR, but wecould not find any difference between the R1 and R1/E cell in this way. Atchromosome analysis, we found, that the number of aneuploid cells, in R1 ES cellline, dramatically increased after 10 passages. We thought that the reason is thatduring the cell division Y chromosome could not arrange correctly between the twonewly derived progeny cells. To prove our conception, we made X and YchromosomeFISH analyses. We found, that the aneuploid R1 and R1/E ES cellscontain only one X and one Y chromosome, so not the loss of Y chromosome causethe problem at the germ cell formation. At last, we made the karyotypeanalysis of R1 and R1/E ES cells at different passages. The karyotype analysisdemonstrated that in the case of R1 ES cell line, the 41 and 42-chromosomecontaining cells hold trisomy. With the increasing of the passages number, thenumber of trisomy containing aneuploid cells increased. The aneuploid ES cells cancontribute to the different tissuses of chimera animals, but cannot form viable germcells.

  2. DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors

    International Nuclear Information System (INIS)

    Amatruda, James F; Frazier, A Lindsay; Poynter, Jenny N; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh

    2013-01-01

    Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy

  3. Interaction between NANOS2 and the CCR4-NOT Deadenylation Complex Is Essential for Male Germ Cell Development in Mouse

    OpenAIRE

    Suzuki, Atsushi; Saba, Rie; Miyoshi, Kei; Morita, Yoshinori; Saga, Yumiko

    2012-01-01

    Nanos is one of the evolutionarily conserved proteins implicated in germ cell development and we have previously shown that it interacts with the CCR4-NOT deadenylation complex leading to the suppression of specific RNAs. However, the molecular mechanism and physiological significance of this interaction have remained elusive. In our present study, we identify CNOT1, a component of the CCR4-NOT deadenylation complex, as a direct factor mediating the interaction with NANOS2. We find that the f...

  4. Tissue- and Cell-Specific Cytokinin Activity in Populus × canescens Monitored by ARR5::GUS Reporter Lines in Summer and Winter.

    Science.gov (United States)

    Paul, Shanty; Wildhagen, Henning; Janz, Dennis; Teichmann, Thomas; Hänsch, Robert; Polle, Andrea

    2016-01-01

    Cytokinins play an important role in vascular development. But knowledge on the cellular localization of this growth hormone in the stem and other organs of woody plants is lacking. The main focus of this study was to investigate the occurrence and cellular localization of active cytokinins in leaves, roots, and along the stem of Populus × canescens and to find out how the pattern is changed between summer and winter. An ARR5::GUS reporter construct was used to monitor distribution of active cytokinins in different tissues of transgenic poplar lines. Three transgenic lines tested under outdoor conditions showed no influence of ARR5::GUS reporter construct on the growth performance compared with the wild-type, but one line lost the reporter activity. ARR5::GUS activity indicated changes in the tissue- and cell type-specific pattern of cytokinin activity during dormancy compared with the growth phase. ARR5::GUS activity, which was present in the root tips in the growing season, disappeared in winter. In the stem apex ground tissue, ARR5::GUS activity was higher in winter than in summer. Immature leaves from tissue-culture grown plants showed inducible ARR5::GUS activity. Leaf primordia in summer showed ARR5::GUS activity, but not the expanded leaves of outdoor plants or leaf primordia in winter. In stem cross sections, the most prominent ARR5::GUS activity was detected in the cortex region and in the rays of bark in summer and in winter. In the cambial zone the ARR5::GUS activity was more pronounced in the dormant than in growth phase. The pith and the ray cells adjacent to the vessels also displayed ARR5::GUS activity. In silico analyses of the tissue-specific expression patterns of the whole PtRR type-A family of poplar showed that PtRR10, the closest ortholog to the Arabidopsis ARR5 gene, was usually the most highly expressed gene in all tissues. In conclusion, gene expression and tissue-localization indicate high activity of cytokinins not only in summer, but

  5. International germ cell consensus classification : A prognostic factor-erased staging system for metastatic germ cell cancers

    NARCIS (Netherlands)

    Mead, GM; Stenning, SP; Cook, P; Fossa, SD; Horwich, A; Kaye, SB; Oliver, RTD; deMulder, PHM; deWit, R; Stoter, G; Sylvester, RJ; Bajorin, DF; Bosl, GJ; Mazumdar, M; Nichols, CR; Amato, R; Pizzocaro, G; Droz, JP; Kramar, A; Daugaard, G; CortesFunes, H; PazAres, L; Levi, JA; Colls, BM; Harvey, VJ; Coppin, C

    Purpose: Cisplatin-containing chemotherapy has dramatically improved the outlook for patients with metastatic germ cell tumors (GCT), and overall cure rates now exceed 80%. To make appropriate risk-based decisions about therapy and to facilitate collaborative trials, a simple prognostic factor-based

  6. Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms.

    Science.gov (United States)

    Svingen, T; Jørgensen, A; Rajpert-De Meyts, E

    2014-08-01

    The measurement of gene expression levels in cells and tissues typically depends on a suitable point of reference for inferring biological relevance. For quantitative (or real-time) RT-PCR assays, the method of choice is often to normalize gene expression data to an endogenous gene that is stably expressed across the samples analysed: a so-called normalizing or housekeeping gene. Although this is a valid strategy, the identification of stable normalizing genes has proved challenging and a gene showing stable expression across all cells or tissues is unlikely to exist. Therefore, it is necessary to define suitable normalizing genes for specific cells and tissues. Here, we report on the performance of a panel of nine commonly employed normalizing genes in adult human testis and testicular pathologies. Our analyses revealed significant variability in transcript abundance for commonly used normalizers, highlighting the importance of selecting appropriate normalizing genes as comparative measurements can yield variable results when different normalizing genes are employed. Based on our results, we recommend using RPS20, RPS29 or SRSF4 when analysing relative gene expression levels in human testis and associated testicular pathologies. OCT4 and SALL4 can be used with caution as second-tier normalizers when determining changes in gene expression in germ cells and germ cell tumour components, but the relative transcript abundance appears variable between different germ cell tumour types. We further recommend that such studies should be accompanied by additional assessment of histology and cellularity of each sample. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Isolation and characterization of a homogeneous isoenzyme of wheat germ acid phosphatase.

    Science.gov (United States)

    Waymack, P P; Van Etten, R L

    1991-08-01

    An acid phosphatase (orthophosphoric monoester phosphohydrolase, acid optimum; EC 3.1.3.2) isoenzyme from wheat germ was purified 7000-fold to homogeneity. The effect of wheat germ sources and their relationship to the isoenzyme content and purification behavior of acid phosphatases was investigated. Extensive information about the purification and stabilization of the enzyme is provided. The instability of isoenzymes in the latter stages of purification appeared to be the result of surface inactivation together with a sensitivity to dilution that could be partially offset by addition of Triton X-100 during chromatographic procedures. Added sulfhydryl protecting reagents had no effect on activity or stability, which was greatest in the pH range 4-7. The purified isoenzyme was homogeneous by polyacrylamide gel electrophoresis and exhibited the highest specific activity and turnover number reported for any acid phosphatase. The molecular weights of the pure isoenzyme and of related isoenzymes from wheat germ were found to be identical (58,000). The pure isoenzyme contained a single polypeptide chain and had a negligible carbohydrate content. The amino acid composition was determined. Of the various reasons that were considered to explain isoenzyme occurrence, a genetic basis was considered most likely. The enzyme was found to exhibit substrate inhibition with some substrates below pH 6, while above pH 8 it exhibited downwardly curving Lineweaver-Burk plots of the type that are generally described as "substrate activation". The observation of a phosphotransferase activity was consistent with the formation of a covalent phosphoenzyme intermediate, while inactivation by diethyl pyrocarbonate was consistent with the presence of an active site histidine.

  8. Icotinib, a potent and specific EGFR tyrosine kinase inhibitor, inhibits growth of squamous cell carcinoma cell line A431 through negatively regulating AKT signaling.

    Science.gov (United States)

    Gao, Zhenzhen; Chen, Wei; Zhang, Xiaohua; Cai, Peifen; Fang, Xianying; Xu, Qiang; Sun, Yang; Gu, Yanhong

    2013-06-01

    Icotinib is a potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. In this study, we reported that icotinib had the antitumor activity on human squamous cell carcinoma cell line A431 in vitro. Meanwhile, adhesion to fibronectin and expression of integrin α3 and β1 were significantly reduced in a dose-dependent manner after the treatment of icotinib. Moreover, icotinib induced cell cycle arrested and affected expression of various cell cycle related proteins in squamous cancer cell line A431, whereas it did not cause apoptosis. Furthermore, icotinib remarkably down-regulated phosphorylation of protein kinase B (AKT) though blocking the interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and AKT in A431 cells. Taken together, it is shown that the small molecular compound, icotinib, has an anti-squamous cell carcinoma activity in vitro and its antitumor mechanism is associated with the blockage of the interaction between PDK1 and AKT. These results provide a novel strategy for anti-squamous cell carcinoma therapy. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  9. Mitochondrial Alterations by PARKIN in Dopaminergic Neurons Using PARK2 Patient-Specific and PARK2 Knockout Isogenic iPSC Lines

    Directory of Open Access Journals (Sweden)

    Atossa Shaltouki

    2015-05-01

    Full Text Available In this study, we used patient-specific and isogenic PARK2-induced pluripotent stem cells (iPSCs to show that mutations in PARK2 alter neuronal proliferation. The percentage of TH+ neurons was decreased in Parkinson’s disease (PD patient-derived neurons carrying various mutations in PARK2 compared with an age-matched control subject. This reduction was accompanied by alterations in mitochondrial:cell volume fraction (mitochondrial volume fraction. The same phenotype was confirmed in isogenic PARK2 null lines. The mitochondrial phenotype was also seen in non-midbrain neurons differentiated from the PARK2 null line, as was the functional phenotype of reduced proliferation in culture. Whole genome expression profiling at various stages of differentiation confirmed the mitochondrial phenotype and identified pathways altered by PARK2 dysfunction that include PD-related genes. Our results are consistent with current model of PARK2 function where damaged mitochondria are targeted for degradation via a PARK2/PINK1-mediated mechanism.

  10. Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

    Science.gov (United States)

    Wai, T; Grumet, R

    1995-09-01

    The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

  11. Meeting Report. Assessing Human Germ-Cell Mutagenesis in thePost-Genome Era: A Celebration of the Legacy of William Lawson (Bill)Russell

    Energy Technology Data Exchange (ETDEWEB)

    Wyrobek, Andrew J.; Mulvihill, John J.; Wassom, John S.; Malling,Heinrich V.; Shelby, Michael D.; Lewis, Susan E.; Witt, Kristine L.; Preston, R. Julian; Perreault-Darney, Sally; Allen, James W.; DeMarini,David M.; Woychik, Richard P.; Bishop Jack B; Workshop Presenters

    2006-04-18

    scientificspecialty groups be convened to address specific questions regarding thepotential germ-cell mutagenicity of environmental, occupational, andlifestyle exposures. Strong support from relevant funding agencies andengagement of scientists outside the fields of genomics and germ-cellmutagenesis will be required to launch a full-scale assault on some ofthe most pressing and enduring questions in environmental mutagenesis: Dohuman germ-cell mutagens exist, what risk do they pose to futuregenerations, and are some parents at higher risk than others foracquiring and transmitting germ-cell mutations?

  12. Study of verification and validation of standard welding procedure specifications guidelines for API 5L X-70 grade line pipe welding

    Directory of Open Access Journals (Sweden)

    Qazi H. A. A.

    2017-12-01

    Full Text Available Verification and validation of welding procedure specifications for X-70 grade line pipe welding was performed as per clause 8.2, Annexure B and D of API 5L, 45th Edition to check weld integrity in its future application conditions. Hot rolled coils were imported from China, de-coiling, strip edge milling, three roller bending to from pipe, inside and outside submerged arc welding of pipe, online ultrasonic testing of weld, HAZ and pipe body, cutting at fixed random length of pipe, visual inspection of pipe, Fluoroscopic inspection of pipe, welding procedure qualification test pieces marking at weld portion of the pipe, tensile testing, guided bend testing, CVN Impact testing were performed. Detailed study was conducted to explore possible explanations and variation in mechanical properties, WPS is examined and qualified as per API 5L 45th Edition.

  13. Application of a Reverse Line Blot hybridisation assay for the species-specific identification of cyathostomins (Nematoda, Strongylida) from benzimidazole-treated horses in the Slovak Republic.

    Science.gov (United States)

    Cernanská, Dana; Paoletti, Barbara; Králová-Hromadová, Ivica; Iorio, Raffaella; Cudeková, Patrícia; Milillo, Piermarino; Traversa, Donato

    2009-03-09

    Five horse farms located in eastern Slovakia were investigated for the presence of benzimidazole-resistant strongyles by faecal egg count reduction test and egg hatch assay. Coprocultures were prepared for each farm from faecal samples taken pre- and post-treatment and harvested larvae were molecularly examined with a Reverse Line Blot assay. Faecal egg count reduction values ranged from 0 to 52.5% and all farms were positive for benzimidazole-resistant cyathostomins. Seven benzimidazole-resistant cyathostomin species were molecularly identified on farms before and also after treatment. These data demonstrate that resistance to benzimidazoles is well established in cyathostomin populations from horse farms in the Slovak Republic and that the molecular assay was able to determine the species-specific distribution of resistant cyathostomins under field conditions.

  14. A study on effective extraction of isoflavones from soy germ using the electron beam

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Hoon [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Choi, Tae Beom [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of); Kim, Sang Wook [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of)], E-mail: swkim@kaeri.re.kr; Hur, Min Goo; Yang, Seung Dae [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Yu, Kook Hyun [Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of)], E-mail: yukook@dongguk.edu

    2009-07-15

    Soy germ was irradiated with 2 MeV electron beam with different doses ranging from 1 to 20 kGy. The amount of isoflavones from irradiated soy germ was compared with those from natural soy germ by extracting with ethanol and methanol. The changed amounts of isoflavones were measured by high-performance liquid chromatography with standard calibration curve. Each extract of soy germ was quantified for antioxidant activity with 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging method. The amount of isoflavones was found to be increased after electron-beam irradiation. Particularly ethanol extract with 15 kGy irradiated soy germ contained the maximum amount of isoflavones. Antioxidant activity of irradiated soy germ was higher than that of natural soy germ.

  15. BRAIN METASTASES OF GERM CELL TUMORS. THE RUSSIAN CANCER RESEARCH CENTER'S EXPERIENCE

    Directory of Open Access Journals (Sweden)

    A. A. Tryakin

    2014-07-01

    Full Text Available This paper analyzes the experience in treating 20 patients with nonseminomatous germ cell tumors metastasizing to the brain. It presents brain metastasis-associated factors: multiple lung metastases; IGCCCG poor prognosis; and a baseline human chorionic gonadotropin level of > 50000 mIU/ml. The authors have identified a group to be screened for brain metastasis, which includes patients with intermediate/poor prognosis and multiple lung metastases. Long-term survival was achieved in 45 % of patients with baseline brain damage and in 22 % of those with metastases revealed after first-line chemotherapy. The positive prognostic factors associated with long-term survival were a single brain lesion, no neurological symptoms, and achievement of clinical complete personse in the brain.

  16. HUMORAL IMMUNE-RESPONSE TO 2,4-DINITROPHENYL KEYHOLE LIMPET HEMOCYANIN IN ANTIGEN-FREE, GERM-FREE AND CONVENTIONAL BALB/C MICE

    NARCIS (Netherlands)

    BOS, NA; PLOPLIS, VA

    The B cell immune response to 2,4-dinitrophenyl (DNP) keyhole limpet hemocyanin was compared in antigen-free, germ-free and conventional BALB/c mice. The numbers of total and of DNP-specific IgM-, IgG- and IgA-secreting cells in the spleen were determined by enzyme-linked immunosorbent plaque assays

  17. A pipeline to quantify serum and cerebrospinal fluid microRNAs for diagnosis and detection of relapse in paediatric malignant germ-cell tumours

    NARCIS (Netherlands)

    M.J. Murray (Matthew); E. Bell (Emma); K.L. Raby (Katie L.); M.A. Rijlaarsdam (Martin); A.J.M. Gillis (Ad); L.H.J. Looijenga (Leendert); H. Brown (Helen); B. Destenaves (Benoit); J.C. Nicholson (James); N. Coleman (Nicholas)

    2016-01-01

    textabstractBackground:The current biomarkers alpha-fetoprotein and human chorionic gonadotropin have limited sensitivity and specificity for diagnosing malignant germ-cell tumours (GCTs). MicroRNAs (miRNAs) from the miR-371-373 and miR-302/367 clusters are overexpressed in all malignant GCTs, and

  18. Park Facilities, Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained by field GPS observation, Published in 2010, Not Applicable scale, Chippewa County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Park Facilities dataset current as of 2010. Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained...

  19. GAGE cancer-germline antigens bind DNA and are recruited to the nuclear envelope by Germ cell-less

    DEFF Research Database (Denmark)

    Gjerstorff, Morten; Rösner, Heike; Pedersen, Christina Bøg

    GAGE genes encode a highly similar, primate-specific protein family with unique primary structure and undefined roles in germ cells, various fetal cells and cancer cells. We report that GAGE proteins are intrinsically disordered proteins that provide novel interfaces between chromatin and the nuc......GAGE genes encode a highly similar, primate-specific protein family with unique primary structure and undefined roles in germ cells, various fetal cells and cancer cells. We report that GAGE proteins are intrinsically disordered proteins that provide novel interfaces between chromatin...... and the nuclear envelope. Structural analysis by NMR and CD spectroscopy showed GAGE proteins lack distinct secondary or tertiary structure and are therefore intrinsically disordered. In normal cells and cancer cells GAGE proteins localize predominantly in the nucleus; we found GAGE proteins formed stable......) at the nuclear envelope. Furthermore, exogenous and endogenous GAGE proteins were recruited to the nuclear envelope in GCL-overexpressing cells. Gene expression analysis and immunohistochemical staining suggest GAGE proteins and GCL interact physiologically in human cells that express both, including male germ...

  20. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Nucleosome organizations in induced pluripotent stem cells reprogrammed from somatic cells belonging to three different germ layers.

    Science.gov (United States)

    Tao, Yu; Zheng, Weisheng; Jiang, Yonghua; Ding, Guitao; Hou, Xinfeng; Tang, Yitao; Li, Yueying; Gao, Shuai; Chang, Gang; Zhang, Xiaobai; Liu, Wenqiang; Kou, Xiaochen; Wang, Hong; Jiang, Cizhong; Gao, Shaorong

    2014-12-21

    Nucleosome organization determines the chromatin state, which in turn controls gene expression or silencing. Nucleosome remodeling occurs during somatic cell reprogramming, but it is still unclear to what degree the re-established nucleosome organization of induced pluripotent stem cells (iPSCs) resembles embryonic stem cells (ESCs), and whether the iPSCs inherit some residual gene expression from the parental fibroblast cells. We generated genome-wide nucleosome maps in mouse ESCs and in iPSCs reprogrammed from somatic cells belonging to three different germ layers using a secondary reprogramming system. Pairwise comparisons showed that the nucleosome organizations in the iPSCs, regardless of the iPSCs' tissue of origin, were nearly identical to the ESCs, but distinct from mouse embryonic fibroblasts (MEF). There is a canonical nucleosome arrangement of -1, nucleosome depletion region, +1, +2, +3, and so on nucleosomes around the transcription start sites of active genes whereas only a nucleosome occupies silent transcriptional units. Transcription factor binding sites possessed characteristic nucleosomal architecture, such that their access was governed by the rotational and translational settings of the nucleosome. Interestingly, the tissue-specific genes were highly expressed only in the parental somatic cells of the corresponding iPS cell line before reprogramming, but had a similar expression level in all the resultant iPSCs and ESCs. The re-established nucleosome landscape during nuclear reprogramming provides a conserved setting for accessibility of DNA sequences in mouse pluripotent stem cells. No persistent residual expression program or nucleosome positioning of the parental somatic cells that reflected their tissue of origin was passed on to the resulting mouse iPSCs.

  2. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  3. The effects of estrogen receptors α- and β-specific agonists and antagonists on cell proliferation and energy metabolism in human bone cell line.

    Science.gov (United States)

    Somjen, D; Katzburg, S; Sharon, O; Grafi-Cohen, M; Knoll, E; Stern, N

    2011-02-01

    In cultured human osteoblasts estradiol-17β (E2) modulated DNA synthesis, the specific activity of creatine kinase BB (CK), 12 and 15 lipoxygenase (LO) mRNA expression and formation of 12- and 15-hydroxyeicosatetraenoic acid (HETE). We now investigate the response of human bone cell line (SaOS2) to phytoestrogens and estrogen receptors (ER)-specific agonists and antagonists. Treatment of SaSO2 with E2, 2,3-bis (4-hydroxyphenyl)-propionitrile (DPN; ERβ-specific agonist), 4,4',4″-[4-propyl-(1H)-pyrazol-1,3,5-triyl] tris-phenol (PPT; ERα-specific agonist), biochainin A (BA), daidzein (D), genistein (G) and raloxifene (Ral) showed increased DNA synthesis and CK. Ral inhibited completely all stimulations except DPN and to some extent D. The ERα-specific antagonist methyl-piperidino-pyrazole (MPP) and the ERβ-specific antagonist 4-[2-phenyl-5,7-bis (tri-fluoro-methyl) pyrazolo [1,5-a]pyrimidin-3-yl] phenol (PTHPP) inhibited DNA synthesis, CK and reactive oxygen species (ROS) formation induced by estrogens according to their receptors affinity. The LO inhibitor baicaleine inhibited only E2, DPN and G's effects. E2 and Ral unlike all other compounds had no effect on ERα mRNA expression, while ERβ mRNA expression was stimulated by all compounds. All compounds modulated the expression of 12LO and 15LO mRNA, except E2, PPT and Ral for 12LO, and 12- and 15-HETE productions and stimulated ROS formation which was inhibited by NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and N-acetyl cysteine and the estrogen inhibitor ICI. DPI did not affect hormonal-induced DNA and CK. In conclusion, we provide evidence for the separation of mediation via ERα and ERβ pathways in the effects of estrogenic compounds on osteoblasts, but the role of LO/HETE/ROS is unclear. Copyright © 2010 Wiley-Liss, Inc.

  4. MRI Findings of Suprasellar Germ Cell Tumors in Two Dogs.

    Science.gov (United States)

    Cook, Laurie; Tensley, Michelle; Drost, Wm Tod; Koivisto, Christopher; Oglesbee, Michael

    A 4 yr old border collie presenting for mydriasis and decreased mentation and a 7 yr old Boston terrier presenting for obtundation, head tilt, and paraparesis were both evaluated using MRI. Findings in both included mass lesions of the thalamus and brainstem that were hypo- to isointense on T1-weighted images and hyperintense on T2-weighted images with regions of hypointensity, and robust contrast enhancement and displacement of adjacent structures. Postmortem histopathology findings, tumor location, and a mixed pattern of epithelial cell differentiation were consistent with germ cell tumor in both cases. Germ cell tumor of the suprasellar region is an infrequently reported neoplasm of dogs and imaging findings in this species have not been well described in the prior literature.

  5. Derivation of the human induced pluripotent stem cell line MUi017-A from a patient with homozygous Hemoglobin Constant Spring

    Directory of Open Access Journals (Sweden)

    Wasinee Wongkummool

    2017-04-01

    Full Text Available Hemoglobin Constant Spring (HbCS, HBA2: c.427T>C is a common nondeletional α-thalassemia resulting from a nucleotide substitution at the termination codon of the HBA2 gene. Homozygosity for HbCS is characterized with mild anemia, jaundice, and splenomegaly. In this study, the human induced pluripotent stem cell line MUi017-A was successfully generated from peripheral blood CD34+ hematopoietic progenitors of a 52 year old female with homozygous HbCS. The MUi017-A cell line exhibited embryonic stem cell characteristics with consistent expression of specific pluripotency markers and the capability of differentiating into the three germ layers. The cell line may be used for the disease modeling.

  6. Genetic effects of combined chemical-X-ray treatments in male mouse germ cells

    International Nuclear Information System (INIS)

    Cattanach, B.M.; Rasberry, C.

    1987-01-01

    Several studies have shown that the yield of genetic damage induced by radiation in male mouse germ cells can be modified by chemical treatments. Pre-treatments with radio-protecting agents have given contradictory results but this appears to be largely attributable to the different germ cell stages tested and dependent upon the level of radiation damage induced. Pre-treatments which enhance the yield of genetic damage have been reported although, as yet, no tests have been conducted with radio-sensitizers. Another form of interaction between chemicals and radiation is specifically found with spermatogonial stem cells. Chemicals that kill cells can, by population depletion, substantially and predictably modify the genetic response to subsequent radiation exposure over a period of several days, or even weeks. Enhancement and reduction in the genetic yield can be attained, dependent upon the interval between treatments, with the modification also varying with the type of genetic damage scored. Post-treatment with one chemical (TEM) has been shown to reduce the genetic response to radiation exposure. (author)

  7. Germ cell toxicity: significance in genetic and fertility effects of radiation and chemicals

    International Nuclear Information System (INIS)

    Oakberg, E.F.

    1983-01-01

    The response of the male and female to radiation and chemicals is different. Any loss of oocytes in the female cannot be replaced, and if severe enough, will result in a shortening of the reproductive span. In the male, a temporary sterile period may be induced owing to destruction of the differentiating spermatogonia, but the stem cells are the most resistant spermatogonial type, are capable of repopulating the seminiferous epithelium, and fertility usually returns. The response of both the male and female changes with development of the embryonic to the adult gonad, and with differentiation and maturation in the adult. The primordial germ cells, early oocytes, and differentiating spermatogonia of the adult male are unusually sensitive to the cytotoxic action of noxious agents, but each agent elicits a specific response owing to the intricate biochemical and physiological changes associated with development and maturation of the gametes. The relationship of germ cell killing to fertility is direct, and long-term fertility effects can be predicted from histological analysis of the gonads. The relationship to genetic effects, on the other hand, is indirect, and acts primarily by limiting the cell stages available for testing, by affecting the distribution of mitotically active stem cells among the different stages of the mitotic cycle, and thereby, changing both the type and frequency of genetic effects observed. 100 references, 38 figures, 7 tables

  8. Video-assisted thoracic surgery mediastinal germ cell metastasis resection.

    Science.gov (United States)

    Nardini, Marco; Jayakumar, Shruti; Migliore, Marcello; Dunning, Joel

    2017-07-01

    Thoracoscopy can be safely used for dissection of masses in the visceral mediastinum. We report the case of a 31-year-old man affected by metastatic germ cell tumour and successfully treated with a 3-port posterior approach video-assisted thoracic surgery. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

  9. Radiation-induced genetic effects in germ cells of mammals

    International Nuclear Information System (INIS)

    Van Buul, P.P.W.

    1993-01-01

    The aim of the project is to gain information on the effects of ionizing radiation on germ cells of rodents and primates as measured by induced chromosomal translocations. Different aspects of the very significant interspecies differences between the mouse and the rhesus monkey (Macaca mulatta) for translocation induction in spermatogonial stem cells were studied. In addition, possible mechanisms for the well established reduced transmission of induced mouse translocations were investigated. (R.P.) 6 refs

  10. On the number of founding germ cells in humans

    Directory of Open Access Journals (Sweden)

    Byers Breck

    2005-08-01

    Full Text Available Abstract Background The number of founding germ cells (FGCs in mammals is of fundamental significance to the fidelity of gene transmission between generations, but estimates from various methods vary widely. In this paper we obtain a new estimate for the value in humans by using a mathematical model of germ cell development that depends on available oocyte counts for adult women. Results The germline-development model derives from the assumption that oogonial proliferation in the embryonic stage starts with a founding cells at t = 0 and that the subsequent proliferation can be defined as a simple stochastic birth process. It follows that the population size X(t at the end of germline expansion (around the 5th month of pregnancy in humans; t = 0.42 years is a random variable with a negative binomial distribution. A formula based on the expectation and variance of this random variable yields a moment-based estimate of a that is insensitive to the progressive reduction in oocyte numbers due to their utilization and apoptosis at later stages of life. In addition, we describe an algorithm for computing the maximum likelihood estimation of the FGC population size (a, as well as the rates of oogonial division and loss to apoptosis. Utilizing both of these approaches to evaluate available oocyte-counting data, we have obtained an estimate of a = 2 – 3 for Homo sapiens. Conclusion The estimated number of founding germ cells in humans corresponds well with values previously derived from chimerical or mosaic mouse data. These findings suggest that the large variation in oocyte numbers between individual women is consistent with a smaller founding germ cell population size than has been estimated by cytological analyses.

  11. European consensus on diagnosis and treatment of germ cell cancer: a report of the European Germ Cell Cancer Consensus Group (EGCCCG)

    NARCIS (Netherlands)

    Schmoll, H. J.; Souchon, R.; Krege, S.; Albers, P.; Beyer, J.; Kollmannsberger, C.; Fossa, S. D.; Skakkebaek, N. E.; de Wit, R.; Fizazi, K.; Droz, J. P.; Pizzocaro, G.; Daugaard, G.; de Mulder, P. H. M.; Horwich, A.; Oliver, T.; Huddart, R.; Rosti, G.; Paz Ares, L.; Pont, O.; Hartmann, J. T.; Aass, N.; Algaba, F.; Bamberg, M.; Bodrogi, I.; Bokemeyer, C.; Classen, J.; Clemm, S.; Culine, S.; de Wit, M.; Derigs, H. G.; Dieckmann, K. P.; Flasshove, M.; Garcia del Muro, X.; Gerl, A.; Germa-Lluch, J. R.; Hartmann, M.; Heidenreich, A.; Hoeltl, W.; Joffe, J.; Jones, W.; Kaiser, G.; Klepp, O.; Kliesch, S.; Kisbenedek, L.; Koehrmann, K. U.; Kuczyk, M.; Laguna, M. P.; Leiva, O.; Loy, V.; Mason, M. D.; Mead, G. M.; Mueller, R. P.; Nicolai, N.; Oosterhof, G. O. N.; Pottek, T.; Rick, O.; Schmidberger, H.; Sedlmayer, F.; Siegert, W.; Studer, U.; Tjulandin, S.; von der Maase, H.; Walz, P.; Weinknecht, S.; Weissbach, L.; Winter, E.; Wittekind, C.

    2004-01-01

    Germ cell tumour is the most frequent malignant tumour type in young men with a 100% rise in the incidence every 20 years. Despite this, the high sensitivity of germ cell tumours to platinum-based chemotherapy, together with radiation and surgical measures, leads to the high cure rate of > or = 99%

  12. Biochemical Intestinal Parameters in Germ-free Minipigs and Rats and in Ex-germ-free Minipigs and Rats Monoassociated with Escherichia coli

    Czech Academy of Sciences Publication Activity Database

    Cardona, M.,E.; Kozáková, Hana; Collinder, E.; Persson, A.-K.; Midtvedt, T.; Norin, E.

    2005-01-01

    Roč. 52, - (2005), s. 109-113 ISSN 1548-9213 R&D Projects: GA AV ČR IAA5020101 Institutional research plan: CEZ:AV0Z5020903 Keywords : germ-free * minipigs * ex-germ-free Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2005

  13. Sequence-specific inhibition of microRNA-130a gene by CRISPR/Cas9 system in breast cancer cell line

    Science.gov (United States)

    Ainina Abdollah, Nur; Das Kumitaa, Theva; Yusof Narazah, Mohd; Razak, Siti Razila Abdul

    2017-05-01

    MicroRNAs (miRNAs) are short stranded noncoding RNA that play important roles in apoptosis, cell survival, development and cell proliferation. However, gene expression control via small regulatory RNA, particularly miRNA in breast cancer is still less explored. Therefore, this project aims to develop an approach to target microRNA-130a using the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system in MCF7, breast cancer cell line. The 20 bp sequences target at stem loop, 3ʹ and 5ʹ end of miR130a were cloned into pSpCas9(BB)-2A-GFP (PX458) plasmid, and the positive clones were confirmed by sequencing. A total of 5 μg of PX458-miR130a was transfected to MCF7 using Lipofectamine® 3000 according to manufacturer’s protocol. The transfected cells were maintained in the incubator at 37 °C under humidified 5% CO2. After 48 hours, cells were harvested and total RNA was extracted using miRNeasy Mini Kit (Qiagen). cDNAs were synthesised specific to miR-130a using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Then, qRT-PCR was carried out using TaqMan Universal Master Mix (Applied Biosystems) to quantify the knockdown level of mature miRNAs in the cells. Result showed that miR-130a-5p was significantly downregulated in MCF7 cell line. However, no significant changes were observed for sequences targeting miR-130a-3p and stem loop. Thus, this study showed that the expression of miR-130a-5p was successfully down-regulated using CRISPR silencing system. This technique may be useful to manipulate the level of miRNA in various cell types to answer clinical questions at the molecular level.

  14. Folic acid induces cell type-specific changes in the transcriptome of breast cancer cell lines: a proof-of-concept study.

    Science.gov (United States)

    Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C

    2016-01-01

    The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.

  15. Malignant primary germ-cell tumor of the brain

    International Nuclear Information System (INIS)

    Yamamoto, Toyoshiro; Sato, Shinichi; Nakao, Satoshi; Ban, Sadahiko; Namba, Koh

    1983-01-01

    The unusual case of a 15 year old boy with three discrete paraventricular germ-cell tumors is reported.FThe first tumor was located just lateral to the left thalamus and included a massive cystic part around it, the second tumor in the paraventricular region above the head of the left caudate nucleus and the third tumor in the medial part of the left parietal lobe.FTotal removal of all tumors was successfully accomplished in stages at four separate operations, namely, the first tumor was removed through the left transsylvian approach, the second tumor via left superior frontal gyrus and the third tumor via left superior frontal gyrus and left superior parietal lobule.FHistological examination revealed that the first tumor was teratoma, the second was choriocarcinoma and the third was germinoma.FPrimary germ-cell tumors of the brain can be divided into 5 groups: 1) germinoma; 2) embryonal carcinoma; 3) choriocarcinoma; 4) yolk-sac tumor; or 5) teratoma.FIn this case, a combination of three different histological patterns was seen. If malignant germ-cell tumor is supected on CT, aggressive extirpation should be done, not only to determine the exact diagnosis, but also to provide the basis for subsequent adjunctive therapy. (author)

  16. Origins and molecular biology of testicular germ cell tumors.

    Science.gov (United States)

    Reuter, Victor E

    2005-02-01

    Testicular germ cell tumors can be divided into three groups (infantile/prepubertal, adolescent/young adult and spermatocytic seminoma), each with its own constellation of clinical histology, molecular and clinical features. They originate from germ cells at different stages of development. The most common testicular cancers arise in postpubertal men and are characterized genetically by having one or more copies of an isochromosome of the short arm of chromosome 12 [i(12p)] or other forms of 12p amplification and by aneuploidy. The consistent gain of genetic material from chromosome 12 seen in these tumors suggests that it has a crucial role in their development. Intratubular germ cell neoplasia, unclassified type (IGCNU) is the precursor to these invasive tumors. Several factors have been associated with their pathogenesis, including cryptorchidism, elevated estrogens in utero and gonadal dysgenesis. Tumors arising in prepubertal gonads are either teratomas or yolk sac tumors, tend to be diploid and are not associated with i(12p) or with IGCNU. Spermatocytic seminoma (SS) arises in older patients. These benign tumors may be either diploid or aneuploid and have losses of chromosome 9 rather than i(12p). Intratubular SS is commonly encountered but IGCNU is not. The pathogenesis of prepubertal GCT and SS is poorly understood.

  17. POMB/ACE chemotherapy for mediastinal germ cell tumours.

    Science.gov (United States)

    Bower, M; Brock, C; Holden, L; Nelstrop, A; Makey, A R; Rustin, G J; Newlands, E S

    1997-05-01

    Mediastinal germ cell tumours (MGCT) are rare and most published series reflect the experiences of individual institutions over many years. Since 1979, we have treated 16 men (12 non-seminomatous germ cell tumours and 4 seminomas) with newly diagnosed primary MGCT with POMB/ACE chemotherapy and elective surgical resection of residual masses. This approach yielded complete remissions in 15/16 (94%) patients. The median follow-up was 6.0 years and no relapses occurred more than 2 years after treatment. The 5 year overall survival in the non-seminomatous germ cell tumours (NSGCT) is 73% (95% confidence interval 43-90%). One patient with NSGCT developed drug-resistant disease and died without achieving remission and 2 patients died of relapsed disease. In addition, 4 patients with bulky and/or metastatic seminoma were treated with POMB/ACE. One died of treatment-related neutropenic sepsis in complete remission and one died of relapsed disease. Finally, 4 patients (2 NSGCT and 2 seminomas) referred at relapse were treated with POMB/ACE and one was successfully salvaged. The combination of POMB/ACE chemotherapy and surgery is effective management for MGCT producing high long-term survival rates.

  18. Human papillomavirus and Epstein-Barr virus in the etiology of testicular germ cell tumours

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, E; Hørding, U; Nielsen, H W

    1994-01-01

    sequences of two viruses with known transforming abilities, human papillomavirus (HPV) and Epstein-Barr virus (EBV). The polymerase chain reaction (PCR) technique was used. In none of the 19 successfully amplified samples were DNA sequences of HPV type 16 or type 18 detected. In six cases a faint trace......Epidemiological features suggest that the risk of testicular cancer may be related to exposure to unknown infectious agents, including viruses. Therefore a series of twenty specimens of testicular germ cell tumours, including preinvasive carcinoma in-situ, were tested for the presence of DNA...... of EBV DNA was revealed in one of two experiments. These samples were examined by immunohistochemical staining with specific antibodies raised against the EBV protein products and in-situ hybridization with specific molecular probes, and were confirmed to be negative. The study indicates...

  19. DETECTION OF ANTIBODIES TO CANDIDA ALBICANS GERM TUBE BY IMMUNOFLUORESCENCE IN IMMUNOSUPPRESSED MICE WITH EXPERIMENTAL SYSTEMIC CANDIDIASIS

    Directory of Open Access Journals (Sweden)

    F. Zaini

    2007-07-01

    Full Text Available "nThe increasing incidence of systemic candidiasis, which parallels the use of invasive and immunosuppressive medical procedures, necessitates development of rapid and cost effective tests for diagnosis of systemic candidiasis. Therefore in this study 85 mice were first immunosuppressed by cyclophosphamide and then infected by Candida albicans NCPF 3153. Other 85 mice were employed as control. The case and control mice were bled and then autopsied. Hearts and kidneys were checked by direct, histopathological and cultural examination for systemic candidiasis. The 85 sera from histological proven cases and 85 control mice were adsorbed with heat killed blastospores of same strain of C. albicans. Anti-Candida albicans germ tube antibodies were detected by indirect immunofluorescence assay for diagnosis of invasive candidiasis in case and control mice. In addition, sera from 35 mice with proven cryptococcosis were also tested. While 84 mice with proven systemic candidiasis (100% had anti-germ tube antibodies, these antibodies were absent in all controls and mice with cryptococcosis. The specificity was 100%, indicating a high degree of discrimination was possible between systemic candidiasis and cryptococcosis in the mice studied. It must be concluded that anti-germ tube responses did not appear to be significantly reduced in immunocompromised mice.

  20. Testis sparing surgery for treatment of small testicular lesions: Is it feasible even in germ cell tumors?

    Science.gov (United States)

    Bojanic, Nebojsa; Bumbasirevic, Uros; Bojanic, Gordana; Vukovic, Ivan; Milojevic, Bogomir; Pekmezovic, Tatjana

    2017-03-01

    To evaluate the results of testis-sparing surgery (TSS) in patients, with small testicular lesions and a normal contralateral testicle. In all, 28 patients were treated with TSS for small testicular lesions and a normal contralateral testicle. TSS was considered in patients with testicular lesions smaller than 2 cm and no evidence of metastatic disease. The mean age of patients was 35.3 ± 7.3 years, while the mean diameter of the testicular lesions was 11.4 ± 3.7 mm. After pathological examination, 18 patients (64.3%) were diagnosed with stromal tumors and miscellaneous lesions, while 10 (35.7%) had a germ cell tumor. The median follow-up time for the former group was 33 months and no recurrences were observed. In one patient with germ cell tumor, immediate orchiectomy was performed, while the remaining nine were followed-up (median time, 45 months). One patient developed local recurrence after 39 months. Excellent outcomes for benign lesions could be achieved using TSS. TSS could be offered safely in highly selected patients with germ cell tumors, specifically within a clinical trial but there is more data needed regarding the potential risks and benefits. J. Surg. Oncol. 2017;115:287-290. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Involvement of the DNA mismatch repair system in cisplatin sensitivity of testicular germ cell tumours.

    Science.gov (United States)

    Rudolph, Christiane; Melau, Cecilie; Nielsen, John E; Vile Jensen, Kristina; Liu, Dekang; Pena-Diaz, Javier; Rajpert-De Meyts, Ewa; Rasmussen, Lene Juel; Jørgensen, Anne

    2017-08-01

    Testicular germ cell tumours (TGCT) are highly sensitive to cisplatin-based chemotherapy, but patients with tumours containing differentiated teratoma components are less responsive to this treatment. The cisplatin sensitivity in TGCT has previously been linked to the embryonic phenotype in the majority of tumours, although the underlying mechanism largely remains to be elucidated. The aim of this study was to investigate the role of the DNA mismatch repair (MMR) system in the cisplatin sensitivity of TGCT. The expression pattern of key MMR proteins, including MSH2, MSH6, MLH1 and PMS2, were investigated during testis development and in the pathogenesis of TGCT, including germ cell neoplasia in situ (GCNIS). The TGCT-derived cell line NTera2 was differentiated using retinoic acid (10 μM, 6 days) after which MMR protein expression and activity, as well as cisplatin sensitivity, were investigated in both undifferentiated and differentiated cells. Finally, the expression of MSH2 was knocked down by siRNA in NTera2 cells after which the effect on cisplatin sensitivity was examined. MMR proteins were expressed in proliferating cells in the testes, while in malignant germ cells MMR protein expression was found to coincide with the expression of the pluripotency factor OCT4, with no or low expression in the more differentiated yolk sac tumours, choriocarcinomas and teratomas. In differentiated NTera2 cells we found a significantly (p cisplatin sensitivity, compared to undifferentiated NTera2 cells. Also, we found that partial knockdown of MSH2 expression in undifferentiated NTera2 cells resulted in a significantly (p cisplatin sensitivity. This study reports, for the first time, expression of the MMR system in fetal gonocytes, from which GCNIS cells are derived. Our findings in primary TGCT specimens and TGCT-derived cells suggest that a reduced sensitivity to cisplatin in differentiated TGCT components could result from a reduced expression of MMR proteins, in

  2. The influence of specific mechanical energy on cornmeal viscosity measured by an on-line system during twin-screw extrusion

    Directory of Open Access Journals (Sweden)

    Y. K. CHANG

    1999-09-01

    Full Text Available The influence of specific mechanical energy (SME on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity of cornmeal at the exit die was influenced by screw speed, rate of total mass flow, mass temperature inside the extruder and SME. An increase in screw speed resulted in an increase in SME and a decrease in viscosity. A reduction in slit die height and an increase in screw speed and mass temperature led to a remarkable macromolecular degradation of the starch, as evidenced by the decrease in viscosity.

  3. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    Science.gov (United States)

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  4. Isolate-specific effects of patulin, penicillic Acid and EDTA on biofilm formation and growth of dental unit water line biofilm isolates.

    Science.gov (United States)

    Liaqat, Iram; Bachmann, Robert Thomas; Sabri, Anjum Nasim; Edyvean, Robert G J

    2010-08-01

    Dental unit water line (DUWL) contamination by opportunistic pathogens has its significance in nosocomial infection of patients, health care workers, and life-threatening infections to immunocompromized persons. Recently, the quorum sensing (QS) system of DUWL isolates has been found to affect their biofilm-forming ability, making it an attractive target for antimicrobial therapy. In this study, the effect of two quorum-sensing inhibitory compounds (patulin; PAT, penicillic acid; PA) and EDTA on planktonic growth, AI-2 signalling and in vitro biofilm formation of Pseudomonas aeruginosa, Achromobacter xylosoxidans and Achromobacter sp. was monitored. Vibrio harveyi BB170 bioassay and crystal violet staining methods were used to detect the AI-2 monitoring and biofilm formation in DUWL isolates, respectively. The V. harveyi BB170 bioassay failed to induce bioluminescence in A. xylosoxidans and Achromobacter sp., while P. aeruginosa showed AI-2 like activity suggesting the need of some pretreatments prior to bioassay. All strains were found to form biofilms within 72 h of incubation. The QSIs/EDTA combination have isolate-specific effects on biofilm formation and in some cases it stimulated biofilm formation as often as it was inhibited. However, detailed information about the anti-biofilm effect of these compounds is still lacking.

  5. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    DEFF Research Database (Denmark)

    Byskov, A G; Fenger, M; Westergaard, L

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... are fixed, squashed, and DNA-stained. In these preparations germ cells and somatic cells can be distinguished, and the number of germ cells in the different stages of meiosis is counted as is the number of somatic cells in mitosis. MIS activity is defined to be present in a medium when meiosis is induced...... in male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media...

  6. Immature germ cells in semen - correlation with total sperm count and sperm motility

    Directory of Open Access Journals (Sweden)

    Priya S Patil

    2013-01-01

    Conclusions: Round cells in semen can be differentiated into immature germ cells and leucocytes using simple staining methods. The differential counts mentioned in a semen report give valuable and clinically relevant information. In this study, we observed a negative correlation between total count and immature germ cells, as well as sperm motility and shedding of immature germ cells. The latter was statistically significant with a P value 0.000.

  7. Fatty acid composition of maize germ oil from high-oil hybrids wet-milling processing

    Directory of Open Access Journals (Sweden)

    Jovanović Petar Lj.

    2005-01-01

    Full Text Available Maize germ was obtained by wet-milling laboratory processing of domestic high-oil maize hybrids. After separation, the germ was subjected to extraction of maize oil. Fatty acid composition of maize germ oil was determined by gas chromatography. The results showed very high levels of unsaturated fatty acids and a constant sum of oleic and linoleic acids in oils of different maize hybrids.

  8. Interaction of NANOS2 and NANOS3 with different components of the CNOT complex may contribute to the functional differences in mouse male germ cells

    Directory of Open Access Journals (Sweden)

    Atsushi Suzuki

    2014-11-01

    Full Text Available NANOS2 and NANOS3 belong to the Nanos family of proteins that contain a conserved zinc finger domain, which consists of two consecutive CCHC-type zinc finger motifs, and contribute to germ cell development in mice. Previous studies indicate that there are redundant and distinct functions of these two proteins. NANOS2 rescues NANOS3 functions in the maintenance of primordial germ cells, whereas NANOS3 fails to replace NANOS2 functions in the male germ cell pathway. However, the lack of a conditional allele of Nanos3 has hampered delineation of each contribution of NANOS2 and NANOS3 to the male germ cell pathway. In addition, the molecular mechanism underlying the distinct functions of these proteins remains unexplored. Here, we report an unexpected observation of a transgenic mouse line expressing a NANOS2 variant harboring mutations in the zinc finger domain. Transcription of Nanos2 and Nanos3 was strongly compromised in the presence of this transgene, which resulted in the mimicking of the Nanos2/Nanos3 double-null condition in the male gonad. In these transgenic mice, P-bodies involved in RNA metabolism had disappeared and germ cell differentiation was more severely affected than that in Nanos2-null mice, indicating that NANOS3 partially substitutes for NANOS2 functions. In addition, similar to NANOS2, we found that NANOS3 associated with the CCR4-NOT deadenylation complex but via a direct interaction with CNOT8, unlike CNOT1 in the case of NANOS2. This alternate interaction might account for the molecular basis of the functional redundancy and differences in NANOS2 and NANOS3 functions.

  9. In vitro cytotoxicity of {sup 211}At-labeled trastuzumab in human breast cancer cell lines: effect of specific activity and HER2 receptor heterogeneity on survival fraction

    Energy Technology Data Exchange (ETDEWEB)

    Akabani, Gamal [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Carlin, Sean [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Welsh, Phil [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States)]. E-mail: zalut001@mc.duke.edu

    2006-04-15

    Introduction: Radioimmunotherapy with anti-HER2 monoclonal antibodies (mAbs) such as trastuzumab is a promising strategy for treating HER2-positive breast and ovarian carcinoma patients. The objective of this study was to determine the cytotoxic effectiveness of trastuzumab labeled with the 7.2-h half-life {alpha}-particle emitter {sup 211}At. Methods: Experiments were performed on SKBr-3, BT-474 and the transfected MCF7/HER2-18 human breast carcinoma cell lines. Intrinsic radiosensitivity was determined after exposure to external beam irradiation. The cytotoxicity of {sup 211}At-labeled trastuzumab was measured by clonogenic assays. The distribution of HER2 receptor expression on the cell lines was measured using fluorescence-activated cell sorting. A pharmacokinetic (PK)/microdosimetric model was established to assess the effects of specific activity (SA), HER2 receptor expression and absorbed dose on survival fraction (SF). Results: With external beam irradiation, the 2-Gy SF for BT-474, SKBr-3 and MCF7/HER2-18 cells was 0.78, 0.53 and 0.64 Gy, respectively. Heterogeneous HER2 expression was observed, with a subpopulation of cells lacking measurable receptor (14.5%, SKBr-3; 0.34%, MCF-7/HER2; 1.73%, BT-474). When plotted as a function of activity concentration, SF curves were biphasic and inversely proportional to SA; however, when the model was applied and absorbed doses calculated, the SF curve was monoexponential independent of SA. Thus, the PK model was able to demonstrate the effects of competition between cold and labeled mAb. These studies showed that the relative biological effectiveness of {sup 211}At-labeled trastuzaumab was about 10 times higher than that of external beam therapy. Conclusion: These in vitro studies showed that {sup 211}At-labeled trastuzumab mAb is an effective cytotoxic agent for the treatment of HER2-positive tumor cells. The SA of the labeled mAb and the homogeneity of HER2 receptor expression are important variables influencing

  10. The Spectral Energy Distributions of z ~ 8 Galaxies from the IRAC Ultra Deep Fields: Emission Lines, Stellar Masses, and Specific Star Formation Rates at 650 Myr

    Science.gov (United States)

    Labbé, I.; Oesch, P. A.; Bouwens, R. J.; Illingworth, G. D.; Magee, D.; González, V.; Carollo, C. M.; Franx, M.; Trenti, M.; van Dokkum, P. G.; Stiavelli, M.

    2013-11-01

    Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ~ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ~120h over the HUDF reaching depths of ~28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct >=3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at >=5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ~ 8 are markedly redder than those at z ~ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ~ 7 and z ~ 8 we estimate a rest-frame equivalent width of {W}_{[O\\,\\scriptsize{III}]\\ \\lambda \\lambda 4959,5007+H\\beta }=670^{+260}_{-170} Å contributing 0.56^{+0.16}_{-0.11} mag to the [4.5] filter at z ~ 8. The corresponding {W}_{H\\alpha }=430^{+160}_{-110} Å implies an average specific star formation rate of sSFR=11_{-5}^{+11} Gyr-1 and a stellar population age of 100_{-50}^{+100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ~3 ×, decreasing the integrated stellar mass density to \\rho ^*(z=8,M_{\\rm{UV}}Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with programs #11563, 9797. Based on observations with the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of

  11. THE SPECTRAL ENERGY DISTRIBUTIONS OF z ∼ 8 GALAXIES FROM THE IRAC ULTRA DEEP FIELDS: EMISSION LINES, STELLAR MASSES, AND SPECIFIC STAR FORMATION RATES AT 650 MYR

    Energy Technology Data Exchange (ETDEWEB)

    Labbé, I.; Bouwens, R. J.; Franx, M. [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Oesch, P. A.; Illingworth, G. D.; Magee, D.; González, V. [UCO/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Carollo, C. M. [Institute for Astronomy, ETH Zurich, 8092 Zurich (Switzerland); Trenti, M. [Kavli Institute for Cosmology and Institute of Astronomy, University of Cambridge, Cambridge (United Kingdom); Van Dokkum, P. G. [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Stiavelli, M. [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2013-11-10

    Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ∼ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ∼120h over the HUDF reaching depths of ∼28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct ≥3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at ≥5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ∼ 8 are markedly redder than those at z ∼ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ∼ 7 and z ∼ 8 we estimate a rest-frame equivalent width of contributing 0.56{sup +0.16}{sub -0.11} mag to the [4.5] filter at z ∼ 8. The corresponding W{sub Hα}=430{sup +160}{sub -110} Å implies an average specific star formation rate of sSFR=11{sub -5}{sup +11} Gyr{sup –1} and a stellar population age of 100{sub -50}{sup +100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ∼3 ×, decreasing the integrated stellar mass density to ρ{sup *}(z=8,M{sub UV}<-18)=0.6{sup +0.4}{sub -0.3}×10{sup 6} M{sub sun} Mpc{sup –3}.

  12. Isolation and purification of wheat germ agglutinin and analysis of its properties

    Science.gov (United States)

    Wang, Han

    2017-12-01

    In this paper, the wheat germ agglutinin was isolated and purified by affinity chromatography of chicken ovomucoid as ligand. The physicochemical properties were analyzed. The chicken ovomucoid was isolated from egg white and conjugated to affinity chromatography column agarose gel to prepare affinity adsorbent. The crude extract of wheat germ was freezedried by affinity chromatography. The physicochemical properties were analyzed by SDSpolyacrylamide gel electrophoresis and isoelectric focusing electrophoresis. And the relative molecular mass and isoelectric point of wheat germ agglutinin were obtained, and the high efficiency of purification of wheat germ agglutinin was proved by affinity chromatography.

  13. Peculiarities in the CT findings of germ cell tumors in various tumor localizations

    International Nuclear Information System (INIS)

    Tazoe, Makoto; Miyagami, Mitsusuke; Tsubokawa, Takashi

    1991-01-01

    The CT findings of 17 germ cell tumors were studied in relation to the locations of the tumor, the pathological diagnoses, and the tumor markers (AFP and HCG). Generally, the CT findings of germ cell tumors depended on the pathological diagnoses more strongly than on the location of the tumors. On plain CT of 7 germ cell tumors in the pineal region, all of them demonstrated heterogeneous findings. Hydrocephalus was seen in 6 cases (86%) and calcification in 6 cases (86%) of the germ cell tumors in the pineal region. Calcification and hydrocephalus that appeared more often than in other regions were characteristic of germ cell tumors of the pineal region. The germ cell tumors in the basal ganglia had a slightly homogenous high density, with small cysts and calcification in most of them on plain CT. On enhanced CT, the tumors were moderately enhanced in all cases located in the basal ganglia. Four cases of germ cell tumors located in the basal ganglia revealed the dilatation of lateral ventricle due to hemispheric atrophy in the tumor side. The germ cell tumors showing an increase in the tumor markers such as AFP and HCG, which were usually malignant germ cell tumors, were strongly enhanced on enhanced CT. (author)

  14. Insights into female germ cell biology: from in vivo development to in vitro derivations.

    Science.gov (United States)

    Jung, Dajung; Kee, Kehkooi

    2015-01-01

    Understanding the mechanisms of human germ cell biology is important for developing infertility treatments. However, little is known about the mechanisms that regulate human gametogenesis due to the difficulties in collecting samples, especially germ cells during fetal development. In contrast to the mitotic arrest of spermatogonia stem cells in the fetal testis, female germ cells proceed into meiosis and began folliculogenesis in fetal ovaries. Regulations of these developmental events, including the initiation of meiosis and the endowment of primordial follicles, remain an enigma. Studying the molecular mechanisms of female germ cell biology in the human ovary has been mostly limited to spatiotemporal characterizations of genes or proteins. Recent efforts in utilizing in vitro differentiation system of stem cells to derive germ cells have allowed researchers to begin studying molecular mechanisms during human germ cell development. Meanwhile, the possibility of isolating female germline stem cells in adult ovaries also excites researchers and generates many debates. This review will mainly focus on presenting and discussing recent in vivo and in vitro studies on female germ cell biology in human. The topics will highlight the progress made in understanding the three main stages of germ cell developments: namely, primordial germ cell formation, meiotic initiation, and folliculogenesis.

  15. The impact of atmospheric cold plasma treatment on inactivation of lipase and lipoxygenase of wheat germs

    DEFF Research Database (Denmark)

    Tolouie, Haniye; Mohammadifar, Mohammad Amin; Ghomi, Hamid

    2018-01-01

    Wheat germ is a by-product of milling process which contains large amount of nutrients. The shelf life of wheat germ could improve by inactivation of destructive endogenous enzymes especially lipase and lipoxygenase. In this work, the impact of atmospheric cold plasma treatment on the inactivation...... of lipase and lipoxygenase enzymes of wheat germ was studied. Dielectric barrier discharge plasma was utilized to treat wheat germs. The impact of treatment time and voltage of plasma on the inactivation of lipase and lipoxygenase were investigated as well. The higher voltage and treatment time led...

  16. Farelo de gérmen de milho desengordurado na dieta de poedeiras comerciais de 28 a 44 semanas de idade Defatted corn germ meal in diets for laying hens from 28 to 44 weeks of age

    Directory of Open Access Journals (Sweden)

    Sandra Regina Brunelli

    2010-05-01

    Full Text Available Um experimento foi conduzido para avaliar os efeitos da inclusão de farelo de gérmen de milho desengordurado na dieta de galinhas de 28 a 44 semanas de idade. Foram utilizadas 240 poedeiras Hy-Line W36 distribuídas em delineamento inteiramente casualizado, com seis níveis de farelo de germen de milho desengordurado (0, 6, 12, 18, 24 e 30%,cada um com cinco repetições de oito aves. No período experimental, que durou quatro ciclos de 28 dias, foram avaliados os parâmetros de desempenho das aves (consumo de ração, produção de ovos, peso médio do ovo, massa de ovo e conversão alimentar e de qualidade dos ovos (gravidade específica, índice de pigmentação da gema, porcentagem de gema e albúmen, porcentagem e espessura da casca e unidade haugh. Os níveis de farelo de gérmen de milho desengordurado tiveram efeito linear negativo sobre o consumo de ração e o índice de pigmentação da gema e efeito quadrático sobre a conversão alimentar. A inclusão de farelo de gérmen de milho desengordurado na dieta não influenciou as outras variáveis estudadas. O farelo de gérmen de milho desengordurado pode ser incluído em níveis de até 21,2% em rações para galinhas poedeiras.This experiment was conducted to evaluate the effect of including defatted corn germ meal in diets for laying hens. It was assigned two hundred and forty laying hens to a randomized design, with six diets and five replicates of eight hens per diet. Experimental diets were formulated by inclusion of defatted corn germ meal at 0, 6, 12, 18, 24 and 30% level. The period experiment was carried out for four 28-day cycles and performance (feed intake, egg production, egg weight, egg mass and feed conversion and the egg quality (egg specific gravity, yolk color, yolk and albumen percentages, shell percentages, shell thickness and Haugh unity were the evaluated parameters. Negative linear effect was observed for feed intake and yolk pigmentation by increasingly

  17. An in vitro model demonstrates the potential of neoplastic human germ cells to influence the tumour microenvironment.

    Science.gov (United States)

    Klein, B; Schuppe, H-C; Bergmann, M; Hedger, M P; Loveland, B E; Loveland, K L

    2017-07-01

    Testicular germ cell tumours (TGCT) typically contain high numbers of infiltrating immune cells, yet the functional nature and consequences of interactions between GCNIS (germ cell neoplasia in situ) or seminoma cells and immune cells remain unknown. A co-culture model using the seminoma-derived TCam-2 cell line and peripheral blood mononuclear cells (PBMC, n = 7 healthy donors) was established to investigate how tumour and immune cells each contribute to the cytokine microenvironment associated with TGCT. Three different co-culture approaches were employed: direct contact during culture to simulate in situ cellular interactions occurring within seminomas (n = 9); indirect contact using well inserts to mimic GCNIS, in which a basement membrane separates the neoplastic germ cells and immune cells (n = 3); and PBMC stimulation prior to direct contact during culture to overcome the potential lack of immune cell activation (n = 3). Transcript levels for key cytokines in PBMC and TCam-2 cell fractions were determined using RT-qPCR. TCam-2 cell fractions showed an immediate increase (within 24 h) in several cytokine mRNAs after direct contact with PBMC, whereas immune cell fractions did not. The high levels of interleukin-6 (IL6) mRNA and protein associated with TCam-2 cells implicate this cytokine as important to seminoma physiology. Use of PBMCs from different donors revealed a robust, repeatable pattern of changes in TCam-2 and PBMC cytokine mRNAs, independent of potential inter-donor variation in immune cell responsiveness. This in vitro model recapitulated previous data from clinical TGCT biopsies, revealing similar cytokine expression profiles and indicating its suitability for exploring the in vivo circumstances of TGCT. Despite the limitations of using a cell line to mimic in vivo events, these results indicate how neoplastic germ cells can directly shape the surrounding tumour microenvironment, including by influencing local immune responses. IL6

  18. Gods, Germs, and Petri Dishes: Toward a Nonsecular Medical Anthropology.

    Science.gov (United States)

    Roberts, Elizabeth F S

    2016-01-01

    This commentary calls on medical anthropology to become programmatically non-secular. Despite recent anthropological critiques of secularity, within and outside of anthropology, most contemporary medical anthropologists continue to leave deities and religiosity out of their examinations of healing practices, especially in their accounts of biomedicine. Through a critical, relational constructionist lens, which traces how all entities are both constructed and real, a non-secular medical anthropology would insist that when deities are part of medical practice, they are integral to analysis. Importantly then, within the symmetrical nature of this same constructionist lens, biomedical entities like germs and petri dishes need to be accounted for just as much as deities.

  19. Mapping Mammalian Cell-type-specific Transcriptional Regulatory Networks Using KD-CAGE and ChIP-seq Data in the TC-YIK Cell Line

    Science.gov (United States)

    Lizio, Marina; Ishizu, Yuri; Itoh, Masayoshi; Lassmann, Timo; Hasegawa, Akira; Kubosaki, Atsutaka; Severin, Jessica; Kawaji, Hideya; Nakamura, Yukio; Suzuki, Harukazu; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.

    2015-01-01

    Mammals are composed of hundreds of different cell types with specialized functions. Each of these cellular phenotypes are controlled by different combinations of transcription factors. Using a human non islet cell insulinoma cell line (TC-YIK) which expresses insulin and the majority of known pancreatic beta cell specific genes as an example, we describe a general approach to identify key cell-type-specific transcription factors (TFs) and their direct and indirect targets. By ranking all human TFs by their level of enriched expression in TC-YIK relative to a broad collection of samples (FANTOM5), we confirmed known key regulators of pancreatic function and development. Systematic siRNA mediated perturbation of these TFs followed by qRT-PCR revealed their interconnections with NEUROD1 at the top of the regulation hierarchy and its depletion drastically reducing insulin levels. For 15 of the TF knock-downs (KD), we then used Cap Analysis of Gene Expression (CAGE) to identify thousands of their targets genome-wide (KD-CAGE). The data confirm NEUROD1 as a key positive regulator in the transcriptional regulatory network (TRN), and ISL1, and PROX1 as antagonists. As a complimentary approach we used ChIP-seq on four of these factors to identify NEUROD1, LMX1A, PAX6, and RFX6 binding sites in the human genome. Examining the overlap between genes perturbed in the KD-CAGE experiments and genes with a ChIP-seq peak within 50 kb of their promoter, we identified direct transcriptional targets of these TFs. Integration of KD-CAGE and ChIP-seq data shows that both NEUROD1 and LMX1A work as the main transcriptional activators. In the core TRN (i.e., TF-TF only), NEUROD1 directly transcriptionally activates the pancreatic TFs HSF4, INSM1, MLXIPL, MYT1, NKX6-3, ONECUT2, PAX4, PROX1, RFX6, ST18, DACH1, and SHOX2, while LMX1A directly transcriptionally activates DACH1, SHOX2, PAX6, and PDX1. Analysis of these complementary datasets suggests the need for caution in interpreting Ch

  20. Methylator phenotype of malignant germ cell tumours in children identifies strong candidates for chemotherapy resistance.

    Science.gov (United States)

    Jeyapalan, J N; Noor, D A Mohamed; Lee, S-H; Tan, C L; Appleby, V A; Kilday, J P; Palmer, R D; Schwalbe, E C; Clifford, S C; Walker, D A; Murray, M J; Coleman, N; Nicholson, J C; Scotting, P J

    2011-08-09

    Yolk sac tumours (YSTs) and germinomas are the two major pure histological subtypes of germ cell tumours. To date, the role of DNA methylation in the aetiology of this class of tumour has only been analysed in adult testicular forms and with respect to only a few genes. A bank of paediatric tumours was analysed for global methylation of LINE-1 repeat elements and global methylation of regulatory elements using GoldenGate methylation arrays. Both germinomas and YSTs exhibited significant global hypomethylation of LINE-1 elements. However, in germinomas, methylation of gene regulatory regions differed little from control samples, whereas YSTs exhibited increased methylation at a large proportion of the loci tested, showing a 'methylator' phenotype, including silencing of genes associated with Caspase-8-dependent apoptosis. Furthermore, we found that the methylator phenotype of YSTs was coincident with higher levels of expression of the DNA methyltransferase, DNA (cytosine-5)-methyltransferase 3B, suggesting a mechanism underlying the phenotype. Epigenetic silencing of a large number of potential tumour suppressor genes in YSTs might explain why they exhibit a more aggressive natural history than germinomas and silencing of genes associated with Caspase-8-dependent cell death might explain the relative resistance of YSTs to conventional therapy.

  1. Tissue-Specific Methylation of Long Interspersed Nucleotide Element-1 of Homo Sapiens (L1Hs) During Human Embryogenesis and Roles in Neural Tube Defects.

    Science.gov (United States)

    Wang, L; Chang, S; Guan, J; Shangguan, S; Lu, X; Wang, Z; Wu, L; Zou, J; Zhao, H; Bao, Y; Qiu, Z; Niu, B; Zhang, T

    2015-01-01

    Epigenetic regulation of long interspersed nucleotide element-1 (LINE-1) retrotransposition events plays crucial roles during early development. Previously we showed that LINE-1 hypomethylation in neuronal tissues is associated with pathogenesis of neural tube defect (NTD). Herein, we further evaluated LINE-1 Homo sapiens (L1Hs) methylation in tissues derived from three germ layers of stillborn NTD fetuses, to define patterns of tissue specific methylation and site-specific hypomethylation at CpG sites within an L1Hs promoter region. Stable, tissue-specific L1Hs methylation patterns throughout three germ layer lineages of the fetus, placenta, and maternal peripheral blood were observed. Samples from maternal peripheral blood exhibited the highest level of L1Hs methylation (64.95%) and that from placenta showed the lowest (26.82%). Between samples from NTDs and controls, decrease in L1Hs methylation was only significant in NTD-affected brain tissue at 7.35%, especially in females (8.98%). L1Hs hypomethylation in NTDs was also associated with a significant increase in expression level of an L1Hs-encoded transcript in females (r = -0.846, p = 0.004). This could be due to genomic DNA instability and alternation in chromatins accessibility resulted from abnormal L1Hs hypomethylation, as showed in this study with HCT-15 cells treated with methylation inhibitor 5-Aza.

  2. Non-germ cell tumours arising in germ cell tumours (teratoma with malignant transformation) in men: CT and MR findings

    Energy Technology Data Exchange (ETDEWEB)

    Athanasiou, A. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Institut Curie, Paris (France)], E-mail: alexandra.athanasiou@curie.net; Vanel, D. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Istituti Ortopedici Rizzoli, Bologna (Italy); El Mesbahi, O. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Theodore, C. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Department of Oncology, Hopital Foch, Suresnes (France); Fizazi, K. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France)

    2009-02-15

    Purpose: To describe the imaging findings of germ cell tumours (GCT) containing non-germ cell malignant components (also designated teratoma with malignant transformation or TMT). Patients and methods: The records of 14 male patients with GCT and a non-germ cell histological component TMT were retrospectively reviewed. All patients had computed tomography (CT) and/or magnetic resonance (MR) studies before and after initial surgery and chemotherapy, as well as during follow-up. Imaging findings were correlated with the response to treatment and with overall survival. Pathological evaluation, immunohistochemistry, serum alpha-fetoprotein (AFP) and human chorionic gonadotropin (HCG) were also taken into consideration. Sarcoma was identified in 10 out of 14 patients, with rhabdomyosarcoma ranking first (n = 4), followed by osteosarcoma (n = 2), fusiform cell sarcoma (n = 1), undifferentiated sarcoma (n = 1), neurosarcoma (n = 1) and myxoid sarcoma (n = 1). Other histological types of malignant transformation included adenocarcinoma (n = 3) and bronchoalveolar carcinoma (n = 1). Overall, 9 patients relapsed at a median time of 84 months (range 60-168). Results: Non-GCT malignant transformation was identified in the retroperitoneum (5), testis (3), mediastinum (3), peritoneum (2) and lungs (1). The CT and MR imaging findings before treatment and after relapse were evaluated with emphasis on imaging features that could possibly imply the presence of malignant transformation (heterogeneously enhancing soft-tissue masses, ossified masses with calcified lymph nodes, diffuse epiploic thickening associated with ascites and peritoneal nodules, pulmonary alveolar infiltration with septal thickening). All but 1 patient with TMT presented with nodal and distant metastases. The prognosis was poor: within a median follow-up of 59 months (range 3-180), 4 out of 14 patients were alive. Conclusion: TMT is rare and associated with poorer survival compared to GCT. Imaging can be useful

  3. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  4. Generation of human iPSC line from a patient with laterality defects and associated congenital heart anomalies carrying a DAND5 missense alteration

    Directory of Open Access Journals (Sweden)

    Fernando Cristo

    2017-12-01

    Full Text Available A human iPSC line was generated from exfoliated renal epithelial (ERE cells of a patient affected with Congenital Heart Disease (CHD and Laterality Defects carrying tshe variant p.R152H in the DAND5 gene. The transgene-free iPSCs were generated with the human OSKM transcription factor using the Sendai-virus reprogramming system. The established iPSC line had the specific heterozygous alteration, a stable karyotype, expressed pluripotency markers and generated embryoid bodies that can differentiate towards the three germ layers in vitro. This iPSC line offers a useful resource to study the molecular mechanisms of cardiomyocyte proliferation, as well as for drug testing.

  5. IMMOBILIZATION OF ACID PHOSPHATASE (TYPE I) FROM WHEAT GERM ON GLUTARALDEHYDE ACTIVATED CHITOSAN BEADS: OPTIMIZATION AND CHARACTERIZATION

    OpenAIRE

    K. Belho; S.R. Nongpiur; P.K. Ambasht

    2014-01-01

    Acid phosphatase from wheat germ (specific activity 1.327 U/mg protein) was used for immobilization on glutaraldehyde activated chitosan beads. Upon activation of chitosan beads, elongated fibers with pores were observed. The optimum percent immobilization obtained was 81.25%. The pH optimum of immobilized acid phosphatase was 5.5 with a shift of 0.5 units from the pH optimum of soluble enzyme (5.0). The values of Km for p-nitrophenylphosphate with soluble and immobilized acid pho...

  6. The 3’UTR of Nanos2 directs enrichment in the germ cell lineage of the sea urchin

    OpenAIRE

    Oulhen, Nathalie; Yoshida, Takaya; Yajima, Mamiko; Song, Jia; Sakuma, Tetsushi; Sakamoto, Naoaki; Yamamoto, Takashi; Wessel, Gary M.

    2013-01-01

    Nanos is a translational regulator required for the survival and maintenance of primordial germ cells during embryogenesis. Three nanos homologs are present in the genome of the sea urchin Strongylocentrotus purpuratus (Sp), and each nanos mRNA accumulates specifically in the small micromere (sMic) lineage. We found that a highly conserved element in the 3’ UTR of nanos2 is sufficient for reporter expression selectively in the sMic lineage: microinjection into a Sp fertilized egg of an RNA th...

  7. Immature germ cells in semen - correlation with total sperm count and sperm motility.

    Science.gov (United States)

    Patil, Priya S; Humbarwadi, Rajendra S; Patil, Ashalata D; Gune, Anita R

    2013-07-01

    Current data regarding infertility suggests that male factor contributes up to 30% of the total cases of infertility. Semen analysis reveals the presence of spermatozoa as well as a number of non-sperm cells, presently being mentioned in routine semen report as "round cells" without further differentiating them into leucocytes or immature germ cells. The aim of this work was to study a simple, cost-effective, and convenient method for differentiating the round cells in semen into immature germ cells and leucocytes and correlating them with total sperm counts and motility. Semen samples from 120 males, who had come for investigation for infertility, were collected, semen parameters recorded, and stained smears studied for different round cells. Statistical analysis of the data was done to correlate total sperm counts and sperm motility with the occurrence of immature germ cells and leucocytes. The average shedding of immature germ cells in different groups with normal and low sperm counts was compared. The clinical significance of "round cells" in semen and their differentiation into leucocytes and immature germ cells are discussed. Round cells in semen can be differentiated into immature germ cells and leucocytes using simple staining methods. The differential counts mentioned in a semen report give valuable and clinically relevant information. In this study, we observed a negative correlation between total count and immature germ cells, as well as sperm motility and shedding of immature germ cells. The latter was statistically significant with a P value 0.000.

  8. Erythropoietin may reduce the risk of germ cell loss in boys with cryptorchidism

    DEFF Research Database (Denmark)

    Cortes, Dina; Visfeldt, J; Thorup, J M

    2001-01-01

    In boys with cryptorchidism older than 2 years a testicular biopsy at time of orchiopexy shows lack of germ cells in 10-40% of the cases. The number of spermatogonia per tubule is prognostic for subsequent fertility potential. A biopsy without germ cells is associated with 33-100% risk of inferti...

  9. Orientation of Germ Tubes of Puccinia hordei on the Hordeum chilense Leaf Surface

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Niks, R.E.

    2000-01-01

    The directional growth of urediospores germ tubes along the transverse axis of a cereal's leaf is considered to be a response to stimuli from the plant surface. In order to find out if the germ tube growth is directed towards stomata, and if the cuticular wax layer plays a role in this orientated

  10. Influence of different dose irradiation on genetic effect in mice somatic and germ cells

    International Nuclear Information System (INIS)

    Kostrova, L.N.; Molofej, V.P.; Mosseh, I.B.

    2007-01-01

    Comparison of clastogenic effects of different radiation doses in somatic and germ cells of one the same animals has been studied. Correlation analysis allows to extrapolate genetic effects from somatic cells to germ ones. This can be useful for human model elaboration. (authors)

  11. Prevention of airborne contamination and cross-contamination in germ-free mice by laminar flow

    NARCIS (Netherlands)

    Waaij, D. van der; Andres, A.H.

    1971-01-01

    The efficacy of horizontal and vertical laminar flow units (equipped with high-efficiency air filters) in the prevention of cross-contamination between cages and of contamination from outside has been demonstrated. With germ-free mice and using germ-free standard techniques for sterilization and for

  12. Weierstrass preparation and division theorems for the ring of germs of superanalytic functions

    International Nuclear Information System (INIS)

    Yankov, C.L.

    1989-11-01

    The aim of this paper is to show that Weierstrass preparation and division theorems hold for the ring of germs of superanalytic functions at a given point. This ring is the tensor product of the ring of germs of analytic functions at that point and a finite-dimensional complex Grassmann algebra. 7 refs

  13. Risk and prognostic significance of metachronous contralateral testicular germ cell tumours

    NARCIS (Netherlands)

    Schaapveld, M.; van den Belt-Dusebout, A. W.; Gietema, J. A.; de Wit, R.; Horenblas, S.; Witjes, J. A.; Hoekstra, H. J.; Kiemeney, L. A. L. M.; Louwman, W. J.; Ouwens, G. M.; Aleman, B. M. P.; van Leeuwen, F. E.

    2012-01-01

    BACKGROUND: Testicular germ cell tumour (TGCT) patients are at increased risk of developing a contralateral testicular germ cell tumour (CTGCT). It is unclear whether TGCT treatment affects CTGCT risk. METHODS: The risk of developing a metachronous CTGCT (a CTGCT diagnosed >= 6 months after a

  14. Primary Germ Cell Tumors of the Mediastinum: 10 Years of Experience in a Tertiary Teaching Hospital

    Directory of Open Access Journals (Sweden)

    Chih-Jen Yang

    2005-09-01

    Full Text Available Germ cell tumors occur mostly in the gonad. Extragonadal germ cell tumors are rare, and most occur in the retroperitoneum and mediastinum. Primary mediastinal germ cell tumors are often found in the anterior portion of the mediastinum and include teratomas and non-teratomatous tumors. Non-teratomatous tumors include seminomas and malignant non-seminomatous germ cell tumors (MNSGCTs. MNSGCTs include yolk sac tumors, choriocarcinomas, embryonal carcinomas, and mixed type germ cell tumors. Teratomas are the most common germ cell tumors of the mediastinum, and seminomas are the most common non-teratomatous germ cell tumors of the mediastinum. Cases of primary mediastinal MNSGCT reported in the literature are rare. In this report, we review all primary mediastinal germ cell tumors from a 10-year period at the Chung-Ho Memorial Hospital of Kaohsiung Medical University. A total of 14 cases were reviewed, including 11 patients with mature teratomas, two with yolk sac tumors, and one with seminoma. We discuss the differences in clinical presentation, histopathologic characteristics, treatment, and prognosis.

  15. Childhood Central Nervous System Germ Cell Tumors Treatment (PDQ®)—Health Professional Version

    Science.gov (United States)

    CNS germ cell tumors can be diagnosed and classified based on histology, tumor markers, or a combination of both. Get detailed information about newly diagnosed and recurrent childhood CNS germ cell tumors including molecular features and clinical features, diagnostic and staging evaluation, and treatment in this summary for clinicians.

  16. Germ cells are not required to establish the female pathway in mouse fetal gonads.

    Directory of Open Access Journals (Sweden)

    Danielle M Maatouk

    Full Text Available The fetal gonad is composed of a mixture of somatic cell lineages and germ cells. The fate of the gonad, male or female, is determined by a population of somatic cells that differentiate into Sertoli or granulosa cells and direct testis or ovary development. It is well established that germ cells are not required for the establishment or maintenance of Sertoli cells or testis cords in the male gonad. However, in the agametic ovary, follicles do not form suggesting that germ cells may influence granulosa cell development. Prior investigations of ovaries in which pre-meiotic germ cells were ablated during fetal life reported no histological changes during stages prior to birth. However, whether granulosa cells underwent normal molecular differentiation was not investigated. In cases where germ cell loss occurred secondary to other mutations, transdifferentiation of granulosa cells towards a Sertoli cell fate was observed, raising questions about whether germ cells play an active role in establishing or maintaining the fate of granulosa cells. We developed a group of molecular markers associated with ovarian development, and show here that the loss of pre-meiotic germ cells does not disrupt the somatic ovarian differentiation program during fetal life, or cause transdifferentiation as defined by expression of Sertoli markers. Since we do not find defects in the ovarian somatic program, the subsequent failure to form follicles at perinatal stages is likely attributable to the absence of germ cells rather than to defects in the somatic cells.

  17. Germ Cells Are Not Required to Establish the Female Pathway in Mouse Fetal Gonads

    Science.gov (United States)

    Maatouk, Danielle M.; Mork, Lindsey; Hinson, Ashley; Kobayashi, Akio; McMahon, Andrew P.; Capel, Blanche

    2012-01-01

    The fetal gonad is composed of a mixture of somatic cell lineages and germ cells. The fate of the gonad, male or female, is determined by a population of somatic cells that differentiate into Sertoli or granulosa cells and direct testis or ovary development. It is well established that germ cells are not required for the establishment or maintenance of Sertoli cells or testis cords in the male gonad. However, in the agametic ovary, follicles do not form suggesting that germ cells may influence granulosa cell development. Prior investigations of ovaries in which pre-meiotic germ cells were ablated during fetal life reported no histological changes during stages prior to birth. However, whether granulosa cells underwent normal molecular differentiation was not investigated. In cases where germ cell loss occurred secondary to other mutations, transdifferentiation of granulosa cells towards a Sertoli cell fate was observed, raising questions about whether germ cells play an active role in establishing or maintaining the fate of granulosa cells. We developed a group of molecular markers associated with ovarian development, and show here that the loss of pre-meiotic germ cells does not disrupt the somatic ovarian differentiation program during fetal life, or cause transdifferentiation as defined by expression of Sertoli markers. Since we do not find defects in the ovarian somatic program, the subsequent failure to form follicles at perinatal stages is likely attributable to the absence of germ cells rather than to defects in the somatic cells. PMID:23091613

  18. Dafachronic acid inhibits C. elegans germ cell proliferation in a DAF-12-dependent manner.

    Science.gov (United States)

    Mukherjee, Madhumati; Chaudhari, Snehal N; Balachandran, Riju S; Vagasi, Alexandra S; Kipreos, Edward T

    2017-12-15

    Dafachronic acid (DA) is a bile acid-like steroid hormone that regulates dauer formation, heterochrony, and lifespan in C. elegans. Here, we describe that DA is an inhibitor of C. elegans germ stem cell proliferation in adult hermaphrodites. Using a C. elegans germ cell primary culture system, we show that DA inhibits the proliferation of germ cells in vitro. Exogenous DA reduces the frequency of large tumors in adult tumorous germline mutants and decreases the proliferation of wild-type germ stem cells in adult hermaphrodites. In contrast, DA has no appreciable effect on the proliferation of larval-stage germ cells in wild type. The inhibition of adult germ cell proliferation by DA requires its canonical receptor DAF-12. Blocking DA production by inactivating the cytochrome P450 DAF-9 increases germ cell proliferation in wild-type adult hermaphrodites and the frequency of large tumors in germline tumorous mutants, suggesting that DA inhibits the rate of germ cell proliferation under normal growth conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Germ Cell Tumor Located in the Midline of the Anterior Neck

    OpenAIRE

    Tatyana PIRDOPSKA; Ivan TERZIEV; Sv. HRISTOVA; W. MLADENOVSKY; R. PETKOV

    2011-01-01

    Primary germ cell tumors involving midline of the anterior neck are extremely rare. Here we report a 68-year-old male who was operated due to a mass lesion in the anterior neck with infiltration of the isthmus of the thyroid gland. Histopathological examination revealed a germ cell tumor with extragonadal localization in the anterior neck infiltrating the isthmus of the thyroid gland.

  20. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  1. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  2. The effects of human TSH receptor gene transfection on iodide uptake and thyroid-specific gene expression in poorly differentiated thyroid carcinoma cell line

    International Nuclear Information System (INIS)

    Hou Shasha; Wang Hui; Feng Fang; Lin Ning; Fu Hongliang; Du Xueliang; Wu Jingchuan

    2011-01-01

    Objective: To investigate the changes of iodide uptake and the expression of thyroid-specific genes in poorly differentiated follicular thyroid carcinoma (FTC) cells after transfection of human TSH receptor (hTSHR) gene in vitro. Methods: The recombinant eukaryotic expression plasmid PcDNA3.1/hTSHR-cDNA was transformed into DH 5a bacterial for amplification and then the recombinant plasmid was extracted. The recombinant was identified with PCR amplifying, restriction enzyme digestion analysis and DNA sequencing. The recombinant plasmid pcDNA3.1/hTSHR was transfected into FTC-133 cell line by lipofectin method in vitro. Immunofluorescence, iodide uptake studies and real time-PCR were applied to detect target protein expression. Statistical analysis was performed with t-test using SPSS 13.0 software. Results: Kpn I and Xba I restriction enzyme digestion, PCR amplifying and DNA sequencing confirmed that pcDNA3.1/hTSHR was successfully constructed. After transfection of the recombinant plasmid pcDNA3.1/hTSHR-cDNA and the stimulation of hTSH, the tumor cells displayed the expression of hTSHR protein at cell surface and cytoplasm. The iodine uptake in pcDNA3.1/hTSHR transfected cells was 2.9 times higher than that of control(pcDNA3.1(+) transfected cells) group(t = 28.63, P<0.01). The expression of TSHR, NIS, TPO and Tg (mRNA levels) in pcDNA3.1/hTSHR transfected cells were also significantly elevated by 1.74 (t =5.959, P<0.01), 7.2 (t =3.807, P<0.05), 2.88 (t=4.769, P<0.01) and 2.67 times (t=6.388, P<0.01) respectively compared to those of the control group. Conclusion: The study demonstrates that iodide uptake may be reactivated by hTSHR receptor gene transfection in poorly differentiated FTC cell. (authors)

  3. Correction of mouse ornithine transcarbamylase deficiency by gene transfer into the germ line

    Energy Technology Data Exchange (ETDEWEB)

    Cavard, C; Grimber, G; Dubois, N; Chasse, J F; Bennoun, M; Minet-Thuriaux, M; Kamoun, P; Briand, P

    1988-03-25

    The sparse fur with abnormal skin and hair (Spf-ash) mouse is a model for the human x-linked hereditary disorder, ornithine transcarbamylase (OTC) deficiency. In Spf-ash mice, both OTC mRNA and enzyme activity are 5% of control values resulting in hyperammonemia, pronounced orotic aciduria and an abnormal phenotype characterized by growth retardation and sparse fur. Using microinjection, the authors introduced a construction containing rat OTC cDNA linked to the SV40 early promoter into fertilized eggs of Spf-ash mice. The expression of the transgene resulted in the development of a transgenic mouse whose phenotype and orotic acid excretion are fully normalized. Thus, the possibility of correcting hereditary enzymatic defect by gene transfer of heterologous cDNA coding for the normal enzyme has been demonstrated.

  4. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line.

    Directory of Open Access Journals (Sweden)

    Amanda Cinquin

    2016-04-01

    Full Text Available Self-renewing organs often experience a decline in function in the course of aging. It is unclear whether chronological age or external factors control this decline, or whether it is driven by stem cell self-renewal-for example, because cycling cells exhaust their replicative capacity and become senescent. Here we assay the relationship between stem cell cycling and senescence in the Caenorhabditis elegans reproductive system, defining this senescence as the progressive decline in "reproductive capacity," i.e. in the number of progeny that can be produced until cessation of reproduction. We show that stem cell cycling diminishes remaining reproductive capacity, at least in part through the DNA damage response. Paradoxically, gonads kept under conditions that preclude reproduction keep cycling and producing cells that undergo apoptosis or are laid as unfertilized gametes, thus squandering reproductive capacity. We show that continued activity is in fact beneficial inasmuch as gonads that are active when reproduction is initiated have more sustained early progeny production. Intriguingly, continued cycling is intermittent-gonads switch between active and dormant states-and in all likelihood stochastic. Other organs face tradeoffs whereby stem cell cycling has the beneficial effect of providing freshly-differentiated cells and the detrimental effect of increasing the likelihood of cancer or senescence; stochastic stem cell cycling may allow for a subset of cells to preserve proliferative potential in old age, which may implement a strategy to deal with uncertainty as to the total amount of proliferation to be undergone over an organism's lifespan.

  5. [About the infection of Drosophila female germ line cells by sigma virus (author's transl)].

    Science.gov (United States)

    Brun, G

    1977-01-01

    The results which have been presented by Bregliano (1973) and Bregliano et Fleuriet (1975) in this "Annales" are discussed. The author's conclusion is that there are two distinct mechanisms for contamination of the cysts of non-stabilized females (in stabilized females, all cells, including oogonial cells, are infected in carrier state by sigma). Hypotheses are discussed.

  6. Identification of 3 novel VHL germ-line mutations in Danish VHL patients

    DEFF Research Database (Denmark)

    Dandanell, Mette; Friis-Hansen, Lennart Jan; Sunde, Lone

    2012-01-01

    von Hippel-Lindau (VHL) disease is a hereditary cancer syndrome in which the patients develop retinal and central nervous system hemangioblastomas, pheochromocytomas and clear-cell renal tumors. The autosomal dominant disease is caused by mutations in the VHL gene.......von Hippel-Lindau (VHL) disease is a hereditary cancer syndrome in which the patients develop retinal and central nervous system hemangioblastomas, pheochromocytomas and clear-cell renal tumors. The autosomal dominant disease is caused by mutations in the VHL gene....

  7. Maternal age effect and severe germ-line bottleneck in the inheritance of human mitochondrial DNA

    DEFF Research Database (Denmark)

    Rebolledo-Jaramillo, Boris; Su, Marcia Shu-Wei; Stoler, Nicholas

    2014-01-01

    The manifestation of mitochondrial DNA (mtDNA) diseases depends on the frequency of heteroplasmy (the presence of several alleles in an individual), yet its transmission across generations cannot be readily predicted owing to a lack of data on the size of the mtDNA bottleneck during oogenesis......, an order of magnitude higher than for nuclear DNA. Notably, we found a positive association between the number of heteroplasmies in a child and maternal age at fertilization, likely attributable to oocyte aging. This study also took advantage of droplet digital PCR (ddPCR) to validate heteroplasmies...... and confirm a de novo mutation. Our results can be used to predict the transmission of disease-causing mtDNA variants and illuminate evolutionary dynamics of the mitochondrial genome....

  8. Retrovirus-mediated in vitro gene transfer into chicken male germ line cells

    Czech Academy of Sciences Publication Activity Database

    Kalina, J.; Šenigl, Filip; Mičáková, A.; Mucksová, J.; Blažková, Jana; Haifeng, Y.; Poplštejn, M.; Hejnar, Jiří; Trefil, P.

    2007-01-01

    Roč. 134, č. 3 (2007), s. 445-453 ISSN 1470-1626 R&D Projects: GA ČR GA523/04/0569 Grant - others:GA MŠk(CZ) 1P05ME722 Institutional research plan: CEZ:AV0Z50520514 Keywords : Transgenic spermatozoa * infection of testicular cells with retrovirus * transgenesis in chicken Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.962, year: 2007

  9. Mismatch repair deficiency does not enhance ENU mutagenesis in the zebrafish germ line.

    NARCIS (Netherlands)

    Feitsma, H.; de Bruijn, E.; van de Belt, J.; Nijman, I.J.; Cuppen, E.

    2008-01-01

    S(N)1-type alkylating agents such as N-ethyl-N-nitrosourea (ENU) are very potent mutagens. They act by transferring their alkyl group to DNA bases, which, upon mispairing during replication, can cause single base pair mutations in the next replication cycle. As DNA mismatch repair (MMR) proteins are

  10. Dicer is required for haploid male germ cell differentiation in mice.

    Directory of Open Access Journals (Sweden)

    Hanna M Korhonen

    Full Text Available BACKGROUND: The RNase III endonuclease Dicer is an important regulator of gene expression that processes microRNAs (miRNAs and small interfering RNAs (siRNAs. The best-characterized function of miRNAs is gene repression at the post-transcriptional level through the pairing with mRNAs of protein-encoding genes. Small RNAs can also act at the transcriptional level by controlling the epigenetic status of chromatin. Dicer and other mediators of small RNA pathways are present in mouse male germ cells, and several miRNAs and endogenous siRNAs are expressed in the testis, suggesting that Dicer-dependent small RNAs are involved in the control of the precisely timed and highly organised process of spermatogenesis. PRINCIPAL FINDINGS: Being interested in the Dicer-mediated functions during spermatogenesis, we have analysed here a male germ cell-specific Dicer1 knockout mouse model, in which the deletion of Dicer1 takes place during early postnatal development in spermatogonia. We found that Dicer1 knockout testes were reduced in size and spermatogenesis within the seminiferous tubules was disrupted. Dicer1 knockout epididymides contained very low number of mature sperm with pronounced morphological abnormalities. Spermatogonial differentiation appeared unaffected. However, the number of haploid cells was decreased in knockout testes, and an increased number of apoptotic spermatocytes was observed. The most prominent defects were found during late haploid differentiation, and Dicer was demonstrated to be critical for the normal organization of chromatin and nuclear shaping of elongating spermatids. CONCLUSIONS/SIGNIFICANCE: We demonstrate that Dicer and Dicer-dependent small RNAs are imperative regulators of haploid spermatid differentiation and essential for male fertility.

  11. Derivation and characterization of the NIH registry human stem cell line NYSCF100 line under defined feeder-free conditions

    Directory of Open Access Journals (Sweden)

    Ana Sevilla

    2018-05-01

    Full Text Available The human embryonic stem cell line NYSCFe001-A was derived from a day 6 blastocyst in feeder-free and antibiotic free conditions. The blastocyst was voluntarily donated for research as surplus after in vitro fertilization treatment following informed consent. The NYSCFe001-A line, registered as NYSCF100 on the NIH registry, presents normal karyotype, is mycoplasma free, expresses all the pluripotency markers and has the potential to differentiate into all three germ layers in vitro.

  12. Multiplicity of Buc copies in Atlantic salmon contrasts with loss of the germ cell determinant in primates, rodents and axolotl

    OpenAIRE

    Skugor, Adrijana; Tveiten, Helge; Johnsen, Hanne; Andersen, Øivind

    2016-01-01

    Background The primordial germ cells (PGCs) giving rise to gametes are determined by two different mechanisms in vertebrates. While the germ cell fate in mammals and salamanders is induced by zygotic signals, maternally delivered germ cell determinants specify the PGCs in birds, frogs and teleost fish. Assembly of the germ plasm in the oocyte is organized by the single Buc in zebrafish, named Velo1 in Xenopus, and by Oskar in Drosophila. Secondary loss of oskar in several insect lineages coin...

  13. Ag85A-specific CD4+ T cell lines derived after boosting BCG-vaccinated cattle with Ad5-85A possess both mycobacterial growth inhibition and anti-inflammatory properties.

    Science.gov (United States)

    Metcalfe, Hannah J; Biffar, Lucia; Steinbach, Sabine; Guzman, Efrain; Connelley, Tim; Morrison, Ivan; Vordermeier, H Martin; Villarreal-Ramos, Bernardo

    2018-05-11

    There is a need to improve the efficacy of the BCG vaccine against human and bovine tuberculosis. Previous data showed that boosting bacilli Calmette-Guerin (BCG)-vaccinated cattle with a recombinant attenuated human type 5 adenovirally vectored subunit vaccine (Ad5-85A) increased BCG protection and was associated with increased frequency of Ag85A-specific CD4 + T cells post-boosting. Here, the capacity of Ag85A-specific CD4 + T cell lines - derived before and after viral boosting - to interact with BCG-infected macrophages was evaluated. No difference before and after boosting was found in the capacity of these Ag85A-specific CD4 + T cell lines to restrict mycobacterial growth, but the secretion of IL-10 in vitro post-boost increased significantly. Furthermore, cell lines derived post-boost had no statistically significant difference in the secretion of pro-inflammatory cytokines (IL-1β, IL-12, IFNγ or TNFα) compared to pre-boost lines. In conclusion, the protection associated with the increased number of Ag85A-specific CD4 + T cells restricting mycobacterial growth may be associated with anti-inflammatory properties to limit immune-pathology. Copyright © 2018 Department for Environment Food and Rural Affairs. Published by Elsevier Ltd.. All rights reserved.

  14. From Young Children's Ideas about Germs to Ideas Shaping a Learning Environment

    Science.gov (United States)

    Ergazaki, Marida; Saltapida, Konstantina; Zogza, Vassiliki

    2010-11-01

    This paper is concerned with highlighting young children’s ideas about the nature, location and appearance of germs, as well as their reasoning strands about germs’ ontological category and biological functions. Moreover, it is concerned with exploring how all these could be taken into account for shaping a potentially fruitful learning environment. Conducting individual, semi-structured interviews with 35 preschoolers (age 4.5-5.5) of public kindergartens in the broader area of Patras, we attempted to trace their ideas about what germs are, where they may be found, whether they are good or bad and living or non-living and how they might look like in a drawing. Moreover, children were required to attribute a series of biological functions to dogs, chairs and germs, and finally to create a story with germs holding a key-role. The analysis of our qualitative data within the “NVivo” software showed that the informants make a strong association of germs with health and hygiene issues, locate germs mostly in our body and the external environment, are not familiar with the ‘good germs’-idea, and draw germs as ‘human-like’, ‘animal-like’ or ‘abstract’ entities. Moreover, they have significant difficulties not only in employing biological functions as criteria for classifying germs in the category of ‘living’, but also in just attributing such functions to germs using a warrant. Finally, the shift from our findings to a 3-part learning environment aiming at supporting preschoolers in refining their initial conceptualization of germs is thoroughly discussed in the paper.

  15. Characterization, isolation and culture of primordial germ cells in domestic animals: recent progress and insights from the ovine species.

    Science.gov (United States)

    Ledda, S; Bogliolo, L; Bebbere, D; Ariu, F; Pirino, S

    2010-09-01

    Primordial germ cell (PGC) allocation, characterization, lineage restriction, and differentiation have been extensively studied in the mouse. Murine PGC can be easily identified using markers as alkaline phosphatase content or the expression of pluripotent markers such as Pou5f1, Nanog, Sox2, Kit, SSEA1, and SSEA4. These tools allowed us to clarify certain aspects of the complex interactions of somatic and germinal cells in the establishment of the germ cell lineage, its segregation from the neighbouring somatic tissue, and the guidance mechanisms during migration that direct most of the germ cells into the genital ridges. Few data are available from other domestic animals and here we reported our preliminary studies on the isolation, characterization, and in vitro culture of sheep PGCs. Sheep PGCs can be identified with the markers previously used in mouse, but, in some cases, these markers are not coherently expressed in the same cell depending on the grade of differentiation and on technical problems related to commercial antibodies used. Pluripotency of PGCs in culture (EGCs) from domestic animals also needs further evaluation even though the derivation of embryonic pluripotent cell lines from large mammals may be an advantage as they are more physiologically similar to the human and perhaps more relevant for clinical translation studies. Comprehensive epigenetic reprogramming of the genome in early germ cells, and derived EGCs including extensive erasure of epigenetic modifications, may be relevant for gaining insight into events that lead to reprogramming and establishment of totipotency. EGCs can differentiate in vitro in a various range of tissues, form embryonic bodies, but in many cases failed to generate tumours when transplanted into immunodeficient mice and are not able to generate germline chimeric animals after their transfer. Such incomplete information clearly indicates the urge to improve the studies on derivation of stem cells in farm animals and

  16. Specific pesticide-dependent increases in α-synuclein levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines.

    Science.gov (United States)

    Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry

    2013-06-01

    Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.

  17. Specific down-regulation of XIAP with RNA interference enhances the sensitivity of canine tumor cell-lines to TRAIL and doxorubicin

    Directory of Open Access Journals (Sweden)

    Rothuizen Jan

    2006-09-01

    Full Text Available Abstract Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE, mammary carcinoma (P114, and osteosarcoma (D17. These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors.

  18. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  19. Generation of a human induced pluripotent stem cell line via CRISPR-Cas9 mediated integration of a site-specific homozygous mutation in CHMP2B

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2016-07-01

    Full Text Available Frontotemporal dementia (FTD is an early onset neurodegenerative disease. Mutations in several genes cause familial FTD and one of them is charged multivesicular body protein 2B (CHMP2B on chromosome 3 (FTD3, a component of the endosomal sorting complex required for transport III (ESCRT-III. We have generated an induced pluripotent stem cell (iPSC line of a healthy individual and inserted the CHMP2B IVS5AS G-C gene mutation into both alleles, resulting in aberrant splicing. This human iPSC line provides an ideal model to study CHMP2B-dependent phenotypes of FTD3.

  20. Clinical use of serum TRA-1-60 as tumor marker in patients with germ cell cancer

    DEFF Research Database (Denmark)

    Lajer, Henrik; Daugaard, Gedske; Andersson, Anna-Maria

    2002-01-01

    TRA-1-60 antigen has been related to the presence of embryonal germ cell carcinoma (EC) and carcinoma in situ. Our study further investigated the clinical efficacy of TRA-1-60 as a serum tumor marker for germ cell cancer in the testis. Three groups of patients with germ cell tumors were included:...

  1. File list: InP.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Gon.10.AllAg.Testicular_germ_cells mm9 Input control Gonad Testicular germ cell.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.10.AllAg.Testicular_germ_cells.bed ...

  2. Evaluation of corn germ from ethanol production as an alternative fat source in dairy cow diets.

    Science.gov (United States)

    Abdelqader, M M; Hippen, A R; Kalscheur, K F; Schingoethe, D J; Karges, K; Gibson, M L

    2009-03-01

    Sixteen multiparous cows (12 Holstein and 4 Brown Swiss, 132 +/- 20 d in milk) were used in a replicated 4 x 4 Latin square design with 4-wk periods to determine the effects of feeding corn germ on dairy cow performance. Diets were formulated with increasing concentrations of corn germ (Dakota Germ, Poet Nutrition, Sioux Falls, SD) at 0, 7, 14, and 21% of the diet dry matter (DM). All diets had a 55:45 forage to concentrate ratio, where forage was 55% corn silage and 45% alfalfa hay. Dietary fat increased from 4.8% in the control diet to 8.2% at the greatest inclusion level of corn germ. The addition of corn germ resulted in a quadratic response in DM intake with numerically greater intake at 14% of diet DM. Feeding corn germ at 7 and 14% of diet DM increased milk yield and energy-corrected milk as well as fat percentage and yield. Milk protein yield tended to decrease as the concentration of corn germ increased in the diet. Dietary treatments had no effect on feed efficiency, which averaged 1.40 kg of energy-corrected milk/kg of DMI. Increasing the dietary concentration of corn germ resulted in a linear increase in milk fat concentrations of monounsaturated and polyunsaturated fatty acids at the expense of saturated fatty acids. Milk fat concentration and yield of cis-9, trans-11 and trans-10, cis-12 conjugated linoleic acid were increased with increased dietary concentrations of corn germ. Although milk fat concentrations of both total trans-18:1 and cis-18:1 fatty acids increased linearly, a marked numeric increase in the concentration of trans-10 C18:1 was observed in milk from cows fed the 21% corn germ diet. A similar response was observed in plasma concentration of trans-10 C18:1. Feeding increasing concentrations of corn germ had no effect on plasma concentrations of glucose, triglyceride, or beta-hydroxybutyrate; however, the concentration of nonesterified fatty acids increased linearly, with plasma cholesterol concentration demonstrating a similar trend

  3. Correlated effects of selection for immunity in White Leghorn chicken lines on natural antibodies and specific antibody responses to KLH and M. butyricum

    NARCIS (Netherlands)

    Minozzi, G.; Parmentier, H.K.; Mignon-Grasteau, S.; Nieuwland, M.G.B.; Bed'hom, B.; Gourichon, D.; Minvielle, F.; Pinard-van der Laan, M.H.

    2008-01-01

    Background - The effect of selection for three general immune response traits on primary antibody responses (Ab) to Mycobacterium butyricum or keyhole limpet hemocyanin (KLH) was studied in four experimental lines of White Leghorn chicken. Birds underwent 12 generations of selection for one of three

  4. Functional fixation of autotransplanted tooth germs by using bioresorbable membranes.

    Science.gov (United States)

    Gérard, Eric; Membre, Hervé; Gaudy, Jean-François; Mahler, Patrick; Bravetti, Pierre

    2002-12-01

    The purpose of this study was to evaluate the contribution of a bioresorbable membrane placement to the healing of immature teeth after autotransplantation of tooth buds. Six cases were selected: 2 transplantations of wisdom teeth, 2 for premolar agenesis, 1 for ectopia, and 1 premolar in an incisor position. The crown of each tooth germ and the marginal alveolar bone were covered with a resorbable membrane. The radicular edification was nearly complete, neither ankylosis nor inflammatory resorption was observable, the pulp vitality was preserved, and the periodontal integration was identical to that of other teeth. The membrane ensured contention and stabilization of the transplant, allowed functional stimulation, permitted protection of the coagulum and periodontal cells, and kept the epithelium at a distance. The transplantations of immature teeth were improved by the use of a resorbable membrane, which caused an optimal functional fixation of the transplanted tooth.

  5. Testicular germ cell tumors: Molecular genetic and clinicomorphological aspects

    Directory of Open Access Journals (Sweden)

    M. V. Nemtsova

    2015-03-01

    Full Text Available Testicular tumors are the most common form of solid cancer in young men. According to the 2004 WHO classification, testicular germ cell tumors (TGCT may present with different histological types. Embryonic cells of varying grade may be a source of TGCT and the occurrence of this type of tumors is directly related to the formation of a pool of male sex cells and gametogenesis. The paper gives information on mo- lecular stages for the process of formation of male sex cells in health, as well as ways of their impairments leading to TGCT. An investigation of the profiles of gene expression and the spectrum of molecular damages revealed genes responsible for a predisposition to the sporadic and hereditary forms of TGCT. The paper presents the current molecular genetic and clinicomorphological characteristics of TGCT. 

  6. Lessons from the use of genetically modified Drosophila melanogaster in ecological studies: Hsf mutant lines show highly trait-specific performance in field and laboratory thermal assays

    DEFF Research Database (Denmark)

    Sørensen, Jesper Givskov; Loeschcke, Volker; Kristensen, Torsten Nygård

    2009-01-01

    . 2.  We have tested the importance of inducible heat shock proteins (Hsps) under different thermal conditions using two heat shock factor (Hsf) mutant lines (either able (Hsf+) or unable (Hsf0) to mount a heat stress response) and an outbred laboratory adapted wild-type line of Drosophila......1.  Laboratory studies on genetically modified strains may reveal important information on mechanisms involved in coping with thermal stress. However, to address the evolutionary significance of specific genes or physiological mechanisms, ecologically relevant field tests should also be performed...

  7. Dead end1 is an essential partner of NANOS2 for selective binding of target RNAs in male germ cell development.

    Science.gov (United States)

    Suzuki, Atsushi; Niimi, Yuki; Shinmyozu, Kaori; Zhou, Zhi; Kiso, Makoto; Saga, Yumiko

    2016-01-01

    RNA-binding proteins (RBPs) play important roles for generating various cell types in many developmental processes, including eggs and sperms. Nanos is widely known as an evolutionarily conserved RNA-binding protein implicated in germ cell development. Mouse NANOS2 interacts directly with the CCR4-NOT (CNOT) deadenylase complex, resulting in the suppression of specific RNAs. However, the mechanisms involved in target specificity remain elusive. We show that another RBP, Dead end1 (DND1), directly interacts with NANOS2 to load unique RNAs into the CNOT complex. This interaction is mediated by the zinc finger domain of NANOS2, which is essential for its association with target RNAs. In addition, the conditional deletion of DND1 causes the disruption of male germ cell differentiation similar to that observed in Nanos2-KO mice. Thus, DND1 is an essential partner for NANOS2 that leads to the degradation of specific RNAs. We also present the first evidence that the zinc finger domain of Nanos acts as a protein-interacting domain for another RBP, providing a novel insight into Nanos-mediated germ cell development. © 2015 The Authors.

  8. Germ Cell Proteins in Melanoma: Prognosis, Diagnosis, Treatment, and Theories on Expression

    International Nuclear Information System (INIS)

    Rosa, A. M.; Dabas, N.; Byrnes, D. M.; Eller, M. S.; Grichnik, J. M.; Grichnik, J M.; Grichnik, J M.

    2012-01-01

    Germ cell protein expression in melanoma has been shown to correlate with malignancy, severity of disease and to serve as an immunologic target for therapy. However, very little is known about the role that germ cell proteins play in cancer development. Unique germ cell pathways include those involved in immortalization, genetic evolution, and energy metabolism. There is an ever increasing recognition that within tumors there is a subpopulation of cells with stem-cell-like characteristics that play a role in driving tumor genesis. Stem cell and germ cell biology is intertwined. Given the enormous potential and known expression of germ cell proteins in melanoma, it is possible that they represent a largely untapped resource that may play a fundamental role in tumor development and progression. The purpose of this paper is to provide an update on the current value of germ cell protein expression in melanoma diagnosis, prognosis, and therapy, as well as to review critical germ cell pathways and discuss the potential roles these pathways may play in malignant transformation

  9. Generation of male differentiated germ cells from various types of stem cells.

    Science.gov (United States)

    Hou, Jingmei; Yang, Shi; Yang, Hao; Liu, Yang; Liu, Yun; Hai, Yanan; Chen, Zheng; Guo, Ying; Gong, Yuehua; Gao, Wei-Qiang; Li, Zheng; He, Zuping

    2014-06-01

    Infertility is a major and largely incurable disease caused by disruption and loss of germ cells. It affects 10-15% of couples, and male factor accounts for half of the cases. To obtain human male germ cells 'especially functional spermatids' is essential for treating male infertility. Currently, much progress has been made on generating male germ cells, including spermatogonia, spermatocytes, and spermatids, from various types of stem cells. These germ cells can also be used in investigation of the pathology of male infertility. In this review, we focused on advances on obtaining male differentiated germ cells from different kinds of stem cells, with an emphasis on the embryonic stem (ES) cells, the induced pluripotent stem (iPS) cells, and spermatogonial stem cells (SSCs). We illustrated the generation of male differentiated germ cells from ES cells, iPS cells and SSCs, and we summarized the phenotype for these stem cells, spermatocytes and spermatids. Moreover, we address the differentiation potentials of ES cells, iPS cells and SSCs. We also highlight the advantages, disadvantages and concerns on derivation of the differentiated male germ cells from several types of stem cells. The ability of generating mature and functional male gametes from stem cells could enable us to understand the precise etiology of male infertility and offer an invaluable source of autologous male gametes for treating male infertility of azoospermia patients. © 2014 Society for Reproduction and Fertility.

  10. Effectivity of pazopanib treatment in orthotopic models of human testicular germ cell tumors

    International Nuclear Information System (INIS)

    Juliachs, Mercè; Viñals, Francesc; Vidal, August; Muro, Xavier Garcia del; Piulats, Josep M; Condom, Enric; Casanovas, Oriol; Graupera, Mariona; Germà, Jose R; Villanueva, Alberto

    2013-01-01

    Cisplatin (CDDP) resistance in testicular germ cell tumors (GCTs) is still a clinical challenge, and one associated with poor prognosis. The purpose of this work was to test pazopanib, an anti-tumoral and anti-angiogenic multikinase inhibitor, and its combination with lapatinib (an anti-ErbB inhibitor) in mouse orthotopic models of human testicular GCTs. We used two different models of human testicular GCTs orthotopically grown in nude mice; a CDDP-sensitive choriocarcinoma (TGT38) and a new orthotopic model generated from a metastatic GCT refractory to first-line CDDP chemotherapy (TGT44). Nude mice implanted with these orthotopic tumors were treated with the inhibitors and the effect on tumoral growth and angiogenesis was evaluated. TGT44 refractory tumor had an immunohistochemical profile similar to the original metastasis, with characteristics of yolk sac tumor. TGT44 did not respond when treated with cisplatin. In contrast, pazopanib had an anti-angiogenic effect and anti-tumor efficacy in this model. Pazopanib in combination with lapatinib in TGT38, an orthotopic model of choriocarcinoma had an additive effect blocking tumor growth. We present pazopanib as a possible agent for the alternative treatment of CDDP-sensitive and CDDP-refractory GCT patients, alone or in combination with anti-ErbB therapies

  11. Conventional-Dose versus High-Dose Chemotherapy for Relapsed Germ Cell Tumors

    Directory of Open Access Journals (Sweden)

    Deaglan J. McHugh

    2018-01-01

    Full Text Available The majority of metastatic germ cell tumors (GCTs are cured with cisplatin-based chemotherapy, but 20–30% of patients will relapse after first-line chemotherapy and require additional salvage strategies. The two major salvage approaches in this scenario are high-dose chemotherapy (HDCT with autologous stem cell transplant (ASCT or conventional-dose chemotherapy (CDCT. Both CDCT and HDCT have curative potential in the management of relapsed/refractory GCT. However, due to a lack of conclusive randomized trials, it remains unknown whether sequential HDCT or CDCT represents the optimal initial salvage approach, with practice varying between tertiary institutions. This represents the most pressing question remaining for defining GCT treatment standards and optimizing outcomes. The authors review prognostic factors in the initial salvage setting as well as the major studies assessing the efficacy of CDCT, HDCT, or both, describing the strengths and weaknesses that formed the rationale behind the ongoing international phase III “TIGER” trial.

  12. Reciprocal translocations in germ cells of male mice receiving external γ-irradiation

    International Nuclear Information System (INIS)

    Bayrakova, A.; Filev, G.; Baev, I.

    1987-01-01

    Experiments were undertaken in which yields were recorded of reciprocal translocations in germ cells of male mice exposed to 0.9 Gy of γ-radiation at dose rates ranging from 6.14 x 10 -3 to 6.14 x 10 2 mGy/min (6 levels); comparisons were made with data published up to 1985 from similar studies using other fixed doses. To do this, translocation yields were expressed as relative yields (F) and their relationship to the dose rate (P) for the individual fixed doses was represented by an equation of the type: F = α + β log P. For most of the equations, the regression coefficients were in good agreement and a single relationship was obtained to represent them. From the analysis performed it follows that, within the 0.6-6.0 Gy dose range, the pattern of the F vs. P relationship is unaffected by the dose. This supports the initial assumption that for the dose range up to 6.0 Gy the dose response for the reciprocal translocation yield is a non-threshold straight-line relationship. (Auth.)

  13. Phosphorus Partitioning of Soybean Lines Containing Different Mutant Alleles of Two Soybean Seed-Specific Adenosine Triphosphate-Binding Cassette Phytic Acid Transporter Paralogs

    Directory of Open Access Journals (Sweden)

    Jason D. Gillman

    2013-03-01

    Full Text Available Seed phytate is a repository of P and minerals in soybean [ (L. Merr.] seeds that limits P and mineral bioavailability for monogastric animals (e.g., humans, swine [], and poultry [especially chicken, ] due to insufficient digestive tract phytase activity. We previously identified epistatic recessive mutations affecting two paralogous adenosine triphosphate-binding cassette phytic acid transporter genes (one a nonsense mutation in and the other a missense mutation in as the molecular genetic basis in the ethyl methanesulfonate (EMS-induced mutant low phytate soybean line M153. An additional mutant low phytate line, M766, contained one single nucleotide polymorphism within the ninth intron of the locus as well as a nonsense mutation in . The objectives of this research were to clarify the genetics underlying the low phytate phenotype in line M766 and to determine P partitioning in new combinations of mutant alleles from M766 and M153. Inheritance of nonsense alleles affecting both ( genes (one from M153 and one from M766 led to the production of viable seeds that contained transgressive reductions in total seed phytate and significantly higher levels of inorganic phosphate than has been reported for nontransgenic soybean material and will allow efficient molecular selection of soybeans with even greater reductions of phytate for improved quality soybean meal.

  14. Disease-specific induced pluripotent stem cells: a platform for human disease modeling and drug discovery.

    Science.gov (United States)

    Jang, Jiho; Yoo, Jeong-Eun; Lee, Jeong-Ah; Lee, Dongjin R; Kim, Ji Young; Huh, Yong Jun; Kim, Dae-Sung; Park, Chul-Yong; Hwang, Dong-Youn; Kim, Han-Soo; Kang, Hoon-Chul; Kim, Dong-Wook

    2012-03-31

    The generation of disease-specific induced pluripotent stem cell (iPSC) lines from patients with incurable diseases is a promising approach for studying disease mechanisms and drug screening. Such innovation enables to obtain autologous cell sources in regenerative medicine. Herein, we report the generation and characterization of iPSCs from fibroblasts of patients with sporadic or familial diseases, including Parkinson's disease (PD), Alzheimer's disease (AD), juvenile-onset, type I diabetes mellitus (JDM), and Duchenne type muscular dystrophy (DMD), as well as from normal human fibroblasts (WT). As an example to modeling disease using disease-specific iPSCs, we also discuss the previously established childhood cerebral adrenoleukodystrophy (CCALD)- and adrenomyeloneuropathy (AMN)-iPSCs by our group. Through DNA fingerprinting analysis, the origins of generated disease-specific iPSC lines were identified. Each iPSC line exhibited an intense alkaline phosphatase activity, expression of pluripotent markers, and the potential to differentiate into all three embryonic germ layers: the ectoderm, endoderm, and mesoderm. Expression of endogenous pluripotent markers and downregulation of retrovirus-delivered transgenes [OCT4 (POU5F1), SOX2, KLF4, and c-MYC] were observed in the generated iPSCs. Collectively, our results demonstrated that disease-specific iPSC lines characteristically resembled hESC lines. Furthermore, we were able to differentiate PD-iPSCs, one of the disease-specific-iPSC lines we generated, into dopaminergic (DA) neurons, the cell type mostly affected by PD. These PD-specific DA neurons along with other examples of cell models derived from disease-specific iPSCs would provide a powerful platform for examining the pathophysiology of relevant diseases at the cellular and molecular levels and for developing new drugs and therapeutic regimens.

  15. EKSTRAKSI DAN ANALISIS FITOSTEROL LEMBAGA GANDUM [Extraction and analysis of Phytosterol from wheat germ (Triticum sp.

    Directory of Open Access Journals (Sweden)

    Latifah K Darusman3

    2005-04-01

    Full Text Available Phytosterol may reduce the absorption of cholesterol, and used for preventing atherosclerosis. It is limited in soybean, but potentially abundant in wheat germ. Research on the utilization of wheat germ sterol had not been reported so far. Many aspects of germ sterol extraction from wheat germ and its characteristics were still unknown. In this research, the best extraction method, kinds and content of phytosterol from wheat germ were investigated.This research consisted of two steps: (1 extraction of phytosterol directly form whole germ and ground germ using hexane, and indirect extraction through germ oil using hexane and mixed solvent of hexane and ethanol, and direct extraction from ground germ using ethanol; (2 analysis of the type and content of phytosterol in the crude extract through the following steps: preparation of crude extract, fractionation, and analysis.Results showed that indirect extraction through germ oil was considered as the best method which yielded 1.37% of phytosterol. The highest yield was obtained when extracted using a mixed solvent of hexane – ethanol 82:18. However, the odor of ethanol and hexane (gasoline like odor was still detected. The solvent’s ratio of hexane to ethanol at 1:2 resulted better odor of the extract. Extraction of sterol using ethanol yielded 18.39% of sterol when the ratio of germ to ethanol at 1:10 (w/v was applied.Results of quantitative analysis on the main component of crude extract of wheat germ sterol showed that the total content of sterol extracted with mixed solvent was higher than those extracted with ethanol. The ratio of hexane to ethanol at 1:1 (v/v gave higher content of total sterol, stigmasterol and campesterol, whereas higher content of -sitosterol was produced at the solvent’s ratio of hexane to ethanol at 1:2 (v/v.

  16. Fat absorption in germ-free and conventional rats artificially deprived of bile secretion

    OpenAIRE

    Demarne, Y.; Corring, T.; Pihet, A.; Sacquet, E.

    1982-01-01

    Bile duct ligation was performed in germ-free and conventional rats in order to study the effects of bile deprivation on the absorption of dietary lipids and the excretion of faecal lipids in the presence or the absence of gastrointestinal flora. The main consequence of bile duct ligation in conventional rats was decrease of about 50% in the apparent absorption of dietary lipids (peanut oil). In germ-free rats, absorption decreased by only about 25%.In conventional as well as in germ-free con...

  17. Establishment of new murine embryonic stem cell lines for the generation of mouse models of human genetic diseases

    Directory of Open Access Journals (Sweden)

    M.A. Sukoyan

    2002-05-01

    Full Text Available Embryonic stem cells are totipotent cells derived from the inner cell mass of blastocysts. Recently, the development of appropriate culture conditions for the differentiation of these cells into specific cell types has permitted their use as potential therapeutic agents for several diseases. In addition, manipulation of their genome in vitro allows the creation of animal models of human genetic diseases and for the study of gene function in vivo. We report the establishment of new lines of murine embryonic stem cells from preimplantation stage embryos of 129/Sv mice. Most of these cells had a normal karyotype and an XY sex chromosome composition. The pluripotent properties of the cell lines obtained were analyzed on the basis of their alkaline phosphatase activity and their capacity to form complex embryoid bodies with rhythmically contracting cardiomyocytes. Two lines, USP-1 and USP-3, with the best in vitro characteristics of pluripotency were used in chimera-generating experiments. The capacity to contribute to the germ line was demonstrated by the USP-1 cell line. This cell line is currently being used to generate mouse models of human diseases.

  18. Defatted wheat germ application: Influence on cookies' properties with regard to its particle size and dough moisture content.

    Science.gov (United States)

    Petrović, Jovana; Rakić, Dušan; Fišteš, Aleksandar; Pajin, Biljana; Lončarević, Ivana; Tomović, Vladimir; Zarić, Danica

    2017-10-01

    The introduction of agro-food industry by-products rich in bioactive compounds represents major challenge in food industry sector. The influence of wheat germ particle size (Box-Behnken experimental design. The substitution of wheat flour with wheat germ increased the protein, fat, mineral, and fiber content of the cookies. The particle size of wheat germ affected the textural properties of cookies. As the particle size of wheat germ increased, the hardness of cookies decreased. The color of the cookie was most influenced by the interaction of dough moisture content and wheat germ particle size. Wheat germ level up to 15% had no significant effect on the sensory characteristics of cookies. A suitable combination of defatted wheat germ level, its particle size, and dough moisture content can improve the nutritional value of cookies, without causing a negative effect on the cookies' sensory characteristics.

  19. YKL-40 is differentially expressed in human embryonic stem cells and in cell progeny of the three germ layers

    DEFF Research Database (Denmark)

    Brøchner, Christian B; Johansen, Julia S; Larsen, Lars A

    2012-01-01

    oxygen tension, in culture medium with or without basic fibroblast growth factor, and on feeder layers comprising mouse embryonic fibroblasts or human foreskin fibroblasts to evaluate whether hESCs and their progeny produced YKL-40 and to characterize YKL-40 expression during differentiation. Secreted......The secreted glycoprotein YKL-40 participates in cell differentiation, inflammation, and cancer progression. High YKL-40 expression is reported during early human development, but its functions are unknown. Six human embryonic stem cell (hESC) lines were cultured in an atmosphere of low or high...... YKL-40 protein and YKL-40 mRNA expression were measured by enzyme-linked immunosorbent assay (ELISA) and quantitative RT-PCR. Serial-sectioned colonies were stained for YKL-40 protein and for pluripotent hESC (OCT4, NANOG) and germ layer (HNF-3ß, PDX1, CD34, p63, nestin, PAX6) markers. Double...

  20. MEASUREMENT OF AFFINITY IN SERUM SAMPLES OF ANTIGEN-FREE, GERM-FREE AND CONVENTIONAL MICE AFTER HYPERIMMUNIZATION WITH 2,4-DINITROPHENYL KEYHOLE LIMPET HEMOCYANIN, USING SURFACE-PLASMON RESONANCE

    NARCIS (Netherlands)

    BAKKER, R; LASONDER, E; BOS, NA

    We previously investigated the primary and secondary responses and hyperimmunization to the T cell-dependent antigen 2,4-dinitrophenyl keyhole limpet hemocyanin (DNP-KLH) in antigen-free (AF), germ-free (GF) and conventional (CV) mice. Both the absolute and relative numbers of DNP-specific

  1. Localization of trefoil factor family peptide 3 (TFF3) in epithelial tissues originating from the three germ layers of developing mouse embryo.

    Science.gov (United States)

    Bijelić, Nikola; Belovari, Tatjana; Tolušić Levak, Maja; Baus Lončar, Mirela

    2017-08-20

    Trefoil factor family (TFF) peptides are involved in the maintenance of epithelial integrity and epithelial restitution. Mature epithelial tissues originate from different embryonic germ layers. The objective of this research was to explore the presence and localization of TFF3 peptide in mouse embryonic epithelia and to examine if the occurrence of TFF3 peptide is germ layer-dependent. Mouse embryos (14-18 days old) were fixed in 4% paraformaldehyde and embedded in paraffin. Immunohistochemistry was performed with affinity purified rabbit anti-TFF3 antibody, goat anti-rabbit biotinylated secondary antibody and streptavidin-horseradish peroxidase, followed by 3,3'-diaminobenzidine. TFF3 peptide was present in the gastric and intestinal mucosa, respiratory mucosa in the upper and lower airways, pancreas, kidney tubules, epidermis, and oral cavity. The presence and localization of TFF3 peptide was associated with the embryonic stage and tissue differentiation. TFF3 peptide distribution specific to the germ layers was not observed. The role of TFF3 peptide in cell migration and differentiation, immune response, and apoptosis might be associated with specific embryonic epithelial cells. TFF3 peptide may also be considered as a marker for mucosal maturation.

  2. Localization of trefoil factor family peptide 3 (TFF3 in epithelial tissues originating from the three germ layers of developing mouse embryo

    Directory of Open Access Journals (Sweden)

    Nikola Bijelić

    2017-08-01

    Full Text Available Trefoil factor family (TFF peptides are involved in the maintenance of epithelial integrity and epithelial restitution. Mature epithelial tissues originate from different embryonic germ layers. The objective of this research was to explore the presence and localization of TFF3 peptide in mouse embryonic epithelia and to examine if the occurrence of TFF3 peptide is germ layer-dependent. Mouse embryos (14-18 days old were fixed in 4% paraformaldehyde and embedded in paraffin. Immunohistochemistry was performed with affinity purified rabbit anti-TFF3 antibody, goat anti-rabbit biotinylated secondary antibody and streptavidin-horseradish peroxidase, followed by 3,3'-diaminobenzidine. TFF3 peptide was present in the gastric and intestinal mucosa, respiratory mucosa in the upper and lower airways, pancreas, kidney tubules, epidermis, and oral cavity. The presence and localization of TFF3 peptide was associated with the embryonic stage and tissue differentiation. TFF3 peptide distribution specific to the germ layers was not observed. The role of TFF3 peptide in cell migration and differentiation, immune response, and apoptosis might be associated with specific embryonic epithelial cells. TFF3 peptide may also be considered as a marker for mucosal maturation.

  3. Retrotransposon long interspersed nucleotide element-1 (LINE-1) is activated during salamander limb regeneration

    Science.gov (United States)

    Zhu, Wei; Kuo, Dwight; Nathanson, Jason; Satoh, Akira; Pao, Gerald M.; Yeo, Gene W.; Bryant, Susan V.; Voss, S. Randal; Gardiner, David M.; Hunter, Tony

    2012-01-01

    Salamanders possess an extraordinary capacity for tissue and organ regeneration when compared to mammals. In our effort to characterize the unique transcriptional fingerprint emerging during the early phase of salamander limb regeneration, we identified transcriptional activation of some germline-specific genes within the Mexican axolotl (Ambystoma mexicanum) that is indicative of cellular reprogramming of differentiated cells into a germline-like state. In this work, we focus on one of these genes, the long interspersed nucleotide element-1 (LINE-1) retrotransposon, which is usually active in germ cells and silent in most of the somatic tissues in other organisms. LINE-1 was found to be dramatically upregulated during regeneration. In addition, higher genomic LINE-1 content was also detected in the limb regenerate when compared to that before amputation indicating that LINE-1 retrotransposition is indeed active during regeneration. Active LINE-1 retrotransposition has been suggested to have a potentially deleterious impact on genomic integrity. Silencing of activated LINE-1 by small RNAs has been reported to be part of the machinery aiming to maintain genomic integrity. Indeed, we were able to identify putative LINE-1-related piRNAs in the limb blastema. Transposable element-related piRNAs have been identified frequently in the germline in other organisms. Thus, we present here a scenario in which a unique germline-like state is established during axolotl limb regeneration, and the re-activation of LINE-1 may serve as a marker for cellular dedifferentiation in the early-stage of limb regeneration. PMID:22913491

  4. Gonadal germ cell tumors in children and adolescents

    Directory of Open Access Journals (Sweden)

    Giovanni Cecchetto

    2014-01-01

    Full Text Available Pediatric germ cell tumors (GCT are rare tumors: 80% are benign, 20% malignant (2-3% of all malignant pediatric tumors. The gonadal sites (ovary and testis account for 40% of cases. Ovarian GCTs: Represent 30% of GCTs and 70% of neoplastic ovarian masses, being the most common ovarian neoplasms in children and teenagers. Benign and immature forms (teratomas constitute about 80% of all ovarian GCTs, malignant forms represent 20% increasing during adolescence. The most common malignant entity in children is the yolk sac tumors (YST; dysgerminoma is frequent during adolescence and being bilateral in 10% of cases. Presentation is similar in malignant and benign lesions; abdominal pain (70-80% and lower abdominal mass are common symptoms. Evaluation of alpha-fetoprotein (αFP or beta subunit of human chorionic gonadotropin (βHCG is essential to address the nature of the tumors: Their elevation means presence of malignancy. Surgery includes intraoperative staging procedures and requires ovariectomy or ovarosalpingectomy for malignant lesions, but may be conservative in selected benign tumors. Since malignant GCTs are very chemosensitive, primary chemotherapy is recommended in metastatic or locally advanced tumors. Testicular GCT: Represent 10% of pediatric GCT, and about 30% of malignant GCT with two age peaks: Children <3 years may experience mature teratoma and malignant GCTs, represented almost exclusively by YST, while adolescents may also show seminomas or other mixed tumors. The main clinical feature is a painless scrotal mass. Surgery represents the cornerstone of the management of testicular GCTs, with an inguinal approach and a primary high orchidectomy for malignant tumors, while a testis-sparing surgery can be considered for benign lesions. A retroperitoneal lymph node (LN biopsy may be necessary to define the staging when the involvement of retroperitoneal LN is uncertain at imaging investigations. Conclusion: Patients with gonadal

  5. Pathogenesis of Testicular Germ Cell Tumors from a Developmental Point of View

    NARCIS (Netherlands)

    K. Biermann (Katharina)

    2010-01-01

    textabstractCurrent classification systems of human germ cell tumors (GCTs) are based on histological composition. In the group of nonseminomas, different variants of teratoma (somatic differentiation), yolk sac tumor and choriocarcinoma (extra-embryonic differentiation), are recognized, as well

  6. Expression of immunohistochemical markers for testicular carcinoma in situ by normal human fetal germ cells

    DEFF Research Database (Denmark)

    Jørgensen, N; Rajpert-De Meyts, E; Graem, N

    1995-01-01

    study. EXPERIMENTAL DESIGN: Normal human germ cells from 10 first-trimester fetuses and 76 second- and third-trimester testes were investigated for the immunohistochemical expression of the markers of testicular carcinoma in situ. The panel of markers included in the study consisted of placental......-like alkaline phosphatase, the protooncogene c-kit protein product, and the antigens for the monoclonal antibodies TRA-1-60 and M2A. The relative numbers of fetal germ cells that demonstrated positive reaction with the markers were calculated. RESULTS: The vast majority of the germ cells (75-100%) in the first......-trimester gonads were positive for placental-like alkaline phosphatase, TRA-1-60, and M2A. The c-kit protein was detected in three out of the ten first-trimester gonads. The relative number of germ cells positive for all the markers studied declined rapidly during the first part of the second trimester...

  7. In vivo cytogenetic effects of 2-trans hexenal on somatic and germ ...

    African Journals Online (AJOL)

    Francis

    meiotic cells. Wyrobek et al. (1983) emphasized that chemicals which are mutagenic to somatic cells, could also affect germ cells. The dose-dependent increase in the frequency of abnormal sperm observed in the present study suggests that ...

  8. In Vitro Effect of Local Anesthetics on Candida albicans Germ Tube Formation

    Directory of Open Access Journals (Sweden)

    Acácio Rodrigues

    1994-01-01

    Full Text Available Objective: This study was planned to clarify the in vitro effect of lidocaine and bupivacaine on germ tube formation by Candida albicans isolates from cases of clinical vaginal candidiasis.

  9. Involvement of epigenetic modifiers in the pathogenesis of testicular dysgenesis and germ cell cancer

    DEFF Research Database (Denmark)

    Lawaetz, Andreas C.; Almstrup, Kristian

    2015-01-01

    Testicular germ cell cancer manifests mainly in young adults as a seminoma or non-seminoma. The solid tumors are preceded by the presence of a non-invasive precursor cell, the carcinoma in situ cell (CIS), which shows great similarity to fetal germ cells. It is therefore hypothesized that the CIS...... of epigenetic modifiers with a focus on jumonji C enzymes in the development of testicular dysgenesis and germ cell cancer in men....... cell is a fetal germ cell that has been arrested during development due to testicular dysgenesis. CIS cells retain a fetal and open chromatin structure, and recently several epigenetic modifiers have been suggested to be involved in testicular dysgenesis in mice. We here review the possible involvement...

  10. Analysis of Maize Seed Germs by Photoacoustic Microscopy and Photopyroelectric Technique

    Science.gov (United States)

    Pacheco, A. Domínguez; Aguilar, C. Hernández; Cruz-Orea, A.

    2013-05-01

    A knowledge about thermal parameters of structural components of maize seed is of great relevance in the seed technology practice. The objective of the present study was to determine the thermal effusivity of germs of maize ( Zea mays L.) of different genotypes by means of the photopyroelectric technique (PPE) in the inverse configuration and obtaining the thermal imaging of these samples by photoacoustic microscopy (PAM). Germs from crystalline maize (white pigment), semi-crystalline maize (yellow pigment), and floury maize (blue pigment) were used in this investigation. The results show differences between germs of maize seeds mainly in the values of their thermal effusivities. The thermal images showed minimum inhomogeneity of these seed germs. Characterizations of thermal parameters in seeds are important in agriculture and food production and could be particularly useful to define their quality and determine their utility. PPE and PAM can be considered as potential diagnostic tools for the characterization of agriculture seeds.

  11. The uranyl influence on a mutation process in germ and somatic cells of mice

    International Nuclear Information System (INIS)

    Kostrova, L.N.; Mosseh, I.B.; Molofej, V.P.

    2008-01-01

    The mutagenic effect of uranyl was revealed by the chromosome rearrangement test in germ and somatic cells of mice. The effect value depended on duration of substance administration into organism. (authors)

  12. Histological evidence of testicular dysgenesis in contralateral biopsies from 218 patients with testicular germ cell cancer

    DEFF Research Database (Denmark)

    Hoei-Hansen, Christina E; Holm, Mette; Rajpert-De Meyts, Ewa

    2003-01-01

    This study was prompted by a hypothesis that testicular germ cell cancer may be aetiologically linked to other male reproductive abnormalities as a part of the so-called 'testicular dysgenesis syndrome' (TDS). To corroborate the hypothesis of a common association of germ cell cancer with testicular...... dysgenesis, microscopic dysgenetic features were quantified in contralateral testicular biopsies in patients with a testicular germ cell tumour. Two hundred and eighty consecutive contralateral testicular biopsies from Danish patients with testicular cancer diagnosed in 1998-2001 were evaluated...... presenting with testicular germ cell neoplasms of the adolescent and young type. The findings therefore support the hypothesis that this cancer is part of a testicular dysgenesis syndrome. The presence of contralateral carcinoma in situ was higher in the present study than previously reported....

  13. Modeling cell elongation during germ band retraction: cell autonomy versus applied anisotropic stress

    International Nuclear Information System (INIS)

    Lynch, Holley E; Shane Hutson, M; Veldhuis, Jim; Wayne Brodland, G

    2014-01-01

    The morphogenetic process of germ band retraction in Drosophila embryos involves coordinated movements of two epithelial tissues—germ band and amnioserosa. The germ band shortens along its rostral–caudal or head-to-tail axis, widens along its perpendicular dorsal-ventral axis, and uncurls from an initial ‘U’ shape. The amnioserosa mechanically assists this process by pulling on the crook of the U-shaped germ band. The amnioserosa may also provide biochemical signals that drive germ band cells to change shape in a mechanically autonomous fashion. Here, we use a finite-element model to investigate how these two contributions reshape the germ band. We do so by modeling the response to laser-induced wounds in each of the germ band’s spatially distinct segments (T1–T3, A1–A9) during the middle of retraction when segments T1–A3 form the ventral arm of the ‘U’, A4–A7 form its crook, and A8–A9 complete the dorsal arm. We explore these responses under a range of externally applied stresses and internal anisotropy of cell edge tensions—akin to a planar cell polarity that can drive elongation of cells in a direction parallel to the minimum edge tension—and identify regions of parameter space (edge-tension anisotropy versus stress anisotropy) that best match previous experiments for each germ band segment. All but three germ band segments are best fit when the applied stress anisotropy and the edge-tension anisotropy work against one another—i.e., when the isolated effects would elongate cells in perpendicular directions. Segments in the crook of the germ band (A4–A7) have cells that elongate in the direction of maximum external stress, i.e., external stress anisotropy is dominant. In most other segments, the dominant factor is internal edge-tension anisotropy. These results are consistent with models in which the amnioserosa pulls on the crook of the germ band to mechanically assist retraction. In addition, they suggest a mechanical cue for

  14. Molecular dosimetry of chemical mutagens: measurement of molecular dose and DNA repair germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.

    1975-01-01

    Molecular dosimetry in the germ cells of male mice is reviewed with regard to in vivo alkylation of sperm heads, in vivo alkylation of sperm DNA, and possible alkylation of sperm protamine. DNA repair in male germ cells is reviewed with regard to basic design of experiments, DNA repair in various stages of spermatogenesis, effect of protamine on DNA repair following treatment with EMS or x radiation, and induction of DNA repair by methyl methanesulfonate, propyl methanesulfonate, and isopropyl methanesulfonate

  15. Pluripotency Factors in Embryonic Stem Cells Regulate Differentiation into Germ Layers

    OpenAIRE

    Thomson, Matt; Liu, Siyuan John; Zou, Ling-Nan; Smith, Zack; Meissner, Alexander; Ramanathan, Sharad

    2011-01-01

    Cell fate decisions are fundamental for development, but we do not know how transcriptional networks reorganize during the transition from a pluripotent to a differentiated cell state. Here, we asked how mouse embryonic stem cells (ESCs) leave the pluripotent state and choose between germ layer fates. By analyzing the dynamics of the transcriptional circuit that maintains pluripotency, we found that Oct4 and Sox2, proteins that maintain ESC identity, also orchestrate germ layer fate selection...

  16. Localisation of RNAs into the germ plasm of vitellogenic Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Sarbjit Nijjar

    Full Text Available We have studied the localisation of mRNAs in full-grown Xenopus laevis oocytes by injecting fluorescent RNAs, followed by confocal microscopy of the oocyte cortex. Concentrating on RNA encoding the Xenopus Nanos homologue, nanos1 (formerly Xcat2, we find that it consistently localised into aggregated germ plasm ribonucleoprotein (RNP particles, independently of cytoskeletal integrity. This implies that a diffusion/entrapment-mediated mechanism is active, as previously reported for previtellogenic oocytes. Sometimes this was accompanied by localisation into scattered particles of the "late", Vg1/VegT pathway; occasionally only late pathway localisation was seen. The Xpat RNA behaved in an identical fashion and for neither RNA was the localisation changed by any culture conditions tested. The identity of the labelled RNP aggregates as definitive germ plasm was confirmed by their inclusion of abundant mitochondria and co-localisation with the germ plasm protein Hermes. Further, the nanos1/Hermes RNP particles are interspersed with those containing the germ plasm protein Xpat. These aggregates may be followed into the germ plasm of unfertilized eggs, but with a notable reduction in its quantity, both in terms of injected molecules and endogenous structures. Our results conflict with previous reports that there is no RNA localisation in large oocytes, and that during mid-oogenesis even germ plasm RNAs localise exclusively by the late pathway. We find that in mid oogenesis nanos1 RNA also localises to germ plasm but also by the late pathway. Late pathway RNAs, Vg1 and VegT, also may localise into germ plasm. Our results support the view that mechanistically the two modes of localisation are extremely similar, and that in an injection experiment RNAs might utilise either pathway, the distinction in fates being very subtle and subject to variation. We discuss these results in relation to their biological significance and the results of others.

  17. Derivation and characterization of the NYSCFe003-A human embryonic stem cell line

    Directory of Open Access Journals (Sweden)

    Ana Sevilla

    2017-12-01

    Full Text Available The human embryonic stem cell line NYSCFe003-A was derived from a day 5 to day 6 blastocyst in feeder-free and antibiotic free conditions. The blastocyst was voluntarily donated for research as surplus after in vitro fertilization treatment following informed consent. The NYSCFe003-A line expresses all the pluripotency markers and has the potential to differentiate into all three germ layers in vitro. The line presents normal karyotype and is mycoplasma free.

  18. Generation of integration-free induced pluripotent stem cell lines derived from two patients with X-linked Alport syndrome (XLAS).

    Science.gov (United States)

    Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

    2017-12-01

    Skin biopsies were obtained from two male patients with X-linked Alport syndrome (XLAS) with hemizygous COL4A5 mutations in exon 41 or exon 46. Dermal fibroblasts were extracted and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53 shRNA. The generated induced Pluripotent Stem Cell (iPSC) lines AS-FiPS2-Ep6F-28 and AS-FiPS3-Ep6F-9 were free of genomically integrated reprogramming genes, had the specific mutations, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. These iPSC lines offer a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  19. A pilgrim's progress: Seeking meaning in primordial germ cell migration.

    Science.gov (United States)

    Cantú, Andrea V; Laird, Diana J

    2017-10-01

    Comparative studies of primordial germ cell (PGC) development across organisms in many phyla reveal surprising diversity in the route of migration, timing and underlying molecular mechanisms, suggesting that the process of migration itself is conserved. However, beyond the perfunctory transport of cellular precursors to their later arising home of the gonads, does PGC migration serve a function? Here we propose that the process of migration plays an additional role in quality control, by eliminating PGCs incapable of completing migration as well as through mechanisms that favor PGCs capable of responding appropriately to migration cues. Focusing on PGCs in mice, we explore evidence for a selective capacity of migration, considering the tandem regulation of proliferation and migration, cell-intrinsic and extrinsic control, the potential for tumors derived from failed PGC migrants, the potential mechanisms by which migratory PGCs vary in their cellular behaviors, and corresponding effects on development. We discuss the implications of a selective role of PGC migration for in vitro gametogenesis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. La fuga imaginaria de Germán Colmenares

    Directory of Open Access Journals (Sweden)

    Isidro Vanegas

    2015-01-01

    Full Text Available El ensayo en que Germán Colmenares califica de prisión historiográfica a la Historia de la revolución de José Manuel Restrepo sigue siendo considerado una verdad de a puño. Allí Colmenares deconstruye una obra que juzga como un obstáculo para comprender el acontecimiento revolucionario y, a la vez, como la matriz de la conciencia colombiana sobre sus propios orígenes, en la que habrían quedado aprisionados los historiadores. Este artículo se ocupa de impugnar ambos asertos, mostrando cómo la obra de Restrepo no gozó entre los publicistas del siglo XIX de la autoridad que se le adjudica, y no pudo ser, por lo tanto, a través de ella que los padres de la patria construyeron su mito y la Nueva Granada su propia imagen como asociación política.