WorldWideScience

Sample records for genomic dna encoding

  1. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  2. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  4. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  5. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  6. ENCODE whole-genome data in the UCSC genome browser (2011 update).

    Science.gov (United States)

    Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

    2011-01-01

    The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

  7. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  8. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  9. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  11. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  12. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  13. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  14. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  15. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  16. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  17. On the Immortality of Television Sets: ?Function? in the Human Genome According to the Evolution-Free Gospel of ENCODE

    OpenAIRE

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selec...

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  19. DNA-encoded chemical libraries - achievements and remaining challenges.

    Science.gov (United States)

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

    2018-04-23

    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  20. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  1. Genomic analysis of murine DNA-dependent protein kinase

    International Nuclear Information System (INIS)

    Fujimori, A.; Abe, M.

    2003-01-01

    Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed

  2. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  3. Genome instabilities arising from ribonucleotides in DNA.

    Science.gov (United States)

    Klein, Hannah L

    2017-08-01

    Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  5. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  6. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  8. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  9. Current View on Phytoplasma Genomes and Encoded Metabolism

    Directory of Open Access Journals (Sweden)

    Michael Kube

    2012-01-01

    Full Text Available Phytoplasmas are specialised bacteria that are obligate parasites of plant phloem tissue and insects. These bacteria have resisted all attempts of cell-free cultivation. Genome research is of particular importance to analyse the genetic endowment of such bacteria. Here we review the gene content of the four completely sequenced ‘Candidatus Phytoplasma’ genomes that include those of ‘Ca. P. asteris’ strains OY-M and AY-WB, ‘Ca. P. australiense,’ and ‘Ca. P. mali’. These genomes are characterized by chromosome condensation resulting in sizes below 900 kb and a G + C content of less than 28%. Evolutionary adaption of the phytoplasmas to nutrient-rich environments resulted in losses of genetic modules and increased host dependency highlighted by the transport systems and limited metabolic repertoire. On the other hand, duplication and integration events enlarged the chromosomes and contribute to genome instability. Present differences in the content of membrane and secreted proteins reflect the host adaptation in the phytoplasma strains. General differences are obvious between different phylogenetic subgroups. ‘Ca. P. mali’ is separated from the other strains by its deviating chromosome organization, the genetic repertoire for recombination and excision repair of nucleotides or the loss of the complete energy-yielding part of the glycolysis. Apart from these differences, comparative analysis exemplified that all four phytoplasmas are likely to encode an alternative pathway to generate pyruvate and ATP.

  10. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  11. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Science.gov (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  14. Natural biased coin encoded in the genome determines cell strategy.

    Directory of Open Access Journals (Sweden)

    Faezeh Dorri

    Full Text Available Decision making at a cellular level determines different fates for isogenic cells. However, it is not yet clear how rational decisions are encoded in the genome, how they are transmitted to their offspring, and whether they evolve and become optimized throughout generations. In this paper, we use a game theoretic approach to explain how rational decisions are made in the presence of cooperators and competitors. Our results suggest the existence of an internal switch that operates as a biased coin. The biased coin is, in fact, a biochemical bistable network of interacting genes that can flip to one of its stable states in response to different environmental stimuli. We present a framework to describe how the positions of attractors in such a gene regulatory network correspond to the behavior of a rational player in a competing environment. We evaluate our model by considering lysis/lysogeny decision making of bacteriophage lambda in E. coli.

  15. The Mimivirus Genome Encodes a Mitochondrial Carrier That Transports dATP and dTTP▿

    Science.gov (United States)

    Monné, Magnus; Robinson, Alan J.; Boes, Christoph; Harbour, Michael E.; Fearnley, Ian M.; Kunji, Edmund R. S.

    2007-01-01

    Members of the mitochondrial carrier family have been reported in eukaryotes only, where they transport metabolites and cofactors across the mitochondrial inner membrane to link the metabolic pathways of the cytosol and the matrix. The genome of the giant virus Mimiviridae mimivirus encodes a member of the mitochondrial carrier family of transport proteins. This viral protein has been expressed in Lactococcus lactis and is shown to transport dATP and dTTP. As the 1.2-Mb double-stranded DNA mimivirus genome is rich in A and T residues, we speculate that the virus is using this protein to target the host mitochondria as a source of deoxynucleotides for its replication. PMID:17229695

  16. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  17. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  18. On the immortality of television sets: "function" in the human genome according to the evolution-free gospel of ENCODE.

    Science.gov (United States)

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B R; Zufall, Rebecca A; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 - 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these "functional" regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means, chiefly by employing the seldom used "causal role" definition of biological function and then applying it inconsistently to different biochemical properties, by committing a logical fallacy known as "affirming the consequent," by failing to appreciate the crucial difference between "junk DNA" and "garbage DNA," by using analytical methods that yield biased errors and inflate estimates of functionality, by favoring statistical sensitivity over specificity, and by emphasizing statistical significance rather than the magnitude of the effect. Here, we detail the many logical and methodological transgressions involved in assigning functionality to almost every nucleotide in the human genome. The ENCODE results were predicted by one of its authors to necessitate the rewriting of textbooks. We agree, many textbooks dealing with marketing, mass-media hype, and public relations may well have to be rewritten.

  19. De novo prediction of human chromosome structures: Epigenetic marking patterns encode genome architecture.

    Science.gov (United States)

    Di Pierro, Michele; Cheng, Ryan R; Lieberman Aiden, Erez; Wolynes, Peter G; Onuchic, José N

    2017-11-14

    Inside the cell nucleus, genomes fold into organized structures that are characteristic of cell type. Here, we show that this chromatin architecture can be predicted de novo using epigenetic data derived from chromatin immunoprecipitation-sequencing (ChIP-Seq). We exploit the idea that chromosomes encode a 1D sequence of chromatin structural types. Interactions between these chromatin types determine the 3D structural ensemble of chromosomes through a process similar to phase separation. First, a neural network is used to infer the relation between the epigenetic marks present at a locus, as assayed by ChIP-Seq, and the genomic compartment in which those loci reside, as measured by DNA-DNA proximity ligation (Hi-C). Next, types inferred from this neural network are used as an input to an energy landscape model for chromatin organization [Minimal Chromatin Model (MiChroM)] to generate an ensemble of 3D chromosome conformations at a resolution of 50 kilobases (kb). After training the model, dubbed Maximum Entropy Genomic Annotation from Biomarkers Associated to Structural Ensembles (MEGABASE), on odd-numbered chromosomes, we predict the sequences of chromatin types and the subsequent 3D conformational ensembles for the even chromosomes. We validate these structural ensembles by using ChIP-Seq tracks alone to predict Hi-C maps, as well as distances measured using 3D fluorescence in situ hybridization (FISH) experiments. Both sets of experiments support the hypothesis of phase separation being the driving process behind compartmentalization. These findings strongly suggest that epigenetic marking patterns encode sufficient information to determine the global architecture of chromosomes and that de novo structure prediction for whole genomes may be increasingly possible. Copyright © 2017 the Author(s). Published by PNAS.

  20. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  1. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  2. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  3. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  4. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  5. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  6. Vast diversity of prokaryotic virus genomes encoding double jelly-roll major capsid proteins uncovered by genomic and metagenomic sequence analysis.

    Science.gov (United States)

    Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V

    2018-04-10

    Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by

  7. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  8. Genomic signal processing for DNA sequence clustering.

    Science.gov (United States)

    Mendizabal-Ruiz, Gerardo; Román-Godínez, Israel; Torres-Ramos, Sulema; Salido-Ruiz, Ricardo A; Vélez-Pérez, Hugo; Morales, J Alejandro

    2018-01-01

    Genomic signal processing (GSP) methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  9. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    International Nuclear Information System (INIS)

    Arneodo, Alain; Vaillant, Cedric; Audit, Benjamin; Argoul, Francoise; D'Aubenton-Carafa, Yves; Thermes, Claude

    2011-01-01

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  10. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  11. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  12. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  13. Reverse gyrase functions in genome integrity maintenance by protecting DNA breaks in vivo

    DEFF Research Database (Denmark)

    Han, Wenyuan; Feng, Xu; She, Qunxin

    2017-01-01

    Reverse gyrase introduces positive supercoils to circular DNA and is implicated in genome stability maintenance in thermophiles. The extremely thermophilic crenarchaeon Sulfolobus encodes two reverse gyrase proteins, TopR1 (topoisomerase reverse gyrase 1) and TopR2, whose functions in thermophilic...... and subsequent DNA degradation. The former occurred immediately after drug treatment, leading to chromosomal DNA degradation that concurred with TopR1 degradation, followed by chromatin protein degradation and DNA-less cell formation. To gain a further insight into TopR1 function, the expression of the enzyme...

  14. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  15. Novel Single-Stranded DNA Virus Genomes Recovered from Chimpanzee Feces Sampled from the Mambilla Plateau in Nigeria

    Science.gov (United States)

    Walters, Matthew; Bawuro, Musa; Christopher, Alfred; Knight, Alexander; Kraberger, Simona; Stainton, Daisy; Chapman, Hazel

    2017-01-01

    ABSTRACT Metagenomic approaches are rapidly expanding our knowledge of the diversity of viruses. In the fecal matter of Nigerian chimpanzees we recovered three gokushovirus genomes, one circular replication-associated protein encoding single-stranded DNA virus (CRESS), and a CRESS DNA molecule. PMID:28254982

  16. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  17. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  18. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  19. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  20. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  1. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  2. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  3. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  4. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  5. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  6. Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

    Directory of Open Access Journals (Sweden)

    Chakrabarti Mrinmay

    2010-08-01

    Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

  7. Annotating the genome by DNA methylation.

    Science.gov (United States)

    Cedar, Howard; Razin, Aharon

    2017-01-01

    DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.

  8. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  9. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  10. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  11. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  12. Genome-wide DNA polymorphism analyses using VariScan

    Directory of Open Access Journals (Sweden)

    Vilella Albert J

    2006-09-01

    Full Text Available Abstract Background DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. Results We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i exhaustive population-genetic analyses including those based on the coalescent theory; ii analysis adapted to the shallow data generated by the high-throughput genome projects; iii use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v visualization of the results integrated with current genome annotations in commonly available genome browsers. Conclusion VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.

  13. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  14. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...

  15. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  16. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  17. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project.

    Science.gov (United States)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya; Guigó, Roderic; Gingeras, Thomas R; Margulies, Elliott H; Weng, Zhiping; Snyder, Michael; Dermitzakis, Emmanouil T; Thurman, Robert E; Kuehn, Michael S; Taylor, Christopher M; Neph, Shane; Koch, Christoph M; Asthana, Saurabh; Malhotra, Ankit; Adzhubei, Ivan; Greenbaum, Jason A; Andrews, Robert M; Flicek, Paul; Boyle, Patrick J; Cao, Hua; Carter, Nigel P; Clelland, Gayle K; Davis, Sean; Day, Nathan; Dhami, Pawandeep; Dillon, Shane C; Dorschner, Michael O; Fiegler, Heike; Giresi, Paul G; Goldy, Jeff; Hawrylycz, Michael; Haydock, Andrew; Humbert, Richard; James, Keith D; Johnson, Brett E; Johnson, Ericka M; Frum, Tristan T; Rosenzweig, Elizabeth R; Karnani, Neerja; Lee, Kirsten; Lefebvre, Gregory C; Navas, Patrick A; Neri, Fidencio; Parker, Stephen C J; Sabo, Peter J; Sandstrom, Richard; Shafer, Anthony; Vetrie, David; Weaver, Molly; Wilcox, Sarah; Yu, Man; Collins, Francis S; Dekker, Job; Lieb, Jason D; Tullius, Thomas D; Crawford, Gregory E; Sunyaev, Shamil; Noble, William S; Dunham, Ian; Denoeud, France; Reymond, Alexandre; Kapranov, Philipp; Rozowsky, Joel; Zheng, Deyou; Castelo, Robert; Frankish, Adam; Harrow, Jennifer; Ghosh, Srinka; Sandelin, Albin; Hofacker, Ivo L; Baertsch, Robert; Keefe, Damian; Dike, Sujit; Cheng, Jill; Hirsch, Heather A; Sekinger, Edward A; Lagarde, Julien; Abril, Josep F; Shahab, Atif; Flamm, Christoph; Fried, Claudia; Hackermüller, Jörg; Hertel, Jana; Lindemeyer, Manja; Missal, Kristin; Tanzer, Andrea; Washietl, Stefan; Korbel, Jan; Emanuelsson, Olof; Pedersen, Jakob S; Holroyd, Nancy; Taylor, Ruth; Swarbreck, David; Matthews, Nicholas; Dickson, Mark C; Thomas, Daryl J; Weirauch, Matthew T; Gilbert, James; Drenkow, Jorg; Bell, Ian; Zhao, XiaoDong; Srinivasan, K G; Sung, Wing-Kin; Ooi, Hong Sain; Chiu, Kuo Ping; Foissac, Sylvain; Alioto, Tyler; Brent, Michael; Pachter, Lior; Tress, Michael L; Valencia, Alfonso; Choo, Siew Woh; Choo, Chiou Yu; Ucla, Catherine; Manzano, Caroline; Wyss, Carine; Cheung, Evelyn; Clark, Taane G; Brown, James B; Ganesh, Madhavan; Patel, Sandeep; Tammana, Hari; Chrast, Jacqueline; Henrichsen, Charlotte N; Kai, Chikatoshi; Kawai, Jun; Nagalakshmi, Ugrappa; Wu, Jiaqian; Lian, Zheng; Lian, Jin; Newburger, Peter; Zhang, Xueqing; Bickel, Peter; Mattick, John S; Carninci, Piero; Hayashizaki, Yoshihide; Weissman, Sherman; Hubbard, Tim; Myers, Richard M; Rogers, Jane; Stadler, Peter F; Lowe, Todd M; Wei, Chia-Lin; Ruan, Yijun; Struhl, Kevin; Gerstein, Mark; Antonarakis, Stylianos E; Fu, Yutao; Green, Eric D; Karaöz, Ulaş; Siepel, Adam; Taylor, James; Liefer, Laura A; Wetterstrand, Kris A; Good, Peter J; Feingold, Elise A; Guyer, Mark S; Cooper, Gregory M; Asimenos, George; Dewey, Colin N; Hou, Minmei; Nikolaev, Sergey; Montoya-Burgos, Juan I; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Huang, Haiyan; Zhang, Nancy R; Holmes, Ian; Mullikin, James C; Ureta-Vidal, Abel; Paten, Benedict; Seringhaus, Michael; Church, Deanna; Rosenbloom, Kate; Kent, W James; Stone, Eric A; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross C; Haussler, David; Miller, Webb; Sidow, Arend; Trinklein, Nathan D; Zhang, Zhengdong D; Barrera, Leah; Stuart, Rhona; King, David C; Ameur, Adam; Enroth, Stefan; Bieda, Mark C; Kim, Jonghwan; Bhinge, Akshay A; Jiang, Nan; Liu, Jun; Yao, Fei; Vega, Vinsensius B; Lee, Charlie W H; Ng, Patrick; Shahab, Atif; Yang, Annie; Moqtaderi, Zarmik; Zhu, Zhou; Xu, Xiaoqin; Squazzo, Sharon; Oberley, Matthew J; Inman, David; Singer, Michael A; Richmond, Todd A; Munn, Kyle J; Rada-Iglesias, Alvaro; Wallerman, Ola; Komorowski, Jan; Fowler, Joanna C; Couttet, Phillippe; Bruce, Alexander W; Dovey, Oliver M; Ellis, Peter D; Langford, Cordelia F; Nix, David A; Euskirchen, Ghia; Hartman, Stephen; Urban, Alexander E; Kraus, Peter; Van Calcar, Sara; Heintzman, Nate; Kim, Tae Hoon; Wang, Kun; Qu, Chunxu; Hon, Gary; Luna, Rosa; Glass, Christopher K; Rosenfeld, M Geoff; Aldred, Shelley Force; Cooper, Sara J; Halees, Anason; Lin, Jane M; Shulha, Hennady P; Zhang, Xiaoling; Xu, Mousheng; Haidar, Jaafar N S; Yu, Yong; Ruan, Yijun; Iyer, Vishwanath R; Green, Roland D; Wadelius, Claes; Farnham, Peggy J; Ren, Bing; Harte, Rachel A; Hinrichs, Angie S; Trumbower, Heather; Clawson, Hiram; Hillman-Jackson, Jennifer; Zweig, Ann S; Smith, Kayla; Thakkapallayil, Archana; Barber, Galt; Kuhn, Robert M; Karolchik, Donna; Armengol, Lluis; Bird, Christine P; de Bakker, Paul I W; Kern, Andrew D; Lopez-Bigas, Nuria; Martin, Joel D; Stranger, Barbara E; Woodroffe, Abigail; Davydov, Eugene; Dimas, Antigone; Eyras, Eduardo; Hallgrímsdóttir, Ingileif B; Huppert, Julian; Zody, Michael C; Abecasis, Gonçalo R; Estivill, Xavier; Bouffard, Gerard G; Guan, Xiaobin; Hansen, Nancy F; Idol, Jacquelyn R; Maduro, Valerie V B; Maskeri, Baishali; McDowell, Jennifer C; Park, Morgan; Thomas, Pamela J; Young, Alice C; Blakesley, Robert W; Muzny, Donna M; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Jiang, Huaiyang; Weinstock, George M; Gibbs, Richard A; Graves, Tina; Fulton, Robert; Mardis, Elaine R; Wilson, Richard K; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B; Chang, Jean L; Lindblad-Toh, Kerstin; Lander, Eric S; Koriabine, Maxim; Nefedov, Mikhail; Osoegawa, Kazutoyo; Yoshinaga, Yuko; Zhu, Baoli; de Jong, Pieter J

    2007-06-14

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non-protein-coding transcripts, and those that extensively overlap one another. Second, systematic examination of transcriptional regulation has yielded new understanding about transcription start sites, including their relationship to specific regulatory sequences and features of chromatin accessibility and histone modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra-species sequence comparisons, has yielded new mechanistic and evolutionary insights concerning the functional landscape of the human genome. Together, these studies are defining a path for pursuit of a more comprehensive characterization of human genome function.

  18. DNA-PKcs, ATM, and ATR Interplay Maintains Genome Integrity during Neurogenesis.

    Science.gov (United States)

    Enriquez-Rios, Vanessa; Dumitrache, Lavinia C; Downing, Susanna M; Li, Yang; Brown, Eric J; Russell, Helen R; McKinnon, Peter J

    2017-01-25

    The DNA damage response (DDR) orchestrates a network of cellular processes that integrates cell-cycle control and DNA repair or apoptosis, which serves to maintain genome stability. DNA-PKcs (the catalytic subunit of the DNA-dependent kinase, encoded by PRKDC), ATM (ataxia telangiectasia, mutated), and ATR (ATM and Rad3-related) are related PI3K-like protein kinases and central regulators of the DDR. Defects in these kinases have been linked to neurodegenerative or neurodevelopmental syndromes. In all cases, the key neuroprotective function of these kinases is uncertain. It also remains unclear how interactions between the three DNA damage-responsive kinases coordinate genome stability, particularly in a physiological context. Here, we used a genetic approach to identify the neural function of DNA-PKcs and the interplay between ATM and ATR during neurogenesis. We found that DNA-PKcs loss in the mouse sensitized neuronal progenitors to apoptosis after ionizing radiation because of excessive DNA damage. DNA-PKcs was also required to prevent endogenous DNA damage accumulation throughout the adult brain. In contrast, ATR coordinated the DDR during neurogenesis to direct apoptosis in cycling neural progenitors, whereas ATM regulated apoptosis in both proliferative and noncycling cells. We also found that ATR controls a DNA damage-induced G 2 /M checkpoint in cortical progenitors, independent of ATM and DNA-PKcs. These nonoverlapping roles were further confirmed via sustained murine embryonic or cortical development after all three kinases were simultaneously inactivated. Thus, our results illustrate how DNA-PKcs, ATM, and ATR have unique and essential roles during the DDR, collectively ensuring comprehensive genome maintenance in the nervous system. The DNA damage response (DDR) is essential for prevention of a broad spectrum of different human neurologic diseases. However, a detailed understanding of the DDR at a physiological level is lacking. In contrast to many in

  19. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  20. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  1. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  2. ATM signaling and genomic stability in response to DNA damage

    International Nuclear Information System (INIS)

    Lavin, Martin F.; Birrell, Geoff; Chen, Philip; Kozlov, Sergei; Scott, Shaun; Gueven, Nuri

    2005-01-01

    DNA double strand breaks represent the most threatening lesion to the integrity of the genome in cells exposed to ionizing radiation and radiomimetic chemicals. Those breaks are recognized, signaled to cell cycle checkpoints and repaired by protein complexes. The product of the gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) plays a central role in the recognition and signaling of DNA damage. ATM is one of an ever growing number of proteins which when mutated compromise the stability of the genome and predispose to tumour development. Mechanisms for recognising double strand breaks in DNA, maintaining genome stability and minimizing risk of cancer are discussed

  3. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard

    2016-06-01

    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  4. TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism.

    Science.gov (United States)

    Harley, Margaret E; Murina, Olga; Leitch, Andrea; Higgs, Martin R; Bicknell, Louise S; Yigit, Gökhan; Blackford, Andrew N; Zlatanou, Anastasia; Mackenzie, Karen J; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A M; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B; Nürnberg, Peter; Jackson, Stephen P; Hurles, Matthew E; Wollnik, Bernd; Stewart, Grant S; Jackson, Andrew P

    2016-01-01

    DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism. We establish that TRAIP relocalizes to sites of DNA damage, where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to ultraviolet (UV) irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a component of the DNA damage response to replication-blocking DNA lesions.

  5. Brief Guide to Genomics: DNA, Genes and Genomes

    Science.gov (United States)

    ... clinic. Most new drugs based on genome-based research are estimated to be at least 10 to 15 years away, though recent genome-driven efforts in lipid-lowering therapy have considerably shortened that interval. According ...

  6. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  7. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Science.gov (United States)

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

    2012-10-01

    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  8. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  9. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  10. Mutagenic repair of double-stranded DNA breaks in vaccinia virus genomes requires cellular DNA ligase IV activity in the cytosol.

    Science.gov (United States)

    Luteijn, Rutger David; Drexler, Ingo; Smith, Geoffrey L; Lebbink, Robert Jan; Wiertz, Emmanuel J H J

    2018-04-20

    Poxviruses comprise a group of large dsDNA viruses that include members relevant to human and animal health, such as variola virus, monkeypox virus, cowpox virus and vaccinia virus (VACV). Poxviruses are remarkable for their unique replication cycle, which is restricted to the cytoplasm of infected cells. The independence from the host nucleus requires poxviruses to encode most of the enzymes involved in DNA replication, transcription and processing. Here, we use the CRISPR/Cas9 genome engineering system to induce DNA damage to VACV (strain Western Reserve) genomes. We show that targeting CRISPR/Cas9 to essential viral genes limits virus replication efficiently. Although VACV is a strictly cytoplasmic pathogen, we observed extensive viral genome editing at the target site; this is reminiscent of a non-homologous end-joining DNA repair mechanism. This pathway was not dependent on the viral DNA ligase, but critically involved the cellular DNA ligase IV. Our data show that DNA ligase IV can act outside of the nucleus to allow repair of dsDNA breaks in poxvirus genomes. This pathway might contribute to the introduction of mutations within the genome of poxviruses and may thereby promote the evolution of these viruses.

  11. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.

  12. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  13. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Science.gov (United States)

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

    2014-01-01

    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  14. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  15. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  16. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  17. Local chromatin structure of heterochromatin regulates repeated DNA stability, nucleolus structure, and genome integrity

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Jamy C. [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Heterochromatin constitutes a significant portion of the genome in higher eukaryotes; approximately 30% in Drosophila and human. Heterochromatin contains a high repeat DNA content and a low density of protein-encoding genes. In contrast, euchromatin is composed mostly of unique sequences and contains the majority of single-copy genes. Genetic and cytological studies demonstrated that heterochromatin exhibits regulatory roles in chromosome organization, centromere function and telomere protection. As an epigenetically regulated structure, heterochromatin formation is not defined by any DNA sequence consensus. Heterochromatin is characterized by its association with nucleosomes containing methylated-lysine 9 of histone H3 (H3K9me), heterochromatin protein 1 (HP1) that binds H3K9me, and Su(var)3-9, which methylates H3K9 and binds HP1. Heterochromatin formation and functions are influenced by HP1, Su(var)3-9, and the RNA interference (RNAi) pathway. My thesis project investigates how heterochromatin formation and function impact nuclear architecture, repeated DNA organization, and genome stability in Drosophila melanogaster. H3K9me-based chromatin reduces extrachromosomal DNA formation; most likely by restricting the access of repair machineries to repeated DNAs. Reducing extrachromosomal ribosomal DNA stabilizes rDNA repeats and the nucleolus structure. H3K9me-based chromatin also inhibits DNA damage in heterochromatin. Cells with compromised heterochromatin structure, due to Su(var)3-9 or dcr-2 (a component of the RNAi pathway) mutations, display severe DNA damage in heterochromatin compared to wild type. In these mutant cells, accumulated DNA damage leads to chromosomal defects such as translocations, defective DNA repair response, and activation of the G2-M DNA repair and mitotic checkpoints that ensure cellular and animal viability. My thesis research suggests that DNA replication, repair, and recombination mechanisms in heterochromatin differ from those in

  18. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  19. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  20. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  1. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

  2. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.

  3. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  4. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  5. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  6. Role of oxidative DNA damage in genome instability and cancer

    International Nuclear Information System (INIS)

    Bignami, M.; Kunkel, T.

    2009-01-01

    Inactivation of mismatch repair (MMR) is associated with a dramatic genomic instability that is observed experimentally as a mutator phenotype and micro satellite instability (MSI). It has been implicit that the massive genetic instability in MMR defective cells simply reflects the accumulation of spontaneous DNA polymerase errors during DNA replication. We recently identified oxidation damage, a common threat to DNA integrity to which purines are very susceptible, as an important cofactor in this genetic instability

  7. Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

    Science.gov (United States)

    Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

    2018-04-01

    Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may

  8. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  9. TALENs: customizable molecular DNA scissors for genome engineering of plants.

    Science.gov (United States)

    Chen, Kunling; Gao, Caixia

    2013-06-20

    Precise genome modification with engineered nucleases is a powerful tool for studying basic biology and applied biotechnology. Transcription activator-like effector nucleases (TALENs), consisting of an engineered specific (TALE) DNA binding domain and a Fok I cleavage domain, are newly developed versatile reagents for genome engineering in different organisms. Because of the simplicity of the DNA recognition code and their modular assembly, TALENs can act as customizable molecular DNA scissors inducing double-strand breaks (DSBs) at given genomic location. Thus, they provide a valuable approach to targeted genome modifications such as mutations, insertions, replacements or chromosome rearrangements. In this article, we review the development of TALENs, and summarize the principles and tools for TALEN-mediated gene targeting in plant cells, as well as current and potential strategies for use in plant research and crop improvement. Copyright © 2013. Published by Elsevier Ltd.

  10. Genomics and physiology of a marine flavobacterium encoding a proteorhodopsin and a xanthorhodopsin-like protein.

    Directory of Open Access Journals (Sweden)

    Thomas Riedel

    Full Text Available Proteorhodopsin (PR photoheterotrophy in the marine flavobacterium Dokdonia sp. PRO95 has previously been investigated, showing no growth stimulation in the light at intermediate carbon concentrations. Here we report the genome sequence of strain PRO95 and compare it to two other PR encoding Dokdonia genomes: that of strain 4H-3-7-5 which shows the most similar genome, and that of strain MED134 which grows better in the light under oligotrophic conditions. Our genome analysis revealed that the PRO95 genome as well as the 4H-3-7-5 genome encode a protein related to xanthorhodopsins. The genomic environment and phylogenetic distribution of this gene suggest that it may have frequently been recruited by lateral gene transfer. Expression analyses by RT-PCR and direct mRNA-sequencing showed that both rhodopsins and the complete β-carotene pathway necessary for retinal production are transcribed in PRO95. Proton translocation measurements showed enhanced proton pump activity in response to light, supporting that one or both rhodopsins are functional. Genomic information and carbon source respiration data were used to develop a defined cultivation medium for PRO95, but reproducible growth always required small amounts of yeast extract. Although PRO95 contains and expresses two rhodopsin genes, light did not stimulate its growth as determined by cell numbers in a nutrient poor seawater medium that mimics its natural environment, confirming previous experiments at intermediate carbon concentrations. Starvation or stress conditions might be needed to observe the physiological effect of light induced energy acquisition.

  11. DNA Repair and Genome Maintenance in Bacillus subtilis

    Science.gov (United States)

    Lenhart, Justin S.; Schroeder, Jeremy W.; Walsh, Brian W.

    2012-01-01

    Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis. PMID:22933559

  12. Structured RNAs in the ENCODE selected regions of the human genome

    DEFF Research Database (Denmark)

    Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O

    2007-01-01

    Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...

  13. Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny.

    Science.gov (United States)

    Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu

    2017-01-01

    Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.

  14. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Science.gov (United States)

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

    2014-01-01

    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  15. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  16. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  17. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  18. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  19. DNA Microarrays in Comparative Genomics and Transcriptomics

    DEFF Research Database (Denmark)

    Willenbrock, Hanni

    2007-01-01

    at identifying the exact breakpoints where DNA has been gained or lost. In this thesis, three popular methods are compared and a realistic simulation model is presented for generating artificial data with known breakpoints and known DNA copy number. By using simulated data, we obtain a realistic evaluation......During the past few years, innovations in the DNA sequencing technology has led to an explosion in available DNA sequence information. This has revolutionized biological research and promoted the development of high throughput analysis methods that can take advantage of the vast amount of sequence...... data. For this, the DNA microarray technology has gained enormous popularity due to its ability to measure the presence or the activity of thousands of genes simultaneously. Microarrays for high throughput data analyses are not limited to a few organisms but may be applied to everything from bacteria...

  20. DNA Precursor Metabolism and Mitochondrial Genome Stability

    National Research Council Canada - National Science Library

    Mathews, Christopher K

    2003-01-01

    ...) metabolism and mutagenesis in the mitochondrial genome. Specific contributions include: (1) We found that conditions altering the normal balance among the four dNTP pools within the mitochondrion stimulate both point and deletion mutagenesis...

  1. Defining functional DNA elements in the human genome

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  2. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  3. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  4. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  5. Oxidative DNA damage causes mitochondrial genomic instability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Doudican, Nicole A; Song, Binwei; Shadel, Gerald S; Doetsch, Paul W

    2005-06-01

    Mitochondria contain their own genome, the integrity of which is required for normal cellular energy metabolism. Reactive oxygen species (ROS) produced by normal mitochondrial respiration can damage cellular macromolecules, including mitochondrial DNA (mtDNA), and have been implicated in degenerative diseases, cancer, and aging. We developed strategies to elevate mitochondrial oxidative stress by exposure to antimycin and H(2)O(2) or utilizing mutants lacking mitochondrial superoxide dismutase (sod2Delta). Experiments were conducted with strains compromised in mitochondrial base excision repair (ntg1Delta) and oxidative damage resistance (pif1Delta) in order to delineate the relationship between these pathways. We observed enhanced ROS production, resulting in a direct increase in oxidative mtDNA damage and mutagenesis. Repair-deficient mutants exposed to oxidative stress conditions exhibited profound genomic instability. Elimination of Ntg1p and Pif1p resulted in a synergistic corruption of respiratory competency upon exposure to antimycin and H(2)O(2). Mitochondrial genomic integrity was substantially compromised in ntg1Delta pif1Delta sod2Delta strains, since these cells exhibit a total loss of mtDNA. A stable respiration-defective strain, possessing a normal complement of mtDNA damage resistance pathways, exhibited a complete loss of mtDNA upon exposure to antimycin and H(2)O(2). This loss was preventable by Sod2p overexpression. These results provide direct evidence that oxidative mtDNA damage can be a major contributor to mitochondrial genomic instability and demonstrate cooperation of Ntg1p and Pif1p to resist the introduction of lesions into the mitochondrial genome.

  6. Differential DNA Methylation Analysis without a Reference Genome

    Directory of Open Access Journals (Sweden)

    Johanna Klughammer

    2015-12-01

    Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

  7. "Isogaba Maware": quality control of genome DNA by checkpoints.

    Science.gov (United States)

    Kitazono, A; Matsumoto, T

    1998-05-01

    Checkpoints maintain the interdependency of cell cycle events by permitting the onset of an event only after the completion of the preceding event. The DNA replication checkpoint induces a cell cycle arrest until the completion of the DNA replication. Similarly, the DNA damage checkpoint arrests cell cycle progression if DNA repair is incomplete. A number of genes that play a role in the two checkpoints have been identified through genetic studies in yeasts, and their homologues have been found in fly, mouse, and human. They form signaling cascades activated by a DNA replication block or DNA damage and subsequently generate the negative constraints on cell cycle regulators. The failure of these signaling cascades results in producing offspring that carry mutations or that lack a portion of the genome. In humans, defects in the checkpoints are often associated with cancer-prone diseases. Focusing mainly on the studies in budding and fission yeasts, we summarize the recent progress.

  8. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  9. Exploratory re-encoding of Yellow Fever Virus genome: new insights for the design of live-attenuated viruses

    OpenAIRE

    Klitting, Raphaelle; Riziki, Toilhata; Moureau, Gregory; De Lamballerie, Xavier; Piorkowski, Geraldine

    2018-01-01

    Virus attenuation by genome re-encoding is a pioneering approach for generating live-attenuated vaccine candidates. Its core principle is to introduce a large number of slightly deleterious synonymous mutations into the viral genome to produce a stable attenuation of the targeted virus. The large number of mutations introduced is supposed to guarantee the stability of the attenuated phenotype by lowering the risks of reversion and recombination for re-encoded sequences. In this prospect, iden...

  10. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  11. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.

    2004-01-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  12. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  13. Mobile units of DNA in phytoplasma genomes.

    Science.gov (United States)

    Dickinson, Matt

    2010-09-01

    Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.

  14. Measuring the Levels of Ribonucleotides Embedded in Genomic DNA.

    Science.gov (United States)

    Meroni, Alice; Nava, Giulia M; Sertic, Sarah; Plevani, Paolo; Muzi-Falconi, Marco; Lazzaro, Federico

    2018-01-01

    Ribonucleotides (rNTPs) are incorporated into genomic DNA at a relatively high frequency during replication. They have beneficial effects but, if not removed from the chromosomes, increase genomic instability. Here, we describe a fast method to easily estimate the amounts of embedded ribonucleotides into the genome. The protocol described is performed in Saccharomyces cerevisiae and allows us to quantify altered levels of rNMPs due to different mutations in the replicative polymerase ε. However, this protocol can be easily applied to cells derived from any organism.

  15. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...... in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H. influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions....

  16. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  17. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

    Science.gov (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

    1998-08-28

    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  18. Genomic gigantism: DNA loss is slow in mountain grasshoppers.

    Science.gov (United States)

    Bensasson, D; Petrov, D A; Zhang, D X; Hartl, D L; Hewitt, G M

    2001-02-01

    Several studies have shown DNA loss to be inversely correlated with genome size in animals. These studies include a comparison between Drosophila and the cricket, Laupala, but there has been no assessment of DNA loss in insects with very large genomes. Podisma pedestris, the brown mountain grasshopper, has a genome over 100 times as large as that of Drosophila and 10 times as large as that of Laupala. We used 58 paralogous nuclear pseudogenes of mitochondrial origin to study the characteristics of insertion, deletion, and point substitution in P. pedestris and Italopodisma. In animals, these pseudogenes are "dead on arrival"; they are abundant in many different eukaryotes, and their mitochondrial origin simplifies the identification of point substitutions accumulated in nuclear pseudogene lineages. There appears to be a mononucleotide repeat within the 643-bp pseudogene sequence studied that acts as a strong hot spot for insertions or deletions (indels). Because the data for other insect species did not contain such an unusual region, hot spots were excluded from species comparisons. The rate of DNA loss relative to point substitution appears to be considerably and significantly lower in the grasshoppers studied than in Drosophila or Laupala. This suggests that the inverse correlation between genome size and the rate of DNA loss can be extended to comparisons between insects with large or gigantic genomes (i.e., Laupala and Podisma). The low rate of DNA loss implies that in grasshoppers, the accumulation of point mutations is a more potent force for obscuring ancient pseudogenes than their loss through indel accumulation, whereas the reverse is true for Drosophila. The main factor contributing to the difference in the rates of DNA loss estimated for grasshoppers, crickets, and Drosophila appears to be deletion size. Large deletions are relatively rare in Podisma and Italopodisma.

  19. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  20. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2016-01-01

    Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb, and uvrABCD), even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination), umuCD (mutational DNA replication), as well as the key SOS genes lexA (regulation of the SOS system) and sulA (postponing of cell division until completion of DNA reparation). Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA, and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively, these findings

  1. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  2. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  3. Methyl-Analyzer--whole genome DNA methylation profiling.

    Science.gov (United States)

    Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G

    2011-08-15

    Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.

  4. Resurrection of DNA function in vivo from an extinct genome.

    Directory of Open Access Journals (Sweden)

    Andrew J Pask

    2008-05-01

    Full Text Available There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine, obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity.

  5. Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

    Science.gov (United States)

    Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

    2005-12-01

    Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

  6. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity. PMID:22791960

  7. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Directory of Open Access Journals (Sweden)

    Helena Machado

    2012-01-01

    Full Text Available Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners’ perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners’ representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  8. Criminal genomic pragmatism: prisoners' representations of DNA technology and biosecurity.

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  9. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  10. On the Immortality of Television Sets: “Function” in the Human Genome According to the Evolution-Free Gospel of ENCODE

    Science.gov (United States)

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 − 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these “functional” regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means, chiefly by employing the seldom used “causal role” definition of biological function and then applying it inconsistently to different biochemical properties, by committing a logical fallacy known as “affirming the consequent,” by failing to appreciate the crucial difference between “junk DNA” and “garbage DNA,” by using analytical methods that yield biased errors and inflate estimates of functionality, by favoring statistical sensitivity over specificity, and by emphasizing statistical significance rather than the magnitude of the effect. Here, we detail the many logical and methodological transgressions involved in assigning functionality to almost every nucleotide in the human genome. The ENCODE results were predicted by one of its authors to necessitate the rewriting of textbooks. We agree, many textbooks dealing with marketing, mass-media hype, and public relations may well have to be rewritten. PMID:23431001

  11. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  13. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  14. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Studies on the effects of persistent RNA priming on DNA replication and genomic stability

    OpenAIRE

    Stuckey, Ruth

    2014-01-01

    [EN]: DNA replication and transcription take place on the same DNA template, and the correct interplay between these processes ensures faithful genome duplication. DNA replication must be highly coordinated with other cell cycle events, such as segregation of fully replicated DNA in order to maintain genomic integrity. Transcription generates RNA:DNA hybrids, transient intermediate structures that are degraded by the ribonuclease H (RNaseH) class of enzymes. RNA:DNA hybrids can form R-loops, ...

  16. Characterization of noncoding regulatory DNA in the human genome.

    Science.gov (United States)

    Elkon, Ran; Agami, Reuven

    2017-08-08

    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  17. Continued colonization of the human genome by mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Miria Ricchetti

    2004-09-01

    Full Text Available Integration of mitochondrial DNA fragments into nuclear chromosomes (giving rise to nuclear DNA sequences of mitochondrial origin, or NUMTs is an ongoing process that shapes nuclear genomes. In yeast this process depends on double-strand-break repair. Since NUMTs lack amplification and specific integration mechanisms, they represent the prototype of exogenous insertions in the nucleus. From sequence analysis of the genome of Homo sapiens, followed by sampling humans from different ethnic backgrounds, and chimpanzees, we have identified 27 NUMTs that are specific to humans and must have colonized human chromosomes in the last 4-6 million years. Thus, we measured the fixation rate of NUMTs in the human genome. Six such NUMTs show insertion polymorphism and provide a useful set of DNA markers for human population genetics. We also found that during recent human evolution, Chromosomes 18 and Y have been more susceptible to colonization by NUMTs. Surprisingly, 23 out of 27 human-specific NUMTs are inserted in known or predicted genes, mainly in introns. Some individuals carry a NUMT insertion in a tumor-suppressor gene and in a putative angiogenesis inhibitor. Therefore in humans, but not in yeast, NUMT integrations preferentially target coding or regulatory sequences. This is indeed the case for novel insertions associated with human diseases and those driven by environmental insults. We thus propose a mutagenic phenomenon that may be responsible for a variety of genetic diseases in humans and suggest that genetic or environmental factors that increase the frequency of chromosome breaks provide the impetus for the continued colonization of the human genome by mitochondrial DNA.

  18. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  19. Alu Mobile Elements: From Junk DNA to Genomic Gems

    Directory of Open Access Journals (Sweden)

    Sami Dridi

    2012-01-01

    Full Text Available Alus, the short interspersed repeated sequences (SINEs, are retrotransposons that litter the human genomes and have long been considered junk DNA. However, recent findings that these mobile elements are transcribed, both as distinct RNA polymerase III transcripts and as a part of RNA polymerase II transcripts, suggest biological functions and refute the notion that Alus are biologically unimportant. Indeed, Alu RNAs have been shown to control mRNA processing at several levels, to have complex regulatory functions such as transcriptional repression and modulating alternative splicing and to cause a host of human genetic diseases. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity, which further indicates that these mobile retroelements are in fact genomic gems rather than genomic junks.

  20. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  1. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.

    Directory of Open Access Journals (Sweden)

    Shunsuke Suzuki

    2007-04-01

    Full Text Available Among mammals, only eutherians and marsupials are viviparous and have genomic imprinting that leads to parent-of-origin-specific differential gene expression. We used comparative analysis to investigate the origin of genomic imprinting in mammals. PEG10 (paternally expressed 10 is a retrotransposon-derived imprinted gene that has an essential role for the formation of the placenta of the mouse. Here, we show that an orthologue of PEG10 exists in another therian mammal, the marsupial tammar wallaby (Macropus eugenii, but not in a prototherian mammal, the egg-laying platypus (Ornithorhynchus anatinus, suggesting its close relationship to the origin of placentation in therian mammals. We have discovered a hitherto missing link of the imprinting mechanism between eutherians and marsupials because tammar PEG10 is the first example of a differentially methylated region (DMR associated with genomic imprinting in marsupials. Surprisingly, the marsupial DMR was strictly limited to the 5' region of PEG10, unlike the eutherian DMR, which covers the promoter regions of both PEG10 and the adjacent imprinted gene SGCE. These results not only demonstrate a common origin of the DMR-associated imprinting mechanism in therian mammals but provide the first demonstration that DMR-associated genomic imprinting in eutherians can originate from the repression of exogenous DNA sequences and/or retrotransposons by DNA methylation.

  2. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Directory of Open Access Journals (Sweden)

    Soko Nuswantoro

    2013-11-01

    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  3. Instability of plastid DNA in the nuclear genome.

    Directory of Open Access Journals (Sweden)

    Anna E Sheppard

    2009-01-01

    Full Text Available Functional gene transfer from the plastid (chloroplast and mitochondrial genomes to the nucleus has been an important driving force in eukaryotic evolution. Non-functional DNA transfer is far more frequent, and the frequency of such transfers from the plastid to the nucleus has been determined experimentally in tobacco using transplastomic lines containing, in their plastid genome, a kanamycin resistance gene (neo readymade for nuclear expression. Contrary to expectations, non-Mendelian segregation of the kanamycin resistance phenotype is seen in progeny of some lines in which neo has been transferred to the nuclear genome. Here, we provide a detailed analysis of the instability of kanamycin resistance in nine of these lines, and we show that it is due to deletion of neo. Four lines showed instability with variation between progeny derived from different areas of the same plant, suggesting a loss of neo during somatic cell division. One line showed a consistent reduction in the proportion of kanamycin-resistant progeny, suggesting a loss of neo during meiosis, and the remaining four lines were relatively stable. To avoid genomic enlargement, the high frequency of plastid DNA integration into the nuclear genome necessitates a counterbalancing removal process. This is the first demonstration of such loss involving a high proportion of recent nuclear integrants. We propose that insertion, deletion, and rearrangement of plastid sequences in the nuclear genome are important evolutionary processes in the generation of novel nuclear genes. This work is also relevant in the context of transgenic plant research and crop production, because similar processes to those described here may be involved in the loss of plant transgenes.

  4. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  5. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  6. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  7. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase

    Directory of Open Access Journals (Sweden)

    Roozbeh Hushiarian

    2015-12-01

    This technique was found to be reliably repeatable. The indirect detection of genomic DNA using this method is significantly improved and showed high efficiency in small amounts of samples with the detection limit of 5.37 × 10−14 M.

  8. Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome Atlas

    Directory of Open Access Journals (Sweden)

    Theo A. Knijnenburg

    2018-04-01

    Full Text Available Summary: DNA damage repair (DDR pathways modulate cancer risk, progression, and therapeutic response. We systematically analyzed somatic alterations to provide a comprehensive view of DDR deficiency across 33 cancer types. Mutations with accompanying loss of heterozygosity were observed in over 1/3 of DDR genes, including TP53 and BRCA1/2. Other prevalent alterations included epigenetic silencing of the direct repair genes EXO5, MGMT, and ALKBH3 in ∼20% of samples. Homologous recombination deficiency (HRD was present at varying frequency in many cancer types, most notably ovarian cancer. However, in contrast to ovarian cancer, HRD was associated with worse outcomes in several other cancers. Protein structure-based analyses allowed us to predict functional consequences of rare, recurrent DDR mutations. A new machine-learning-based classifier developed from gene expression data allowed us to identify alterations that phenocopy deleterious TP53 mutations. These frequent DDR gene alterations in many human cancers have functional consequences that may determine cancer progression and guide therapy. : Knijnenburg et al. present The Cancer Genome Atlas (TCGA Pan-Cancer analysis of DNA damage repair (DDR deficiency in cancer. They use integrative genomic and molecular analyses to identify frequent DDR alterations across 33 cancer types, correlate gene- and pathway-level alterations with genome-wide measures of genome instability and impaired function, and demonstrate the prognostic utility of DDR deficiency scores. Keywords: The Cancer Genome Atlas PanCanAtlas project, DNA damage repair, somatic mutations, somatic copy-number alterations, epigenetic silencing, DNA damage footprints, mutational signatures, integrative statistical analysis, protein structure analysis

  9. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  10. Whole-genome amplified DNA from stored dried blood spots is reliable in high resolution melting curve and sequencing analysis

    DEFF Research Database (Denmark)

    Winkel, Bo G; Hollegaard, Mads V; Olesen, Morten S

    2011-01-01

    BACKGROUND: The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted...

  11. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  12. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  13. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  14. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project

    DEFF Research Database (Denmark)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya

    2007-01-01

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses...

  15. Klebsiella pneumoniae asparagine tDNAs are integration hotspots for different genomic islands encoding microcin E492 production determinants and other putative virulence factors present in hypervirulent strains

    Directory of Open Access Journals (Sweden)

    Andrés Esteban Marcoleta

    2016-06-01

    Full Text Available Due to the developing of multi-resistant and invasive hypervirulent strains, Klebsiella pneumoniae has become one of the most urgent bacterial pathogen threats in the last years. Genomic comparison of a growing number of sequenced isolates has allowed the identification of putative virulence factors, proposed to be acquirable mainly through horizontal gene transfer. In particular, those related with synthesizing the antibacterial peptide microcin E492 (MccE492 and salmochelin siderophores were found to be highly prevalent among hypervirulent strains. The determinants for the production of both molecules were first reported as part of a 13-kbp segment of K. pneumoniae RYC492 chromosome, and were cloned and characterized in E. coli. However, the genomic context of this segment in K. pneumoniae remained uncharacterized.In this work we provided experimental and bioinformatics evidence indicating that the MccE492 cluster is part of a highly conserved 23-kbp genomic island (GI named GIE492, that was integrated in a specific asparagine-tRNA gene (asn-tDNA and was found in a high proportion of isolates from liver abscesses sampled around the world. This element resulted to be unstable and its excision frequency increased after treating bacteria with mytomicin C and upon the overexpression of the island-encoded integrase. Besides the MccE492 genetic cluster, it invariably included an integrase-coding gene, at least 7 protein-coding genes of unknown function, and a putative transfer origin that possibly allows this GI to be mobilized through conjugation. In addition, we analyzed the asn-tDNA loci of all the available K. pneumoniae assembled chromosomes to evaluate them as GI-integration sites. Remarkably, 73% of the strains harbored at least one GI integrated in one of the four asn-tDNA present in this species, confirming them as integration hotspots. Each of these tDNAs was occupied with different frequencies, although they were 100% identical. Also, we

  16. Characterization of the dsDNA prophage sequences in the genome of Neisseria gonorrhoeae and visualization of productive bacteriophage

    Directory of Open Access Journals (Sweden)

    Maugel Timothy K

    2007-07-01

    Full Text Available Abstract Background Bioinformatic analysis of the genome sequence of Neisseria gonorrhoeae revealed the presence of nine probable prophage islands. The distribution, conservation and function of many of these sequences, and their ability to produce bacteriophage particles are unknown. Results Our analysis of the genomic sequence of FA1090 identified five genomic regions (NgoΦ1 – 5 that are related to dsDNA lysogenic phage. The genetic content of the dsDNA prophage sequences were examined in detail and found to contain blocks of genes encoding for proteins homologous to proteins responsible for phage DNA replication, structural proteins and proteins responsible for phage assembly. The DNA sequences from NgoΦ1, NgoΦ2 and NgoΦ3 contain some significant regions of identity. A unique region of NgoΦ2 showed very high similarity with the Pseudomonas aeruginosa generalized transducing phage F116. Comparative analysis at the nucleotide and protein levels suggests that the sequences of NgoΦ1 and NgoΦ2 encode functionally active phages, while NgoΦ3, NgoΦ4 and NgoΦ5 encode incomplete genomes. Expression of the NgoΦ1 and NgoΦ2 repressors in Escherichia coli inhibit the growth of E. coli and the propagation of phage λ. The NgoΦ2 repressor was able to inhibit transcription of N. gonorrhoeae genes and Haemophilus influenzae HP1 phage promoters. The holin gene of NgoΦ1 (identical to that encoded by NgoΦ2, when expressed in E. coli, could serve as substitute for the phage λ s gene. We were able to detect the presence of the DNA derived from NgoΦ1 in the cultures of N. gonorrhoeae. Electron microscopy analysis of culture supernatants revealed the presence of multiple forms of bacteriophage particles. Conclusion These data suggest that the genes similar to dsDNA lysogenic phage present in the gonococcus are generally conserved in this pathogen and that they are able to regulate the expression of other neisserial genes. Since phage particles were

  17. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  18. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  19. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  20. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  1. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  2. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  3. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  4. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  5. Automated Processing of 2-D Gel Electrophoretograms of Genomic DNA for Hunting Pathogenic DNA Molecular Changes.

    Science.gov (United States)

    Takahashi; Nakazawa; Watanabe; Konagaya

    1999-01-01

    We have developed the automated processing algorithms for 2-dimensional (2-D) electrophoretograms of genomic DNA based on RLGS (Restriction Landmark Genomic Scanning) method, which scans the restriction enzyme recognition sites as the landmark and maps them onto a 2-D electrophoresis gel. Our powerful processing algorithms realize the automated spot recognition from RLGS electrophoretograms and the automated comparison of a huge number of such images. In the final stage of the automated processing, a master spot pattern, on which all the spots in the RLGS images are mapped at once, can be obtained. The spot pattern variations which seemed to be specific to the pathogenic DNA molecular changes can be easily detected by simply looking over the master spot pattern. When we applied our algorithms to the analysis of 33 RLGS images derived from human colon tissues, we successfully detected several colon tumor specific spot pattern changes.

  6. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  7. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  8. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-01-01

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  9. A Domain of Herpes Simplex Virus pUL33 Required To Release Monomeric Viral Genomes from Cleaved Concatemeric DNA.

    Science.gov (United States)

    Yang, Kui; Dang, Xiaoqun; Baines, Joel D

    2017-10-15

    Monomeric herpesvirus DNA is cleaved from concatemers and inserted into preformed capsids through the actions of the viral terminase. The terminase of herpes simplex virus (HSV) is composed of three subunits encoded by U L 15, U L 28, and U L 33. The U L 33-encoded protein (pU L 33) interacts with pU L 28, but its precise role in the DNA cleavage and packaging reaction is unclear. To investigate the function of pU L 33, we generated a panel of recombinant viruses with either deletions or substitutions in the most conserved regions of U L 33 using a bacterial artificial chromosome system. Deletion of 11 amino acids (residues 50 to 60 or residues 110 to 120) precluded viral replication, whereas the truncation of the last 10 amino acids from the pU L 33 C terminus did not affect viral replication or the interaction of pU L 33 with pU L 28. Mutations that replaced the lysine at codon 110 and the arginine at codon 111 with alanine codons failed to replicate, and the pU L 33 mutant interacted with pU L 28 less efficiently. Interestingly, genomic termini of the large (L) and small (S) components were detected readily in cells infected with these mutants, indicating that concatemeric DNA was cleaved efficiently. However, the release of monomeric genomes as assessed by pulsed-field gel electrophoresis was greatly diminished, and DNA-containing capsids were not observed. These results suggest that pU L 33 is necessary for one of the two viral DNA cleavage events required to release individual genomes from concatemeric viral DNA. IMPORTANCE This paper shows a role for pU L 33 in one of the two DNA cleavage events required to release monomeric genomes from concatemeric viral DNA. This is the first time that such a phenotype has been observed and is the first identification of a function of this protein relevant to DNA packaging other than its interaction with other terminase components. Copyright © 2017 Yang et al.

  10. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  11. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  12. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  13. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  14. Characterization of the legumains encoded by the genome of Theobroma cacao L.

    Science.gov (United States)

    Santana, Juliano Oliveira; Freire, Laís; de Sousa, Aurizangela Oliveira; Fontes Soares, Virgínia Lúcia; Gramacho, Karina Peres; Pirovani, Carlos Priminho

    2016-01-01

    Legumains are cysteine proteases related to plant development, protein degradation, programmed cell death, and defense against pathogens. In this study, we have identified and characterized three legumains encoded by Theobroma cacao genome through in silico analyses, three-dimensional modeling, genetic expression pattern in different tissues and as a response to the inoculation of Moniliophthora perniciosa fungus. The three proteins were named TcLEG3, TcLEG6, and TcLEG9. Histidine and cysteine residue which are part of the catalytic site were conserved among the proteins, and they remained parallel in the loop region in the 3D modeling. Three-dimensional modeling showed that the propeptide, which is located in the terminal C region of legumains blocks the catalytic cleft. Comparing dendrogram data with the relative expression analysis, indicated that TcLEG3 is related to the seed legumain group, TcLEG6 is related with the group of embryogenesis activities, and protein TcLEG9, with processes regarding the vegetative group. Furthermore, the expression analyses proposes a significant role for the three legumains during the development of Theobroma cacao and in its interaction with M. perniciosa. Copyright © 2015 Universidade Estadual de Santa Cruz, CNPJ: 40738999/0001-95. Published by Elsevier Masson SAS.. All rights reserved.

  15. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  17. Gross genomic damage measured by DNA image cytometry independently predicts gastric cancer patient survival

    NARCIS (Netherlands)

    Belien, J.A.M.; Buffart, T.E.; Gill, A.; Broeckaert, M.A.M.; Quirke, P.; Meijer, G.A.; Grabsch, H.

    2009-01-01

    BACKGROUND: DNA aneuploidy reflects gross genomic changes. It can be measured by flow cytometry (FCM-DNA) or image cytometry (ICM-DNA). In gastric cancer, the prevalence of DNA aneuploidy has been reported to range from 27 to 100%, with conflicting associations with clinicopathological variables.

  18. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  19. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  20. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  1. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA.

    Science.gov (United States)

    Shahal, Tamar; Gilat, Noa; Michaeli, Yael; Redy-Keisar, Orit; Shabat, Doron; Ebenstein, Yuval

    2014-08-19

    5-Hydroxymethylcytosine (5hmC), a modified form of the DNA base cytosine, is an important epigenetic mark linked to regulation of gene expression in development, and tumorigenesis. We have developed a spectroscopic method for a global quantification of 5hmC in genomic DNA. The assay is performed within a multiwell plate, which allows simultaneous recording of up to 350 samples. Our quantification procedure of 5hmC is direct, simple, and rapid. It relies on a two-step protocol that consists of enzymatic glucosylation of 5hmC with an azide-modified glucose, followed by a "click reaction" with an alkyne-fluorescent tag. The fluorescence intensity recorded from the DNA sample is proportional to its 5hmC content and can be quantified by a simple plate reader measurement. This labeling technique is specific and highly sensitive, allowing detection of 5hmC down to 0.002% of the total nucleotides. Our results reveal significant variations in the 5hmC content obtained from different mouse tissues, in agreement with previously reported data.

  2. Characterization of large-insert DNA libraries from soil for environmental genomic studies of Archaea

    DEFF Research Database (Denmark)

    Treusch, Alexander H; Kletzin, Arnulf; Raddatz, Guenter

    2004-01-01

    Complex genomic libraries are increasingly being used to retrieve complete genes, operons or large genomic fragments directly from environmental samples, without the need to cultivate the respective microorganisms. We report on the construction of three large-insert fosmid libraries in total...... (approximately 1% each) have been captured in our libraries. The diversity of putative protein-encoding genes, as reflected by their distribution into different COG clusters, was comparable to that encoded in complete genomes of cultivated microorganisms. A huge variety of genomic fragments has been captured...

  3. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  4. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  5. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  6. In Vitro Whole Genome DNA Binding Analysis of the Bacterial Replication Initiator and Transcription Factor DnaA.

    Directory of Open Access Journals (Sweden)

    Janet L Smith

    2015-05-01

    Full Text Available DnaA, the replication initiation protein in bacteria, is an AAA+ ATPase that binds and hydrolyzes ATP and exists in a heterogeneous population of ATP-DnaA and ADP-DnaA. DnaA binds cooperatively to the origin of replication and several other chromosomal regions, and functions as a transcription factor at some of these regions. We determined the binding properties of Bacillus subtilis DnaA to genomic DNA in vitro at single nucleotide resolution using in vitro DNA affinity purification and deep sequencing (IDAP-Seq. We used these data to identify 269 binding regions, refine the consensus sequence of the DnaA binding site, and compare the relative affinity of binding regions for ATP-DnaA and ADP-DnaA. Most sites had a slightly higher affinity for ATP-DnaA than ADP-DnaA, but a few had a strong preference for binding ATP-DnaA. Of the 269 sites, only the eight strongest binding ones have been observed to bind DnaA in vivo, suggesting that other cellular factors or the amount of available DnaA in vivo restricts DnaA binding to these additional sites. Conversely, we found several chromosomal regions that were bound by DnaA in vivo but not in vitro, and that the nucleoid-associated protein Rok was required for binding in vivo. Our in vitro characterization of the inherent ability of DnaA to bind the genome at single nucleotide resolution provides a backdrop for interpreting data on in vivo binding and regulation of DnaA, and is an approach that should be adaptable to many other DNA binding proteins.

  7. A protocol for large scale genomic DNA isolation for cacao genetics ...

    African Journals Online (AJOL)

    Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the preservation of tissue samples for future use in cacao genome studies. The present study proposes a method for the ...

  8. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  9. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  10. Selective enrichment and sequencing of whole mitochondrial genomes in the presence of nuclear encoded mitochondrial pseudogenes (numts.

    Directory of Open Access Journals (Sweden)

    Jonci N Wolff

    Full Text Available Numts are an integral component of many eukaryote genomes offering a snapshot of the evolutionary process that led from the incorporation of an α-proteobacterium into a larger eukaryotic cell some 1.8 billion years ago. Although numt sequence can be harnessed as molecular marker, these sequences often remain unidentified and are mistaken for genuine mtDNA leading to erroneous interpretation of mtDNA data sets. It is therefore indispensable that during the process of amplifying and sequencing mitochondrial genes, preventive measures are taken to ensure the exclusion of numts to guarantee the recovery of genuine mtDNA. This applies to mtDNA analyses in general but especially to studies where mtDNAs are sequenced de novo as the launch pad for subsequent mtDNA-based research. By using a combination of dilution series and nested rolling circle amplification (RCA, we present a novel strategy to selectively amplify mtDNA and exclude the amplification of numt sequence. We have successfully applied this strategy to de novo sequence the mtDNA of the Black Field Cricket Teleogryllus commodus, a species known to contain numts. Aligning our assembled sequence to the reference genome of Teleogryllus emma (GenBank EU557269.1 led to the identification of a numt sequence in the reference sequence. This unexpected result further highlights the need of a reliable and accessible strategy to eliminate this source of error.

  11. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  12. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Devor, E.J.; Dill-Devor, R.M. [Univ. of Iowa College of Medicine, Iowa City (United States)

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCR assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.

  13. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH.

    Science.gov (United States)

    Guillaud-Bataille, Marine; Valent, Alexander; Soularue, Pascal; Perot, Christine; Inda, Maria Mar; Receveur, Aline; Smaïli, Sadek; Roest Crollius, Hugues; Bénard, Jean; Bernheim, Alain; Gidrol, Xavier; Danglot, Gisèle

    2004-07-29

    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detection of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical 1 microg usually necessary. Using a discrete series of DNA fragments, we defined the parameters adapted to the most faithful ligation-mediated PCR amplification and the limits of the technique. The optimized protocol allows a 3000-fold DNA amplification, retaining the quantitative characteristics of the initial genome. Validation of the amplification procedure, using DNA from 10 tumour cell lines hybridized to BAC-arrays of 1500 spots, showed almost perfectly superimposed ratios for the non-amplified and amplified DNAs. Correlation coefficients of 0.96 and 0.99 were observed for regions of low-copy-level variations and all regions, respectively (including in vivo amplified oncogenes). Finally, labelling DNA using two nucleotides bearing the same fluorophore led to a significant increase in reproducibility and to the correct detection of one-copy gain or loss in >90% of the analysed data, even for pseudotriploid tumour genomes.

  14. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  15. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  16. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  17. Genome-wide survey of repetitive DNA elements in the button mushroom Agaricus bisporus

    NARCIS (Netherlands)

    Foulongne-Oriol, M.; Murat, C.; Castanera, R.; Ramírez, L.; Sonnenberg, A.S.M.

    2013-01-01

    Repetitive DNA elements are ubiquitous constituents of eukaryotic genomes. The biological roles of these repetitive elements, supposed to impact genome organization and evolution, are not completely elucidated yet. The availability of whole genome sequence offers the opportunity to draw a picture of

  18. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  19. Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance

    Directory of Open Access Journals (Sweden)

    Haque Kashif A

    2005-09-01

    Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of

  20. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  1. Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

    Science.gov (United States)

    Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

    2017-04-01

    Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

  2. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    Science.gov (United States)

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In

  3. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing.

    Science.gov (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C

    2017-03-31

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  4. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  5. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  6. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  7. Functional Genome Mining for Metabolites Encoded by Large Gene Clusters through Heterologous Expression of a Whole-Genome Bacterial Artificial Chromosome Library in Streptomyces spp.

    Science.gov (United States)

    Xu, Min; Wang, Yemin; Zhao, Zhilong; Gao, Guixi; Huang, Sheng-Xiong; Kang, Qianjin; He, Xinyi; Lin, Shuangjun; Pang, Xiuhua; Deng, Zixin

    2016-01-01

    ABSTRACT Genome sequencing projects in the last decade revealed numerous cryptic biosynthetic pathways for unknown secondary metabolites in microbes, revitalizing drug discovery from microbial metabolites by approaches called genome mining. In this work, we developed a heterologous expression and functional screening approach for genome mining from genomic bacterial artificial chromosome (BAC) libraries in Streptomyces spp. We demonstrate mining from a strain of Streptomyces rochei, which is known to produce streptothricins and borrelidin, by expressing its BAC library in the surrogate host Streptomyces lividans SBT5, and screening for antimicrobial activity. In addition to the successful capture of the streptothricin and borrelidin biosynthetic gene clusters, we discovered two novel linear lipopeptides and their corresponding biosynthetic gene cluster, as well as a novel cryptic gene cluster for an unknown antibiotic from S. rochei. This high-throughput functional genome mining approach can be easily applied to other streptomycetes, and it is very suitable for the large-scale screening of genomic BAC libraries for bioactive natural products and the corresponding biosynthetic pathways. IMPORTANCE Microbial genomes encode numerous cryptic biosynthetic gene clusters for unknown small metabolites with potential biological activities. Several genome mining approaches have been developed to activate and bring these cryptic metabolites to biological tests for future drug discovery. Previous sequence-guided procedures relied on bioinformatic analysis to predict potentially interesting biosynthetic gene clusters. In this study, we describe an efficient approach based on heterologous expression and functional screening of a whole-genome library for the mining of bioactive metabolites from Streptomyces. The usefulness of this function-driven approach was demonstrated by the capture of four large biosynthetic gene clusters for metabolites of various chemical types, including

  8. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Differential distribution of a SINE element in the Entamoeba histolytica and Entamoeba dispar genomes: Role of the LINE-encoded endonuclease

    Directory of Open Access Journals (Sweden)

    Gupta Abhishek K

    2011-05-01

    Full Text Available Abstract Background Entamoeba histolytica and Entamoeba dispar are closely related protistan parasites but while E. histolytica can be invasive, E. dispar is completely non pathogenic. Transposable elements constitute a significant portion of the genome in these species; there being three families of LINEs and SINEs. These elements can profoundly influence the expression of neighboring genes. Thus their genomic location can have important phenotypic consequences. A genome-wide comparison of the location of these elements in the E. histolytica and E. dispar genomes has not been carried out. It is also not known whether the retrotransposition machinery works similarly in both species. The present study was undertaken to address these issues. Results Here we extracted all genomic occurrences of full-length copies of EhSINE1 in the E. histolytica genome and matched them with the homologous regions in E. dispar, and vice versa, wherever it was possible to establish synteny. We found that only about 20% of syntenic sites were occupied by SINE1 in both species. We checked whether the different genomic location in the two species was due to differences in the activity of the LINE-encoded endonuclease which is required for nicking the target site. We found that the endonucleases of both species were essentially very similar, both in their kinetic properties and in their substrate sequence specificity. Hence the differential distribution of SINEs in these species is not likely to be influenced by the endonuclease. Further we found that the physical properties of the DNA sequences adjoining the insertion sites were similar in both species. Conclusions Our data shows that the basic retrotransposition machinery is conserved in these sibling species. SINEs may indeed have occupied all of the insertion sites in the genome of the common ancestor of E. histolytica and E. dispar but these may have been subsequently lost from some locations. Alternatively, SINE

  10. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  11. Genomics and radical mediated DNA damage: major differences between ionizing radiation and DNA-cleaving enediynes

    International Nuclear Information System (INIS)

    Cosgrove, J.P.; Begley, T.J.; Samson, L.D.; Dedon, P.C.

    2003-01-01

    While the evidence is strong for radical-mediated oxidative processes in the pathophysiology of cancer and aging, the mechanisms by which cells respond to oxidative stress have eluded definition. To this end, we have undertaken genomic studies comparing the response of S. cerevisiae to DNA-specific oxidizing agents, the enediynes calicheamicin (CAL), esperamicin (ESP), and neocarzinostatin (NCS), and the non-specific gamma-radiation (RAD). While RAD results in relatively indiscriminate oxidation of cellular molecules, the enediynes are highly specific to DNA and produce damage by a common mechanism involving radical-mediated oxidation of deoxyribose. Transcriptional profiling in response to these agents (80% survival; 15 min exposure; Affymetrix) revealed unexpected differences between RAD and the enediynes and among the three enediynes. Only 2 genes responded in common to all agents, while 9 genes were regulated in common for the 3 enediynes (no DNA repair genes altered in common). The limited common gene expression changes for the 3 enediynes may result from differences in deoxyribose oxidation chemistry, DNA and chromatin targets or the proportions of single- and double-strand DNA lesions. RAD produced a more robust response than the enediynes, altering expression of 195 and 52 genes by more than 2- and 5-fold, respectively, compared to 16-44 and *2 genes, respectively, for the enediynes. This suggests that the transcriptional response varies in intensity according to the number of cellular features affected by the toxin. Genes showing the strongest up-regulation with RAD: ribonucleotide reductase, multidrug resistance, DS break repair/RAD51, GSH transferase; strongly reduced gene expression: TEL1 (damage signaling), NAT2 (acetyltransferase). Genomic phenotyping studies, using a subset of the Research Genetics deletion library, revealed that loss of apn1, the major AP endonuclease, caused resistance to NCS, possibly due to reduced formation of protein-DNA cross

  12. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  13. Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

    Science.gov (United States)

    Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

    2011-06-01

    This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

  14. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  15. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    Science.gov (United States)

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  16. Whole-genome DNA methylation status associated with clinical PTSD measures of OIF/OEF veterans

    Science.gov (United States)

    Hammamieh, R; Chakraborty, N; Gautam, A; Muhie, S; Yang, R; Donohue, D; Kumar, R; Daigle, B J; Zhang, Y; Amara, D A; Miller, S-A; Srinivasan, S; Flory, J; Yehuda, R; Petzold, L; Wolkowitz, O M; Mellon, S H; Hood, L; Doyle, F J; Marmar, C; Jett, M

    2017-01-01

    Emerging knowledge suggests that post-traumatic stress disorder (PTSD) pathophysiology is linked to the patients’ epigenetic changes, but comprehensive studies examining genome-wide methylation have not been performed. In this study, we examined genome-wide DNA methylation in peripheral whole blood in combat veterans with and without PTSD to ascertain differentially methylated probes. Discovery was initially made in a training sample comprising 48 male Operation Enduring Freedom (OEF)/Operation Iraqi Freedom (OIF) veterans with PTSD and 51 age/ethnicity/gender-matched combat-exposed PTSD-negative controls. Agilent whole-genome array detected ~5600 differentially methylated CpG islands (CpGI) annotated to ~2800 differently methylated genes (DMGs). The majority (84.5%) of these CpGIs were hypermethylated in the PTSD cases. Functional analysis was performed using the DMGs encoding the promoter-bound CpGIs to identify networks related to PTSD. The identified networks were further validated by an independent test set comprising 31 PTSD+/29 PTSD− veterans. Targeted bisulfite sequencing was also used to confirm the methylation status of 20 DMGs shown to be highly perturbed in the training set. To improve the statistical power and mitigate the assay bias and batch effects, a union set combining both training and test set was assayed using a different platform from Illumina. The pathways curated from this analysis confirmed 65% of the pool of pathways mined from training and test sets. The results highlight the importance of assay methodology and use of independent samples for discovery and validation of differentially methylated genes mined from whole blood. Nonetheless, the current study demonstrates that several important epigenetically altered networks may distinguish combat-exposed veterans with and without PTSD. PMID:28696412

  17. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  18. MtDNA genomes reveal a relaxation of selective constraints in low-BMI individuals in a Uyghur population.

    Science.gov (United States)

    Zheng, Hong-Xiang; Li, Lei; Jiang, Xiao-Yan; Yan, Shi; Qin, Zhendong; Wang, Xiaofeng; Jin, Li

    2017-10-01

    Considerable attention has been focused on the effect of deleterious mutations caused by the recent relaxation of selective constraints on human health, including the prevalence of obesity, which might represent an adaptive response of energy-conserving metabolism under the conditions of modern society. Mitochondrial DNA (mtDNA) encoding 13 core subunits of oxidative phosphorylation plays an important role in metabolism. Therefore, we hypothesized that a relaxation of selection constraints on mtDNA and an increase in the proportion of deleterious mutations have played a role in obesity prevalence. In this study, we collected and sequenced the mtDNA genomes of 722 Uyghurs, a typical population with a high prevalence of obesity. We identified the variants that occurred in the Uyghur population for each sample and found that the number of nonsynonymous mutations carried by Uyghur individuals declined with elevation of their BMI (P = 0.015). We further calculated the nonsynonymous and synonymous ratio (N/S) of the high-BMI and low-BMI haplogroups, and the results showed that a significantly higher N/S occurred in the whole mtDNA genomes of the low-BMI haplogroups (0.64) than in that of the high-BMI haplogroups (0.35, P = 0.030) and ancestor haplotypes (0.41, P = 0.032); these findings indicated that low-BMI individuals showed a recent relaxation of selective constraints. In addition, we investigated six clinical characteristics and found that fasting plasma glucose might be correlated with the N/S and selective pressures. We hypothesized that a higher proportion of deleterious mutations led to mild mitochondrial dysfunction, which helps to drive glucose consumption and thereby prevents obesity. Our results provide new insights into the relationship between obesity predisposition and mitochondrial genome evolution.

  19. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  20. Reciprocal Regulation between DNA-PKcs and Snail1 Conferring Genomic Instability

    International Nuclear Information System (INIS)

    Seo, Haeng Ran; Lee, Hae June; Jin, Yeung Bae; Bae, Sang Woo; Lee, Yun Sil; Kim, Nam Hee; Kim, Hyun Sil; Nam, Hyung Wook; Yook, Jong In

    2010-01-01

    Although the roles of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) involving non-homologous end joining (NHEJ) of DNA repair are well recognized, the biological mechanisms and regulators by which DNA-PKcs regulate genomic instability are not clearly defined. We show herein that DNA-PKcs activity resulting from DNA damage caused by ionizing radiation (IR) phosphorylates Snail1 at serine 100, which results in increased Snail1 expression and its function by inhibition of GSK-3-mediated phosphorylation. Furthermore, Snail1 phosphorylated at serine 100 can reciprocally inhibit kinase activity of DNA-PKcs, resulting in an inhibition to recruit DNA-PKcs or Ku70/80 to a DNA double-strand break site, and ultimately inhibition of DNA repair activity. The impairment of repair activity by a direct interaction between Snail1 and DNA-PKcs increases the resistance to DNA damaging agents, such as IR, and genomic instability. Our findings provide a novel cellular mechanism for induction of genomic instability by reciprocal regulation of DNA-PKcs and Snail1

  1. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  2. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

  3. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    Science.gov (United States)

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  4. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  5. Evaluation of different sources of DNA for use in genome wide studies and forensic application.

    Science.gov (United States)

    Al Safar, Habiba S; Abidi, Fatima H; Khazanehdari, Kamal A; Dadour, Ian R; Tay, Guan K

    2011-02-01

    In the field of epidemiology, Genome-Wide Association Studies (GWAS) are commonly used to identify genetic predispositions of many human diseases. Large repositories housing biological specimens for clinical and genetic investigations have been established to store material and data for these studies. The logistics of specimen collection and sample storage can be onerous, and new strategies have to be explored. This study examines three different DNA sources (namely, degraded genomic DNA, amplified degraded genomic DNA and amplified extracted DNA from FTA card) for GWAS using the Illumina platform. No significant difference in call rate was detected between amplified degraded genomic DNA extracted from whole blood and amplified DNA retrieved from FTA™ cards. However, using unamplified-degraded genomic DNA reduced the call rate to a mean of 42.6% compared to amplified DNA extracted from FTA card (mean of 96.6%). This study establishes the utility of FTA™ cards as a viable storage matrix for cells from which DNA can be extracted to perform GWAS analysis.

  6. Epigenetic control of mobile DNA as an interface between experience and genome change

    Directory of Open Access Journals (Sweden)

    James A. Shapiro

    2014-04-01

    Full Text Available Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration.

  7. Influence of Feature Encoding and Choice of Classifier on Disease Risk Prediction in Genome-Wide Association Studies.

    Directory of Open Access Journals (Sweden)

    Florian Mittag

    Full Text Available Various attempts have been made to predict the individual disease risk based on genotype data from genome-wide association studies (GWAS. However, most studies only investigated one or two classification algorithms and feature encoding schemes. In this study, we applied seven different classification algorithms on GWAS case-control data sets for seven different diseases to create models for disease risk prediction. Further, we used three different encoding schemes for the genotypes of single nucleotide polymorphisms (SNPs and investigated their influence on the predictive performance of these models. Our study suggests that an additive encoding of the SNP data should be the preferred encoding scheme, as it proved to yield the best predictive performances for all algorithms and data sets. Furthermore, our results showed that the differences between most state-of-the-art classification algorithms are not statistically significant. Consequently, we recommend to prefer algorithms with simple models like the linear support vector machine (SVM as they allow for better subsequent interpretation without significant loss of accuracy.

  8. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

    International Nuclear Information System (INIS)

    Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

    1987-01-01

    Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

  9. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  10. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  11. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  12. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  13. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  14. Single-cell genomics reveals pyrrolysine-encoding potential in members of uncultivated archaeal candidate division MSBL1

    KAUST Repository

    Guan, Yue; Haroon, Mohamed; Alam, Intikhab; Ferry, James G.; Stingl, Ulrich

    2017-01-01

    Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.

  15. Single-cell genomics reveals pyrrolysine-encoding potential in members of uncultivated archaeal candidate division MSBL1

    KAUST Repository

    Guan, Yue

    2017-05-11

    Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.

  16. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  17. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  18. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  19. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in order to establish the storage conditions for the collected samples before DNA extraction. Secondly, the aim was to determine the best protocol for the extraction of high quality DNA, ...

  20. Excised radicle tips as a source of genomic DNA for PCR-based ...

    Indian Academy of Sciences (India)

    2012-12-13

    Dec 13, 2012 ... Cotton; cry1Ac; genomic DNA isolation; high-resolution melting curve analysis; radicle tip; seed purity testing .... cooled to 40°C. Fluorescence data for melting curves were ... greatly increased by introducing automation.

  1. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  2. Proteins Encoded in Genomic Regions Associated with Immune-Mediated Disease Physically Interact and Suggest Underlying Biology

    DEFF Research Database (Denmark)

    Rossin, Elizabeth J.; Hansen, Kasper Lage; Raychaudhuri, Soumya

    2011-01-01

    Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these r......Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed...... in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein-protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more...... that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non...

  3. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  4. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  5. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabian; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; de Wit, Pierre J. G. M.; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2013-03-05

    The class of Dothideomycetes is one of the largest and most diverse groups of fungi. Many are plant pathogens and pose a serious threat to agricultural crops that are grown for biofuel, food or feed. Most Dothideomycetes have only a single host plant, and related species can have very diverse hosts. Eighteen genomes of Dothideomycetes have currently been sequenced by the Joint Genome Institute and other sequencing centers. Here we describe the results of comparative analyses of the fungi in this group.

  6. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Doethideomycetes Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabien; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; de Wit, Pierre J. G. M.; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2012-03-13

    The class of Dothideomycetes is one of the largest and most diverse groups of fungi. Many are plant pathogens and pose a serious threat to agricultural crops grown for biofuel, food or feed. Most Dothideomycetes have only a single host and related species can have very diverse host plants. Eighteen genomes of Dothideomycetes have currently been sequenced by the Joint Genome Institute and other sequencing centers. Here we describe the results of comparative analyses of the fungi in this group.

  7. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. DNA Oncogenic Virus-Induced Oxidative Stress, Genomic Damage, and Aberrant Epigenetic Alterations

    Directory of Open Access Journals (Sweden)

    Mankgopo Magdeline Kgatle

    2017-01-01

    Full Text Available Approximately 20% of human cancers is attributable to DNA oncogenic viruses such as human papillomavirus (HPV, hepatitis B virus (HBV, and Epstein-Barr virus (EBV. Unrepaired DNA damage is the most common and overlapping feature of these DNA oncogenic viruses and a source of genomic instability and tumour development. Sustained DNA damage results from unceasing production of reactive oxygen species and activation of inflammasome cascades that trigger genomic changes and increased propensity of epigenetic alterations. Accumulation of epigenetic alterations may interfere with genome-wide cellular signalling machineries and promote malignant transformation leading to cancer development. Untangling and understanding the underlying mechanisms that promote these detrimental effects remain the major objectives for ongoing research and hope for effective virus-induced cancer therapy. Here, we review current literature with an emphasis on how DNA damage influences HPV, HVB, and EBV replication and epigenetic alterations that are associated with carcinogenesis.

  10. Appraising the relevance of DNA copy number loss and gain in prostate cancer using whole genome DNA sequence data.

    Directory of Open Access Journals (Sweden)

    Niedzica Camacho

    2017-09-01

    Full Text Available A variety of models have been proposed to explain regions of recurrent somatic copy number alteration (SCNA in human cancer. Our study employs Whole Genome DNA Sequence (WGS data from tumor samples (n = 103 to comprehensively assess the role of the Knudson two hit genetic model in SCNA generation in prostate cancer. 64 recurrent regions of loss and gain were detected, of which 28 were novel, including regions of loss with more than 15% frequency at Chr4p15.2-p15.1 (15.53%, Chr6q27 (16.50% and Chr18q12.3 (17.48%. Comprehensive mutation screens of genes, lincRNA encoding sequences, control regions and conserved domains within SCNAs demonstrated that a two-hit genetic model was supported in only a minor proportion of recurrent SCNA losses examined (15/40. We found that recurrent breakpoints and regions of inversion often occur within Knudson model SCNAs, leading to the identification of ZNF292 as a target gene for the deletion at 6q14.3-q15 and NKX3.1 as a two-hit target at 8p21.3-p21.2. The importance of alterations of lincRNA sequences was illustrated by the identification of a novel mutational hotspot at the KCCAT42, FENDRR, CAT1886 and STCAT2 loci at the 16q23.1-q24.3 loss. Our data confirm that the burden of SCNAs is predictive of biochemical recurrence, define nine individual regions that are associated with relapse, and highlight the possible importance of ion channel and G-protein coupled-receptor (GPCR pathways in cancer development. We concluded that a two-hit genetic model accounts for about one third of SCNA indicating that mechanisms, such haploinsufficiency and epigenetic inactivation, account for the remaining SCNA losses.

  11. Isolation and sequence analysis of the wheat B genome subtelomeric DNA

    Directory of Open Access Journals (Sweden)

    Huneau Cecile

    2009-09-01

    Full Text Available Abstract Background Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. Results The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119 737 bp was annotated. It is composed of 33% transposable elements (TEs, 8.2% Spelt52 (namely, the subfamily Spelt52.2 and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11 666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0. Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Conclusion Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat

  12. Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

    Science.gov (United States)

    Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

    2009-09-05

    Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time

  13. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

    1992-12-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  14. Crucial optimization steps in getting premier quality of Aquilaria malaccensis genomic DNA for molecular activities

    International Nuclear Information System (INIS)

    Muhammad Hanif Azhari; Azhar Mohamad

    2013-01-01

    Gaharu resin is derived from Aquilaria sp. or Agar wood tree in a tropical ecosystem. In Malaysia the Aquilaria species especially A. malaccensis in danger of extinction in the wild due to illegal logging as its resin is highly used for the production of greatly valued incense throughout Asia. A significant tool in fingerprinting the species is through molecular activities of Polymerase Chain Reaction (PCR) application on which requires total genomic DNA as a starting material. This paper, described optimizations of both fresh and dried samples derived from A. malaccensis for genomic DNA. Three main parameters for the optimization were temperature (60, 65, and 70 degree Celsius), incubation period (30, 60, 90 minutes) and concentration of CTAB (1 %, 3 %, 5 %). The experimental design in these work resulted a total of 46 combinations of the parameters in which 0.5 g samples was used in each combination. Nano-drop spectrometer was used in detecting the quantitative genomic DNA at ng/ μl. In fresh samples, incubation temperatures at 65 degree Celsius for 60 minutes in 3 % were yielded 723.2 ng/ μl genomic DNA. Whereas, for dried samples, incubation temperature at 70 degree Celsius for 90 minutes in 5 % CTAB were yielded 70.2 ng/ μl of genomic DNA. Spectrometer reading at OD280/ 260 was 1.9 for both type of samples. The isolated genomic DNA is useful for the molecular activities to identify specific plants between the same species or among the Aquilaria species. (author)

  15. Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine

    Science.gov (United States)

    Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson

    2011-01-01

    Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

  16. Ku-mediated coupling of DNA cleavage and repair during programmed genome rearrangements in the ciliate Paramecium tetraurelia.

    Directory of Open Access Journals (Sweden)

    Antoine Marmignon

    2014-08-01

    Full Text Available During somatic differentiation, physiological DNA double-strand breaks (DSB can drive programmed genome rearrangements (PGR, during which DSB repair pathways are mobilized to safeguard genome integrity. Because of their unique nuclear dimorphism, ciliates are powerful unicellular eukaryotic models to study the mechanisms involved in PGR. At each sexual cycle, the germline nucleus is transmitted to the progeny, but the somatic nucleus, essential for gene expression, is destroyed and a new somatic nucleus differentiates from a copy of the germline nucleus. In Paramecium tetraurelia, the development of the somatic nucleus involves massive PGR, including the precise elimination of at least 45,000 germline sequences (Internal Eliminated Sequences, IES. IES excision proceeds through a cut-and-close mechanism: a domesticated transposase, PiggyMac, is essential for DNA cleavage, and DSB repair at excision sites involves the Ligase IV, a specific component of the non-homologous end-joining (NHEJ pathway. At the genome-wide level, a huge number of programmed DSBs must be repaired during this process to allow the assembly of functional somatic chromosomes. To understand how DNA cleavage and DSB repair are coordinated during PGR, we have focused on Ku, the earliest actor of NHEJ-mediated repair. Two Ku70 and three Ku80 paralogs are encoded in the genome of P. tetraurelia: Ku70a and Ku80c are produced during sexual processes and localize specifically in the developing new somatic nucleus. Using RNA interference, we show that the development-specific Ku70/Ku80c heterodimer is essential for the recovery of a functional somatic nucleus. Strikingly, at the molecular level, PiggyMac-dependent DNA cleavage is abolished at IES boundaries in cells depleted for Ku80c, resulting in IES retention in the somatic genome. PiggyMac and Ku70a/Ku80c co-purify as a complex when overproduced in a heterologous system. We conclude that Ku has been integrated in the Paramecium

  17. Complete DNA sequence of the mitochondrial genome of the treehopper Leptobelus gazella (Membracoidea: Hemiptera).

    Science.gov (United States)

    Zhao, Xing; Liang, Ai-Ping

    2016-09-01

    The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera.

  18. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  19. Genome-wide analysis reveals loci encoding anti-macrophage factors in the human pathogen Burkholderia pseudomallei K96243.

    Directory of Open Access Journals (Sweden)

    Andrea J Dowling

    2010-12-01

    Full Text Available Burkholderia pseudomallei is an important human pathogen whose infection biology is still poorly understood. The bacterium is endemic to tropical regions, including South East Asia and Northern Australia, where it causes melioidosis, a serious disease associated with both high mortality and antibiotic resistance. B. pseudomallei is a Gram-negative facultative intracellular pathogen that is able to replicate in macrophages. However despite the critical nature of its interaction with macrophages, few anti-macrophage factors have been characterized to date. Here we perform a genome-wide gain of function screen of B. pseudomallei strain K96243 to identify loci encoding factors with anti-macrophage activity. We identify a total of 113 such loci scattered across both chromosomes, with positive gene clusters encoding transporters and secretion systems, enzymes/toxins, secondary metabolite, biofilm, adhesion and signal response related factors. Further phenotypic analysis of four of these regions shows that the encoded factors cause striking cellular phenotypes relevant to infection biology, including apoptosis, formation of actin 'tails' and multi-nucleation within treated macrophages. The detailed analysis of the remaining host of loci will facilitate genetic dissection of the interaction of this important pathogen with host macrophages and thus further elucidate this critical part of its infection cycle.

  20. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  1. Multiple displacement amplification of whole genomic DNA from urediospores of Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Zhang, R; Ma, Z H; Wu, B M

    2015-05-01

    Biotrophic fungi, such as Puccinia striiformis f. sp. tritici, because they cannot be cultured on nutrient media, to obtain adequate quantity of DNA for molecular genetic analysis, are usually propagated on living hosts, wheat plants in case of P. striiformis f. sp. tritici. The propagation process is time-, space- and labor-consuming and has been a bottleneck to molecular genetic analysis of this pathogen. In this study we evaluated multiple displacement amplification (MDA) of pathogen genomic DNA from urediospores as an alternative approach to traditional propagation of urediospores followed by DNA extraction. The quantities of pathogen genomic DNA in the products were further determined via real-time PCR with a pair of primers specific for the β-tubulin gene of P. striiformis f. sp. tritici. The amplified fragment length polymorphism (AFLP) fingerprints were also compared between the DNA products. The results demonstrated that adequate genomic DNA at fragment size larger than 23 Kb could be amplified from 20 to 30 urediospores via MDA method. The real-time PCR results suggested that although fresh urediospores collected from diseased leaves were the best, spores picked from diseased leaves stored for a prolonged period could also be used for amplification. AFLP fingerprints exhibited no significant differences between amplified DNA and DNA extracted with CTAB method, suggesting amplified DNA can represent the pathogen's genomic DNA very well. Therefore, MDA could be used to obtain genomic DNA from small precious samples (dozens of spores) for molecular genetic analysis of wheat stripe rust pathogen, and other fungi that are difficult to propagate.

  2. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  3. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    International Nuclear Information System (INIS)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong

    2012-01-01

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  4. A DNA minor groove electronegative potential genome map based on photo-chemical probing

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten

    2011-01-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciat...

  5. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  6. Single-tube linear DNA amplification for genome-wide studies using a few thousand cells

    NARCIS (Netherlands)

    Shankaranarayanan, P.; Mendoza-Parra, M.A.; Gool, van W.; Trindade, L.M.; Gronemeyer, H.

    2012-01-01

    Linear amplification of DNA (LinDA) by T7 polymerase is a versatile and robust method for generating sufficient amounts of DNA for genome-wide studies with minute amounts of cells. LinDA can be coupled to a great number of global profiling technologies. Indeed, chromatin immunoprecipitation coupled

  7. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  8. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  9. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  10. Genome-wide DNA methylation analysis of the porcine hypothalamus-pituitary-ovary axis

    DEFF Research Database (Denmark)

    Yuan, Xiao Long; Zhang, Zhe; Li, Bin

    2017-01-01

    Previous studies have suggested that DNA methylation in both CpG and CpH (where H = C, T or A) contexts plays a critical role in biological functions of different tissues. However, the genome-wide DNA methylation patterns of porcine hypothalamus-pituitary-ovary (HPO) tissues remain virtually unex...

  11. Formation of mushrooms and lignocellulose degradation encoded in the genome sequence of Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; de Jong, Jan F.; Lugones, Luis G.; Aerts, Andrea; Kothe, Erika; Stajich, Jason E.; de Vries, Ronald P.; Record, Eric; Levasseur, Anthony; Baker, Scott E.; Bartholomew, Kirk A.; Coutinho, Pedro M.; Erdmann, Susann; Fowler, Thomas J.; Gathman, Allen C.; Lombard, Vincent; Henrissat, Bernard; Knabe, Nicole; Kues, Ursula; Lilly, Walt W.; Lindquist, Erika; Lucas, Susan; Magnuson, Jon K.; Piumi, Francois; Raudaskoski, Marjatta; Salamov, Asaf; Schmutz, Jeremy; Schwarze, Francis W.M.R.; van Kuyk, Patricia A.; Horton, J. Stephen; Grigoriev, Igor V.; Wosten, Han A.B.

    2010-07-12

    The wood degrading fungus Schizophyllum commune is a model system for mushroom development. Here, we describe the 38.5 Mb assembled genome of this basidiomycete and application of whole genome expression analysis to study the 13,210 predicted genes. Comparative analyses of the S. commune genome revealed unique wood degrading machinery and mating type loci with the highest number of reported genes. Gene expression analyses revealed that one third of the 471 identified transcription factor genes were differentially expressed during sexual development. Two of these transcription factor genes were deleted. Inactivation of fst4 resulted in the inability to form mushrooms, whereas inactivation of fst3 resulted in more but smaller mushrooms than wild-type. These data illustrate that mechanisms underlying mushroom formation can be dissected using S. commune as a model. This will impact commercial production of mushrooms and the industrial use of these fruiting bodies to produce enzymes and pharmaceuticals.

  12. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  13. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Directory of Open Access Journals (Sweden)

    Scott Cukras

    Full Text Available Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  14. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Science.gov (United States)

    Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon

    2014-01-01

    Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  15. DNA mismatch repair, genome instability and cancer in zebrafish

    NARCIS (Netherlands)

    Feitsma, H.

    2008-01-01

    The objective of this study was to find out whether the zebrafish can be an appropriate model for studying DNA repair and cancer. For this purpose three fish lines were used that lack components of an important mechanism for the repair of small DNA damage: DNA mismatch repair. These fish are

  16. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    SERVER

    2008-03-04

    Mar 4, 2008 ... Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in order to establish the storage conditions for the collected samples before DNA extraction. Secondly, the aim was to determine the best protocol for the extraction.

  17. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  18. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  19. Genome-wide DNA Methylation Profiling of Cell-Free Serum DNA in Esophageal Adenocarcinoma and Barrett Esophagus

    Directory of Open Access Journals (Sweden)

    Rihong Zhai

    2012-01-01

    Full Text Available Aberrant DNA methylation (DNAm is a feature of most types of cancers. Genome-wide DNAm profiling has been performed successfully on tumor tissue DNA samples. However, the invasive procedure limits the utility of tumor tissue for epidemiological studies. While recent data indicate that cell-free circulating DNAm (cfDNAm profiles reflect DNAm status in corresponding tumor tissues, no studies have examined the association of cfDNAm with cancer or precursors on a genome-wide scale. The objective of this pilot study was to evaluate the putative significance of genome-wide cfDNAm profiles in esophageal adenocarcinoma (EA and Barrett esophagus (BE, EA precursor. We performed genome-wide DNAm profiling in EA tissue DNA (n = 8 and matched serum DNA (n = 8, in serum DNA of BE (n = 10, and in healthy controls (n = 10 using the Infinium HumanMethylation27 BeadChip that covers 27,578 CpG loci in 14,495 genes. We found that cfDNAm profiles were highly correlated to DNAm profiles in matched tumor tissue DNA (r = 0.92 in patients with EA. We selected the most differentially methylated loci to perform hierarchical clustering analysis. We found that 911 loci can discriminate perfectly between EA and control samples, 554 loci can separate EA from BE samples, and 46 loci can distinguish BE from control samples. These results suggest that genome-wide cfDNAm profiles are highly consistent with DNAm profiles detected in corresponding tumor tissues. Differential cfDNAm profiling may be a useful approach for the noninvasive screening of EA and EA premalignant lesions.

  20. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner

    DEFF Research Database (Denmark)

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan

    2009-01-01

    MOTIVATION: The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary...... determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than...

  1. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    International Nuclear Information System (INIS)

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  2. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  3. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

    1986-01-01

    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

  4. Global DNA methylation synergistically regulates the nuclear and mitochondrial genomes in glioblastoma cells.

    Science.gov (United States)

    Sun, Xin; Johnson, Jacqueline; St John, Justin C

    2018-05-02

    Replication of mitochondrial DNA is strictly regulated during differentiation and development allowing each cell type to acquire its required mtDNA copy number to meet its specific needs for energy. Undifferentiated cells establish the mtDNA set point, which provides low numbers of mtDNA copy but sufficient template for replication once cells commit to specific lineages. However, cancer cells, such as those from the human glioblastoma multiforme cell line, HSR-GBM1, cannot complete differentiation as they fail to enforce the mtDNA set point and are trapped in a 'pseudo-differentiated' state. Global DNA methylation is likely to be a major contributing factor, as DNA demethylation treatments promote differentiation of HSR-GBM1 cells. To determine the relationship between DNA methylation and mtDNA copy number in cancer cells, we applied whole genome MeDIP-Seq and RNA-Seq to HSR-GBM1 cells and following their treatment with the DNA demethylation agents 5-azacytidine and vitamin C. We identified key methylated regions modulated by the DNA demethylation agents that also induced synchronous changes to mtDNA copy number and nuclear gene expression. Our findings highlight the control exerted by DNA methylation on the expression of key genes, the regulation of mtDNA copy number and establishment of the mtDNA set point, which collectively contribute to tumorigenesis.

  5. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  6. Recurrent DNA inversion rearrangements in the human genome

    DEFF Research Database (Denmark)

    Flores, Margarita; Morales, Lucía; Gonzaga-Jauregui, Claudia

    2007-01-01

    Several lines of evidence suggest that reiterated sequences in the human genome are targets for nonallelic homologous recombination (NAHR), which facilitates genomic rearrangements. We have used a PCR-based approach to identify breakpoint regions of rearranged structures in the human genome...... to human genomic variation is discussed........ In particular, we have identified intrachromosomal identical repeats that are located in reverse orientation, which may lead to chromosomal inversions. A bioinformatic workflow pathway to select appropriate regions for analysis was developed. Three such regions overlapping with known human genes, located...

  7. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  8. Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi.

    Directory of Open Access Journals (Sweden)

    Robin A Ohm

    Full Text Available The class Dothideomycetes is one of the largest groups of fungi with a high level of ecological diversity including many plant pathogens infecting a broad range of hosts. Here, we compare genome features of 18 members of this class, including 6 necrotrophs, 9 (hemibiotrophs and 3 saprotrophs, to analyze genome structure, evolution, and the diverse strategies of pathogenesis. The Dothideomycetes most likely evolved from a common ancestor more than 280 million years ago. The 18 genome sequences differ dramatically in size due to variation in repetitive content, but show much less variation in number of (core genes. Gene order appears to have been rearranged mostly within chromosomal boundaries by multiple inversions, in extant genomes frequently demarcated by adjacent simple repeats. Several Dothideomycetes contain one or more gene-poor, transposable element (TE-rich putatively dispensable chromosomes of unknown function. The 18 Dothideomycetes offer an extensive catalogue of genes involved in cellulose degradation, proteolysis, secondary metabolism, and cysteine-rich small secreted proteins. Ancestors of the two major orders of plant pathogens in the Dothideomycetes, the Capnodiales and Pleosporales, may have had different modes of pathogenesis, with the former having fewer of these genes than the latter. Many of these genes are enriched in proximity to transposable elements, suggesting faster evolution because of the effects of repeat induced point (RIP mutations. A syntenic block of genes, including oxidoreductases, is conserved in most Dothideomycetes and upregulated during infection in L. maculans, suggesting a possible function in response to oxidative stress.

  9. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabian; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; Wit, Pierre J. G. M. de; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2012-02-29

    The class Dothideomycetes is one of the largest groups of fungi with a high level of ecological diversity including many plant pathogens infecting a broad range of hosts. Here, we compare genome features of 18 members of this class, including 6 necrotrophs, 9 (hemi)biotrophs and 3 saprotrophs, to analyze genome structure, evolution, and the diverse strategies of pathogenesis. The Dothideomycetes most likely evolved from a common ancestor more than 280 million years ago. The 18 genome sequences differ dramatically in size due to variation in repetitive content, but show much less variation in number of (core) genes. Gene order appears to have been rearranged mostly within chromosomal boundaries by multiple inversions, in extant genomes frequently demarcated by adjacent simple repeats. Several Dothideomycetes contain one or more gene-poor, transposable element (TE)-rich putatively dispensable chromosomes of unknown function. The 18 Dothideomycetes offer an extensive catalogue of genes involved in cellulose degradation, proteolysis, secondary metabolism, and cysteine-rich small secreted proteins. Ancestors of the two major orders of plant pathogens in the Dothideomycetes, the Capnodiales and Pleosporales, may have had different modes of pathogenesis, with the former having fewer of these genes than the latter. Many of these genes are enriched in proximity to transposable elements, suggesting faster evolution because of the effects of repeat induced point (RIP) mutations. A syntenic block of genes, including oxidoreductases, is conserved in most Dothideomycetes and upregulated during infection in L. maculans, suggesting a possible function in response to oxidative stress.

  10. Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

    2016-01-01

    that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

  11. Polymorphism and mutation analysis of genomic DNA on cancer

    International Nuclear Information System (INIS)

    Ohta, Tsutomu

    2003-01-01

    DNA repair is a universal process in living cells that maintains the structural integrity of chromosomal DNA molecules in face of damage. A deficiency in DNA damage repair is associated with an increased cancer risk by increasing a mutation frequency of cancer-related genes. Variation in DNA repair capacity may be genetically determined. Therefore, we searched single-nucleotide polymorphisms (SNPs) in major DNA repair genes. This led to the finding of 600 SNPs and mutations including many novel SNPs in Japanese population. Case-control studies to explore the contribution of the SNPs in DNA repair genes to the risk of lung cancer revealed that five SNPs are associated with lung carcinogenesis. One of these SNPs is found in RAD54L gene, which is involved in double-strand DNA repair. We analyzed and reported activities of Rad54L protein with SNP and mutations. (authors)

  12. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  13. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii.

    Science.gov (United States)

    Funk, Helena T; Berg, Sabine; Krupinska, Karin; Maier, Uwe G; Krause, Kirsten

    2007-08-22

    The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels) and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a) the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b) the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c) a significant reduction of RNA editing. Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards a simplification of the plastid gene expression

  14. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii

    Directory of Open Access Journals (Sweden)

    Maier Uwe G

    2007-08-01

    Full Text Available Abstract Background The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. Results The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c a significant reduction of RNA editing. Conclusion Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards

  15. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  16. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  17. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  18. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  19. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  20. Genome Partitioner: A web tool for multi-level partitioning of large-scale DNA constructs for synthetic biology applications.

    Science.gov (United States)

    Christen, Matthias; Del Medico, Luca; Christen, Heinz; Christen, Beat

    2017-01-01

    Recent advances in lower-cost DNA synthesis techniques have enabled new innovations in the field of synthetic biology. Still, efficient design and higher-order assembly of genome-scale DNA constructs remains a labor-intensive process. Given the complexity, computer assisted design tools that fragment large DNA sequences into fabricable DNA blocks are needed to pave the way towards streamlined assembly of biological systems. Here, we present the Genome Partitioner software implemented as a web-based interface that permits multi-level partitioning of genome-scale DNA designs. Without the need for specialized computing skills, biologists can submit their DNA designs to a fully automated pipeline that generates the optimal retrosynthetic route for higher-order DNA assembly. To test the algorithm, we partitioned a 783 kb Caulobacter crescentus genome design. We validated the partitioning strategy by assembling a 20 kb test segment encompassing a difficult to synthesize DNA sequence. Successful assembly from 1 kb subblocks into the 20 kb segment highlights the effectiveness of the Genome Partitioner for reducing synthesis costs and timelines for higher-order DNA assembly. The Genome Partitioner is broadly applicable to translate DNA designs into ready to order sequences that can be assembled with standardized protocols, thus offering new opportunities to harness the diversity of microbial genomes for synthetic biology applications. The Genome Partitioner web tool can be accessed at https://christenlab.ethz.ch/GenomePartitioner.

  1. Genome Partitioner: A web tool for multi-level partitioning of large-scale DNA constructs for synthetic biology applications.

    Directory of Open Access Journals (Sweden)

    Matthias Christen

    Full Text Available Recent advances in lower-cost DNA synthesis techniques have enabled new innovations in the field of synthetic biology. Still, efficient design and higher-order assembly of genome-scale DNA constructs remains a labor-intensive process. Given the complexity, computer assisted design tools that fragment large DNA sequences into fabricable DNA blocks are needed to pave the way towards streamlined assembly of biological systems. Here, we present the Genome Partitioner software implemented as a web-based interface that permits multi-level partitioning of genome-scale DNA designs. Without the need for specialized computing skills, biologists can submit their DNA designs to a fully automated pipeline that generates the optimal retrosynthetic route for higher-order DNA assembly. To test the algorithm, we partitioned a 783 kb Caulobacter crescentus genome design. We validated the partitioning strategy by assembling a 20 kb test segment encompassing a difficult to synthesize DNA sequence. Successful assembly from 1 kb subblocks into the 20 kb segment highlights the effectiveness of the Genome Partitioner for reducing synthesis costs and timelines for higher-order DNA assembly. The Genome Partitioner is broadly applicable to translate DNA designs into ready to order sequences that can be assembled with standardized protocols, thus offering new opportunities to harness the diversity of microbial genomes for synthetic biology applications. The Genome Partitioner web tool can be accessed at https://christenlab.ethz.ch/GenomePartitioner.

  2. The study of genomic DNA adsorption and subsequent interactions using total internal reflection ellipsometry.

    Science.gov (United States)

    Nabok, Alexei; Tsargorodskaya, Anna; Davis, Frank; Higson, Séamus P J

    2007-10-31

    The adsorption of genomic DNA and subsequent interactions between adsorbed and solvated DNA was studied using a novel sensitive optical method of total internal reflection ellipsometry (TIRE), which combines spectroscopic ellipsometry with surface plasmon resonance (SPR). Single strands of DNA of two species of fish (herring and salmon) were electrostatically adsorbed on top of polyethylenimine films deposited upon gold coated glass slides. The ellipsometric spectra were recorded and data fitting utilized to extract optical parameters (thickness and refractive index) of adsorbed DNA layers. The further adsorption of single stranded DNA from an identical source, i.e. herring ss-DNA on herring ss-DNA or salmon ss-DNA on salmon ss-DNA, on the surface was observed to give rise to substantial film thickness increases at the surface of about 20-21 nm. Conversely adsorption of DNA from alternate species, i.e. salmon ss-DNA on herring ss-DNA or herring ss-DNA on salmon ss-DNA, yielded much smaller changes in thickness of 3-5 nm. AFM studies of the surface roughness of adsorbed layers were in line with the TIRE data.

  3. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  4. Quantification of trace-level DNA by real-time whole genome amplification.

    Science.gov (United States)

    Kang, Min-Jung; Yu, Hannah; Kim, Sook-Kyung; Park, Sang-Ryoul; Yang, Inchul

    2011-01-01

    Quantification of trace amounts of DNA is a challenge in analytical applications where the concentration of a target DNA is very low or only limited amounts of samples are available for analysis. PCR-based methods including real-time PCR are highly sensitive and widely used for quantification of low-level DNA samples. However, ordinary PCR methods require at least one copy of a specific gene sequence for amplification and may not work for a sub-genomic amount of DNA. We suggest a real-time whole genome amplification method adopting the degenerate oligonucleotide primed PCR (DOP-PCR) for quantification of sub-genomic amounts of DNA. This approach enabled quantification of sub-picogram amounts of DNA independently of their sequences. When the method was applied to the human placental DNA of which amount was accurately determined by inductively coupled plasma-optical emission spectroscopy (ICP-OES), an accurate and stable quantification capability for DNA samples ranging from 80 fg to 8 ng was obtained. In blind tests of laboratory-prepared DNA samples, measurement accuracies of 7.4%, -2.1%, and -13.9% with analytical precisions around 15% were achieved for 400-pg, 4-pg, and 400-fg DNA samples, respectively. A similar quantification capability was also observed for other DNA species from calf, E. coli, and lambda phage. Therefore, when provided with an appropriate standard DNA, the suggested real-time DOP-PCR method can be used as a universal method for quantification of trace amounts of DNA.

  5. Improved reproducibility in genome-wide DNA methylation analysis for PAXgene® fixed samples compared to restored FFPE DNA

    DEFF Research Database (Denmark)

    Andersen, Gitte Brinch; Hager, Henrik; Hansen, Lise Lotte

    2014-01-01

    Chip. Quantitative DNA methylation analysis demonstrated that the methylation profile in PAXgene-fixed tissues showed, in comparison with restored FFPE samples, a higher concordance with the profile detected in frozen samples. We demonstrate, for the first time, that DNA from PAXgene conserved tissue performs better......Formalin fixation has been the standard method for conservation of clinical specimens for decades. However, a major drawback is the high degradation of nucleic acids, which complicates its use in genome-wide analyses. Unbiased identification of biomarkers, however, requires genome-wide studies......, precluding the use of the valuable archives of specimens with long-term follow-up data. Therefore, restoration protocols for DNA from formalin-fixed and paraffin-embedded (FFPE) samples have been developed, although they are cost-intensive and time-consuming. An alternative to FFPE and snap...

  6. The Complete Mitochondrial DNA Sequence of Scenedesmus obliquus Reflects an Intermediate Stage in the Evolution of the Green Algal Mitochondrial Genome

    Science.gov (United States)

    Nedelcu, Aurora M.; Lee, Robert W.; Lemieux, Claude; Gray, Michael W.; Burger, Gertraud

    2000-01-01

    Two distinct mitochondrial genome types have been described among the green algal lineages investigated to date: a reduced–derived, Chlamydomonas-like type and an ancestral, Prototheca-like type. To determine if this unexpected dichotomy is real or is due to insufficient or biased sampling and to define trends in the evolution of the green algal mitochondrial genome, we sequenced and analyzed the mitochondrial DNA (mtDNA) of Scenedesmus obliquus. This genome is 42,919 bp in size and encodes 42 conserved genes (i.e., large and small subunit rRNA genes, 27 tRNA and 13 respiratory protein-coding genes), four additional free-standing open reading frames with no known homologs, and an intronic reading frame with endonuclease/maturase similarity. No 5S rRNA or ribosomal protein-coding genes have been identified in Scenedesmus mtDNA. The standard protein-coding genes feature a deviant genetic code characterized by the use of UAG (normally a stop codon) to specify leucine, and the unprecedented use of UCA (normally a serine codon) as a signal for termination of translation. The mitochondrial genome of Scenedesmus combines features of both green algal mitochondrial genome types: the presence of a more complex set of protein-coding and tRNA genes is shared with the ancestral type, whereas the lack of 5S rRNA and ribosomal protein-coding genes as well as the presence of fragmented and scrambled rRNA genes are shared with the reduced–derived type of mitochondrial genome organization. Furthermore, the gene content and the fragmentation pattern of the rRNA genes suggest that this genome represents an intermediate stage in the evolutionary process of mitochondrial genome streamlining in green algae. [The sequence data described in this paper have been submitted to the GenBank data library under accession no. AF204057.] PMID:10854413

  7. Kinetics of carboplatin-DNA binding in genomic DNA and bladder cancer cells as determined by accelerator mass spectrometry

    International Nuclear Information System (INIS)

    Hah, S S; Stivers, K M; Vere White, R; Henderson, P T

    2005-01-01

    Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [ 14 C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [ 14 C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 (micro)g of DNA. This sensitivity may allow the method to be used for clinical applications

  8. Kinetics of carboplatin-DNA binding in genomic DNA and bladder cancer cells as determined by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hah, S S; Stivers, K M; Vere White, R; Henderson, P T

    2005-12-29

    Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [{sup 14}C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [{sup 14}C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 {micro}g of DNA. This sensitivity may allow the method to be used for clinical applications.

  9. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  10. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  11. USE OF COMPETITIVE DNA HYBRIDIZATION TO IDENTIFY DIFFERENCES IN THE GENOMES OF TWO CLOSELY RELATED FECAL INDICATOR BACTERIA

    Science.gov (United States)

    Although recent technological advances in DNA sequencing and computational biology now allow scientists to compare entire microbial genomes, comparisons of closely related bacterial species and individual isolates by whole-genome sequencing approaches remains prohibitively expens...

  12. Studies on the Interaction between Zinc-Hydroxybenzoite Complex and Genomic DNA

    Directory of Open Access Journals (Sweden)

    Hacali Necefoglu

    2006-04-01

    Full Text Available Zinc-Hydroxybenzoite ([Zn (H206] (p-HO-C6H4COO22H20 complex which wassynthesized and characterized by instrumental methods and the DNA samples which hadbeen isolated from cattle were allowed to interact at 37 oC for different time periods. Theinteraction of genomic DNA with this complex has been followed by agarose gelelectrophoresis at 50 V for 2 h. When DNA samples were allowed to interact with this metalcomplex, it was found that band intensities changed with the concentrations of the complex.In the result of interaction between this complex and genomic DNA samples, it wasdetermined that the intensities of bands were changed at the different concentrations of thecomplex. The brightness of the bands was increased and mobility of the bands wasdecreased, indicating the occurrence of increased covalent binding of the metal complexwith DNA. In this study it was concluded that the damage effect of ascorbate was reducedby Zinc-Hydroxybenzoite.

  13. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    Science.gov (United States)

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  14. Accurate DNA assembly and genome engineering with optimized uracil excision cloning

    DEFF Research Database (Denmark)

    Cavaleiro, Mafalda; Kim, Se Hyeuk; Seppala, Susanna

    2015-01-01

    Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway that pro......Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway...... that produces β-carotene to optimize assembly junctions and the uracil excision protocol. By combining uracil excision cloning with a genomic integration technology, we demonstrate that up to six DNA fragments can be assembled in a one-tube reaction for direct genome integration with high accuracy, greatly...... facilitating the advanced engineering of robust cell factories....

  15. AID to overcome the limitations of genomic information by introducing somatic DNA alterations.

    Science.gov (United States)

    Honjo, Tasuku; Muramatsu, Masamichi; Nagaoka, Hitoshi; Kinoshita, Kazuo; Shinkura, Reiko

    2006-05-01

    The immune system has adopted somatic DNA alterations to overcome the limitations of the genomic information. Activation induced cytidine deaminase (AID) is an essential enzyme to regulate class switch recombination (CSR), somatic hypermutation (SHM) and gene conversion (GC) of the immunoglobulin gene. AID is known to be required for DNA cleavage of S regions in CSR and V regions in SHM. However, its molecular mechanism is a focus of extensive debate. RNA editing hypothesis postulates that AID edits yet unknown mRNA, to generate specific endonucleases for CSR and SHM. By contrast, DNA deamination hypothesis assumes that AID deaminates cytosine in DNA, followed by DNA cleavage by base excision repair enzymes. We summarize the basic knowledge for molecular mechanisms for CSR and SHM and then discuss the importance of AID not only in the immune regulation but also in the genome instability.

  16. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  17. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  18. Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.

    Directory of Open Access Journals (Sweden)

    Christine Couldrey

    Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.

  19. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  20. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  1. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    Science.gov (United States)

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  2. Transcription facilitated genome-wide recruitment of topoisomerase I and DNA gyrase.

    Science.gov (United States)

    Ahmed, Wareed; Sala, Claudia; Hegde, Shubhada R; Jha, Rajiv Kumar; Cole, Stewart T; Nagaraja, Valakunja

    2017-05-01

    Movement of the transcription machinery along a template alters DNA topology resulting in the accumulation of supercoils in DNA. The positive supercoils generated ahead of transcribing RNA polymerase (RNAP) and the negative supercoils accumulating behind impose severe topological constraints impeding transcription process. Previous studies have implied the role of topoisomerases in the removal of torsional stress and the maintenance of template topology but the in vivo interaction of functionally distinct topoisomerases with heterogeneous chromosomal territories is not deciphered. Moreover, how the transcription-induced supercoils influence the genome-wide recruitment of DNA topoisomerases remains to be explored in bacteria. Using ChIP-Seq, we show the genome-wide occupancy profile of both topoisomerase I and DNA gyrase in conjunction with RNAP in Mycobacterium tuberculosis taking advantage of minimal topoisomerase representation in the organism. The study unveils the first in vivo genome-wide interaction of both the topoisomerases with the genomic regions and establishes that transcription-induced supercoils govern their recruitment at genomic sites. Distribution profiles revealed co-localization of RNAP and the two topoisomerases on the active transcriptional units (TUs). At a given locus, topoisomerase I and DNA gyrase were localized behind and ahead of RNAP, respectively, correlating with the twin-supercoiled domains generated. The recruitment of topoisomerases was higher at the genomic loci with higher transcriptional activity and/or at regions under high torsional stress compared to silent genomic loci. Importantly, the occupancy of DNA gyrase, sole type II topoisomerase in Mtb, near the Ter domain of the Mtb chromosome validates its function as a decatenase.

  3. Proteins Encoded in Genomic Regions Associated with Immune-Mediated Disease Physically Interact and Suggest Underlying Biology

    Science.gov (United States)

    Rossin, Elizabeth J.; Lage, Kasper; Raychaudhuri, Soumya; Xavier, Ramnik J.; Tatar, Diana; Benita, Yair

    2011-01-01

    Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these risk variants. It has previously been observed that different genes harboring causal mutations for the same Mendelian disease often physically interact. We sought to evaluate the degree to which this is true of genes within strongly associated loci in complex disease. Using sets of loci defined in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein–protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more densely connected than chance expectation. To confirm biological relevance, we show that the components of the networks tend to be expressed in similar tissues relevant to the phenotypes in question, suggesting the network indicates common underlying processes perturbed by risk loci. Furthermore, we show that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non-immune traits to assess its applicability to complex traits in general. We find that genes in loci associated to height and lipid levels assemble into significantly connected networks but did not detect excess connectivity among Type 2 Diabetes (T2D) loci beyond chance. Taken together, our results constitute evidence that, for many of the complex diseases studied here, common genetic associations implicate regions encoding proteins that physically interact in a preferential manner, in

  4. Comparative Analysis of the Genomic DNA Isolation Methods on Inula sp. (Asteraceae

    Directory of Open Access Journals (Sweden)

    Emre SEVİNDİK

    2016-12-01

    Full Text Available Simple, fast, low-cost and high throughput protocols are required for DNA isolation of plant species. In this study, phenol chloroform isoamyl alcohol and commercial (Sigma DNA isolation kit methods were applied on some Inula species that belong to Asteraceae family. Genomic DNA amounts, A260, A280, A260/A230 and purity degrees (A260/A280 that were obtained through both methods were measured through electrophoresis and spectrophotometer. Additionally, PCR amplification was realized by primer pairs specific to nrDNA ITS, cpDNA ndhF (972F-1603R and trnL-F regions. Results showed that maximum genomic DNA in nanograms obtained by phenol chloroform isoamyl alcohol method. The study also revealed that I. macrocephala had the maximum DNA and I. heterolepis had the minimum DNA amount. A260/A280 purity degrees showed that the highest and lowest purity in gDNAs obtained through phenol-choloform isoamyl alcohol method were in I.aucheriana and I. salicina, respectively. The highest and lowest purity degrees of gDNAs obtained through commercial kit was observed in I. fragilis and I. macrocephala samples, respectively. PCR amplification results showed that while band profiles of each three regions (ITS, trnL-F and ndhF did not yield positive results in PCR amplifications using phenol-choloform isoamyl alcohol method; PCR band profiles obtained through commercial kit yielded positive results. As a result, it is fair to say that the relation of genomic DNA with PCR was found to be more efficient although the maximum amount of genomic DNA was obtained through phenol chloroform isoamyl alcohol method.

  5. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  6. Concentrating Genomic Length DNA in a Microfabricated Array

    DEFF Research Database (Denmark)

    Chen, Yu; Abrams, Ezra S.; Boles, T. Christian

    2015-01-01

    the DNA molecules to minimal coil size using polyethylene glycol (PEG) derived depletion forces. We map out the sweet spot, where concentration occurs, as a function of PEG concentration and flow speed using a combination of theoretical analysis and experiment. Purification of DNA from enzymatic reactions...

  7. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.

    1989-01-01

    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  8. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob

    2016-01-01

    Stored neonatal dried blood spot (DBS) samples from neonatal screening programmes are a valuable diagnostic and research resource. Combined with information from national health registries they can be used in population-based studies of genetic diseases. DNA extracted from neonatal DBSs can...... be amplified to obtain micrograms of an otherwise limited resource, referred to as whole-genome amplified DNA (wgaDNA). Here we investigate the robustness of exome sequencing of wgaDNA of neonatal DBS samples. We conducted three pilot studies of seven, eight and seven subjects, respectively. For each subject...... we analysed a neonatal DBS sample and corresponding adult whole-blood (WB) reference sample. Different DNA sample types were prepared for each of the subjects. Pilot 1: wgaDNA of 2x3.2mm neonatal DBSs (DBS_2x3.2) and raw DNA extract of the WB reference sample (WB_ref). Pilot 2: DBS_2x3.2, WB...

  9. Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems differentially distributed in Salmonella serotypes

    Directory of Open Access Journals (Sweden)

    Santiviago Carlos A

    2009-08-01

    Full Text Available Abstract Background The recently described Type VI Secretion System (T6SS represents a new paradigm of protein secretion in bacteria. A number of bioinformatic studies have been conducted to identify T6SS gene clusters in the available bacterial genome sequences. According to these studies, Salmonella harbors a unique T6SS encoded in the Salmonella Pathogenicity Island 6 (SPI-6. Since these studies only considered few Salmonella genomes, the present work aimed to identify novel T6SS loci by in silico analysis of every genome sequence of Salmonella available. Results The analysis of sequencing data from 44 completed or in progress Salmonella genome projects allowed the identification of 3 novel T6SS loci. These clusters are located in differentially-distributed genomic islands we designated SPI-19, SPI-20 and SPI-21, respectively. SPI-19 was identified in a subset of S. enterica serotypes including Dublin, Weltevreden, Agona, Gallinarum and Enteritidis. In the later, an internal deletion eliminated most of the island. On the other hand, SPI-20 and SPI-21 were restricted to S. enterica subspecies arizonae (IIIa serotype 62:z4,z23:-. Remarkably, SPI-21 encodes a VgrG protein containing a C-terminal extension similar to S-type pyocins of Pseudomonas aeruginosa. This is not only the first evolved VgrG described in Salmonella, but also the first evolved VgrG including a pyocin domain described so far in the literature. In addition, the data indicate that SPI-6 T6SS is widely distributed in S. enterica and absent in serotypes Enteritidis, Gallinarum, Agona, Javiana, Paratyphi B, Virchow, IIIa 62:z4,z23:- and IIIb 61:1,v:1,5,(7. Interestingly, while some serotypes harbor multiple T6SS (Dublin, Weltvreden and IIIa 62:z4,z23:- others do not encode for any (Enteritidis, Paratyphi B, Javiana, Virchow and IIIb 61:1,v:1,5,(7. Comparative and phylogenetic analyses indicate that the 4 T6SS loci in Salmonella have a distinct evolutionary history. Finally, we

  10. FSPP: A Tool for Genome-Wide Prediction of smORF-Encoded Peptides and Their Functions

    Directory of Open Access Journals (Sweden)

    Hui Li

    2018-04-01

    Full Text Available smORFs are small open reading frames of less than 100 codons. Recent low throughput experiments showed a lot of smORF-encoded peptides (SEPs played crucial rule in processes such as regulation of transcription or translation, transportation through membranes and the antimicrobial activity. In order to gather more functional SEPs, it is necessary to have access to genome-wide prediction tools to give profound directions for low throughput experiments. In this study, we put forward a functional smORF-encoded peptides predictor (FSPP which tended to predict authentic SEPs and their functions in a high throughput method. FSPP used the overlap of detected SEPs from Ribo-seq and mass spectrometry as target objects. With the expression data on transcription and translation levels, FSPP built two co-expression networks. Combing co-location relations, FSPP constructed a compound network and then annotated SEPs with functions of adjacent nodes. Tested on 38 sequenced samples of 5 human cell lines, FSPP successfully predicted 856 out of 960 annotated proteins. Interestingly, FSPP also highlighted 568 functional SEPs from these samples. After comparison, the roles predicted by FSPP were consistent with known functions. These results suggest that FSPP is a reliable tool for the identification of functional small peptides. FSPP source code can be acquired at https://www.bioinfo.org/FSPP.

  11. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  12. Enhancing Targeted Genomic DNA Editing in Chicken Cells Using the CRISPR/Cas9 System

    Science.gov (United States)

    Wang, Ling; Yang, Likai; Guo, Yijie; Du, Weili; Yin, Yajun; Zhang, Tao; Lu, Hongzhao

    2017-01-01

    The CRISPR/Cas9 system has enabled highly efficient genome targeted editing for various organisms. However, few studies have focused on CRISPR/Cas9 nuclease-mediated chicken genome editing compared with mammalian genomes. The current study combined CRISPR with yeast Rad52 (yRad52) to enhance targeted genomic DNA editing in chicken DF-1 cells. The efficiency of CRISPR/Cas9 nuclease-induced targeted mutations in the chicken genome was increased to 41.9% via the enrichment of the dual-reporter surrogate system. In addition, the combined effect of CRISPR nuclease and yRad52 dramatically increased the efficiency of the targeted substitution in the myostatin gene using 50-mer oligodeoxynucleotides (ssODN) as the donor DNA, resulting in a 36.7% editing efficiency after puromycin selection. Furthermore, based on the effect of yRad52, the frequency of exogenous gene integration in the chicken genome was more than 3-fold higher than that without yRad52. Collectively, these results suggest that ssODN is an ideal donor DNA for targeted substitution and that CRISPR/Cas9 combined with yRad52 significantly enhances chicken genome editing. These findings could be extensively applied in other organisms. PMID:28068387

  13. Study on the relationship between DNA-PKcs and genomic instability and hyper-radiosensitivity

    International Nuclear Information System (INIS)

    Yang Kang; Zhu Jiayun; Ding Nan; Li Junhong; Hu Wentao; Su Fengtao; He Jinpeng; Li Sha

    2010-01-01

    To investigate the relationship between DNA-PKcs and genome instability and hyper-radiosensitivity, human glioma cell lines M059K and M059J, as a model expressing wild-type DNA-PKcs and a model defective in DNA-PKcs activity, were exposed to low doses of X-rays. Cells survival fractions were assessed by colony-forming assay and Cytochalasin-B micronucleus assay was employed to detect the genomic instability happening in each single irradiated colony. It has been found that as the post-incubation time increased, M059K cells expressing wild-type DNA-PKcs exhibited low-dose hyper-radiosensitivity and showed a similar genomic instability after 0.2 Gy and 0.6 Gy irradiations, but the M059J cells lacking in DNA-PKcs didn't present low-dose hyper-radiosensitivity and showed a higher genomic instability of 0.6 Gy than that of 0.2 Gy. The results indicate that DNA-PKcs may act as one of the key factors that lead to low-dose hyper-radiosensitivity. (authors)

  14. FANCG knockout CHO cells display sensitivity to diverse DNA damaging agents and possible genomic instability

    International Nuclear Information System (INIS)

    Hinz, J.M.; Tebbs, R.S.; Yamada, N.A.; Salazar, E.P.; Kopf, V.L.; Thompson, L.H.

    2003-01-01

    Full text: The function of the proteins encoded by the genes responsible for the disease Fanconi anemia (FA) have not been elucidated. Several of these proteins (FancA, C, E, F, and G) form a complex in the nucleus, and cells deficient in any one of these proteins are sensitive to crosslinking agents, suggesting a possible role for these proteins in some aspect of DNA repair, chromosomal maintenance, or replication. We constructed a FancG knockout mutant (FGKO40) in CHO AA8 cells, as well as FancG-corrected FGKO40 cells (KO40BP6, which is a pool of six BAC-clone transformants). FGKO40 cells are sensitive to a wide variety of DNA damaging agents. Sensitivity to the cross-linking agents MMC (3x) and chloroethyl-nitrosourea (3x) does not exceed that of methyl methanesulfonate (MMS) (4x), methyl-nitrosourea (4x), or ethyl-nitrosourea (3x), or the purine analog 6-thioguanine (5x). Other agents show mild sensitivity in FGKO40 cells: ionizing radiation (1.2x), UV-C (1.5x), hydroxyurea (1.2x), camptothecin (1.2x), and excess thymidine (normal). The length of S phase was carefully measured by monitoring the progression of highly synchronous G1 cells obtained by centrifugal elutriation. FGKO40 cells traversed S phase normally but had a slightly longer G2 phase than parental cells. Treatment of synchronized G1 cells with MMS did not increase S phase in parental or mutant cells, but again G2 was slightly longer for FGKO40. Mutation rates were measured at the hrpt and aprt loci, where gene inactivation confers resistance to 6-thioguanine or 8-azaadenine, respectively. FGKO40 had a slightly reduced mutation rate for hprt mutants, suggesting reduced recovery of large deletions at this locus. Moreover, the rate of methotrexate resistance was elevated 2.5-fold in mutant cells compared to controls. Resistance to this drug is generally associated with amplification of the dhfr locus, suggesting FancG plays a role in this aspect of genome stability. We suggest that the defect in FGKO

  15. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability

    OpenAIRE

    Lambert, Muriel W

    2016-01-01

    Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...

  16. Genome Sizes in Hepatica Mill: (Ranunculaceae Show a Loss of DNA, Not a Gain, in Polyploids

    Directory of Open Access Journals (Sweden)

    B. J. M. Zonneveld

    2010-01-01

    , and a possible pentaploid. The somatic nuclear DNA contents (2C-value, as measured by flow cytometry with propidium iodide, were shown to range from 33 to 80 pg. The Asiatic and American species, often considered subspecies of H. nobilis, could be clearly distinguished from European H. nobilis. DNA content confirmed the close relationships in the Asiatic species, and these are here considered as subspecies of H. asiatica. Parents for the allotetraploid species could be suggested based on their nuclear DNA content. Contrary to the increase in genome size suggested earlier for Hepatica, a significant (6%–14% loss of nuclear DNA in the natural allopolyploids was found.

  17. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  18. DNA Data Bank of Japan at work on genome sequence data.

    Science.gov (United States)

    Tateno, Y; Fukami-Kobayashi, K; Miyazaki, S; Sugawara, H; Gojobori, T

    1998-01-01

    We at the DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp) have recently begun receiving, processing and releasing EST and genome sequence data submitted by various Japanese genome projects. The data include those for human, Arabidopsis thaliana, rice, nematode, Synechocystis sp. and Escherichia coli. Since the quantity of data is very large, we organized teams to conduct preliminary discussions with project teams about data submission and handling for release to the public. We also developed a mass submission tool to cope with a large quantity of data. In addition, to provide genome data on WWW, we developed a genome information system using Java. This system (http://mol.genes.nig.ac.jp/ecoli/) can in theory be used for any genome sequence data. These activities will facilitate processing of large quantities of EST and genome data.

  19. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  20. Genomic clone encoding the α chain of the OKM1, LFA-1, and platelet glycoprotein IIb-IIIa molecules

    International Nuclear Information System (INIS)

    Cosgrove, L.J.; Sandrin, M.S.; Rajasekariah, P.; McKenzie, I.F.C.

    1986-01-01

    LFA-1, an antigen involved in cytolytic T lymphocyte-mediated killing, and Mac-1, the receptor for complement component C3bi, constitute a family of structurally and functionally related cell surface glycoproteins involved in cellular interactions. In both mouse and man, Mac-1 (OKM1) and LFA-1 share a common 95-kDa β subunit but are distinguished by their α chains, which have different cellular distributions, apparent molecular masses (165 and 177 kDa, respectively), and peptide maps. The authors report the isolation of a genomic clone from a human genomic library that on transfection into mouse fibroblasts produced a molecule(s) reactive with monoclonal antibodies to OKM1, to LFA-1, and to platelet glycoprotein IIb-IIIa. This gene was cloned by several cycles of transfection of L cells with a human genomic library cloned in λ phase Charon 4A and subsequent rescue of the λ phage. Transfection with the purified recombinant λ DNA yielded a transfectant that expressed the three human α chains of OKM1, LFA-1, and glycoprotein IIb-IIIa, presumably in association with the murine β chain

  1. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  2. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  3. Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

    Science.gov (United States)

    Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

    2015-08-01

    Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

    Science.gov (United States)

    Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

    2018-03-01

    Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

  5. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa

    Directory of Open Access Journals (Sweden)

    Xu Yanhao

    2017-01-01

    Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.

  7. Functional interrogation of non-coding DNA through CRISPR genome editing.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

    2017-05-15

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Digital Droplet Multiple Displacement Amplification (ddMDA for Whole Genome Sequencing of Limited DNA Samples.

    Directory of Open Access Journals (Sweden)

    Minsoung Rhee

    Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.

  9. Extensive variation in the density and distribution of DNA polymorphism in sorghum genomes.

    Directory of Open Access Journals (Sweden)

    Joseph Evans

    Full Text Available Sorghum genotypes currently used for grain production in the United States were developed from African landraces that were imported starting in the mid-to-late 19(th century. Farmers and plant breeders selected genotypes for grain production with reduced plant height, early flowering, increased grain yield, adaptation to drought, and improved resistance to lodging, diseases and pests. DNA polymorphisms that distinguish three historically important grain sorghum genotypes, BTx623, BTx642 and Tx7000, were characterized by genome sequencing, genotyping by sequencing, genetic mapping, and pedigree-based haplotype analysis. The distribution and density of DNA polymorphisms in the sequenced genomes varied widely, in part because the lines were derived through breeding and selection from diverse Kafir, Durra, and Caudatum race accessions. Genomic DNA spanning dw1 (SBI-09 and dw3 (SBI-07 had identical haplotypes due to selection for reduced height. Lower SNP density in genes located in pericentromeric regions compared with genes located in euchromatic regions is consistent with background selection in these regions of low recombination. SNP density was higher in euchromatic DNA and varied >100-fold in contiguous intervals that spanned up to 300 Kbp. The localized variation in DNA polymorphism density occurred throughout euchromatic regions where recombination is elevated, however, polymorphism density was not correlated with gene density or DNA methylation. Overall, sorghum chromosomes contain distal euchromatic regions characterized by extensive, localized variation in DNA polymorphism density, and large pericentromeric regions of low gene density, diversity, and recombination.

  10. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  11. Evaluation of FTA ® paper for storage of oral meta-genomic DNA.

    Science.gov (United States)

    Foitzik, Magdalena; Stumpp, Sascha N; Grischke, Jasmin; Eberhard, Jörg; Stiesch, Meike

    2014-10-01

    The purpose of the present study was to evaluate the short-term storage of meta-genomic DNA from native oral biofilms on FTA(®) paper. Thirteen volunteers of both sexes received an acrylic splint for intraoral biofilm formation over a period of 48 hours. The biofilms were collected, resuspended in phosphate-buffered saline, and either stored on FTA(®) paper or directly processed by standard laboratory DNA extraction. The nucleic acid extraction efficiencies were evaluated by 16S rDNA targeted SSCP fingerprinting. The acquired banding pattern of FTA-derived meta-genomic DNA was compared to a standard DNA preparation protocol. Sensitivity and positive predictive values were calculated. The volunteers showed inter-individual differences in their bacterial species composition. A total of 200 bands were found for both methods and 85% of the banding patterns were equal, representing a sensitivity of 0.941 and a false-negative predictive value of 0.059. Meta-genomic DNA sampling, extraction, and adhesion using FTA(®) paper is a reliable method for storage of microbial DNA for a short period of time.

  12. A Network of Multi-Tasking Proteins at the DNA Replication Fork Preserves Genome Stability.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available To elucidate the network that maintains high fidelity genome replication, we have introduced two conditional mutant alleles of DNA2, an essential DNA replication gene, into each of the approximately 4,700 viable yeast deletion mutants and determined the fitness of the double mutants. Fifty-six DNA2-interacting genes were identified. Clustering analysis of genomic synthetic lethality profiles of each of 43 of the DNA2-interacting genes defines a network (consisting of 322 genes and 876 interactions whose topology provides clues as to how replication proteins coordinate regulation and repair to protect genome integrity. The results also shed new light on the functions of the query gene DNA2, which, despite many years of study, remain controversial, especially its proposed role in Okazaki fragment processing and the nature of its in vivo substrates. Because of the multifunctional nature of virtually all proteins at the replication fork, the meaning of any single genetic interaction is inherently ambiguous. The multiplexing nature of the current studies, however, combined with follow-up supporting experiments, reveals most if not all of the unique pathways requiring Dna2p. These include not only Okazaki fragment processing and DNA repair but also chromatin dynamics.

  13. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  14. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  16. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  17. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  18. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions......The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many......, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some...

  19. Analysis of the mycoplasma genome by recombinant DNA technology

    DEFF Research Database (Denmark)

    Christiansen, C; Frydenberg, Jane; Christiansen, G

    1984-01-01

    A library of DNA fragments from Mycoplasma sp. strain PG50 has been made in the vector pBR325. Analysis in Escherichia coli minicells of randomly picked clones from this library demonstrated that many plasmids can promote synthesis of mycoplasma protein in the E. coli genetic background. Screening....... The DNA sequence of 16S rRNA and the surrounding control regions has been determined....

  20. Optical Detection of Non-amplified Genomic DNA

    Science.gov (United States)

    Li, Di; Fan, Chunhai

    Nucleic acid sequences are unique to every living organisms including animals, plants and even bacteria and virus, which provide a practical molecular target for the identification and diagnosis of various diseases. DNA contains heterocyclic rings that has inherent optical absorbance at 260 nm, which is widely used to quantify single and double stranded DNA in biology. However, this simple quantification method could not differentiate sequences; therefore it is not suitable for sequence-specific analyte detection. In addition to a few exceptions such as chiral-related circular dichroism spectra, DNA hybridization does not produce significant changes in optical signals, thus an optical label is generally needed for sequence-specific DNA detection with optical means. During the last two decades, we have witnessed explosive progress in the area of optical DNA detection, especially with the help of simultaneously rapidly developed nanomaterials. In this chapter, we will summarize recent advances in optical DNA detection including colorimetric, fluorescent, luminescent, surface plasmon resonance (SPR) and Raman scattering assays. Challenges and problems remained to be addressed are also discussed.

  1. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Philippe Lashermes

    2016-09-01

    Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

  2. Highly efficient PCR assay to discriminate allelic DNA methylation status using whole genome amplification

    Directory of Open Access Journals (Sweden)

    Ito Takashi

    2011-06-01

    Full Text Available Abstract Background We previously developed a simple method termed HpaII-McrBC PCR (HM-PCR to discriminate allelic methylation status of the genomic sites of interest, and successfully applied it to a comprehensive analysis of CpG islands (CGIs on human chromosome 21q. However, HM-PCR requires 200 ng of genomic DNA to examine one target site, thereby precluding its application to such samples that are limited in quantity. Findings We developed HpaII-McrBC whole-genome-amplification PCR (HM-WGA-PCR that uses whole-genome-amplified DNA as the template. HM-WGA-PCR uses only 1/100th the genomic template material required for HM-PCR. Indeed, we successfully analyzed 147 CGIs by HM-WGA-PCR using only ~300 ng of DNA, whereas previous HM-PCR study had required ~30 μg. Furthermore, we confirmed that allelic methylation status revealed by HM-WGA-PCR is identical to that by HM-PCR in every case of the 147 CGIs tested, proving high consistency between the two methods. Conclusions HM-WGA-PCR would serve as a reliable alternative to HM-PCR in the analysis of allelic methylation status when the quantity of DNA available is limited.

  3. Genome-wide alterations of the DNA replication program during tumor progression

    Science.gov (United States)

    Arneodo, A.; Goldar, A.; Argoul, F.; Hyrien, O.; Audit, B.

    2016-08-01

    Oncogenic stress is a major driving force in the early stages of cancer development. Recent experimental findings reveal that, in precancerous lesions and cancers, activated oncogenes may induce stalling and dissociation of DNA replication forks resulting in DNA damage. Replication timing is emerging as an important epigenetic feature that recapitulates several genomic, epigenetic and functional specificities of even closely related cell types. There is increasing evidence that chromosome rearrangements, the hallmark of many cancer genomes, are intimately associated with the DNA replication program and that epigenetic replication timing changes often precede chromosomic rearrangements. The recent development of a novel methodology to map replication fork polarity using deep sequencing of Okazaki fragments has provided new and complementary genome-wide replication profiling data. We review the results of a wavelet-based multi-scale analysis of genomic and epigenetic data including replication profiles along human chromosomes. These results provide new insight into the spatio-temporal replication program and its dynamics during differentiation. Here our goal is to bring to cancer research, the experimental protocols and computational methodologies for replication program profiling, and also the modeling of the spatio-temporal replication program. To illustrate our purpose, we report very preliminary results obtained for the chronic myelogeneous leukemia, the archetype model of cancer. Finally, we discuss promising perspectives on using genome-wide DNA replication profiling as a novel efficient tool for cancer diagnosis, prognosis and personalized treatment.

  4. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  5. Genomic signal processing methods for computation of alignment-free distances from DNA sequences.

    Science.gov (United States)

    Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro

    2014-01-01

    Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

  6. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  7. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  8. Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

    Science.gov (United States)

    Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

    2016-05-10

    Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

  9. DNA end resection by CtIP and exonuclease 1 prevents genomic instability

    DEFF Research Database (Denmark)

    Eid, Wassim; Steger, Martin; El-Shemerly, Mahmoud

    2010-01-01

    End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1). In this s......End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1...... of DNA-PK-dependent radial chromosome formation. Thus, our study identifies new functions of CtIP and EXO1 in DNA end resection and provides new information on the regulation of DSB repair pathways, which is a key factor in the maintenance of genome integrity....

  10. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  11. Automated genomic DNA purification options in agricultural applications using MagneSil paramagnetic particles

    Science.gov (United States)

    Bitner, Rex M.; Koller, Susan C.

    2002-06-01

    The automated high throughput purification of genomic DNA form plant materials can be performed using MagneSil paramagnetic particles on the Beckman-Coulter FX, BioMek 2000, and the Tecan Genesis robot. Similar automated methods are available for DNA purifications from animal blood. These methods eliminate organic extractions, lengthy incubations and cumbersome filter plates. The DNA is suitable for applications such as PCR and RAPD analysis. Methods are described for processing traditionally difficult samples such as those containing large amounts of polyphenolics or oils, while still maintaining a high level of DNA purity. The robotic protocols have ben optimized for agricultural applications such as marker assisted breeding, seed-quality testing, and SNP discovery and scoring. In addition to high yield purification of DNA from plant samples or animal blood, the use of Promega's DNA-IQ purification system is also described. This method allows for the purification of a narrow range of DNA regardless of the amount of additional DNA that is present in the initial sample. This simultaneous Isolation and Quantification of DNA allows the DNA to be used directly in applications such as PCR, SNP analysis, and RAPD, without the need for separate quantitation of the DNA.

  12. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    OpenAIRE

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it possible to map SCEs at orders-of-magnitude greater resolution than was previously possible. On average, murine embryonic stem (mES) cells exhibit eight SCEs, which are detected at a resolution of up...

  13. Universal Internucleotide Statistics in Full Genomes: A Footprint of the DNA Structure and Packaging?

    OpenAIRE

    Bogachev, Mikhail I.; Kayumov, Airat R.; Bunde, Armin

    2014-01-01

    Uncovering the fundamental laws that govern the complex DNA structural organization remains challenging and is largely based upon reconstructions from the primary nucleotide sequences. Here we investigate the distributions of the internucleotide intervals and their persistence properties in complete genomes of various organisms from Archaea and Bacteria to H. Sapiens aiming to reveal the manifestation of the universal DNA architecture. We find that in all considered organisms the internucleot...

  14. The pathological consequences of impaired genome integrity in humans; disorders of the DNA replication machinery.

    Science.gov (United States)

    O'Driscoll, Mark

    2017-01-01

    Accurate and efficient replication of the human genome occurs in the context of an array of constitutional barriers, including regional topological constraints imposed by chromatin architecture and processes such as transcription, catenation of the helical polymer and spontaneously generated DNA lesions, including base modifications and strand breaks. DNA replication is fundamentally important for tissue development and homeostasis; differentiation programmes are intimately linked with stem cell division. Unsurprisingly, impairments of the DNA replication machinery can have catastrophic consequences for genome stability and cell division. Functional impacts on DNA replication and genome stability have long been known to play roles in malignant transformation through a variety of complex mechanisms, and significant further insights have been gained from studying model organisms in this context. Congenital hypomorphic defects in components of the DNA replication machinery have been and continue to be identified in humans. These disorders present with a wide range of clinical features. Indeed, in some instances, different mutations in the same gene underlie different clinical presentations. Understanding the origin and molecular basis of these features opens a window onto the range of developmental impacts of suboptimal DNA replication and genome instability in humans. Here, I will briefly overview the basic steps involved in DNA replication and the key concepts that have emerged from this area of research, before switching emphasis to the pathological consequences of defects within the DNA replication network; the human disorders. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  15. Whole genomic DNA probe for detection of Porphyromonas endodontalis.

    Science.gov (United States)

    Nissan, R; Makkar, S R; Sela, M N; Stevens, R

    2000-04-01

    The purpose of the present study was to develop a DNA probe for Porphyromonas endodontalis. Pure cultures of P. endodontalis were grown in TYP medium, in an anaerobic chamber. DNA was extracted from the P. endodontalis and labeled using the Genius System by Boehringer Mannheim. The labeled P. endodontalis DNA was used in dot-blot hybridization reactions with homologous (P. endodontalis) and unrelated bacterial samples. To determine specificity, strains of 40 other oral bacterial species (e.g. Porphyromonas gingivalis, Porphyromonas asaccharolytica, and Prevotella intermedia) were spotted and reacted with the P. endodontalis DNA probe. None of the panel of 40 oral bacteria hybridized with the P. endodontalis probe, whereas the blot of the homologous organism showed a strong positive reaction. To determine the sensitivity of the probe, dilutions of a P. endodontalis suspension of known concentration were blotted onto a nylon membrane and reacted with the probe. The results of our investigation indicate that the DNA probe that we have prepared specifically detects only P. endodontalis and can detect at least 3 x 10(4) cells.

  16. Reconstruction of a Bacterial Genome from DNA Cassettes

    Energy Technology Data Exchange (ETDEWEB)

    Christopher Dupont; John Glass; Laura Sheahan; Shibu Yooseph; Lisa Zeigler Allen; Mathangi Thiagarajan; Andrew Allen; Robert Friedman; J. Craig Venter

    2011-12-31

    This basic research program comprised two major areas: (1) acquisition and analysis of marine microbial metagenomic data and development of genomic analysis tools for broad, external community use; (2) development of a minimal bacterial genome. Our Marine Metagenomic Diversity effort generated and analyzed shotgun sequencing data from microbial communities sampled from over 250 sites around the world. About 40% of the 26 Gbp of sequence data has been made publicly available to date with a complete release anticipated in six months. Our results and those mining the deposited data have revealed a vast diversity of genes coding for critical metabolic processes whose phylogenetic and geographic distributions will enable a deeper understanding of carbon and nutrient cycling, microbial ecology, and rapid rate evolutionary processes such as horizontal gene transfer by viruses and plasmids. A global assembly of the generated dataset resulted in a massive set (5Gbp) of genome fragments that provide context to the majority of the generated data that originated from uncultivated organisms. Our Synthetic Biology team has made significant progress towards the goal of synthesizing a minimal mycoplasma genome that will have all of the machinery for independent life. This project, once completed, will provide fundamentally new knowledge about requirements for microbial life and help to lay a basic research foundation for developing microbiological approaches to bioenergy.

  17. Sugar Cane Genome Numbers Assumption by Ribosomal DNA FISH Techniques

    NARCIS (Netherlands)

    Thumjamras, S.; Jong, de H.; Iamtham, S.; Prammanee, S.

    2013-01-01

    Conventional cytological method is limited for polyploidy plant genome study, especially sugar cane chromosomes that show unstable numbers of each cultivar. Molecular cytogenetic as fluorescent in situ hybridization (FISH) techniques were used in this study. A basic chromosome number of sugar cane

  18. Ascaris phylogeny based on multiple whole mtDNA genomes

    DEFF Research Database (Denmark)

    Nejsum, Peter; Hawash, Mohamed B F; Betson, Martha

    2016-01-01

    and C) of human and pig Ascaris based on partial cox1 sequences. In the present study, we selected major haplotypes from these different clusters to characterize their whole mitochondrial genomes for phylogenetic analysis. We also undertook coalescent simulations to investigate the evolutionary history...

  19. Genomes of rumen bacteria encode atypical pathways for fermenting hexoses to short-chain fatty acids.

    Science.gov (United States)

    Hackmann, Timothy J; Ngugi, David Kamanda; Firkins, Jeffrey L; Tao, Junyi

    2017-11-01

    Bacteria have been thought to follow only a few well-recognized biochemical pathways when fermenting glucose or other hexoses. These pathways have been chiseled in the stone of textbooks for decades, with most sources rendering them as they appear in the classic 1986 text by Gottschalk. Still, it is unclear how broadly these pathways apply, given that they were established and delineated biochemically with only a few model organisms. Here, we show that well-recognized pathways often cannot explain fermentation products formed by bacteria. In the most extensive analysis of its kind, we reconstructed pathways for glucose fermentation from genomes of 48 species and subspecies of bacteria from one environment (the rumen). In total, 44% of these bacteria had atypical pathways, including several that are completely unprecedented for bacteria or any organism. In detail, 8% of bacteria had an atypical pathway for acetate formation; 21% of bacteria had an atypical pathway for propionate or succinate formation; 6% of bacteria had an atypical pathway for butyrate formation and 33% of bacteria had an atypical or incomplete Embden-Meyerhof-Parnas pathway. This study shows that reconstruction of metabolic pathways - a common goal of omics studies - could be incorrect if well-recognized pathways are used for reference. Furthermore, it calls for renewed efforts to delineate fermentation pathways biochemically. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Genomes of rumen bacteria encode atypical pathways for fermenting hexoses to short-chain fatty acids

    KAUST Repository

    Hackmann, Timothy J.

    2017-09-11

    Bacteria have been thought to follow only a few well-recognized biochemical pathways when fermenting glucose or other hexoses. These pathways have been chiseled in the stone of textbooks for decades, with most sources rendering them as they appear in the classic 1986 text by Gottschalk. Still, it is unclear how broadly these pathways apply, given that they were established and delineated biochemically with only a few model organisms. Here we show that well-recognized pathways often cannot explain fermentation products formed by bacteria. In the most extensive analysis of its kind, we reconstructed pathways for glucose fermentation from genomes of 48 species and subspecies of bacteria from one environment (the rumen). In total, 44% of these bacteria had atypical pathways, including several that are completely unprecedented for bacteria or any organism. In detail, 8% of bacteria had an atypical pathway for acetate formation; 21% for propionate or succinate formation; 6% for butyrate formation; and 33% had an atypical or incomplete Embden-Meyerhof-Parnas pathway. This study shows that reconstruction of metabolic pathways-a common goal of omics studies-could be incorrect if well-recognized pathways are used for reference. Further, it calls for renewed efforts to delineate fermentation pathways biochemically. This article is protected by copyright. All rights reserved.

  1. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  2. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  3. Guardians of the mycobacterial genome: A review on DNA repair systems in Mycobacterium tuberculosis.

    Science.gov (United States)

    Singh, Amandeep

    2017-12-01

    The genomic integrity of Mycobacterium tuberculosis is continuously threatened by the harsh survival conditions inside host macrophages, due to immune and antibiotic stresses. Faithful genome maintenance and repair must be accomplished under stress for the bacillus to survive in the host, necessitating a robust DNA repair system. The importance of DNA repair systems in pathogenesis is well established. Previous examination of the M. tuberculosis genome revealed homologues of almost all the major DNA repair systems, i.e. nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR) and non-homologous end joining (NHEJ). However, recent developments in the field have pointed to the presence of novel proteins and pathways in mycobacteria. Homologues of archeal mismatch repair proteins were recently reported in mycobacteria, a pathway previously thought to be absent. RecBCD, the major nuclease-helicase enzymes involved in HR in E. coli, were implicated in the single-strand annealing (SSA) pathway. Novel roles of archeo-eukaryotic primase (AEP) polymerases, previously thought to be exclusive to NHEJ, have been reported in BER. Many new proteins with a probable role in DNA repair have also been discovered. It is now realized that the DNA repair systems in M. tuberculosis are highly evolved and have redundant backup mechanisms to mend the damage. This review is an attempt to summarize our current understanding of the DNA repair systems in M. tuberculosis.

  4. Quality assessment of buccal versus blood genomic DNA using the Affymetrix 500 K GeneChip

    Directory of Open Access Journals (Sweden)

    Martin Lisa J

    2007-11-01

    Full Text Available Abstract Background With the advent of genome-wide genotyping, the utility of stored buccal brushes for DNA extraction and genotyping has been questioned. We sought to describe the genomic DNA yield and concordance between stored buccal brushes and blood samples from the same individuals in the context of Affymetrix 500 K Human GeneChip genotyping. Results Buccal cytobrushes stored for ~7 years at -80°C prior to extraction yielded sufficient double stranded DNA (dsDNA to be successfully genotyped on the Affymetrix ~262 K NspI chip, with yields between 536 and 1047 ng dsDNA. Using the BRLMM algorithm, genotyping call rates for blood samples averaged 98.4%, and for buccal samples averaged 97.8%. Matched blood samples exhibited 99.2% concordance, while matched blood and buccal samples exhibited 98.8% concordance. Conclusion Buccal cytobrushes stored long-term result in sufficient dsDNA concentrations to achieve high genotyping call rates and concordance with stored blood samples in the context of Affymetrix 500 K SNP genotyping. Thus, given high-quality collection and storage protocols, it is possible to use stored buccal cytobrush samples for genome-wide association studies.

  5. Detection of extracellular genomic DNA scaffold in human thrombus

    DEFF Research Database (Denmark)

    Oklu, Rahmi; Albadawi, Hassan; Watkins, Michael T

    2012-01-01

    into thrombus remodeling. MATERIALS AND METHODS: Ten human thrombus samples were collected during cases of thrombectomy and open surgical repair of abdominal aortic aneurysms (five samples 1 y old). Additionally, an acute murine hindlimb ischemia model was created to evaluate...... thrombus samples in mice. Human sections were immunostained for the H2A/H2B/DNA complex, myeloperoxidase, fibrinogen, and von Willebrand factor. Mouse sections were immunostained with the H2A antibody. All samples were further evaluated after hematoxylin and eosin and Masson trichrome staining. RESULTS......: An extensive network of extracellular histone/DNA complex was demonstrated in the matrix of human ex vivo thrombus. This network is present throughout the highly cellular acute thrombus. However, in chronic thrombi, detection of the histone/DNA network was predominantly in regions of low collagen content...

  6. Genome-wide association between DNA methylation and alternative splicing in an invertebrate

    Directory of Open Access Journals (Sweden)

    Flores Kevin

    2012-09-01

    Full Text Available Abstract Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee and Nasonia vitripennis (jewel wasp analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice

  7. Hybrid and rogue kinases encoded in the genomes of model eukaryotes.

    Directory of Open Access Journals (Sweden)

    Ramaswamy Rakshambikai

    Full Text Available The highly modular nature of protein kinases generates diverse functional roles mediated by evolutionary events such as domain recombination, insertion and deletion of domains. Usually domain architecture of a kinase is related to the subfamily to which the kinase catalytic domain belongs. However outlier kinases with unusual domain architectures serve in the expansion of the functional space of the protein kinase family. For example, Src kinases are made-up of SH2 and SH3 domains in addition to the kinase catalytic domain. A kinase which lacks these two domains but retains sequence characteristics within the kinase catalytic domain is an outlier that is likely to have modes of regulation different from classical src kinases. This study defines two types of outlier kinases: hybrids and rogues depending on the nature of domain recombination. Hybrid kinases are those where the catalytic kinase domain belongs to a kinase subfamily but the domain architecture is typical of another kinase subfamily. Rogue kinases are those with kinase catalytic domain characteristic of a kinase subfamily but the domain architecture is typical of neither that subfamily nor any other kinase subfamily. This report provides a consolidated set of such hybrid and rogue kinases gleaned from six eukaryotic genomes-S.cerevisiae, D. melanogaster, C.elegans, M.musculus, T.rubripes and H.sapiens-and discusses their functions. The presence of such kinases necessitates a revisiting of the classification scheme of the protein kinase family using full length sequences apart from classical classification using solely the sequences of kinase catalytic domains. The study of these kinases provides a good insight in engineering signalling pathways for a desired output. Lastly, identification of hybrids and rogues in pathogenic protozoa such as P.falciparum sheds light on possible strategies in host-pathogen interactions.

  8. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    Science.gov (United States)

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. A Legionella pneumophila effector protein encoded in a region of genomic plasticity binds to Dot/Icm-modified vacuoles.

    Directory of Open Access Journals (Sweden)

    Shira Ninio

    2009-01-01

    Full Text Available Legionella pneumophila is an opportunistic pathogen that can cause a severe pneumonia called Legionnaires' disease. In the environment, L. pneumophila is found in fresh water reservoirs in a large spectrum of environmental conditions, where the bacteria are able to replicate within a variety of protozoan hosts. To survive within eukaryotic cells, L. pneumophila require a type IV secretion system, designated Dot/Icm, that delivers bacterial effector proteins into the host cell cytoplasm. In recent years, a number of Dot/Icm substrate proteins have been identified; however, the function of most of these proteins remains unknown, and it is unclear why the bacterium maintains such a large repertoire of effectors to promote its survival. Here we investigate a region of the L. pneumophila chromosome that displays a high degree of plasticity among four sequenced L. pneumophila strains. Analysis of GC content suggests that several genes encoded in this region were acquired through horizontal gene transfer. Protein translocation studies establish that this region of genomic plasticity encodes for multiple Dot/Icm effectors. Ectopic expression studies in mammalian cells indicate that one of these substrates, a protein called PieA, has unique effector activities. PieA is an effector that can alter lysosome morphology and associates specifically with vacuoles that support L. pneumophila replication. It was determined that the association of PieA with vacuoles containing L. pneumophila requires modifications to the vacuole mediated by other Dot/Icm effectors. Thus, the localization properties of PieA reveal that the Dot/Icm system has the ability to spatially and temporally control the association of an effector with vacuoles containing L. pneumophila through activities mediated by other effector proteins.

  10. Links between DNA methylation and nucleosome occupancy in the human genome.

    Science.gov (United States)

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  11. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Administrator

    2011-09-21

    Sep 21, 2011 ... *DNA diluted a thousand times to measure OD. silkworms are raised .... using gel extraction kit (Hi Media) and cloned into pGEMT easy vector (Promega) ..... Laboratory Press, Cold Spring Harbor, New York. Sharma J, Yadav ...

  12. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  13. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    SERVER

    2008-03-04

    Mar 4, 2008 ... Full Length Research Paper. Leaf storage ... 2006; Chen and Yang, 2004; Nan et al., 2003; Ipek and. Madison, 2001 ... the same function of pure DNA isolation. These are .... eppendorf tube and then dropped in liquid nitrogen for 2 min. The weighed ..... the solubility of polysaccharides in ethanol, effectively.

  14. Susceptibilities to DNA Structural Transitions within Eukaryotic Genomes

    Science.gov (United States)

    Zhabinskaya, Dina; Benham, Craig; Madden, Sally

    2012-02-01

    We analyze the competitive transitions to alternate secondary DNA structures in a negatively supercoiled DNA molecule of kilobase length and specified base sequence. We use statistical mechanics to calculate the competition among all regions within the sequence that are susceptible to transitions to alternate structures. We use an approximate numerical method since the calculation of an exact partition function is numerically cumbersome for DNA molecules of lengths longer than hundreds of base pairs. This method yields accurate results in reasonable computational times. We implement algorithms that calculate the competition between transitions to denatured states and to Z-form DNA. We analyze these transitions near the transcription start sites (TSS) of a set of eukaryotic genes. We find an enhancement of Z-forming regions upstream of the TSS and a depletion of denatured regions around the start sites. We confirm that these finding are statistically significant by comparing our results to a set of randomized genes with preserved base composition at each position relative to the gene start sites. When we study the correlation of these transitions in orthologous mouse and human genes we find a clear evolutionary conservation of both types of transitions around the TSS.

  15. Human β satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA

    International Nuclear Information System (INIS)

    Waye, J.S.; Willard, H.F.

    1989-01-01

    The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes

  16. Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

    Science.gov (United States)

    Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

    1995-07-01

    Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

  17. Draft genome sequence of an elite Dura palm and whole-genome patterns of DNA variation in oil palm.

    Science.gov (United States)

    Jin, Jingjing; Lee, May; Bai, Bin; Sun, Yanwei; Qu, Jing; Rahmadsyah; Alfiko, Yuzer; Lim, Chin Huat; Suwanto, Antonius; Sugiharti, Maria; Wong, Limsoon; Ye, Jian; Chua, Nam-Hai; Yue, Gen Hua

    2016-12-01

    Oil palm is the world's leading source of vegetable oil and fat. Dura, Pisifera and Tenera are three forms of oil palm. The genome sequence of Pisifera is available whereas the Dura form has not been sequenced yet. We sequenced the genome of one elite Dura palm, and re-sequenced 17 palm genomes. The assemble genome sequence of the elite Dura tree contained 10,971 scaffolds and was 1.701 Gb in length, covering 94.49% of the oil palm genome. 36,105 genes were predicted. Re-sequencing of 17 additional palm trees identified 18.1 million SNPs. We found high genetic variation among palms from different geographical regions, but lower variation among Southeast Asian Dura and Pisifera palms. We mapped 10,000 SNPs on the linkage map of oil palm. In addition, high linkage disequilibrium (LD) was detected in the oil palms used in breeding populations of Southeast Asia, suggesting that LD mapping is likely to be practical in this important oil crop. Our data provide a valuable resource for accelerating genetic improvement and studying the mechanism underlying phenotypic variations of important oil palm traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  19. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  20. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  1. The complete chloroplast genome sequence of the chlorophycean green alga Scenedesmus obliquus reveals a compact gene organization and a biased distribution of genes on the two DNA strands

    Science.gov (United States)

    de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique

    2006-01-01

    Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ

  2. Hepatitis A virus-encoded miRNAs attenuate the accumulation of viral genomic RNAs in infected cells.

    Science.gov (United States)

    Shi, Jiandong; Sun, Jing; Wu, Meini; Hu, Ningzhu; Hu, Yunzhang

    2016-06-01

    The establishment of persistent infection with hepatitis A virus (HAV) is the common result of most HAV/cell culture systems. Previous observations show that the synthesis of viral RNAs is reduced during infection. However, the underlying mechanism is poorly understood. We characterized three HAV-encoded miRNAs in our previous study. In this study, we aim to investigate the impact of these miRNAs on the accumulation of viral RNAs. The results indicated that the synthesis of viral genomic RNAs was dramatically reduced (more than 75 % reduction, P viral miRNA mimics. Conversely, they were significantly increased (more than 3.3-fold addition, P viral miRNA inhibitors. The luciferase reporter assay of miRNA targets showed that viral miRNAs were fully complementary to specific sites of the viral plus or minus strand RNA and strongly inhibited their expressions. Further data showed that the relative abundance of viral genomic RNA fragments that contain miRNA targets was also dramatically reduced (more than 80 % reduction, P viral miRNAs were overexpressed with miRNA mimics. In contrast, they were significantly increased (approximately 2-fold addition, P viral miRNAs were inhibited with miRNA inhibitors. In conclusion, these data suggest a possible mechanism for the reduction of viral RNA synthesis during HAV infection. Thus, we propose that it is likely that RNA virus-derived miRNA could serve as a self-mediated feedback regulator during infection.

  3. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  4. Myeloperoxidase-produced Genomic DNA-centered Radicals and Protection by Resveratrol

    Science.gov (United States)

    Myeloperoxidase (MPO) released by activated neutrophils, production of hypochlorous acid (HOCI) and oxidation of the genomic DNA in epithelial cells is thought to initiate and promote carcinogenesis. In this study we applied the 5,5-dimethyl-l-pyrroline N-oxide (DMPO)-based i;nmu...

  5. Genomic and functional integrity of the hematopoietic system requires tolerance of oxidative DNA lesions

    DEFF Research Database (Denmark)

    Martín-Pardillos, Ana; Tsaalbi-Shtylik, Anastasia; Chen, Si

    2017-01-01

    -distorting nucleotide lesions, resulted in the perinatal loss of hematopoietic stem cells, progressive loss of bone marrow, and fatal aplastic anemia between 3 and 4 months of age. This was associated with replication stress, genomic breaks, DNA damage signaling, senescence, and apoptosis in bone marrow. Surprisingly...

  6. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  7. Shotgun Bisulfite Sequencing of the Betula platyphylla Genome Reveals the Tree’s DNA Methylation Patterning

    Directory of Open Access Journals (Sweden)

    Chang Su

    2014-12-01

    Full Text Available DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees.

  8. Genome-wide tracking of unmethylated DNA Alu repeats in normal and cancer cells

    DEFF Research Database (Denmark)

    Rodriguez, Jairo; Vives, Laura; Jordà, Mireia

    2008-01-01

    Methylation of the cytosine is the most frequent epigenetic modification of DNA in mammalian cells. In humans, most of the methylated cytosines are found in CpG-rich sequences within tandem and interspersed repeats that make up to 45% of the human genome, being Alu repeats the most common family....

  9. The levels of yield and purity of genomic DNA from five tomato ...

    African Journals Online (AJOL)

    Isolation of good quality genomic DNA from different plant materials is an important prerequisite for many molecular techniques related to both basic and applied research in the areas of plant molecular biology, crop improvement, biodiversity studies and conservation of genetic materials. Therefore, the need to extract ...

  10. DNA Breaks and End Resection Measured Genome-wide by End Sequencing.

    Science.gov (United States)

    Canela, Andres; Sridharan, Sriram; Sciascia, Nicholas; Tubbs, Anthony; Meltzer, Paul; Sleckman, Barry P; Nussenzweig, André

    2016-09-01

    DNA double-strand breaks (DSBs) arise during physiological transcription, DNA replication, and antigen receptor diversification. Mistargeting or misprocessing of DSBs can result in pathological structural variation and mutation. Here we describe a sensitive method (END-seq) to monitor DNA end resection and DSBs genome-wide at base-pair resolution in vivo. We utilized END-seq to determine the frequency and spectrum of restriction-enzyme-, zinc-finger-nuclease-, and RAG-induced DSBs. Beyond sequence preference, chromatin features dictate the repertoire of these genome-modifying enzymes. END-seq can detect at least one DSB per cell among 10,000 cells not harboring DSBs, and we estimate that up to one out of 60 cells contains off-target RAG cleavage. In addition to site-specific cleavage, we detect DSBs distributed over extended regions during immunoglobulin class-switch recombination. Thus, END-seq provides a snapshot of DNA ends genome-wide, which can be utilized for understanding genome-editing specificities and the influence of chromatin on DSB pathway choice. Published by Elsevier Inc.

  11. Alignment of Escherichia coli K12 DNA sequences to a genomic restriction map.

    Science.gov (United States)

    Rudd, K E; Miller, W; Ostell, J; Benson, D A

    1990-01-25

    We use the extensive published information describing the genome of Escherichia coli and new restriction map alignment software to align DNA sequence, genetic, and physical maps. Restriction map alignment software is used which considers restriction maps as strings analogous to DNA or protein sequences except that two values, enzyme name and DNA base address, are associated with each position on the string. The resulting alignments reveal a nearly linear relationship between the physical and genetic maps of the E. coli chromosome. Physical map comparisons with the 1976, 1980, and 1983 genetic maps demonstrate a better fit with the more recent maps. The results of these alignments are genomic kilobase coordinates, orientation and rank of the alignment that best fits the genetic data. A statistical measure based on extreme value distribution is applied to the alignments. Additional computer analyses allow us to estimate the accuracy of the published E. coli genomic restriction map, simulate rearrangements of the bacterial chromosome, and search for repetitive DNA. The procedures we used are general enough to be applicable to other genome mapping projects.

  12. Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

    Directory of Open Access Journals (Sweden)

    Jenny van Dongen

    2014-05-01

    Full Text Available DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment. We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19 using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs, compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins.

  13. Horizontal transfer of DNA from the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae)

    Science.gov (United States)

    Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron. Liston

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...

  14. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  15. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  16. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  17. Analysis of the giant genomes of Fritillaria (Liliaceae) indicates that a lack of DNA removal characterizes extreme expansions in genome size.

    Science.gov (United States)

    Kelly, Laura J; Renny-Byfield, Simon; Pellicer, Jaume; Macas, Jiří; Novák, Petr; Neumann, Pavel; Lysak, Martin A; Day, Peter D; Berger, Madeleine; Fay, Michael F; Nichols, Richard A; Leitch, Andrew R; Leitch, Ilia J

    2015-10-01

    Plants exhibit an extraordinary range of genome sizes, varying by > 2000-fold between the smallest and largest recorded values. In the absence of polyploidy, changes in the amount of repetitive DNA (transposable elements and tandem repeats) are primarily responsible for genome size differences between species. However, there is ongoing debate regarding the relative importance of amplification of repetitive DNA versus its deletion in governing genome size. Using data from 454 sequencing, we analysed the most repetitive fraction of some of the largest known genomes for diploid plant species, from members of Fritillaria. We revealed that genomic expansion has not resulted from the recent massive amplification of just a handful of repeat families, as shown in species with smaller genomes. Instead, the bulk of these immense genomes is composed of highly heterogeneous, relatively low-abundance repeat-derived DNA, supporting a scenario where amplified repeats continually accumulate due to infrequent DNA removal. Our results indicate that a lack of deletion and low turnover of repetitive DNA are major contributors to the evolution of extremely large genomes and show that their size cannot simply be accounted for by the activity of a small number of high-abundance repeat families. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  19. The complete chloroplast DNA sequence of the green alga Oltmannsiellopsis viridis reveals a distinctive quadripartite architecture in the chloroplast genome of early diverging ulvophytes

    Directory of Open Access Journals (Sweden)

    Lemieux Claude

    2006-02-01

    Full Text Available Abstract Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. The basal position of the Prasinophyceae has been well documented, but the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae is currently debated. The four complete chloroplast DNA (cpDNA sequences presently available for representatives of these classes have revealed extensive variability in overall structure, gene content, intron composition and gene order. The chloroplast genome of Pseudendoclonium (Ulvophyceae, in particular, is characterized by an atypical quadripartite architecture that deviates from the ancestral type by a large inverted repeat (IR featuring an inverted rRNA operon and a small single-copy (SSC region containing 14 genes normally found in the large single-copy (LSC region. To gain insights into the nature of the events that led to the reorganization of the chloroplast genome in the Ulvophyceae, we have determined the complete cpDNA sequence of Oltmannsiellopsis viridis, a representative of a distinct, early diverging lineage. Results The 151,933 bp IR-containing genome of Oltmannsiellopsis differs considerably from Pseudendoclonium and other chlorophyte cpDNAs in intron content and gene order, but shares close similarities with its ulvophyte homologue at the levels of quadripartite architecture, gene content and gene density. Oltmannsiellopsis cpDNA encodes 105 genes, contains five group I introns, and features many short dispersed repeats. As in Pseudendoclonium cpDNA, the rRNA genes in the IR are transcribed toward the single copy region featuring the genes typically found in the ancestral LSC region, and the opposite single copy region harbours genes characteristic of both the ancestral SSC and LSC regions. The 52 genes that were transferred from the ancestral LSC to SSC region include 12 of those observed in Pseudendoclonium cpDNA. Surprisingly, the overall gene organization of

  20. Identification of genes involved in DNA replication of the Autographa californica baculovirus

    NARCIS (Netherlands)

    Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.

    1994-01-01

    By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,

  1. Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

    Science.gov (United States)

    Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

    2018-03-27

    Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  3. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    Directory of Open Access Journals (Sweden)

    Padmavathy

    2012-02-01

    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  4. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells.

    Science.gov (United States)

    Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M

    2013-12-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.

  5. Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

    Science.gov (United States)

    Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

    2018-01-05

    Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Genetically contextual effects of smoking on genome wide DNA methylation.

    Science.gov (United States)

    Dogan, Meeshanthini V; Beach, Steven R H; Philibert, Robert A

    2017-09-01

    Smoking is the leading cause of death in the United States. It exerts its effects by increasing susceptibility to a variety of complex disorders among those who smoke, and if pregnant, to their unborn children. In prior efforts to understand the epigenetic mechanisms through which this increased vulnerability is conveyed, a number of investigators have conducted genome wide methylation analyses. Unfortunately, secondary to methodological limitations, these studies were unable to examine methylation in gene regions with significant amounts of genetic variation. Using genome wide genetic and epigenetic data from the Framingham Heart Study, we re-examined the relationship of smoking status to genome wide methylation status. When only methylation status is considered, smoking was significantly associated with differential methylation in 310 genes that map to a variety of biological process and cellular differentiation pathways. However, when SNP effects on the magnitude of smoking associated methylation changes are also considered, cis and trans-interaction effects were noted at a total of 266 and 4353 genes with no marked enrichment for any biological pathways. Furthermore, the SNP variation participating in the significant interaction effects is enriched for loci previously associated with complex medical illnesses. The enlarged scope of the methylome shown to be affected by smoking may better explicate the mediational pathways linking smoking with a myriad of smoking related complex syndromes. Additionally, these results strongly suggest that combined epigenetic and genetic data analyses may be critical for a more complete understanding of the relationship between environmental variables, such as smoking, and pathophysiological outcomes. © 2017 Wiley Periodicals, Inc.

  7. A novel rat genomic simple repeat DNA with RNA-homology shows triplex (H-DNA)-like structure and tissue-specific RNA expression

    International Nuclear Information System (INIS)

    Dey, Indranil; Rath, Pramod C.

    2005-01-01

    Mammalian genome contains a wide variety of repetitive DNA sequences of relatively unknown function. We report a novel 227 bp simple repeat DNA (3.3 DNA) with a d {(GA) 7 A (AG) 7 } dinucleotide mirror repeat from the rat (Rattus norvegicus) genome. 3.3 DNA showed 75-85% homology with several eukaryotic mRNAs due to (GA/CU) n dinucleotide repeats by nBlast search and a dispersed distribution in the rat genome by Southern blot hybridization with [ 32 P]3.3 DNA. The d {(GA) 7 A (AG) 7 } mirror repeat formed a triplex (H-DNA)-like structure in vitro. Two large RNAs of 9.1 and 7.5 kb were detected by [ 32 P]3.3 DNA in rat brain by Northern blot hybridization indicating expression of such simple sequence repeats at RNA level in vivo. Further, several cDNAs were isolated from a rat cDNA library by [ 32 P]3.3 DNA probe. Three such cDNAs showed tissue-specific RNA expression in rat. pRT 4.1 cDNA showed strong expression of a 2.39 kb RNA in brain and spleen, pRT 5.5 cDNA showed strong expression of a 2.8 kb RNA in brain and a 3.9 kb RNA in lungs, and pRT 11.4 cDNA showed weak expression of a 2.4 kb RNA in lungs. Thus, genomic simple sequence repeats containing d (GA/CT) n dinucleotides are transcriptionally expressed and regulated in rat tissues. Such d (GA/CT) n dinucleotide repeats may form structural elements (e.g., triplex) which may be sites for functional regulation of genomic coding sequences as well as RNAs. This may be a general function of such transcriptionally active simple sequence repeats widely dispersed in mammalian genome

  8. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

    Science.gov (United States)

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

    2009-07-01

    The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

  9. Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping

    Directory of Open Access Journals (Sweden)

    Maruoka Shuichiro

    2008-12-01

    Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models

  10. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  11. Inter-Fork Strand Annealing causes genomic deletions during the termination of DNA replication.

    Science.gov (United States)

    Morrow, Carl A; Nguyen, Michael O; Fower, Andrew; Wong, Io Nam; Osman, Fekret; Bryer, Claire; Whitby, Matthew C

    2017-06-06

    Problems that arise during DNA replication can drive genomic alterations that are instrumental in the development of cancers and many human genetic disorders. Replication fork barriers are a commonly encountered problem, which can cause fork collapse and act as hotspots for replication termination. Collapsed forks can be rescued by homologous recombination, which restarts replication. However, replication restart is relatively slow and, therefore, replication termination may frequently occur by an active fork converging on a collapsed fork. We find that this type of non-canonical fork convergence in fission yeast is prone to trigger deletions between repetitive DNA sequences via a mechanism we call Inter-Fork Strand Annealing (IFSA) that depends on the recombination proteins Rad52, Exo1 and Mus81, and is countered by the FANCM-related DNA helicase Fml1. Based on our findings, we propose that IFSA is a potential threat to genomic stability in eukaryotes.

  12. Genomic relations among 31 species of Mammillaria haworth (Cactaceae) using random amplified polymorphic DNA.

    Science.gov (United States)

    Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda

    2006-01-01

    Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.

  13. Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome

    Science.gov (United States)

    Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.

    2018-03-01

    The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.

  14. Ligation bias in illumina next-generation DNA libraries: implications for sequencing ancient genomes.

    Directory of Open Access Journals (Sweden)

    Andaine Seguin-Orlando

    Full Text Available Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.

  15. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  16. The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.

    Science.gov (United States)

    González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen

    2017-06-15

    Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site

  17. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Directory of Open Access Journals (Sweden)

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  18. Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses

    Science.gov (United States)

    Lee, Yan-Jiun; Dai, Nan; Walsh, Shannon E.; Müller, Stephanie; Fraser, Morgan E.; Kauffman, Kathryn M.; Guan, Chudi; Weigele, Peter R.

    2018-01-01

    Certain viruses of bacteria (bacteriophages) enzymatically hypermodify their DNA to protect their genetic material from host restriction endonuclease-mediated cleavage. Historically, it has been known that virion DNAs from the Delftia phage ΦW-14 and the Bacillus phage SP10 contain the hypermodified pyrimidines α-putrescinylthymidine and α-glutamylthymidine, respectively. These bases derive from the modification of 5-hydroxymethyl-2′-deoxyuridine (5-hmdU) in newly replicated phage DNA via a pyrophosphorylated intermediate. Like ΦW-14 and SP10, the Pseudomonas phage M6 and the Salmonella phage ViI encode kinase homologs predicted to phosphorylate 5-hmdU DNA but have uncharacterized nucleotide content [Iyer et al. (2013) Nucleic Acids Res 41:7635–7655]. We report here the discovery and characterization of two bases, 5-(2-aminoethoxy)methyluridine (5-NeOmdU) and 5-(2-aminoethyl)uridine (5-NedU), in the virion DNA of ViI and M6 phages, respectively. Furthermore, we show that recombinant expression of five gene products encoded by phage ViI is sufficient to reconstitute the formation of 5-NeOmdU in vitro. These findings point to an unexplored diversity of DNA modifications and the underlying biochemistry of their formation. PMID:29555775

  19. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Science.gov (United States)

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing

    2017-07-01

    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  1. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  2. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  3. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  4. The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli

    DEFF Research Database (Denmark)

    Cho, Suhyung; Cho, Yoo-Bok; Kang, Taek Jin

    2015-01-01

    DNA-binding motifs that are recognized by transcription factors (TFs) have been well studied; however, challenges remain in determining the in vivo architecture of TF-DNA complexes on a genome-scale. Here, we determined the in vivo architecture of Escherichia coli arginine repressor (ArgR)-DNA co...

  5. Comparison of microbial DNA enrichment tools for metagenomic whole genome sequencing.

    Science.gov (United States)

    Thoendel, Matthew; Jeraldo, Patricio R; Greenwood-Quaintance, Kerryl E; Yao, Janet Z; Chia, Nicholas; Hanssen, Arlen D; Abdel, Matthew P; Patel, Robin

    2016-08-01

    Metagenomic whole genome sequencing for detection of pathogens in clinical samples is an exciting new area for discovery and clinical testing. A major barrier to this approach is the overwhelming ratio of human to pathogen DNA in samples with low pathogen abundance, which is typical of most clinical specimens. Microbial DNA enrichment methods offer the potential to relieve this limitation by improving this ratio. Two commercially available enrichment kits, the NEBNext Microbiome DNA Enrichment Kit and the Molzym MolYsis Basic kit, were tested for their ability to enrich for microbial DNA from resected arthroplasty component sonicate fluids from prosthetic joint infections or uninfected sonicate fluids spiked with Staphylococcus aureus. Using spiked uninfected sonicate fluid there was a 6-fold enrichment of bacterial DNA with the NEBNext kit and 76-fold enrichment with the MolYsis kit. Metagenomic whole genome sequencing of sonicate fluid revealed 13- to 85-fold enrichment of bacterial DNA using the NEBNext enrichment kit. The MolYsis approach achieved 481- to 9580-fold enrichment, resulting in 7 to 59% of sequencing reads being from the pathogens known to be present in the samples. These results demonstrate the usefulness of these tools when testing clinical samples with low microbial burden using next generation sequencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  7. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  8. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  9. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  10. DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

    Science.gov (United States)

    Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

    2003-03-01

    We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

  11. Maintaining Genome Stability in Defiance of Mitotic DNA Damage

    Science.gov (United States)

    Ferrari, Stefano; Gentili, Christian

    2016-01-01

    The implementation of decisions affecting cell viability and proliferation is based on prompt detection of the issue to be addressed, formulation and transmission of a correct set of instructions and fidelity in the execution of orders. While the first and the last are purely mechanical processes relying on the faithful functioning of single proteins or macromolecular complexes (sensors and effectors), information is the real cue, with signal amplitude, duration, and frequency ultimately determining the type of response. The cellular response to DNA damage is no exception to the rule. In this review article we focus on DNA damage responses in G2 and Mitosis. First, we set the stage describing mitosis and the machineries in charge of assembling the apparatus responsible for chromosome alignment and segregation as well as the inputs that control its function (checkpoints). Next, we examine the type of issues that a cell approaching mitosis might face, presenting the impact of post-translational modifications (PTMs) on the correct and timely functioning of pathways correcting errors or damage before chromosome segregation. We conclude this essay with a perspective on the current status of mitotic signaling pathway inhibitors and their potential use in cancer therapy. PMID:27493659

  12. Links between persistent DNA damage, genome instability, and aging

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S. [Emory Univ., Atlanta, GA (United States). Dept. of Radiation Oncology

    2016-11-14

    The goal of this study was to examine long-term effects of low-dose radiation exposure. One of the hypotheses was that radiation exposure would accelerate the normal aging process. The study was jointly funded by NASA and examined both low-LET radiation (γ-rays) and high-LET radiation (1000 MeV/nucleon 56Fe ions) at doses of 0.1 Gy and up. The work used the Japanese medaka fish (Oryzias latipes), as a vertebrate model organism that can be maintained in large numbers at low cost for lifetime studies. Like other small laboratory fish, Japanese medaka share many anatomical and histological characteristics with other vertebrates, and a variety of genetic and genomic resources are available. Some work also used the zebrafish (Danio rerio), another widely used laboratory model organism.

  13. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks.

    Science.gov (United States)

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-22

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named "DeepMethyl" to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  14. Impact of nuclear organization and chromatin structure on DNA repair and genome stability

    International Nuclear Information System (INIS)

    Batte, Amandine

    2016-01-01

    The non-random organization of the eukaryotic cell nucleus and the folding of genome in chromatin more or less condensed can influence many functions related to DNA metabolism, including genome stability. Double-strand breaks (DSBs) are the most deleterious DNA damages for the cells. To preserve genome integrity, eukaryotic cells thus developed DSB repair mechanisms conserved from yeast to human, among which homologous recombination (HR) that uses an intact homologous sequence to repair a broken chromosome. HR can be separated in two sub-pathways: Gene Conversion (GC) transfers genetic information from one molecule to its homologous and Break Induced Replication (BIR) establishes a replication fork than can proceed until the chromosome end. My doctorate work was focused on the contribution of the chromatin context and 3D genome organization on DSB repair. In S. cerevisiae, nuclear organization and heterochromatin spreading at sub-telomeres can be modified through the overexpression of the Sir3 or sir3A2Q mutant proteins. We demonstrated that reducing the physical distance between homologous sequences increased GC rates, reinforcing the notion that homology search is a limiting step for recombination. We also showed that hetero-chromatinization of DSB site fine-tunes DSB resection, limiting the loss of the DSB ends required to perform homology search and complete HR. Finally, we noticed that the presence of heterochromatin at the donor locus decreased both GC and BIR efficiencies, probably by affecting strand invasion. This work highlights new regulatory pathways of DNA repair. (author) [fr

  15. Higher-Density Culture in Human Embryonic Stem Cells Results in DNA Damage and Genome Instability

    Directory of Open Access Journals (Sweden)

    Kurt Jacobs

    2016-03-01

    Full Text Available Human embryonic stem cells (hESC show great promise for clinical and research applications, but their well-known proneness to genomic instability hampers the development to their full potential. Here, we demonstrate that medium acidification linked to culture density is the main cause of DNA damage and genomic alterations in hESC grown on feeder layers, and this even in the short time span of a single passage. In line with this, we show that increasing the frequency of the medium refreshments minimizes the levels of DNA damage and genetic instability. Also, we show that cells cultured on laminin-521 do not present this increase in DNA damage when grown at high density, although the (long-term impact on their genomic stability remains to be elucidated. Our results explain the high levels of genome instability observed over the years by many laboratories worldwide, and show that the development of optimal culture conditions is key to solving this problem.

  16. Transcription Restores DNA Repair to Heterochromatin, Determining Regional Mutation Rates in Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Christina L. Zheng

    2014-11-01

    Full Text Available Somatic mutations in cancer are more frequent in heterochromatic and late-replicating regions of the genome. We report that regional disparities in mutation density are virtually abolished within transcriptionally silent genomic regions of cutaneous squamous cell carcinomas (cSCCs arising in an XPC−/− background. XPC−/− cells lack global genome nucleotide excision repair (GG-NER, thus establishing differential access of DNA repair machinery within chromatin-rich regions of the genome as the primary cause for the regional disparity. Strikingly, we find that increasing levels of transcription reduce mutation prevalence on both strands of gene bodies embedded within H3K9me3-dense regions, and only to those levels observed in H3K9me3-sparse regions, also in an XPC-dependent manner. Therefore, transcription appears to reduce mutation prevalence specifically by relieving the constraints imposed by chromatin structure on DNA repair. We model this relationship among transcription, chromatin state, and DNA repair, revealing a new, personalized determinant of cancer risk.

  17. Archaeal Genome Guardians Give Insights into Eukaryotic DNA Replication and Damage Response Proteins

    Directory of Open Access Journals (Sweden)

    David S. Shin

    2014-01-01

    Full Text Available As the third domain of life, archaea, like the eukarya and bacteria, must have robust DNA replication and repair complexes to ensure genome fidelity. Archaea moreover display a breadth of unique habitats and characteristics, and structural biologists increasingly appreciate these features. As archaea include extremophiles that can withstand diverse environmental stresses, they provide fundamental systems for understanding enzymes and pathways critical to genome integrity and stress responses. Such archaeal extremophiles provide critical data on the periodic table for life as well as on the biochemical, geochemical, and physical limitations to adaptive strategies allowing organisms to thrive under environmental stress relevant to determining the boundaries for life as we know it. Specifically, archaeal enzyme structures have informed the architecture and mechanisms of key DNA repair proteins and complexes. With added abilities to temperature-trap flexible complexes and reveal core domains of transient and dynamic complexes, these structures provide insights into mechanisms of maintaining genome integrity despite extreme environmental stress. The DNA damage response protein structures noted in this review therefore inform the basis for genome integrity in the face of environmental stress, with implications for all domains of life as well as for biomanufacturing, astrobiology, and medicine.

  18. Identification of the ``a'' Genome of Finger Millet Using Chloroplast DNA

    Science.gov (United States)

    Hilu, K. W.

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E. tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy. PMID:8608927