WorldWideScience

Sample records for genomic dna encoding

  1. Isolation of genomic DNA encoding transcription factor TFIID from Acanthamoeba castellanii: characterization of the promoter.

    Science.gov (United States)

    Wong, J M; Liu, F; Bateman, E

    1992-01-01

    We have isolated a genomic clone encoding Acanthamoeba castellanii TFIID. The clone contains the entire TFIID gene, 300 bp of 5' promoter sequences and several hundred base pairs of 3' non-coding sequence. The coding region is interrupted by two short introns, but is otherwise identical to Acanthamoeba TFIID cDNA. Comparisons between forty four Acanthamoeba intron 5' and 3' boundaries suggest a 5' splice site consensus of GTACG(T/C) and a 3' consensus of CAG. We determined the position of the transcription initiation site used in vivo, and show that the same site is used in vitro by homologous nuclear extracts. Deletion analysis of the promoter region shows that the minimal promoter required for efficient expression in vitro is located between -97 and +4 relative to the transcription start site. Three regions within the promoter are important for transcription in vitro; sequences between -97 and -35, the TATAAA box and the initiation region. The initiation region is dispensable but appears to position the transcription start site relative to the TATAAA box. The TATAAA box is absolutely required for transcription initiation whereas the upstream region stimulates transcription approximately five-fold. Images PMID:1408796

  2. An encyclopedia of mouse DNA elements (Mouse ENCODE).

    Science.gov (United States)

    Stamatoyannopoulos, John A; Snyder, Michael; Hardison, Ross; Ren, Bing; Gingeras, Thomas; Gilbert, David M; Groudine, Mark; Bender, Michael; Kaul, Rajinder; Canfield, Theresa; Giste, Erica; Johnson, Audra; Zhang, Mia; Balasundaram, Gayathri; Byron, Rachel; Roach, Vaughan; Sabo, Peter J; Sandstrom, Richard; Stehling, A Sandra; Thurman, Robert E; Weissman, Sherman M; Cayting, Philip; Hariharan, Manoj; Lian, Jin; Cheng, Yong; Landt, Stephen G; Ma, Zhihai; Wold, Barbara J; Dekker, Job; Crawford, Gregory E; Keller, Cheryl A; Wu, Weisheng; Morrissey, Christopher; Kumar, Swathi A; Mishra, Tejaswini; Jain, Deepti; Byrska-Bishop, Marta; Blankenberg, Daniel; Lajoie, Bryan R; Jain, Gaurav; Sanyal, Amartya; Chen, Kaun-Bei; Denas, Olgert; Taylor, James; Blobel, Gerd A; Weiss, Mitchell J; Pimkin, Max; Deng, Wulan; Marinov, Georgi K; Williams, Brian A; Fisher-Aylor, Katherine I; Desalvo, Gilberto; Kiralusha, Anthony; Trout, Diane; Amrhein, Henry; Mortazavi, Ali; Edsall, Lee; McCleary, David; Kuan, Samantha; Shen, Yin; Yue, Feng; Ye, Zhen; Davis, Carrie A; Zaleski, Chris; Jha, Sonali; Xue, Chenghai; Dobin, Alex; Lin, Wei; Fastuca, Meagan; Wang, Huaien; Guigo, Roderic; Djebali, Sarah; Lagarde, Julien; Ryba, Tyrone; Sasaki, Takayo; Malladi, Venkat S; Cline, Melissa S; Kirkup, Vanessa M; Learned, Katrina; Rosenbloom, Kate R; Kent, W James; Feingold, Elise A; Good, Peter J; Pazin, Michael; Lowdon, Rebecca F; Adams, Leslie B

    2012-08-13

    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome.

  3. ENCODE whole-genome data in the UCSC Genome Browser

    Science.gov (United States)

    Rosenbloom, Kate R.; Dreszer, Timothy R.; Pheasant, Michael; Barber, Galt P.; Meyer, Laurence R.; Pohl, Andy; Raney, Brian J.; Wang, Ting; Hinrichs, Angie S.; Zweig, Ann S.; Fujita, Pauline A.; Learned, Katrina; Rhead, Brooke; Smith, Kayla E.; Kuhn, Robert M.; Karolchik, Donna; Haussler, David; Kent, W. James

    2010-01-01

    The Encyclopedia of DNA Elements (ENCODE) project is an international consortium of investigators funded to analyze the human genome with the goal of producing a comprehensive catalog of functional elements. The ENCODE Data Coordination Center at The University of California, Santa Cruz (UCSC) is the primary repository for experimental results generated by ENCODE investigators. These results are captured in the UCSC Genome Bioinformatics database and download server for visualization and data mining via the UCSC Genome Browser and companion tools (Rhead et al. The UCSC Genome Browser Database: update 2010, in this issue). The ENCODE web portal at UCSC (http://encodeproject.org or http://genome.ucsc.edu/ENCODE) provides information about the ENCODE data and convenient links for access. PMID:19920125

  4. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  5. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    Science.gov (United States)

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  6. Characterization of Sinorhizobium sp. LM21 Prophages and Virus-Encoded DNA Methyltransferases in the Light of Comparative Genomic Analyses of the Sinorhizobial Virome

    Directory of Open Access Journals (Sweden)

    Przemyslaw Decewicz

    2017-06-01

    Full Text Available The genus Sinorhizobium/Ensifer mostly groups nitrogen-fixing bacteria that create root or stem nodules on leguminous plants and transform atmospheric nitrogen into ammonia, which improves the productivity of the plants. Although these biotechnologically-important bacteria are commonly found in various soil environments, little is known about their phages. In this study, the genome of Sinorhizobium sp. LM21 isolated from a heavy-metal-contaminated copper mine in Poland was investigated for the presence of prophages and DNA methyltransferase-encoding genes. In addition to the previously identified temperate phage, ΦLM21, and the phage-plasmid, pLM21S1, the analysis revealed the presence of three prophage regions. Moreover, four novel phage-encoded DNA methyltransferase (MTase genes were identified and the enzymes were characterized. It was shown that two of the identified viral MTases methylated the same target sequence (GANTC as cell cycle-regulated methyltransferase (CcrM of the bacterial host strain, LM21. This discovery was recognized as an example of the evolutionary convergence between enzymes of sinorhizobial viruses and their host, which may play an important role in virus cycle. In the last part of the study, thorough comparative analyses of 31 sinorhizobial (prophages (including active sinorhizobial phages and novel putative prophages retrieved and manually re-annotated from Sinorhizobium spp. genomes were performed. The networking analysis revealed the presence of highly conserved proteins (e.g., holins and endolysins and a high diversity of viral integrases. The analysis also revealed a large number of viral DNA MTases, whose genes were frequently located within the predicted replication modules of analyzed prophages, which may suggest their important regulatory role. Summarizing, complex analysis of the phage protein similarity network enabled a new insight into overall sinorhizobial virome diversity.

  7. A user's guide to the encyclopedia of DNA elements (ENCODE).

    Science.gov (United States)

    2011-04-01

    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

  8. [ENCODE apophenia or a panglossian analysis of the human genome].

    Science.gov (United States)

    Casane, Didier; Fumey, Julien; Laurenti, Patrick

    2015-01-01

    In September 2012, a batch of more than 30 articles presenting the results of the ENCODE (Encyclopaedia of DNA Elements) project was released. Many of these articles appeared in Nature and Science, the two most prestigious interdisciplinary scientific journals. Since that time, hundreds of other articles dedicated to the further analyses of the Encode data have been published. The time of hundreds of scientists and hundreds of millions of dollars were not invested in vain since this project had led to an apparent paradigm shift: contrary to the classical view, 80% of the human genome is not junk DNA, but is functional. This hypothesis has been criticized by evolutionary biologists, sometimes eagerly, and detailed refutations have been published in specialized journals with impact factors far below those that published the main contribution of the Encode project to our understanding of genome architecture. In 2014, the Encode consortium released a new batch of articles that neither suggested that 80% of the genome is functional nor commented on the disappearance of their 2012 scientific breakthrough. Unfortunately, by that time many biologists had accepted the idea that 80% of the genome is functional, or at least, that this idea is a valid alternative to the long held evolutionary genetic view that it is not. In order to understand the dynamics of the genome, it is necessary to re-examine the basics of evolutionary genetics because, not only are they well established, they also will allow us to avoid the pitfall of a panglossian interpretation of Encode. Actually, the architecture of the genome and its dynamics are the product of trade-offs between various evolutionary forces, and many structural features are not related to functional properties. In other words, evolution does not produce the best of all worlds, not even the best of all possible worlds, but only one possible world. © 2015 médecine/sciences – Inserm.

  9. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  10. ENCODE whole-genome data in the UCSC genome browser (2011 update)

    Science.gov (United States)

    Raney, Brian J.; Cline, Melissa S.; Rosenbloom, Kate R.; Dreszer, Timothy R.; Learned, Katrina; Barber, Galt P.; Meyer, Laurence R.; Sloan, Cricket A.; Malladi, Venkat S.; Roskin, Krishna M.; Suh, Bernard B.; Hinrichs, Angie S.; Clawson, Hiram; Zweig, Ann S.; Kirkup, Vanessa; Fujita, Pauline A.; Rhead, Brooke; Smith, Kayla E.; Pohl, Andy; Kuhn, Robert M.; Karolchik, Donna; Haussler, David; Kent, W. James

    2011-01-01

    The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access. PMID:21037257

  11. ENCODE whole-genome data in the UCSC Genome Browser: update 2012

    Science.gov (United States)

    Rosenbloom, Kate R.; Dreszer, Timothy R.; Long, Jeffrey C.; Malladi, Venkat S.; Sloan, Cricket A.; Raney, Brian J.; Cline, Melissa S.; Karolchik, Donna; Barber, Galt P.; Clawson, Hiram; Diekhans, Mark; Fujita, Pauline A.; Goldman, Mary; Gravell, Robert C.; Harte, Rachel A.; Hinrichs, Angie S.; Kirkup, Vanessa M.; Kuhn, Robert M.; Learned, Katrina; Maddren, Morgan; Meyer, Laurence R.; Pohl, Andy; Rhead, Brooke; Wong, Matthew C.; Zweig, Ann S.; Haussler, David; Kent, W. James

    2012-01-01

    The Encyclopedia of DNA Elements (ENCODE) Consortium is entering its 5th year of production-level effort generating high-quality whole-genome functional annotations of the human genome. The past year has brought the ENCODE compendium of functional elements to critical mass, with a diverse set of 27 biochemical assays now covering 200 distinct human cell types. Within the mouse genome, which has been under study by ENCODE groups for the past 2 years, 37 cell types have been assayed. Over 2000 individual experiments have been completed and submitted to the Data Coordination Center for public use. UCSC makes this data available on the quality-reviewed public Genome Browser (http://genome.ucsc.edu) and on an early-access Preview Browser (http://genome-preview.ucsc.edu). Visual browsing, data mining and download of raw and processed data files are all supported. An ENCODE portal (http://encodeproject.org) provides specialized tools and information about the ENCODE data sets. PMID:22075998

  12. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  13. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    Science.gov (United States)

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  14. Comparative genomics of Shiga toxin encoding bacteriophages

    Directory of Open Access Journals (Sweden)

    Smith Darren L

    2012-07-01

    Full Text Available Abstract Background Stx bacteriophages are responsible for driving the dissemination of Stx toxin genes (stx across their bacterial host range. Lysogens carrying Stx phages can cause severe, life-threatening disease and Stx toxin is an integral virulence factor. The Stx-bacteriophage vB_EcoP-24B, commonly referred to as Ф24B, is capable of multiply infecting a single bacterial host cell at a high frequency, with secondary infection increasing the rate at which subsequent bacteriophage infections can occur. This is biologically unusual, therefore determining the genomic content and context of Ф24B compared to other lambdoid Stx phages is important to understanding the factors controlling this phenomenon and determining whether they occur in other Stx phages. Results The genome of the Stx2 encoding phage, Ф24B was sequenced and annotated. The genomic organisation and general features are similar to other sequenced Stx bacteriophages induced from Enterohaemorrhagic Escherichia coli (EHEC, however Ф24B possesses significant regions of heterogeneity, with implications for phage biology and behaviour. The Ф24B genome was compared to other sequenced Stx phages and the archetypal lambdoid phage, lambda, using the Circos genome comparison tool and a PCR-based multi-loci comparison system. Conclusions The data support the hypothesis that Stx phages are mosaic, and recombination events between the host, phages and their remnants within the same infected bacterial cell will continue to drive the evolution of Stx phage variants and the subsequent dissemination of shigatoxigenic potential.

  15. The Encyclopedia of DNA elements (ENCODE): data portal update.

    Science.gov (United States)

    Davis, Carrie A; Hitz, Benjamin C; Sloan, Cricket A; Chan, Esther T; Davidson, Jean M; Gabdank, Idan; Hilton, Jason A; Jain, Kriti; Baymuradov, Ulugbek K; Narayanan, Aditi K; Onate, Kathrina C; Graham, Keenan; Miyasato, Stuart R; Dreszer, Timothy R; Strattan, J Seth; Jolanki, Otto; Tanaka, Forrest Y; Cherry, J Michael

    2018-01-04

    The Encyclopedia of DNA Elements (ENCODE) Data Coordinating Center has developed the ENCODE Portal database and website as the source for the data and metadata generated by the ENCODE Consortium. Two principles have motivated the design. First, experimental protocols, analytical procedures and the data themselves should be made publicly accessible through a coherent, web-based search and download interface. Second, the same interface should serve carefully curated metadata that record the provenance of the data and justify its interpretation in biological terms. Since its initial release in 2013 and in response to recommendations from consortium members and the wider community of scientists who use the Portal to access ENCODE data, the Portal has been regularly updated to better reflect these design principles. Here we report on these updates, including results from new experiments, uniformly-processed data from other projects, new visualization tools and more comprehensive metadata to describe experiments and analyses. Additionally, the Portal is now home to meta(data) from related projects including Genomics of Gene Regulation, Roadmap Epigenome Project, Model organism ENCODE (modENCODE) and modERN. The Portal now makes available over 13000 datasets and their accompanying metadata and can be accessed at: https://www.encodeproject.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.

    Science.gov (United States)

    Siggens, L; Ekwall, K

    2014-09-01

    The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.

  17. Brief Guide to Genomics: DNA, Genes and Genomes

    Science.gov (United States)

    ... de genómica A Brief Guide to Genomics DNA, Genes and Genomes Deoxyribonucleic acid (DNA) is the chemical ... needed to build the entire human body. A gene traditionally refers to the unit of DNA that ...

  18. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  19. Invariants of DNA genomic signals

    Science.gov (United States)

    Cristea, Paul Dan A.

    2005-02-01

    For large scale analysis purposes, the conversion of genomic sequences into digital signals opens the possibility to use powerful signal processing methods for handling genomic information. The study of complex genomic signals reveals large scale features, maintained over the scale of whole chromosomes, that would be difficult to find by using only the symbolic representation. Based on genomic signal methods and on statistical techniques, the paper defines parameters of DNA sequences which are invariant to transformations induced by SNPs, splicing or crossover. Re-orienting concatenated coding regions in the same direction, regularities shared by the genomic material in all exons are revealed, pointing towards the hypothesis of a regular ancestral structure from which the current chromosome structures have evolved. This property is not found in non-nuclear genomic material, e.g., plasmids.

  20. Solving traveling salesman problems with DNA molecules encoding numerical values.

    Science.gov (United States)

    Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

    2004-12-01

    We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

  1. Translating the ENCyclopedia Of DNA Elements Project findings to the clinic: ENCODE's implications for eye disease.

    Science.gov (United States)

    Sanfilippo, Paul G; Hewitt, Alex W

    2014-01-01

    Approximately 10 years after the Human Genome Project unravelled the sequence of our DNA, the ENCyclopedia Of DNA Elements (ENCODE) Project sought to interpret it. Data from the recently completed project have shed new light on the proportion of biologically active human DNA, assigning a biochemical role to much of the sequence previously considered to be 'junk'. Many of these newly catalogued functional elements represent epigenetic mechanisms involved in regulation of gene expression. Analogous to an Ishihara plate, a gene-coding region of DNA (target dots) only comes into context when the non-coding DNA (surrounding dots) is appreciated. In this review we provide an overview of the ENCODE project, discussing the significance of these data for ophthalmic research and eye disease. The novel insights afforded by the ENCODE project will in time allow for the development of new therapeutic strategies in the management of common blinding disorders. © 2013 Royal Australian and New Zealand College of Ophthalmologists.

  2. Multiplexed Sequence Encoding: A Framework for DNA Communication

    Science.gov (United States)

    Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

    2016-01-01

    Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

  3. Assessment of a DNA Vaccine Encoding Burkholderia pseudomallei Bacterioferritin

    Science.gov (United States)

    2007-08-01

    excised by restriction enzyme digestion with Xba I and subcloned into the mammalian expression vector pcDNA3.1start, to create the DNA vaccine...Lewis, J. T. August, and E. T. Marques. 2006. DNA Encoding an HIV -1 Gag/Human Lysosome-Associated Membrane Protein-1 Chimera Elicits a Broad

  4. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  5. CAG-encoded polyglutamine length polymorphism in the human genome

    Directory of Open Access Journals (Sweden)

    Hayden Michael R

    2007-05-01

    Full Text Available Abstract Background Expansion of polyglutamine-encoding CAG trinucleotide repeats has been identified as the pathogenic mutation in nine different genes associated with neurodegenerative disorders. The majority of individuals clinically diagnosed with spinocerebellar ataxia do not have mutations within known disease genes, and it is likely that additional ataxias or Huntington disease-like disorders will be found to be caused by this common mutational mechanism. We set out to determine the length distributions of CAG-polyglutamine tracts for the entire human genome in a set of healthy individuals in order to characterize the nature of polyglutamine repeat length variation across the human genome, to establish the background against which pathogenic repeat expansions can be detected, and to prioritize candidate genes for repeat expansion disorders. Results We found that repeats, including those in known disease genes, have unique distributions of glutamine tract lengths, as measured by fragment analysis of PCR-amplified repeat regions. This emphasizes the need to characterize each distribution and avoid making generalizations between loci. The best predictors of known disease genes were occurrence of a long CAG-tract uninterrupted by CAA codons in their reference genome sequence, and high glutamine tract length variance in the normal population. We used these parameters to identify eight priority candidate genes for polyglutamine expansion disorders. Twelve CAG-polyglutamine repeats were invariant and these can likely be excluded as candidates. We outline some confusion in the literature about this type of data, difficulties in comparing such data between publications, and its application to studies of disease prevalence in different populations. Analysis of Gene Ontology-based functions of CAG-polyglutamine-containing genes provided a visual framework for interpretation of these genes' functions. All nine known disease genes were involved in DNA

  6. pENCODE: a plant encyclopedia of DNA elements.

    Science.gov (United States)

    Lane, Amanda K; Niederhuth, Chad E; Ji, Lexiang; Schmitz, Robert J

    2014-01-01

    ENCODE projects exist for many eukaryotes, including humans, but as of yet no defined project exists for plants. A plant ENCODE would be invaluable to the research community and could be more readily produced than its metazoan equivalents by capitalizing on the preexisting infrastructure provided from similar projects. Collecting and normalizing plant epigenomic data for a range of species will facilitate hypothesis generation, cross-species comparisons, annotation of genomes, and an understanding of epigenomic functions throughout plant evolution. Here, we discuss the need for such a project, outline the challenges it faces, and suggest ways forward to build a plant ENCODE.

  7. Genome segment S8 of grass carp hemorrhage virus encodes a virion protein.

    Science.gov (United States)

    Qiu, T; Zhang, J; Lu, R; Zhu, Z

    2001-01-01

    The complete nucleotide sequence of the genome segment S8 of grass carp hemorrhage virus (GCHV) was determined from cDNA corresponding to the viral genomic RNA. It is 1,287 nucleotides in length and contains a large open reading frame that could encode a protein of 409 amino acids with a predicted molecular mass of 44 kD. The S8 was expressed using the pET fusion protein vector and detected by Western blotting analysis using the chicken egg IgY against intact GCHV particles, indicating that S8 encodes a virion protein. Amino acid sequence comparisons revealed that the protein encoded by S8 is closely related to protein sigma2 of mammalian reovirus, suggesting that the deduced protein of S8 is an inner capsid protein. Copyright 2001 S. Karger AG, Basel

  8. Reverse gyrase functions in genome integrity maintenance by protecting DNA breaks in vivo

    DEFF Research Database (Denmark)

    Han, Wenyuan; Feng, Xu; She, Qunxin

    2017-01-01

    Reverse gyrase introduces positive supercoils to circular DNA and is implicated in genome stability maintenance in thermophiles. The extremely thermophilic crenarchaeon Sulfolobus encodes two reverse gyrase proteins, TopR1 (topoisomerase reverse gyrase 1) and TopR2, whose functions in thermophili...... genomic DNA degradation during MMS treatment, accompanied by a higher rate of cell death. Taken together, these results indicate that TopR1 probably facilitates genome integrity maintenance by protecting DNA breaks from thermo-degradation in vivo....

  9. Direct detection of methylation in genomic DNA

    NARCIS (Netherlands)

    Bart, A.; van Passel, M. W. J.; van Amsterdam, K.; van der Ende, A.

    2005-01-01

    The identification of methylated sites on bacterial genomic DNA would be a useful tool to study the major roles of DNA methylation in prokaryotes: distinction of self and nonself DNA, direction of post-replicative mismatch repair, control of DNA replication and cell cycle, and regulation of gene

  10. Amsacta moorei entomopoxvirus encodes a functional DNA photolyase (AMV025)

    NARCIS (Netherlands)

    Nalcacioglu, R.; Dizman, Y.A.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2010-01-01

    The major damage induced in DNA by ultraviolet light is the induction of cyclobutane pyrimidine dimers (CPDs). Amsacta moorei entomopoxvirus (AMEV) encodes a CPD photolyase (AMV025) with a putative role in converting these dimers back into monomers. In infected Lymantria dispar cells transcription

  11. An integrated encyclopedia of DNA elements in the human genome.

    Science.gov (United States)

    2012-09-06

    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

  12. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  13. Genome instabilities arising from ribonucleotides in DNA.

    Science.gov (United States)

    Klein, Hannah L

    2017-08-01

    Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  15. Current View on Phytoplasma Genomes and Encoded Metabolism

    Directory of Open Access Journals (Sweden)

    Michael Kube

    2012-01-01

    Full Text Available Phytoplasmas are specialised bacteria that are obligate parasites of plant phloem tissue and insects. These bacteria have resisted all attempts of cell-free cultivation. Genome research is of particular importance to analyse the genetic endowment of such bacteria. Here we review the gene content of the four completely sequenced ‘Candidatus Phytoplasma’ genomes that include those of ‘Ca. P. asteris’ strains OY-M and AY-WB, ‘Ca. P. australiense,’ and ‘Ca. P. mali’. These genomes are characterized by chromosome condensation resulting in sizes below 900 kb and a G + C content of less than 28%. Evolutionary adaption of the phytoplasmas to nutrient-rich environments resulted in losses of genetic modules and increased host dependency highlighted by the transport systems and limited metabolic repertoire. On the other hand, duplication and integration events enlarged the chromosomes and contribute to genome instability. Present differences in the content of membrane and secreted proteins reflect the host adaptation in the phytoplasma strains. General differences are obvious between different phylogenetic subgroups. ‘Ca. P. mali’ is separated from the other strains by its deviating chromosome organization, the genetic repertoire for recombination and excision repair of nucleotides or the loss of the complete energy-yielding part of the glycolysis. Apart from these differences, comparative analysis exemplified that all four phytoplasmas are likely to encode an alternative pathway to generate pyruvate and ATP.

  16. Comparison of three methods of parasitoid polydnavirus genomic DNA isolation to facilitate polydnavirus genomic sequencing.

    Science.gov (United States)

    Rodríguez-Pérez, Mario A; Beckage, Nancy E

    2008-04-01

    A major long-term goal of polydnavirus (PDV) genome research is to identify novel virally encoded molecules that may serve as biopesticides to target insect pests that threaten agriculture and human health. As PDV viral replication in cell culture in vitro has not yet been achieved, several thousands of wasps must be dissected to yield enough viral DNA from the adult ovaries to carry out PDV genomic sequencing. This study compares three methods of PDV genomic DNA isolation for the PDV of Cotesia flavipes, which parasitizes the sugarcane borer, Diatraea saccharalis, preparatory to sequencing the C. flavipes bracovirus genome. Two of these protocols incorporate phenol-chloroform DNA extraction steps in the procedure and the third protocol uses a modified Qiagen DNA kit method to extract viral DNA. The latter method proved significantly less time-consuming and more cost-effective. Efforts are currently underway to bioengineer insect pathogenic viruses with PDV genes, so that their gene products will enhance baculovirus virulence for agricultural insect pests, either via suppression of the immune system of the host or by PDV-mediated induction of its developmental arrest. Sequencing a growing number of complete PDV genomes will enhance those efforts, which will be facilitated by the study reported here. (c) 2008 Wiley-Liss, Inc.

  17. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  18. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.

    Science.gov (United States)

    Qu, Hongzhu; Fang, Xiangdong

    2013-06-01

    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease. Copyright © 2013. Production and hosting by Elsevier Ltd.

  19. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Science.gov (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  20. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  1. Cryptanalysis of an image encryption algorithm based on DNA encoding

    Science.gov (United States)

    Akhavan, A.; Samsudin, A.; Akhshani, A.

    2017-10-01

    Recently an image encryption algorithm based on DNA encoding and the Elliptic Curve Cryptography (ECC) is proposed. This paper aims to investigate the security the DNA-based image encryption algorithm and its resistance against chosen plaintext attack. The results of the analysis demonstrate that security of the algorithm mainly relies on one static shuffling step, with a simple confusion operation. In this study, a practical plain image recovery method is proposed, and it is shown that the images encrypted with the same key could easily be recovered using the suggested cryptanalysis method with as low as two chosen plain images. Also, a strategy to improve the security of the algorithm is presented in this paper.

  2. Natural biased coin encoded in the genome determines cell strategy.

    Science.gov (United States)

    Dorri, Faezeh; Mahini, Hamid; Sharifi-Zarchi, Ali; Totonchi, Mehdi; Tusserkani, Ruzbeh; Pezeshk, Hamid; Sadeghi, Mehdi

    2014-01-01

    Decision making at a cellular level determines different fates for isogenic cells. However, it is not yet clear how rational decisions are encoded in the genome, how they are transmitted to their offspring, and whether they evolve and become optimized throughout generations. In this paper, we use a game theoretic approach to explain how rational decisions are made in the presence of cooperators and competitors. Our results suggest the existence of an internal switch that operates as a biased coin. The biased coin is, in fact, a biochemical bistable network of interacting genes that can flip to one of its stable states in response to different environmental stimuli. We present a framework to describe how the positions of attractors in such a gene regulatory network correspond to the behavior of a rational player in a competing environment. We evaluate our model by considering lysis/lysogeny decision making of bacteriophage lambda in E. coli.

  3. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  4. The Mimivirus Genome Encodes a Mitochondrial Carrier That Transports dATP and dTTP▿

    Science.gov (United States)

    Monné, Magnus; Robinson, Alan J.; Boes, Christoph; Harbour, Michael E.; Fearnley, Ian M.; Kunji, Edmund R. S.

    2007-01-01

    Members of the mitochondrial carrier family have been reported in eukaryotes only, where they transport metabolites and cofactors across the mitochondrial inner membrane to link the metabolic pathways of the cytosol and the matrix. The genome of the giant virus Mimiviridae mimivirus encodes a member of the mitochondrial carrier family of transport proteins. This viral protein has been expressed in Lactococcus lactis and is shown to transport dATP and dTTP. As the 1.2-Mb double-stranded DNA mimivirus genome is rich in A and T residues, we speculate that the virus is using this protein to target the host mitochondria as a source of deoxynucleotides for its replication. PMID:17229695

  5. Essential roles for imuA′- and imuB-encoded accessory factors in DnaE2-dependent mutagenesis in Mycobacterium tuberculosis

    OpenAIRE

    Warner, Digby F.; Ndwandwe, Duduzile E.; Abrahams, Garth L.; Kana, Bavesh D.; Machowski, Edith E.; Venclovas, Česlovas; Mizrahi, Valerie

    2010-01-01

    In Mycobacterium tuberculosis (Mtb), damage-induced mutagenesis is dependent on the C-family DNA polymerase, DnaE2. Included with dnaE2 in the Mtb SOS regulon is a putative operon comprising Rv3395c, which encodes a protein of unknown function restricted primarily to actinomycetes, and Rv3394c, which is predicted to encode a Y-family DNA polymerase. These genes were previously identified as components of an imuA-imuB-dnaE2–type mutagenic cassette widespread among bacterial genomes. Here, we c...

  6. De novo prediction of human chromosome structures: Epigenetic marking patterns encode genome architecture

    Science.gov (United States)

    Di Pierro, Michele; Cheng, Ryan R.; Lieberman Aiden, Erez; Wolynes, Peter G.; Onuchic, José N.

    2017-01-01

    Inside the cell nucleus, genomes fold into organized structures that are characteristic of cell type. Here, we show that this chromatin architecture can be predicted de novo using epigenetic data derived from chromatin immunoprecipitation-sequencing (ChIP-Seq). We exploit the idea that chromosomes encode a 1D sequence of chromatin structural types. Interactions between these chromatin types determine the 3D structural ensemble of chromosomes through a process similar to phase separation. First, a neural network is used to infer the relation between the epigenetic marks present at a locus, as assayed by ChIP-Seq, and the genomic compartment in which those loci reside, as measured by DNA-DNA proximity ligation (Hi-C). Next, types inferred from this neural network are used as an input to an energy landscape model for chromatin organization [Minimal Chromatin Model (MiChroM)] to generate an ensemble of 3D chromosome conformations at a resolution of 50 kilobases (kb). After training the model, dubbed Maximum Entropy Genomic Annotation from Biomarkers Associated to Structural Ensembles (MEGABASE), on odd-numbered chromosomes, we predict the sequences of chromatin types and the subsequent 3D conformational ensembles for the even chromosomes. We validate these structural ensembles by using ChIP-Seq tracks alone to predict Hi-C maps, as well as distances measured using 3D fluorescence in situ hybridization (FISH) experiments. Both sets of experiments support the hypothesis of phase separation being the driving process behind compartmentalization. These findings strongly suggest that epigenetic marking patterns encode sufficient information to determine the global architecture of chromosomes and that de novo structure prediction for whole genomes may be increasingly possible. PMID:29087948

  7. De novo prediction of human chromosome structures: Epigenetic marking patterns encode genome architecture.

    Science.gov (United States)

    Di Pierro, Michele; Cheng, Ryan R; Lieberman Aiden, Erez; Wolynes, Peter G; Onuchic, José N

    2017-11-14

    Inside the cell nucleus, genomes fold into organized structures that are characteristic of cell type. Here, we show that this chromatin architecture can be predicted de novo using epigenetic data derived from chromatin immunoprecipitation-sequencing (ChIP-Seq). We exploit the idea that chromosomes encode a 1D sequence of chromatin structural types. Interactions between these chromatin types determine the 3D structural ensemble of chromosomes through a process similar to phase separation. First, a neural network is used to infer the relation between the epigenetic marks present at a locus, as assayed by ChIP-Seq, and the genomic compartment in which those loci reside, as measured by DNA-DNA proximity ligation (Hi-C). Next, types inferred from this neural network are used as an input to an energy landscape model for chromatin organization [Minimal Chromatin Model (MiChroM)] to generate an ensemble of 3D chromosome conformations at a resolution of 50 kilobases (kb). After training the model, dubbed Maximum Entropy Genomic Annotation from Biomarkers Associated to Structural Ensembles (MEGABASE), on odd-numbered chromosomes, we predict the sequences of chromatin types and the subsequent 3D conformational ensembles for the even chromosomes. We validate these structural ensembles by using ChIP-Seq tracks alone to predict Hi-C maps, as well as distances measured using 3D fluorescence in situ hybridization (FISH) experiments. Both sets of experiments support the hypothesis of phase separation being the driving process behind compartmentalization. These findings strongly suggest that epigenetic marking patterns encode sufficient information to determine the global architecture of chromosomes and that de novo structure prediction for whole genomes may be increasingly possible. Copyright © 2017 the Author(s). Published by PNAS.

  8. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. Profiling genome-wide DNA methylation.

    Science.gov (United States)

    Yong, Wai-Shin; Hsu, Fei-Man; Chen, Pao-Yang

    2016-01-01

    DNA methylation is an epigenetic modification that plays an important role in regulating gene expression and therefore a broad range of biological processes and diseases. DNA methylation is tissue-specific, dynamic, sequence-context-dependent and trans-generationally heritable, and these complex patterns of methylation highlight the significance of profiling DNA methylation to answer biological questions. In this review, we surveyed major methylation assays, along with comparisons and biological examples, to provide an overview of DNA methylation profiling techniques. The advances in microarray and sequencing technologies make genome-wide profiling possible at a single-nucleotide or even a single-cell resolution. These profiling approaches vary in many aspects, such as DNA input, resolution, genomic region coverage, and bioinformatics analysis, and selecting a feasible method requires knowledge of these methods. We first introduce the biological background of DNA methylation and its pattern in plants, animals and fungi. We present an overview of major experimental approaches to profiling genome-wide DNA methylation and hydroxymethylation and then extend to the single-cell methylome. To evaluate these methods, we outline their strengths and weaknesses and perform comparisons across the different platforms. Due to the increasing need to compute high-throughput epigenomic data, we interrogate the computational pipeline for bisulfite sequencing data and also discuss the concept of identifying differentially methylated regions (DMRs). This review summarizes the experimental and computational concepts for profiling genome-wide DNA methylation, followed by biological examples. Overall, this review provides researchers useful guidance for the selection of a profiling method suited to specific research questions.

  11. Do Non-Genomically Encoded Fusion Transcripts Cause Recurrent Chromosomal Translocations?

    Directory of Open Access Journals (Sweden)

    Theo Dingermann

    2012-10-01

    Full Text Available We among others have recently demonstrated that normal cells produce “fusion mRNAs”. These fusion mRNAs do not derive from rearranged genomic loci, but rather they are derived from “early-terminated transcripts” (ETTs. Premature transcriptional termination takes place in intronic sequences that belong to “breakpoint cluster regions”. One important property of ETTs is that they exhibit an unsaturated splice donor site. This results in: (1 splicing to “cryptic exons” present in the final intron; (2 Splicing to another transcript of the same gene (intragenic trans-splicing, resulting in “exon repetitions”; (3 splicing to a transcript of another gene (intergenic trans-splicing, leading to “non-genomically encoded fusion transcripts” (NGEFTs. These NGEFTs bear the potential risk to influence DNA repair processes, since they share identical nucleotides with their DNA of origin, and thus, could be used as “guidance RNA” for DNA repair processes. Here, we present experimental data about four other genes. Three of them are associated with hemato-malignancies (ETV6, NUP98 and RUNX1, while one is associated with solid tumors (EWSR1. Our results demonstrate that all genes investigated so far (MLL, AF4, AF9, ENL, ELL, ETV6, NUP98, RUNX1 and EWSR1 display ETTs and produce transpliced mRNA species, indicating that this is a genuine property of translocating genes.

  12. Do Non-Genomically Encoded Fusion Transcripts Cause Recurrent Chromosomal Translocations?

    Energy Technology Data Exchange (ETDEWEB)

    Kowarz, Eric; Dingermann, Theo; Marschalek, Rolf, E-mail: Rolf.Marschalek@em.uni-frankfurt.de [Institute of Pharmaceutical Biology/ZAFES/DCAL, Goethe-University of Frankfurt, Biocenter, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main (Germany)

    2012-10-18

    We among others have recently demonstrated that normal cells produce “fusion mRNAs”. These fusion mRNAs do not derive from rearranged genomic loci, but rather they are derived from “early-terminated transcripts” (ETTs). Premature transcriptional termination takes place in intronic sequences that belong to “breakpoint cluster regions”. One important property of ETTs is that they exhibit an unsaturated splice donor site. This results in: (1) splicing to “cryptic exons” present in the final intron; (2) Splicing to another transcript of the same gene (intragenic trans-splicing), resulting in “exon repetitions”; (3) splicing to a transcript of another gene (intergenic trans-splicing), leading to “non-genomically encoded fusion transcripts” (NGEFTs). These NGEFTs bear the potential risk to influence DNA repair processes, since they share identical nucleotides with their DNA of origin, and thus, could be used as “guidance RNA” for DNA repair processes. Here, we present experimental data about four other genes. Three of them are associated with hemato-malignancies (ETV6, NUP98 and RUNX1), while one is associated with solid tumors (EWSR1). Our results demonstrate that all genes investigated so far (MLL, AF4, AF9, ENL, ELL, ETV6, NUP98, RUNX1 and EWSR1) display ETTs and produce transpliced mRNA species, indicating that this is a genuine property of translocating genes.

  13. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  14. DNA Microarrays in Comparative Genomics and Transcriptomics

    DEFF Research Database (Denmark)

    Willenbrock, Hanni

    2007-01-01

    analysis, analysis of chromosomal aberrations and DNA sequence dependent gene expression. First, this thesis contains a description of how the gene expression profiles from children with acute lymphoblastic leukemia may be used to improve the diagnosis of these patients and potentially improve......During the past few years, innovations in the DNA sequencing technology has led to an explosion in available DNA sequence information. This has revolutionized biological research and promoted the development of high throughput analysis methods that can take advantage of the vast amount of sequence...... of each method’s ability to analyze DNA copy number data. Moreover, our study shows that analysis methods developed for cancer research may also successfully be applied to DNA copy number profiles from bacterial genomes. However, here the purpose is to characterize variations in the gene content...

  15. Characterization of a cDNA encoding cottonseed catalase.

    Science.gov (United States)

    Ni, W; Turley, R B; Trelease, R N

    1990-06-21

    A 1.7 kb cDNA clone was isolated from our lambda gt11 library constructed from poly(A) RNA of 24-h-old cotyledons. The cDNA encodes a full-length catalase peptide (492 amino acid residues). The calculated molecular mass is 56,800, similar to that determined for purified enzyme (57,000 SDS-PAGE). Among higher plant catalases, this cotton catalase shows the highest amino acid sequence identity (85%) to the subunit of homotetrameric maize CAT 1, a developmental counterpart to the homotetrameric CAT A isoform of cotton seeds. Comparison of sequences from cotton, sweet potato, maize CAT 1, and yeast with bovine catalase revealed that the amino acid residues and regions that are involved in catalytic activity and/or required to maintain basic catalase structure, are highly conserved. The C-terminus region, which has the lowest nucleotide sequence identity between plant and mammalian catalases, does not terminate with a tripeptide, S-K/R/H-L, a putative targeting signal for peroxisomal proteins.

  16. Genomic signal processing for DNA sequence clustering

    Directory of Open Access Journals (Sweden)

    Gerardo Mendizabal-Ruiz

    2018-01-01

    Full Text Available Genomic signal processing (GSP methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  17. Genomic signal processing for DNA sequence clustering.

    Science.gov (United States)

    Mendizabal-Ruiz, Gerardo; Román-Godínez, Israel; Torres-Ramos, Sulema; Salido-Ruiz, Ricardo A; Vélez-Pérez, Hugo; Morales, J Alejandro

    2018-01-01

    Genomic signal processing (GSP) methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  18. Genome segment 6 of Antheraea mylitta cypovirus encodes a structural protein with ATPase activity

    International Nuclear Information System (INIS)

    Chavali, Venkata R.M.; Madhurantakam, Chaithanya; Ghorai, Suvankar; Roy, Sobhan; Das, Amit K.; Ghosh, Ananta K.

    2008-01-01

    The genome segment 6 (S6) of the 11 double stranded RNA genomes from Antheraea mylitta cypovirus was converted into cDNA, cloned and sequenced. S6 consisted of 1944 nucleotides with an ORF of 607 amino acids and could encode a protein of 68 kDa, termed P68. Motif scan and molecular docking analysis of P68 showed the presence of two cystathionine beta synthase (CBS) domains and ATP binding sites. The ORF of AmCPV S6 was expressed in E. coli as His-tag fusion protein and polyclonal antibody was raised. Immunoblot analysis of virus infected gut cells and purified polyhedra using raised anti-p68 polyclonal antibody showed that S6 encodes a viral structural protein. Fluorescence and ATPase assay of soluble P68 produced in Sf-9 cells via baculovirus expression system showed its ability to bind and cleave ATP. These results suggest that P68 may bind viral RNA through CBS domains and help in replication and transcription through ATP binding and hydrolysis

  19. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    Energy Technology Data Exchange (ETDEWEB)

    Arneodo, Alain, E-mail: alain.arneodo@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Vaillant, Cedric, E-mail: cedric.vaillant@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Audit, Benjamin, E-mail: benjamin.audit@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Argoul, Francoise, E-mail: francoise.argoul@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); D' Aubenton-Carafa, Yves, E-mail: daubenton@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France); Thermes, Claude, E-mail: claude.thermes@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France)

    2011-02-15

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  20. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  1. Chromatin Dynamics in Genome Stability: Roles in Suppressing Endogenous DNA Damage and Facilitating DNA Repair

    Science.gov (United States)

    Nair, Nidhi; Shoaib, Muhammad

    2017-01-01

    Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage. PMID:28698521

  2. Bacterial species determination from DNA-DNA hybridization by using genome fragments and DNA microarrays.

    Science.gov (United States)

    Cho, J C; Tiedje, J M

    2001-08-01

    Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments of approximately 1 kb from each strain were spotted on microarrays. Genomes from 12 well-characterized fluorescent Pseudomonas strains were labeled with Cy dyes and hybridized to the arrays. Cluster analysis of the hybridization profiles revealed taxonomic relationships between bacterial strains tested at species to strain level resolution, suggesting that this approach is useful for the identification of bacteria as well as determining the genetic distance among bacteria. Since arrays can contain thousands of DNA spots, a single array has the potential for broad identification capacity. In addition, the method does not require laborious cross-hybridizations and can provide an open database of hybridization profiles, avoiding the limitations of traditional DNA-DNA hybridization.

  3. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    Ribosomal protein S4X (RPS4X) is one of the 40S ribosomal proteins encoded by the RPS4X gene. The cDNA and the genomic sequence of RPS4X were cloned successfully from giant panda (Ailuropoda melanoleuca) using reverse transcriptase-polymerase chain reaction (RT-PCR) and touchdown-PCR technology ...

  4. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  5. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... Ribosomal protein S4X (RPS4X) is one of the 40S ribosomal proteins encoded by the RPS4X gene. The. cDNA and the genomic sequence of RPS4X were cloned successfully from giant panda (Ailuropoda melanoleuca) using reverse transcriptase-polymerase chain reaction (RT-PCR) and touchdown- ...

  6. Foreign DNA acquisition by invertebrate genomes.

    Science.gov (United States)

    Drezen, J-M; Gauthier, J; Josse, T; Bézier, A; Herniou, E; Huguet, E

    2017-07-01

    Recent studies have highlighted that the accidental acquisition of DNA from other species by invertebrate genomes is much more common than originally thought. The transferred DNAs are of bacterial or eukaryote origin and in both cases the receiver species may end up utilising the transferred genes for its own benefit. Frequent contact with prokaryotic DNA from symbiotic endocellular bacteria may predispose invertebrates to incorporate this genetic material into their genomes. Increasing evidence also points to viruses as major players in transferring genes and mobile elements between the species they infect. Unexpectedly a gene flux between Hymenoptera and Lepidoptera mediated by endogenous viruses of parasitic wasps has been recently unravelled, suggesting we are probably just seeing the tip of the iceberg concerning horizontal gene transfers in invertebrates. In the context of insect for feed and food, if the new technology of insect genome editing (such as Crisper/Cas9) were used to modify the genome of reared insects it is important to take into account the risk that an introduced gene can be transferred. More generally, although insects are traditionally consumed in Asia and Africa, knowledge on insect viruses is still limited rendering it difficult to predict the impact they might have in the context of insect rearing at an industrial scale. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  8. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    317. 2.4 cDNA sequencing and analysis. The nucleotide sequence of the cloned H. fossilis GH. cDNA was determined by Sanger's dideoxy chain termi- nation method, using Perkin Elmer bigdye terminator kit in an ABI Prism 377 automated DNA sequencer. All other computational analysis of the GH cDNA was done using.

  9. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  10. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  11. Molecular cloning of growth hormone encoding cDNA of Indian ...

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  12. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  13. Elucidating population histories using genomic DNA sequences.

    Science.gov (United States)

    Vigilant, Linda

    2009-04-01

    In 1993, Cliff Jolly suggested that rather than debating species definitions and classifications, energy would be better spent investigating multidimensional patterns of variation and gene flow among populations. Until now, however, genetic studies of wild primate populations have been limited to very small portions of the genome. Access to complete genome sequences of humans, chimpanzees, macaques, and other primates makes it possible to design studies surveying substantial amounts of DNA sequence variation at multiple genetic loci in representatives of closely related but distinct wild primate populations. Such data can be analyzed with new approaches that estimate not only when populations diverged but also the relative amounts and directions of subsequent gene flow. These analyses will reemphasize the difficulty of achieving consistent species and subspecies definitions by revealing the extent of variation in the amount and duration of gene flow accompanying population divergences.

  14. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    Science.gov (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  15. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project

    DEFF Research Database (Denmark)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya

    2007-01-01

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses...... modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra....... Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non...

  16. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  17. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Using polymerase chain reaction (PCR) primers representing the conserved regions of fish GH sequences the 3′ region of catfish GH cDNA (540 bp) was cloned by random amplification of cDNA ends and the clone was used as a probe to isolate recombinant phages carrying the full-length cDNA sequence. The full-length ...

  18. Limitations of the Echinococcus granulosus genome sequence assemblies for analysis of the gene family encoding the EG95 vaccine antigen.

    Science.gov (United States)

    Gauci, Charles G; Alvarez Rojas, Cristian A; Chow, Conan; Lightowlers, Marshall W

    2017-11-27

    Echinococcus granulosus is an important zoonotic parasite that is distributed worldwide. The EG95 vaccine was developed to assist with control of E. granulosus transmission through the parasite's livestock intermediate hosts. The vaccine is based on a recombinant antigen encoded by a gene which is a member of a multi-gene family. With the recent availability of two E. granulosus draft genomes, we sought to map the eg95 gene family to the genomes. We were unable to map unequivocally any of the eg95 gene family members which had previously been characterized by cloning and sequencing both strands of genomic DNA fragments. Our inability to map EG95-related genes to the genomes has revealed limitations in the assembled sequence data when utilized for gene family analyses. This study contrasts with the expectations expressed in often high-profile publications describing draft genomes of parasitic organisms, highlighting deficiencies in currently available genomic resources for E. granulosus and provides a cautionary note for research which seeks to utilize these genome datasets.

  19. Chemical ligation methods for the tagging of DNA-encoded chemical libraries.

    Science.gov (United States)

    Keefe, Anthony D; Clark, Matthew A; Hupp, Christopher D; Litovchick, Alexander; Zhang, Ying

    2015-06-01

    The generation of DNA-encoded chemical libraries requires the unimolecular association of multiple encoding oligonucleotides with encoded chemical entities during combinatorial synthesis processes. This has traditionally been achieved using enzymatic ligation. We discuss a range of chemical ligation methods that provide alternatives to enzymatic ligation. These chemical ligation methods include the generation of modified internucleotide linkages that support polymerase translocation and other modified linkages that while not supporting the translocation of polymerases can also be used to generate individual cDNA molecules containing encoded chemical information specifying individual library members. We also describe which of these approaches have been successfully utilized for the preparation of DNA-encoded chemical libraries and those that were subsequently used for the discovery of inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Complementary DNA sequences encoding the multimammate rat MHC class II DQ α and β chains and cross-species sequence comparison in rodents

    DEFF Research Database (Denmark)

    Goüy de Bellocq, J; Leirs, H

    2009-01-01

    DNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide...... of Mana-DQB, which is unique among known rodents....

  1. Blocking Blood Supply to Breast Carcinoma with a DNA Vaccine Encoding VEGF Receptor-2

    National Research Council Canada - National Science Library

    Xiang, Rong

    2003-01-01

    Proof of concept was established for the hypothesis driving this project indicating that effective suppression of tumor angiogenesis can be achieved with a DNA vaccine encoding murine VEGF receptor-2 (FLK-l...

  2. Blocking Blood Supply to Breast Carcinoma with a DNA Vaccine Encoding VEGF Receptor-2

    National Research Council Canada - National Science Library

    Xiang, Rong

    2004-01-01

    .... In our second fiscal year, we demonstrated proof of concept indicating that effective suppression of tumor angiogenesis can be achieved with a DNA vaccine encoding either muring VEGF receptor-2 (Flk-1...

  3. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors

    Directory of Open Access Journals (Sweden)

    Lough John W

    2010-08-01

    Full Text Available Abstract Background The use of lentiviruses to reprogram human somatic cells into induced pluripotent stem (iPS cells could limit their therapeutic usefulness due to the integration of viral DNA sequences into the genome of the recipient cell. Recent work has demonstrated that human iPS cells can be generated using episomal plasmids, excisable transposons, adeno or sendai viruses, mRNA, or recombinant proteins. While these approaches offer an advance, the protocols have some drawbacks. Commonly the procedures require either subcloning to identify human iPS cells that are free of exogenous DNA, a knowledge of virology and safe handling procedures, or a detailed understanding of protein biochemistry. Results Here we report a simple approach that facilitates the reprogramming of human somatic cells using standard techniques to transfect expression plasmids that encode OCT4, NANOG, SOX2, and LIN28 without the need for episomal stability or selection. The resulting human iPS cells are free of DNA integration, express pluripotent markers, and form teratomas in immunodeficient animals. These iPS cells were also able to undergo directed differentiation into hepatocyte-like and cardiac myocyte-like cells in culture. Conclusions Simple transient transfection of plasmid DNA encoding reprogramming factors is sufficient to generate human iPS cells from primary fibroblasts that are free of exogenous DNA integrations. This approach is highly accessible and could expand the use of iPS cells in the study of human disease and development.

  4. The genome of the brown alga Ectocarpus siliculosus contains a series of viral DNA pieces, suggesting an ancient association with large dsDNA viruses

    Directory of Open Access Journals (Sweden)

    Boland Wilhelm

    2008-04-01

    Full Text Available Abstract Background Ectocarpus siliculosus virus-1 (EsV-1 is a lysogenic dsDNA virus belonging to the super family of nucleocytoplasmic large DNA viruses (NCLDV that infect Ectocarpus siliculosus, a marine filamentous brown alga. Previous studies indicated that the viral genome is integrated into the host DNA. In order to find the integration sites of the viral genome, a genomic library from EsV-1-infected algae was screened using labelled EsV-1 DNA. Several fragments were isolated and some of them were sequenced and analyzed in detail. Results Analysis revealed that the algal genome is split by a copy of viral sequences that have a high identity to EsV-1 DNA sequences. These fragments are interspersed with DNA repeats, pseudogenes and genes coding for products involved in DNA replication, integration and transposition. Some of these gene products are not encoded by EsV-1 but are present in the genome of other members of the NCLDV family. Further analysis suggests that the Ectocarpus algal genome contains traces of the integration of a large dsDNA viral genome; this genome could be the ancestor of the extant NCLDV genomes. Furthermore, several lines of evidence indicate that the EsV-1 genome might have originated in these viral DNA pieces, implying the existence of a complex integration and recombination system. A protein similar to a new class of tyrosine recombinases might be a key enzyme of this system. Conclusion Our results support the hypothesis that some dsDNA viruses are monophyletic and evolved principally through genome reduction. Moreover, we hypothesize that phaeoviruses have probably developed an original replication system.

  5. Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

    Directory of Open Access Journals (Sweden)

    Chakrabarti Mrinmay

    2010-08-01

    Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

  6. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  7. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Edith E., E-mail: ed.mueller@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Mayr, Johannes A., E-mail: h.mayr@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Zimmermann, Franz A., E-mail: f.zimmermann@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Feichtinger, Rene G., E-mail: r.feichtinger@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Stanger, Olaf, E-mail: o.stanger@rbht.nhs.uk [Department of Cardiac Surgery, Paracelsus Medical University, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Sperl, Wolfgang, E-mail: w.sperl@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Kofler, Barbara, E-mail: b.kofler@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria)

    2012-01-20

    Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.

  8. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  9. Whole-genome methylation caller designed for methyl-DNA ...

    African Journals Online (AJOL)

    DNA methylation is an indispensable epigenetic modification required for regulating the expression of mammalian genomes. Continued efforts have been made to unravel the methylation states genome-wide, featuring the methyl-DNA immunoprecipitation (MeDIP) coupled with next-generation sequencing. Our method ...

  10. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  11. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    Suitable method for isolation of genomic DNA is really important. The best method can make the best result for genetic study. About five differences methods were used amongst which were Sarkosyl Method, CTAB method, Kit Method, SDS Method and Phenol-Chloroform Method. Isolated genomic DNA showed high purity ...

  12. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  13. Molecular cloning and characterization of a cDNA encoding ...

    African Journals Online (AJOL)

    enoh

    2012-03-29

    Nanjing) co., Ltd. The nucleotide sequences of these primers are as follows: ..... Ebizuka Y (2000). Molecular cloning and characterization of a cDNA for Glycyrrhiza glabra cycloartenol synthase. Biol. Pharm. Bull. 23(2):231-234.

  14. Annotating the genome by DNA methylation.

    Science.gov (United States)

    Cedar, Howard; Razin, Aharon

    2017-01-01

    DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.

  15. Searching for avidity by chemical ligation of combinatorially self-assembled DNA-encoded ligand libraries.

    Science.gov (United States)

    Matysiak, Stefan; Hellmuth, Klaus; El-Sagheer, Afaf H; Shivalingam, Arun; Ariyurek, Yavuz; de Jong, Marco; Hollestelle, Martine J; Out, Ruud; Brown, Tom

    2017-12-19

    DNA encoded ligands are self-assembled into bivalent complexes and chemically ligated to link their identities. To demonstrate their potential as a combinatorial screening platform for avidity interactions, the optimal bivalent aptamer design (examplar ligands) for human alpha-thrombin is determined in a single round of selection and the DNA scaffold replaced with minimal impact on the final design.

  16. Genomic DNA k-mer Spectra: Models and Modalities

    Science.gov (United States)

    Chor, Benny; Horn, David; Goldman, Nick; Levy, Yaron; Massingham, Tim

    Background: The empirical frequencies of DNA k-mers in whole genome sequences provide an interesting perspective on genomic complexity, and the availability of large segments of genomic sequence from many organisms means that analysis of k-mers with non-trivial lengths is now possible.

  17. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Author Affiliations. Vikas Anathy1 Thayanithy Venugopal1 Ramanathan Koteeswaran1 Thavamani J Pandian1 Sinnakaruppan Mathavan2. Department of Genetics, School of Biological Sciences, Madurai Kamaraj University, Madurai 625 021, India; Genome Institute of Singapore, National University of Singapore, 1, ...

  18. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  19. GENCODE: the reference human genome annotation for The ENCODE Project.

    Science.gov (United States)

    Harrow, Jennifer; Frankish, Adam; Gonzalez, Jose M; Tapanari, Electra; Diekhans, Mark; Kokocinski, Felix; Aken, Bronwen L; Barrell, Daniel; Zadissa, Amonida; Searle, Stephen; Barnes, If; Bignell, Alexandra; Boychenko, Veronika; Hunt, Toby; Kay, Mike; Mukherjee, Gaurab; Rajan, Jeena; Despacio-Reyes, Gloria; Saunders, Gary; Steward, Charles; Harte, Rachel; Lin, Michael; Howald, Cédric; Tanzer, Andrea; Derrien, Thomas; Chrast, Jacqueline; Walters, Nathalie; Balasubramanian, Suganthi; Pei, Baikang; Tress, Michael; Rodriguez, Jose Manuel; Ezkurdia, Iakes; van Baren, Jeltje; Brent, Michael; Haussler, David; Kellis, Manolis; Valencia, Alfonso; Reymond, Alexandre; Gerstein, Mark; Guigó, Roderic; Hubbard, Tim J

    2012-09-01

    The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation data set, few new protein-coding loci have been added, yet the number of alternative splicing transcripts annotated has steadily increased. The GENCODE 7 release contains 20,687 protein-coding and 9640 long noncoding RNA loci and has 33,977 coding transcripts not represented in UCSC genes and RefSeq. It also has the most comprehensive annotation of long noncoding RNA (lncRNA) loci publicly available with the predominant transcript form consisting of two exons. We have examined the completeness of the transcript annotation and found that 35% of transcriptional start sites are supported by CAGE clusters and 62% of protein-coding genes have annotated polyA sites. Over one-third of GENCODE protein-coding genes are supported by peptide hits derived from mass spectrometry spectra submitted to Peptide Atlas. New models derived from the Illumina Body Map 2.0 RNA-seq data identify 3689 new loci not currently in GENCODE, of which 3127 consist of two exon models indicating that they are possibly unannotated long noncoding loci. GENCODE 7 is publicly available from gencodegenes.org and via the Ensembl and UCSC Genome Browsers.

  20. GENCODE: The reference human genome annotation for The ENCODE Project

    Science.gov (United States)

    Harrow, Jennifer; Frankish, Adam; Gonzalez, Jose M.; Tapanari, Electra; Diekhans, Mark; Kokocinski, Felix; Aken, Bronwen L.; Barrell, Daniel; Zadissa, Amonida; Searle, Stephen; Barnes, If; Bignell, Alexandra; Boychenko, Veronika; Hunt, Toby; Kay, Mike; Mukherjee, Gaurab; Rajan, Jeena; Despacio-Reyes, Gloria; Saunders, Gary; Steward, Charles; Harte, Rachel; Lin, Michael; Howald, Cédric; Tanzer, Andrea; Derrien, Thomas; Chrast, Jacqueline; Walters, Nathalie; Balasubramanian, Suganthi; Pei, Baikang; Tress, Michael; Rodriguez, Jose Manuel; Ezkurdia, Iakes; van Baren, Jeltje; Brent, Michael; Haussler, David; Kellis, Manolis; Valencia, Alfonso; Reymond, Alexandre; Gerstein, Mark; Guigó, Roderic; Hubbard, Tim J.

    2012-01-01

    The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation data set, few new protein-coding loci have been added, yet the number of alternative splicing transcripts annotated has steadily increased. The GENCODE 7 release contains 20,687 protein-coding and 9640 long noncoding RNA loci and has 33,977 coding transcripts not represented in UCSC genes and RefSeq. It also has the most comprehensive annotation of long noncoding RNA (lncRNA) loci publicly available with the predominant transcript form consisting of two exons. We have examined the completeness of the transcript annotation and found that 35% of transcriptional start sites are supported by CAGE clusters and 62% of protein-coding genes have annotated polyA sites. Over one-third of GENCODE protein-coding genes are supported by peptide hits derived from mass spectrometry spectra submitted to Peptide Atlas. New models derived from the Illumina Body Map 2.0 RNA-seq data identify 3689 new loci not currently in GENCODE, of which 3127 consist of two exon models indicating that they are possibly unannotated long noncoding loci. GENCODE 7 is publicly available from gencodegenes.org and via the Ensembl and UCSC Genome Browsers. PMID:22955987

  1. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  2. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project.

    Science.gov (United States)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya; Guigó, Roderic; Gingeras, Thomas R; Margulies, Elliott H; Weng, Zhiping; Snyder, Michael; Dermitzakis, Emmanouil T; Thurman, Robert E; Kuehn, Michael S; Taylor, Christopher M; Neph, Shane; Koch, Christoph M; Asthana, Saurabh; Malhotra, Ankit; Adzhubei, Ivan; Greenbaum, Jason A; Andrews, Robert M; Flicek, Paul; Boyle, Patrick J; Cao, Hua; Carter, Nigel P; Clelland, Gayle K; Davis, Sean; Day, Nathan; Dhami, Pawandeep; Dillon, Shane C; Dorschner, Michael O; Fiegler, Heike; Giresi, Paul G; Goldy, Jeff; Hawrylycz, Michael; Haydock, Andrew; Humbert, Richard; James, Keith D; Johnson, Brett E; Johnson, Ericka M; Frum, Tristan T; Rosenzweig, Elizabeth R; Karnani, Neerja; Lee, Kirsten; Lefebvre, Gregory C; Navas, Patrick A; Neri, Fidencio; Parker, Stephen C J; Sabo, Peter J; Sandstrom, Richard; Shafer, Anthony; Vetrie, David; Weaver, Molly; Wilcox, Sarah; Yu, Man; Collins, Francis S; Dekker, Job; Lieb, Jason D; Tullius, Thomas D; Crawford, Gregory E; Sunyaev, Shamil; Noble, William S; Dunham, Ian; Denoeud, France; Reymond, Alexandre; Kapranov, Philipp; Rozowsky, Joel; Zheng, Deyou; Castelo, Robert; Frankish, Adam; Harrow, Jennifer; Ghosh, Srinka; Sandelin, Albin; Hofacker, Ivo L; Baertsch, Robert; Keefe, Damian; Dike, Sujit; Cheng, Jill; Hirsch, Heather A; Sekinger, Edward A; Lagarde, Julien; Abril, Josep F; Shahab, Atif; Flamm, Christoph; Fried, Claudia; Hackermüller, Jörg; Hertel, Jana; Lindemeyer, Manja; Missal, Kristin; Tanzer, Andrea; Washietl, Stefan; Korbel, Jan; Emanuelsson, Olof; Pedersen, Jakob S; Holroyd, Nancy; Taylor, Ruth; Swarbreck, David; Matthews, Nicholas; Dickson, Mark C; Thomas, Daryl J; Weirauch, Matthew T; Gilbert, James; Drenkow, Jorg; Bell, Ian; Zhao, XiaoDong; Srinivasan, K G; Sung, Wing-Kin; Ooi, Hong Sain; Chiu, Kuo Ping; Foissac, Sylvain; Alioto, Tyler; Brent, Michael; Pachter, Lior; Tress, Michael L; Valencia, Alfonso; Choo, Siew Woh; Choo, Chiou Yu; Ucla, Catherine; Manzano, Caroline; Wyss, Carine; Cheung, Evelyn; Clark, Taane G; Brown, James B; Ganesh, Madhavan; Patel, Sandeep; Tammana, Hari; Chrast, Jacqueline; Henrichsen, Charlotte N; Kai, Chikatoshi; Kawai, Jun; Nagalakshmi, Ugrappa; Wu, Jiaqian; Lian, Zheng; Lian, Jin; Newburger, Peter; Zhang, Xueqing; Bickel, Peter; Mattick, John S; Carninci, Piero; Hayashizaki, Yoshihide; Weissman, Sherman; Hubbard, Tim; Myers, Richard M; Rogers, Jane; Stadler, Peter F; Lowe, Todd M; Wei, Chia-Lin; Ruan, Yijun; Struhl, Kevin; Gerstein, Mark; Antonarakis, Stylianos E; Fu, Yutao; Green, Eric D; Karaöz, Ulaş; Siepel, Adam; Taylor, James; Liefer, Laura A; Wetterstrand, Kris A; Good, Peter J; Feingold, Elise A; Guyer, Mark S; Cooper, Gregory M; Asimenos, George; Dewey, Colin N; Hou, Minmei; Nikolaev, Sergey; Montoya-Burgos, Juan I; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Huang, Haiyan; Zhang, Nancy R; Holmes, Ian; Mullikin, James C; Ureta-Vidal, Abel; Paten, Benedict; Seringhaus, Michael; Church, Deanna; Rosenbloom, Kate; Kent, W James; Stone, Eric A; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross C; Haussler, David; Miller, Webb; Sidow, Arend; Trinklein, Nathan D; Zhang, Zhengdong D; Barrera, Leah; Stuart, Rhona; King, David C; Ameur, Adam; Enroth, Stefan; Bieda, Mark C; Kim, Jonghwan; Bhinge, Akshay A; Jiang, Nan; Liu, Jun; Yao, Fei; Vega, Vinsensius B; Lee, Charlie W H; Ng, Patrick; Shahab, Atif; Yang, Annie; Moqtaderi, Zarmik; Zhu, Zhou; Xu, Xiaoqin; Squazzo, Sharon; Oberley, Matthew J; Inman, David; Singer, Michael A; Richmond, Todd A; Munn, Kyle J; Rada-Iglesias, Alvaro; Wallerman, Ola; Komorowski, Jan; Fowler, Joanna C; Couttet, Phillippe; Bruce, Alexander W; Dovey, Oliver M; Ellis, Peter D; Langford, Cordelia F; Nix, David A; Euskirchen, Ghia; Hartman, Stephen; Urban, Alexander E; Kraus, Peter; Van Calcar, Sara; Heintzman, Nate; Kim, Tae Hoon; Wang, Kun; Qu, Chunxu; Hon, Gary; Luna, Rosa; Glass, Christopher K; Rosenfeld, M Geoff; Aldred, Shelley Force; Cooper, Sara J; Halees, Anason; Lin, Jane M; Shulha, Hennady P; Zhang, Xiaoling; Xu, Mousheng; Haidar, Jaafar N S; Yu, Yong; Ruan, Yijun; Iyer, Vishwanath R; Green, Roland D; Wadelius, Claes; Farnham, Peggy J; Ren, Bing; Harte, Rachel A; Hinrichs, Angie S; Trumbower, Heather; Clawson, Hiram; Hillman-Jackson, Jennifer; Zweig, Ann S; Smith, Kayla; Thakkapallayil, Archana; Barber, Galt; Kuhn, Robert M; Karolchik, Donna; Armengol, Lluis; Bird, Christine P; de Bakker, Paul I W; Kern, Andrew D; Lopez-Bigas, Nuria; Martin, Joel D; Stranger, Barbara E; Woodroffe, Abigail; Davydov, Eugene; Dimas, Antigone; Eyras, Eduardo; Hallgrímsdóttir, Ingileif B; Huppert, Julian; Zody, Michael C; Abecasis, Gonçalo R; Estivill, Xavier; Bouffard, Gerard G; Guan, Xiaobin; Hansen, Nancy F; Idol, Jacquelyn R; Maduro, Valerie V B; Maskeri, Baishali; McDowell, Jennifer C; Park, Morgan; Thomas, Pamela J; Young, Alice C; Blakesley, Robert W; Muzny, Donna M; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Jiang, Huaiyang; Weinstock, George M; Gibbs, Richard A; Graves, Tina; Fulton, Robert; Mardis, Elaine R; Wilson, Richard K; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B; Chang, Jean L; Lindblad-Toh, Kerstin; Lander, Eric S; Koriabine, Maxim; Nefedov, Mikhail; Osoegawa, Kazutoyo; Yoshinaga, Yuko; Zhu, Baoli; de Jong, Pieter J

    2007-06-14

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non-protein-coding transcripts, and those that extensively overlap one another. Second, systematic examination of transcriptional regulation has yielded new understanding about transcription start sites, including their relationship to specific regulatory sequences and features of chromatin accessibility and histone modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra-species sequence comparisons, has yielded new mechanistic and evolutionary insights concerning the functional landscape of the human genome. Together, these studies are defining a path for pursuit of a more comprehensive characterization of human genome function.

  3. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    cell embryo and the expression was monitored continuously. The expression shown here is in developing embryo and freshly hatched fish. The intensity of green colour indicate the strong expression of EGFP in all the tissues of the embryo/fry. The expression of EGPF indicates the co-expression of catfish GH cDNA and the ...

  4. Cloning and characterization of cDNA encoding xyloglucan ...

    African Journals Online (AJOL)

    Jane

    2011-08-22

    Aug 22, 2011 ... construction and restructuring of xyloglucan cross-links, thereby controlling the mechanical properties of cell wall. We cloned complete cDNA of an ..... are marked by horizontal lines. The conserved cysteine residues (amino acids 220, 229, 274 and 288 in P. glaucum) are marked by vertical blue arrows.

  5. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...

  6. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  7. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    Abstract. There is no 'one' procedure for extracting DNA from the whole blood of both mammals and birds, since each species has a unique property that require different methods to release its own DNA. Therefore, to obtain genomic DNA, a universal, rapid, and noncostly method was developed. A very simple biological ...

  8. Chromosomal localization of rDNA genes and genomic organization ...

    Indian Academy of Sciences (India)

    Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples.

  9. DNA methylation, genomic silencing, and links to nutrition and cancer.

    Science.gov (United States)

    McCabe, Dale C; Caudill, Marie A

    2005-06-01

    DNA methylation is a heritable epigenetic feature that is associated with transcriptional silencing, X-chromosome inactivation, genetic imprinting, and genomic stability. The addition of the methyl group is catalyzed by a family of DNA methyltransferases whose co-substrates are DNA and S-adenosylmethionine, the latter being derived from the methionine cycle. Aberrant DNA methylation is linked to numerous pathologies, including cancer. The purpose of this review is to describe DNA methylation and its functions, to examine the relationship between dietary methyl insufficiency and DNA methylation, and to evaluate the associations between DNA methylation and cancer.

  10. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria.

    Science.gov (United States)

    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc

    2015-05-26

    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Multi-modulus algorithm based on global artificial fish swarm intelligent optimization of DNA encoding sequences.

    Science.gov (United States)

    Guo, Y C; Wang, H; Wu, H P; Zhang, M Q

    2015-12-21

    Aimed to address the defects of the large mean square error (MSE), and the slow convergence speed in equalizing the multi-modulus signals of the constant modulus algorithm (CMA), a multi-modulus algorithm (MMA) based on global artificial fish swarm (GAFS) intelligent optimization of DNA encoding sequences (GAFS-DNA-MMA) was proposed. To improve the convergence rate and reduce the MSE, this proposed algorithm adopted an encoding method based on DNA nucleotide chains to provide a possible solution to the problem. Furthermore, the GAFS algorithm, with its fast convergence and global search ability, was used to find the best sequence. The real and imaginary parts of the initial optimal weight vector of MMA were obtained through DNA coding of the best sequence. The simulation results show that the proposed algorithm has a faster convergence speed and smaller MSE in comparison with the CMA, the MMA, and the AFS-DNA-MMA.

  12. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  13. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    Science.gov (United States)

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  14. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  15. DNA-Encoded Chemical Libraries: A Selection System Based On Endowing Organic Compounds with Amplifiable Information.

    Science.gov (United States)

    Neri, Dario; Lerner, Richard A

    2018-01-12

    The discovery of organic ligands that bind specifically to proteins is a central problem in chemistry, biology, and the biomedical sciences. The encoding of individual organic molecules with distinctive DNA tags, serving as amplifiable identification bar codes, allows the construction and screening of combinatorial libraries of unprecedented size, thus facilitating the discovery of ligands to many different protein targets. Fundamentally, one links powers of genetics and chemical synthesis. After the initial description of DNA-encoded chemical libraries in 1992, several experimental embodiments of the technology have been reduced to practice. This review provides a historical account of important milestones in the development of DNA-encoded chemical libraries, a survey of relevant ongoing research activities, and a glimpse into the future. Expected final online publication date for the Annual Review of Biochemistry Volume 87 is June 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  16. DNA-free genome editing methods for targeted crop improvement.

    Science.gov (United States)

    Kanchiswamy, Chidananda Nagamangala

    2016-07-01

    Evolution of the next-generation clustered, regularly interspaced, short palindromic repeat/Cas9 (CRISPR/Cas9) genome editing tools, ribonucleoprotein (RNA)-guided endonuclease (RGEN) RNPs, is paving the way for developing DNA-free genetically edited crop plants. In this review, I discuss the various methods of RGEN RNPs tool delivery into plant cells and their limitations to adopt this technology to numerous crop plants. Furthermore, focus is given on the importance of developing DNA-free genome edited crop plants, including perennial crop plants. The possible regulation on the DNA-free, next-generation genome-edited crop plants is also highlighted.

  17. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  18. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  19. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  20. DNA encoding individual mycobacterial antigens protects mice against tuberculosis

    Directory of Open Access Journals (Sweden)

    C.L. Silva

    1999-02-01

    Full Text Available Over the last few years, some of our experiments in which mycobacterial antigens were presented to the immune system as if they were viral antigens have had a significant impact on our understanding of protective immunity against tuberculosis. They have also markedly enhanced the prospects for new vaccines. We now know that individual mycobacterial protein antigens can confer protection equal to that from live BCG vaccine in mice. A critical determinant of the outcome of immunization appears to be the degree to which antigen-specific cytotoxic T cells are generated by the immune response. Our most recent studies indicate that DNA vaccination is an effective way to establish long-lasting cytotoxic T cell memory and protection against tuberculosis.

  1. Analysis of the genome of a Korean isolate of the Pieris rapae granulovirus enabled by its separation from total host genomic DNA by pulse-field electrophoresis.

    Directory of Open Access Journals (Sweden)

    Yong Hun Jo

    Full Text Available BACKGROUND: Most traditional genome sequencing projects involving viruses include the culture and purification of the virus particles. However, purification of virions may yield insufficient material for traditional sequencing. The electrophoretic method described here provides a strategy whereby the genomic DNA of the Korean isolate of Pieris rapae granulovirus (PiraGV-K could be recovered in sufficient amounts for sequencing by purifying it directly from total host DNA by pulse-field gel electrophoresis (PFGE. METHODOLOGY/PRINCIPAL FINDINGS: The total genomic DNA of infected P. rapae was embedded in agarose plugs, treated with restriction nuclease and methylase, and then PFGE was used to separate PiraGV-K DNA from the DNA of P. rapae, followed by mapping of fosmid clones of the purified viral DNA. The double-stranded circular genome of PiraGV-K was found to encode 120 open reading frames (ORFs, which covered 92% of the sequence. BLAST and ORF arrangement showed the presence of 78 homologs to other genes in the database. The mean overall amino acid identity of PiraGV-K ORFs was highest with the Chinese isolate of PiraGV (~99%, followed up with Choristoneura occidentalis ORFs at 58%. PiraGV-K ORFs were grouped, according to function, into 10 genes involved in transcription, 11 involved in replication, 25 structural protein genes, and 15 auxiliary genes. Genes for Chitinase (ORF 10 and cathepsin (ORF 11, involved in the liquefaction of the host, were found in the genome. CONCLUSIONS/SIGNIFICANCE: The recovery of PiraGV-K DNA genome by pulse-field electrophoretic separation from host genomic DNA had several advantages, compared with its isolation from particles harvested as virions or inclusions from the P. rapae host. We have sequenced and analyzed the 108,658 bp PiraGV-K genome purified by the electrophoretic method. The method appears to be generally applicable to the analysis of genomes of large viruses.

  2. Hyper-expansion of large DNA segments in the genome of kuruma shrimp, Marsupenaeus japonicus

    Directory of Open Access Journals (Sweden)

    Kondo Hidehiro

    2010-02-01

    Full Text Available Abstract Background Higher crustaceans (class Malacostraca represent the most species-rich and morphologically diverse group of non-insect arthropods and many of its members are commercially important. Although the crustacean DNA sequence information is growing exponentially, little is known about the genome organization of Malacostraca. Here, we constructed a bacterial artificial chromosome (BAC library and performed BAC-end sequencing to provide genomic information for kuruma shrimp (Marsupenaeus japonicus, one of the most widely cultured species among crustaceans, and found the presence of a redundant sequence in the BAC library. We examined the BAC clone that includes the redundant sequence to further analyze its length, copy number and location in the kuruma shrimp genome. Results Mj024A04 BAC clone, which includes one redundant sequence, contained 27 putative genes and seemed to display a normal genomic DNA structure. Notably, of the putative genes, 3 genes encode homologous proteins to the inhibitor of apoptosis protein and 7 genes encode homologous proteins to white spot syndrome virus, a virulent pathogen known to affect crustaceans. Colony hybridization and PCR analysis of 381 BAC clones showed that almost half of the BAC clones maintain DNA segments whose sequences are homologous to the representative BAC clone Mj024A04. The Mj024A04 partial sequence was detected multiple times in the kuruma shrimp nuclear genome with a calculated copy number of at least 100. Microsatellites based BAC genotyping clearly showed that Mj024A04 homologous sequences were cloned from at least 48 different chromosomal loci. The absence of micro-syntenic relationships with the available genomic sequences of Daphnia and Drosophila suggests the uniqueness of these fragments in kuruma shrimp from current arthropod genome sequences. Conclusions Our results demonstrate that hyper-expansion of large DNA segments took place in the kuruma shrimp genome. Although we

  3. Isolation and enrichment of Cryptosporidium DNA and verification of DNA purity for whole-genome sequencing.

    Science.gov (United States)

    Guo, Yaqiong; Li, Na; Lysén, Colleen; Frace, Michael; Tang, Kevin; Sammons, Scott; Roellig, Dawn M; Feng, Yaoyu; Xiao, Lihua

    2015-02-01

    Whole-genome sequencing of Cryptosporidium spp. is hampered by difficulties in obtaining sufficient, highly pure genomic DNA from clinical specimens. In this study, we developed procedures for the isolation and enrichment of Cryptosporidium genomic DNA from fecal specimens and verification of DNA purity for whole-genome sequencing. The isolation and enrichment of genomic DNA were achieved by a combination of three oocyst purification steps and whole-genome amplification (WGA) of DNA from purified oocysts. Quantitative PCR (qPCR) analysis of WGA products was used as an initial quality assessment of amplified genomic DNA. The purity of WGA products was assessed by Sanger sequencing of cloned products. Next-generation sequencing tools were used in final evaluations of genome coverage and of the extent of contamination. Altogether, 24 fecal specimens of Cryptosporidium parvum, C. hominis, C. andersoni, C. ubiquitum, C. tyzzeri, and Cryptosporidium chipmunk genotype I were processed with the procedures. As expected, WGA products with low (sequences in Sanger sequencing. The cloning-sequencing analysis, however, showed significant contamination in 5 WGA products (proportion of positive colonies derived from Cryptosporidium genomic DNA, ≤25%). Following this strategy, 20 WGA products from six Cryptosporidium species or genotypes with low (mostly sequencing, generating sequence data covering 94.5% to 99.7% of Cryptosporidium genomes, with mostly minor contamination from bacterial, fungal, and host DNA. These results suggest that the described strategy can be used effectively for the isolation and enrichment of Cryptosporidium DNA from fecal specimens for whole-genome sequencing. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Genomic DNA Methylation Analyses Reveal the Distinct Profiles in Castor Bean Seeds with Persistent Endosperms1

    Science.gov (United States)

    Yang, Tianquan; Dong, Xue; Li, De-Zhu

    2016-01-01

    Investigations of genomic DNA methylation in seeds have been restricted to a few model plants. The endosperm genomic DNA hypomethylation has been identified in angiosperm, but it is difficult to dissect the mechanism of how this hypomethylation is established and maintained because endosperm is ephemeral and disappears with seed development in most dicots. Castor bean (Ricinus communis), unlike Arabidopsis (Arabidopsis thaliana), endosperm is persistent throughout seed development, providing an excellent model in which to dissect the mechanism of endosperm genomic hypomethylation in dicots. We characterized the DNA methylation-related genes encoding DNA methyltransferases and demethylases and analyzed their expression profiles in different tissues. We examined genomic methylation including CG, CHG, and CHH contexts in endosperm and embryo tissues using bisulfite sequencing and revealed that the CHH methylation extent in endosperm and embryo was, unexpectedly, substantially higher than in previously studied plants, irrespective of the CHH percentage in their genomes. In particular, we found that the endosperm exhibited a global reduction in CG and CHG methylation extents relative to the embryo, markedly switching global gene expression. However, CHH methylation occurring in endosperm did not exhibit a significant reduction. Combining with the expression of 24-nucleotide small interfering RNAs (siRNAs) mapped within transposable element (TE) regions and genes involved in the RNA-directed DNA methylation pathway, we demonstrate that the 24-nucleotide siRNAs played a critical role in maintaining CHH methylation and repressing the activation of TEs in persistent endosperm development. This study discovered a novel genomic DNA methylation pattern and proposes the potential mechanism occurring in dicot seeds with persistent endosperm. PMID:27208275

  5. Local chromatin structure of heterochromatin regulates repeated DNA stability, nucleolus structure, and genome integrity

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Jamy C. [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Heterochromatin constitutes a significant portion of the genome in higher eukaryotes; approximately 30% in Drosophila and human. Heterochromatin contains a high repeat DNA content and a low density of protein-encoding genes. In contrast, euchromatin is composed mostly of unique sequences and contains the majority of single-copy genes. Genetic and cytological studies demonstrated that heterochromatin exhibits regulatory roles in chromosome organization, centromere function and telomere protection. As an epigenetically regulated structure, heterochromatin formation is not defined by any DNA sequence consensus. Heterochromatin is characterized by its association with nucleosomes containing methylated-lysine 9 of histone H3 (H3K9me), heterochromatin protein 1 (HP1) that binds H3K9me, and Su(var)3-9, which methylates H3K9 and binds HP1. Heterochromatin formation and functions are influenced by HP1, Su(var)3-9, and the RNA interference (RNAi) pathway. My thesis project investigates how heterochromatin formation and function impact nuclear architecture, repeated DNA organization, and genome stability in Drosophila melanogaster. H3K9me-based chromatin reduces extrachromosomal DNA formation; most likely by restricting the access of repair machineries to repeated DNAs. Reducing extrachromosomal ribosomal DNA stabilizes rDNA repeats and the nucleolus structure. H3K9me-based chromatin also inhibits DNA damage in heterochromatin. Cells with compromised heterochromatin structure, due to Su(var)3-9 or dcr-2 (a component of the RNAi pathway) mutations, display severe DNA damage in heterochromatin compared to wild type. In these mutant cells, accumulated DNA damage leads to chromosomal defects such as translocations, defective DNA repair response, and activation of the G2-M DNA repair and mitotic checkpoints that ensure cellular and animal viability. My thesis research suggests that DNA replication, repair, and recombination mechanisms in heterochromatin differ from those in

  6. An automated annotation tool for genomic DNA sequences using ...

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  7. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...

  8. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  9. Molecular cloning of growth hormone encoding cDNA of Indian ...

    Indian Academy of Sciences (India)

    Unknown

    Evans and Long 1921) and the human growth hormone (GH) encoding cDNA was per- haps the first to be isolated and characterized (Li and. Evans 1944). GH, chorionic somatomamotropin (placental lactogen) and prolactin (PRL) are all a family of ...

  10. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  11. Molecular cloning and characterization of cDNA encoding fibrinolytic enzyme-3 from earthworm Eisenia foetida.

    Science.gov (United States)

    Dong, Guo-Qing; Yuan, Xiao-Ling; Shan, Ya-Jun; Zhao, Zhen-Hu; Chen, Jia-Pei; Cong, Yu-Wen

    2004-04-01

    The earthworm fibrinolytic enzyme-3 (EFE-3, GenBank accession No: AY438622), from the earthworm Eisenia foetida, is a component of earthworm fibrinolytic enzymes. In this study, cDNA encoding the EFE-3 was cloned by RT-PCR. The cDNA contained an open reading frame of 741 nucleotides, which encoded a deduced protein of 247 amino acid residues, including signal sequences. EFE-3 showed a high degree of homology to earthworm (Lumbricus rebullus) proteases F-III-1, F-III-2, and bovine trypsin. The recombinant EFE-3 was expressed in E. coli as inclusion bodies, and the gene encoding the native form of EFE-3 was expressed in COS-7 cells in the medium. Both the refolding product of inclusion bodies and the secreted protease could dissolve the artificial fibrin plate.

  12. Genomics and physiology of a marine flavobacterium encoding a proteorhodopsin and a xanthorhodopsin-like protein.

    Directory of Open Access Journals (Sweden)

    Thomas Riedel

    Full Text Available Proteorhodopsin (PR photoheterotrophy in the marine flavobacterium Dokdonia sp. PRO95 has previously been investigated, showing no growth stimulation in the light at intermediate carbon concentrations. Here we report the genome sequence of strain PRO95 and compare it to two other PR encoding Dokdonia genomes: that of strain 4H-3-7-5 which shows the most similar genome, and that of strain MED134 which grows better in the light under oligotrophic conditions. Our genome analysis revealed that the PRO95 genome as well as the 4H-3-7-5 genome encode a protein related to xanthorhodopsins. The genomic environment and phylogenetic distribution of this gene suggest that it may have frequently been recruited by lateral gene transfer. Expression analyses by RT-PCR and direct mRNA-sequencing showed that both rhodopsins and the complete β-carotene pathway necessary for retinal production are transcribed in PRO95. Proton translocation measurements showed enhanced proton pump activity in response to light, supporting that one or both rhodopsins are functional. Genomic information and carbon source respiration data were used to develop a defined cultivation medium for PRO95, but reproducible growth always required small amounts of yeast extract. Although PRO95 contains and expresses two rhodopsin genes, light did not stimulate its growth as determined by cell numbers in a nutrient poor seawater medium that mimics its natural environment, confirming previous experiments at intermediate carbon concentrations. Starvation or stress conditions might be needed to observe the physiological effect of light induced energy acquisition.

  13. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... DNA methylation is an indispensable epigenetic modification required for regulating the expression of mammalian ... wide, featuring the methyl-DNA immunoprecipitation (MeDIP) coupled with next-generation sequencing. Our method uses a ...... segmentation of chimpanzee genome. In Proceedings of the ...

  14. Small and large scale genomic DNA isolation protocol for chickpea ...

    African Journals Online (AJOL)

    Small and large scale genomic DNA isolation protocol for chickpea ( Cicer arietinum L.), suitable for molecular marker and transgenic analyses. ... Chickpea is an important food legume crop with high nutritional value. Lack of appropriate DNA isolation protocol is a limiting factor for any molecular studies of this crop.

  15. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  16. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    ... with starches. The isolated DNA proved amenable to polymerase chain reaction (PCR) amplification and restriction digestion. This technique is fast, reproducible, and can be applied for simple sequence repeats (SSR)-PCR markers identification. Key words: Annona senegalensis, genomic DNA, fruits, modified, markers.

  17. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

  18. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin. cDNA cloned ...

  19. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    Science.gov (United States)

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  20. Structured RNAs in the ENCODE selected regions of the human genome

    DEFF Research Database (Denmark)

    Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O

    2007-01-01

    Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...

  1. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  2. Role of oxidative DNA damage in genome instability and cancer

    International Nuclear Information System (INIS)

    Bignami, M.; Kunkel, T.

    2009-01-01

    Inactivation of mismatch repair (MMR) is associated with a dramatic genomic instability that is observed experimentally as a mutator phenotype and micro satellite instability (MSI). It has been implicit that the massive genetic instability in MMR defective cells simply reflects the accumulation of spontaneous DNA polymerase errors during DNA replication. We recently identified oxidation damage, a common threat to DNA integrity to which purines are very susceptible, as an important cofactor in this genetic instability

  3. Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

    Science.gov (United States)

    Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

    2018-04-01

    Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may

  4. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  5. Selective microbial genomic DNA isolation using restriction endonucleases.

    Science.gov (United States)

    Barnes, Helen E; Liu, Guohong; Weston, Christopher Q; King, Paula; Pham, Long K; Waltz, Shannon; Helzer, Kimberly T; Day, Laura; Sphar, Dan; Yamamoto, Robert T; Forsyth, R Allyn

    2014-01-01

    To improve the metagenomic analysis of complex microbiomes, we have repurposed restriction endonucleases as methyl specific DNA binding proteins. As an example, we use DpnI immobilized on magnetic beads. The ten minute extraction technique allows specific binding of genomes containing the DpnI Gm6ATC motif common in the genomic DNA of many bacteria including γ-proteobacteria. Using synthetic genome mixtures, we demonstrate 80% recovery of Escherichia coli genomic DNA even when only femtogram quantities are spiked into 10 µg of human DNA background. Binding is very specific with less than 0.5% of human DNA bound. Next Generation Sequencing of input and enriched synthetic mixtures results in over 100-fold enrichment of target genomes relative to human and plant DNA. We also show comparable enrichment when sequencing complex microbiomes such as those from creek water and human saliva. The technique can be broadened to other restriction enzymes allowing for the selective enrichment of trace and unculturable organisms from complex microbiomes and the stratification of organisms according to restriction enzyme enrichment.

  6. DNA Repair and Genome Maintenance in Bacillus subtilis

    Science.gov (United States)

    Lenhart, Justin S.; Schroeder, Jeremy W.; Walsh, Brian W.

    2012-01-01

    Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis. PMID:22933559

  7. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  8. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  9. Nuclear genome transfer in human oocytes eliminates mitochondrial DNA variants.

    Science.gov (United States)

    Paull, Daniel; Emmanuele, Valentina; Weiss, Keren A; Treff, Nathan; Stewart, Latoya; Hua, Haiqing; Zimmer, Matthew; Kahler, David J; Goland, Robin S; Noggle, Scott A; Prosser, Robert; Hirano, Michio; Sauer, Mark V; Egli, Dieter

    2013-01-31

    Mitochondrial DNA mutations transmitted maternally within the oocyte cytoplasm often cause life-threatening disorders. Here we explore the use of nuclear genome transfer between unfertilized oocytes of two donors to prevent the transmission of mitochondrial mutations. Nuclear genome transfer did not reduce developmental efficiency to the blastocyst stage, and genome integrity was maintained provided that spontaneous oocyte activation was avoided through the transfer of incompletely assembled spindle-chromosome complexes. Mitochondrial DNA transferred with the nuclear genome was initially detected at levels below 1%, decreasing in blastocysts and stem-cell lines to undetectable levels, and remained undetectable after passaging for more than one year, clonal expansion, differentiation into neurons, cardiomyocytes or β-cells, and after cellular reprogramming. Stem cells and differentiated cells had mitochondrial respiratory chain enzyme activities and oxygen consumption rates indistinguishable from controls. These results demonstrate the potential of nuclear genome transfer to prevent the transmission of mitochondrial disorders in humans.

  10. De novo assembly of the carrot mitochondrial genome using next generation sequencing of whole genomic DNA provides first evidence of DNA transfer into an angiosperm plastid genome

    Directory of Open Access Journals (Sweden)

    Iorizzo Massimo

    2012-05-01

    Full Text Available Abstract Background Sequence analysis of organelle genomes has revealed important aspects of plant cell evolution. The scope of this study was to develop an approach for de novo assembly of the carrot mitochondrial genome using next generation sequence data from total genomic DNA. Results Sequencing data from a carrot 454 whole genome library were used to develop a de novo assembly of the mitochondrial genome. Development of a new bioinformatic tool allowed visualizing contig connections and elucidation of the de novo assembly. Southern hybridization demonstrated recombination across two large repeats. Genome annotation allowed identification of 44 protein coding genes, three rRNA and 17 tRNA. Identification of the plastid genome sequence allowed organelle genome comparison. Mitochondrial intergenic sequence analysis allowed detection of a fragment of DNA specific to the carrot plastid genome. PCR amplification and sequence analysis across different Apiaceae species revealed consistent conservation of this fragment in the mitochondrial genomes and an insertion in Daucus plastid genomes, giving evidence of a mitochondrial to plastid transfer of DNA. Sequence similarity with a retrotransposon element suggests a possibility that a transposon-like event transferred this sequence into the plastid genome. Conclusions This study confirmed that whole genome sequencing is a practical approach for de novo assembly of higher plant mitochondrial genomes. In addition, a new aspect of intercompartmental genome interaction was reported providing the first evidence for DNA transfer into an angiosperm plastid genome. The approach used here could be used more broadly to sequence and assemble mitochondrial genomes of diverse species. This information will allow us to better understand intercompartmental interactions and cell evolution.

  11. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  12. Immune response induced by candidate Sarcoptes scabiei var. cuniculi DNA vaccine encoding paramyosin in mice.

    Science.gov (United States)

    Gu, Xiaobin; Xie, Yue; Wang, Shuxian; Peng, Xuerong; Lai, Songjia; Yang, Guangyou

    2014-07-01

    Sarcoptes scabiei is the causal agent of the highly contagious disease sarcoptic mange (scabies) that affects animals and humans worldwide. An increasing number of cases of treatment failure is being reported because of drug resistance. The development of a specific vaccine would be a sustainable option for control of this disease. In this study, we cloned and expressed a S. scabiei gene encoding paramyosin (PAR) and investigated the immune response elicited by DNA encoding PAR in mice. The ability of the DNA vaccine to express antigen in COS-7 cells was confirmed by RT-PCR and IFA. The immune response induced by DNA vaccine was investigated by ELISA, splenocyte proliferation assay, and cytokine production assay. Compared to the pVAX1 control group, the PAR DNA vaccination group showed the higher levels of IgG, IgG1, IgG2a, IgE, IgM, stronger lymphocyte proliferation in mouse spleen, and larger production of IL-2, IL-4, IL-5, and IFN-γ in the supernatant of cultures from splenocytes. These results indicated that the PAR DNA vaccine induced a mixed Th1/Th2 response in mice. In conclusion, our results revealed that the S. scabiei PAR DNA vaccine induced both a humoral and cellular immune response, which would provide basic data for the further study to develop an effective vaccine against sarcoptic mange.

  13. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  14. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes.

    Science.gov (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg

    2017-05-20

    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Mapping of polypeptides encoded by the Epstein-Barr virus genome in productive infection.

    OpenAIRE

    Hummel, M; Kieff, E

    1982-01-01

    Over 30 viral-specified polypeptides are translated in vitro from RNA of cells productively infected with Epstein-Barr virus (EBV). The polypeptides map to sites in EBV DNA by hybrid selection. Almost all of the polypeptides are reactive with EBV immune human serum. Several of the polypeptides are part of the early antigen complex. Two others are likely to be major structural components of the virus. Genes encoding persistent early and late polypeptides are intermixed through most of the EBV ...

  16. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  17. Adenovirus core protein VII down-regulates the DNA damage response on the host genome.

    Science.gov (United States)

    Avgousti, Daphne C; Della Fera, Ashley N; Otter, Clayton J; Herrmann, Christin; Pancholi, Neha J; Weitzman, Matthew D

    2017-08-09

    Viral manipulation of cellular proteins allows viruses to suppress host defenses and generate infectious progeny. Due to the linear double-stranded DNA nature of the adenovirus genome, the cellular DNA damage response (DDR) is considered a barrier for successful infection. The adenovirus genome is packaged with protein VII, a viral-encoded histone-like core protein that is suggested to protect incoming viral genomes from detection by cellular DNA damage machinery. We showed that protein VII localizes to host chromatin during infection, leading us to hypothesize that protein VII may affect DNA damage responses on the cellular genome. Here, we show that protein VII at cellular chromatin results in a significant decrease in accumulation of phosphorylated H2AX (γH2AX) following irradiation, indicating that protein VII inhibits DDR signaling. The oncoprotein SET was recently suggested to modulate the DDR by affecting access of repair proteins to chromatin. Since protein VII binds SET, we investigated a role for SET in DDR inhibition by protein VII. We show that knockdown of SET partially rescues the protein VII-induced decrease in γH2AX accumulation on the host genome, suggesting that SET is required for inhibition. Finally, we show that knockdown of SET also allows ATM to localize to incoming viral genomes bound by protein VII during infection with a mutant lacking early region E4. Together, our data suggest that the protein VII-SET interaction contributes to DDR evasion by adenovirus. Our results provide an additional example of a strategy used by adenovirus to manipulate the host DDR and show how viruses can modify cellular processes through manipulation of host chromatin. IMPORTANCE The DNA damage response (DDR) is a cellular network crucial for maintaining genome integrity. DNA viruses replicating in the nucleus challenge the resident genome and must overcome cellular responses, including the DDR. Adenoviruses are prevalent human pathogens that can cause a

  18. Defining functional DNA elements in the human genome

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  19. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    Science.gov (United States)

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-07

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1.

  20. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  1. Numerical encoding of DNA sequences by chaos game representation with application in similarity comparison.

    Science.gov (United States)

    Hoang, Tung; Yin, Changchuan; Yau, Stephen S-T

    2016-10-01

    Numerical encoding plays an important role in DNA sequence analysis via computational methods, in which numerical values are associated with corresponding symbolic characters. After numerical representation, digital signal processing methods can be exploited to analyze DNA sequences. To reflect the biological properties of the original sequence, it is vital that the representation is one-to-one. Chaos Game Representation (CGR) is an iterative mapping technique that assigns each nucleotide in a DNA sequence to a respective position on the plane that allows the depiction of the DNA sequence in the form of image. Using CGR, a biological sequence can be transformed one-to-one to a numerical sequence that preserves the main features of the original sequence. In this research, we propose to encode DNA sequences by considering 2D CGR coordinates as complex numbers, and apply digital signal processing methods to analyze their evolutionary relationship. Computational experiments indicate that this approach gives comparable results to the state-of-the-art multiple sequence alignment method, Clustal Omega, and is significantly faster. The MATLAB code for our method can be accessed from: www.mathworks.com/matlabcentral/fileexchange/57152. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. A platform for high-throughput screening of DNA-encoded catalyst libraries in organic solvents.

    Science.gov (United States)

    Hook, K Delaney; Chambers, John T; Hili, Ryan

    2017-10-01

    We have developed a novel high-throughput screening platform for the discovery of small-molecules catalysts for bond-forming reactions. The method employs an in vitro selection for bond-formation using amphiphilic DNA-encoded small molecules charged with reaction substrate, which enables selections to be conducted in a variety of organic or aqueous solvents. Using the amine-catalysed aldol reaction as a catalytic model and high-throughput DNA sequencing as a selection read-out, we demonstrate the 1200-fold enrichment of a known aldol catalyst from a library of 16.7-million uncompetitive library members.

  3. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  4. Two-label peak-height encoded DNA sequencing by capillary gel electrophoresis: three examples.

    OpenAIRE

    Chen, D; Harke, H R; Dovichi, N J

    1992-01-01

    We report a modification to the peak-height encoded DNA sequencing technique of Tabor and Richardson. As in the original protocol, the sequencing reaction uses modified T7 polymerase with manganese rather than magnesium to produce very uniform incorporation of each dideoxynucleoside. To improve sequencing accuracy, two fluorescently labeled primers are employed in separate sequencing reactions. As an example, one sequencing reaction uses a FAM-labeled primer with dideoxyadenosine triphosphate...

  5. Oxidative DNA damage causes mitochondrial genomic instability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Doudican, Nicole A; Song, Binwei; Shadel, Gerald S; Doetsch, Paul W

    2005-06-01

    Mitochondria contain their own genome, the integrity of which is required for normal cellular energy metabolism. Reactive oxygen species (ROS) produced by normal mitochondrial respiration can damage cellular macromolecules, including mitochondrial DNA (mtDNA), and have been implicated in degenerative diseases, cancer, and aging. We developed strategies to elevate mitochondrial oxidative stress by exposure to antimycin and H(2)O(2) or utilizing mutants lacking mitochondrial superoxide dismutase (sod2Delta). Experiments were conducted with strains compromised in mitochondrial base excision repair (ntg1Delta) and oxidative damage resistance (pif1Delta) in order to delineate the relationship between these pathways. We observed enhanced ROS production, resulting in a direct increase in oxidative mtDNA damage and mutagenesis. Repair-deficient mutants exposed to oxidative stress conditions exhibited profound genomic instability. Elimination of Ntg1p and Pif1p resulted in a synergistic corruption of respiratory competency upon exposure to antimycin and H(2)O(2). Mitochondrial genomic integrity was substantially compromised in ntg1Delta pif1Delta sod2Delta strains, since these cells exhibit a total loss of mtDNA. A stable respiration-defective strain, possessing a normal complement of mtDNA damage resistance pathways, exhibited a complete loss of mtDNA upon exposure to antimycin and H(2)O(2). This loss was preventable by Sod2p overexpression. These results provide direct evidence that oxidative mtDNA damage can be a major contributor to mitochondrial genomic instability and demonstrate cooperation of Ntg1p and Pif1p to resist the introduction of lesions into the mitochondrial genome.

  6. Genomic libraries: II. Subcloning, sequencing, and assembling large-insert genomic DNA clones.

    Science.gov (United States)

    Quail, Mike A; Matthews, Lucy; Sims, Sarah; Lloyd, Christine; Beasley, Helen; Baxter, Simon W

    2011-01-01

    Sequencing large insert clones to completion is useful for characterizing specific genomic regions, identifying haplotypes, and closing gaps in whole genome sequencing projects. Despite being a standard technique in molecular laboratories, DNA sequencing using the Sanger method can be highly problematic when complex secondary structures or sequence repeats are encountered in genomic clones. Here, we describe methods to isolate DNA from a large insert clone (fosmid or BAC), subclone the sample, and sequence the region to the highest industry standard. Troubleshooting solutions for sequencing difficult templates are discussed.

  7. Differential DNA Methylation Analysis without a Reference Genome

    Directory of Open Access Journals (Sweden)

    Johanna Klughammer

    2015-12-01

    Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

  8. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  9. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  10. Analysis of phage Mu DNA transposition by whole-genome ...

    Indian Academy of Sciences (India)

    labelled ChIP DNA and Cy3-labelled whole-genome DNA, both amplified by random primers. The 'ratio' value of each probe (fluorescence intensity of Cy5 over Cy3) is the relative enrichment of that probe sequence in the ChIP sample, referred to as the relative MuB binding preference, or BBP. A scatter plot of log2 BBP ...

  11. Shearing DNA for genomic library construction.

    Science.gov (United States)

    Hengen, P N

    1997-07-01

    Methods and reagents is a unique monthly column that highlights current discussion in the newsgroup bionet.molibio.methds-reagnts, available on the internet. This month's column discusses the pros and cons of various techniques used to shear DNA for shotgun cloning. For details on how to partake in the newsgroup, see the accompanying box.

  12. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    Science.gov (United States)

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Cloning and expression of full-length cDNA encoding human vitamin D receptor

    Energy Technology Data Exchange (ETDEWEB)

    Baker, A.R.; McDonnell, D.P.; Hughes, M.; Crisp, T.M.; Mangelsdorf, D.J.; Haussler, M.R.; Pike, J.W.; Shine, J.; O' Malley, B.W. (California Biotechnology Inc., Mountain View (USA))

    1988-05-01

    Complementary DNA clones encoding the human vitamin D receptor have been isolated from human intestine and T47D cell cDNA libraries. The nucleotide sequence of the 4605-base pair (bp) cDNA includes a noncoding leader sequence of 115 bp, a 1281-bp open reading frame, and 3209 bp of 3{prime} noncoding sequence. Two polyadenylylation signals, AATAAA, are present 25 and 70 bp upstream of the poly(A) tail, respectively. RNA blot hybridization indicates a single mRNA species of {approx} 4600 bp. Transfection of the cloned sequences into COS-1 cells results in the production of a single receptor species indistinguishable from the native receptor. Sequence comparisons demonstrate that the vitamin D receptor belongs to the steroid-receptor gene family and is closest in size and sequence to another member of this family, the thyroid hormone receptor.

  14. Identification of differential genes by suppression subtractive hybridization: I. Preparation of subtracted cDNA or genomic DNA library.

    Science.gov (United States)

    Rebrikov, Denis V

    2008-07-01

    INTRODUCTIONSuppression subtractive hybridization (SSH) is one of the most powerful and popular methods for generating subtracted cDNA or genomic DNA libraries. This technique can be used to compare two mRNA populations and obtain cDNAs representing genes that are either overexpressed or exclusively expressed in one population as compared to another. It can also be used for comparison of genomic DNA populations. This protocol describes the preparation of a subtracted cDNA or genomic DNA library, and includes methods for cDNA synthesis, tester and driver DNA digestion, and adapter ligation.

  15. Extreme mitochondrial evolution in the ctenophore Mnemiopsis leidyi: Insight from mtDNA and the nuclear genome.

    Science.gov (United States)

    Pett, Walker; Ryan, Joseph F; Pang, Kevin; Mullikin, James C; Martindale, Mark Q; Baxevanis, Andreas D; Lavrov, Dennis V

    2011-08-01

    Recent advances in sequencing technology have led to a rapid accumulation of mitochondrial DNA (mtDNA) sequences, which now represent the wide spectrum of animal diversity. However, one animal phylum--Ctenophora--has, to date, remained completely unsampled. Ctenophores, a small group of marine animals, are of interest due to their unusual biology, controversial phylogenetic position, and devastating impact as invasive species. Using data from the Mnemiopsis leidyi genome sequencing project, we Polymerase Chain Reaction (PCR) amplified and analyzed its complete mitochondrial (mt-) genome. At just over 10 kb, the mt-genome of M. leidyi is the smallest animal mtDNA ever reported and is among the most derived. It has lost at least 25 genes, including atp6 and all tRNA genes. We show that atp6 has been relocated to the nuclear genome and has acquired introns and a mitochondrial targeting presequence, while tRNA genes have been genuinely lost, along with nuclear-encoded mt-aminoacyl tRNA synthetases. The mt-genome of M. leidyi also displays extremely high rates of sequence evolution, which likely led to the degeneration of both protein and rRNA genes. In particular, encoded rRNA molecules possess little similarity with their homologs in other organisms and have highly reduced secondary structures. At the same time, nuclear encoded mt-ribosomal proteins have undergone expansions, likely to compensate for the reductions in mt-rRNA. The unusual features identified in M. leidyi mtDNA make this organism an interesting system for the study of various aspects of mitochondrial biology, particularly protein and tRNA import and mt-ribosome structures, and add to its value as an emerging model species. Furthermore, the fast-evolving M. leidyi mtDNA should be a convenient molecular marker for species- and population-level studies.

  16. Extreme Mitochondrial Evolution in the Ctenophore Mnemiopsis leidyi: Insights from mtDNA and the Nuclear Genome

    Science.gov (United States)

    Pett, Walker; Ryan, Joseph F.; Pang, Kevin; Mullikin, James C.; Martindale, Mark Q.; Baxevanis, Andreas D.; Lavrov, Dennis V.

    2012-01-01

    Recent advances in sequencing technology have led to a rapid accumulation of mitochondrial DNA (mtDNA) sequences, which now represent the wide spectrum of animal diversity. However, one animal phylum – Ctenophora – has, to date, remained completely unsampled. Ctenophores, a small group of marine animals, are of interest due to their unusual biology, controversial phylogenetic position, and devastating impact as an invasive species. Using data from the Mnemiopsis leidyi genome sequencing project, we PCR amplified and analyzed its complete mitochondrial (mt-) genome. At just over 10kb, the mt-genome of M. leidyi is the smallest animal mtDNA ever reported and is among the most derived. It has lost at least 25 genes, including atp6 and all tRNA genes. We show that atp6 has been relocated to the nuclear genome and has acquired introns and a mitochondrial targeting presequence, while tRNA genes have been genuinely lost, along with nuclear-encoded mt-aminoacyl tRNA synthetases. The mt-genome of M. leidyi also displays extremely high rates of sequence evolution, which likely led to the degeneration of both protein and rRNA genes. In particular, encoded rRNA molecules possess little similarity with their homologues in other organisms and have highly reduced secondary structures. At the same time, nuclear encoded mt-ribosomal proteins have undergone expansions, probably to compensate for the reductions in mt-rRNA. The unusual features identified in M. leidyi mtDNA make this organism an interesting system for the study of various aspects of mitochondrial biology, particularly protein and tRNA import and mt-ribosome structures, and add to its value as an emerging model species. Furthermore, the fast-evolving M. leidyi mtDNA should be a convenient molecular marker for species- and population-level studies. PMID:21985407

  17. Chaotic Image Encryption Algorithm Based on Bit Permutation and Dynamic DNA Encoding

    Directory of Open Access Journals (Sweden)

    Xuncai Zhang

    2017-01-01

    Full Text Available With the help of the fact that chaos is sensitive to initial conditions and pseudorandomness, combined with the spatial configurations in the DNA molecule’s inherent and unique information processing ability, a novel image encryption algorithm based on bit permutation and dynamic DNA encoding is proposed here. The algorithm first uses Keccak to calculate the hash value for a given DNA sequence as the initial value of a chaotic map; second, it uses a chaotic sequence to scramble the image pixel locations, and the butterfly network is used to implement the bit permutation. Then, the image is coded into a DNA matrix dynamic, and an algebraic operation is performed with the DNA sequence to realize the substitution of the pixels, which further improves the security of the encryption. Finally, the confusion and diffusion properties of the algorithm are further enhanced by the operation of the DNA sequence and the ciphertext feedback. The results of the experiment and security analysis show that the algorithm not only has a large key space and strong sensitivity to the key but can also effectively resist attack operations such as statistical analysis and exhaustive analysis.

  18. Comparative genomics of DNA recombination and repair in cyanobacteria: biotechnological implications

    Directory of Open Access Journals (Sweden)

    Corinne Cassier-Chauvat

    2016-11-01

    Full Text Available Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb and uvrABCD, even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination, umuCD (mutational DNA replication, as well as the key SOS genes lexA (regulation of the SOS system and sulA (postponing of cell division until completion of DNA reparation. Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively

  19. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2016-01-01

    Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb, and uvrABCD), even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination), umuCD (mutational DNA replication), as well as the key SOS genes lexA (regulation of the SOS system) and sulA (postponing of cell division until completion of DNA reparation). Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA, and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively, these findings

  20. Analysis of phage Mu DNA transposition by whole-genome ...

    Indian Academy of Sciences (India)

    In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced ...

  1. An automated annotation tool for genomic DNA sequences using ...

    Indian Academy of Sciences (India)

    Unknown

    , New Delhi 110 067, India. Abstract ... analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by .... genes for the TCA cycle, while in mitochondria only a subset of the ...

  2. Nuclear DNA content and genome size of trout and human

    Czech Academy of Sciences Publication Activity Database

    Doležel, Jaroslav; Bartoš, Jan; Voglmayr, H.; Greilhuber, J.

    2003-01-01

    Roč. 51, - (2003), s. 127-128 ISSN 0196-4763 R&D Projects: GA AV ČR IBS5038104 Institutional research plan: CEZ:AV0Z5038910 Keywords : flow cytometry * nuclear DNA content * genome size Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.095, year: 2003

  3. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    A very simple biological basis is followed in this procedure, in which, when the bloodis placed in water, it rapidly enters the RBCs by osmosis and causes cells to burst by hemolysis. The validity of extracting genomic DNA was confirmed by several molecular biological experiments. It was found that this method provides an ...

  4. Analysis of phage Mu DNA transposition by whole-genome ...

    Indian Academy of Sciences (India)

    by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or ... able elements (TEs) have learnt to balance self-propagation with host survival. ..... Genome wide mapping of Mu transposition targets and MuB binding on the E. coli chromosome. Top panel, an ...

  5. Genomic DNA isolation from Artemisia species grown in cold desert ...

    African Journals Online (AJOL)

    ... protocol to extract pure genomic DNA from different Artemisia species was tailored. The protocol was based on the CTAB method with slight modifications. In the study, 1.6 M NaCl, 2% cetyltrimethyl ammonium bromide (CTAB), 3% polyvinylpyrrolidone (PVP) and 0.5% β-mercaptoethanol was used in the extraction buffer.

  6. The white spot syndrome virus DNA genome sequence

    NARCIS (Netherlands)

    Hulten, van M.C.W.; Witteveldt, J.; Peters, S.; Kloosterboer, N.; Tarchini, R.; Fiers, M.; Sandbrink, H.; Klein Lankhorst, R.; Vlak, J.M.

    2001-01-01

    White spot syndrome virus (WSSV) is at present a major scourge to worldwide shrimp cultivation. We have determined the entire sequence of the double-stranded, circular DNA genome of WSSV, which contains 292,967 nucleotides encompassing 184 major open reading frames (ORFs). Only 6 f the WSSV ORFs

  7. Molecular characterization of a cDNA encoding copper/zinc superoxide dismutase from cultured cells of Manihot esculenta.

    Science.gov (United States)

    Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo

    2005-01-01

    Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.

  8. Resurrection of DNA function in vivo from an extinct genome.

    Directory of Open Access Journals (Sweden)

    Andrew J Pask

    2008-05-01

    Full Text Available There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine, obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity.

  9. Criminal genomic pragmatism: prisoners' representations of DNA technology and biosecurity.

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  10. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Directory of Open Access Journals (Sweden)

    Helena Machado

    2012-01-01

    Full Text Available Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners’ perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners’ representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  11. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity. PMID:22791960

  12. Vaccination with DNA Encoding an Immunodominant Myelin Basic Protein Peptide Targeted to Fc of Immunoglobulin G Suppresses Experimental Autoimmune Encephalomyelitis

    OpenAIRE

    Lobell, Anna; Weissert, Robert; Storch, Maria K.; Svanholm, Cecilia; de Graaf, Katrien L.; Lassmann, Hans; Andersson, Roland; Olsson, Tomas; Wigzell, Hans

    1998-01-01

    We explore here if vaccination with DNA encoding an autoantigenic peptide can suppress autoimmune disease. For this purpose we used experimental autoimmune encephalomyelitis (EAE), which is an autoaggressive disease in the central nervous system and an animal model for multiple sclerosis. Lewis rats were vaccinated with DNA encoding an encephalitogenic T cell epitope, guinea pig myelin basic protein peptide 68–85 (MBP68–85), before induction of EAE with MBP68–85 in complete Freund's adjuvant....

  13. Base-Resolution Analysis of Cisplatin–DNA Adducts at the Genome Scale

    OpenAIRE

    Shu, Xiaoting; Xiong, Xushen; Song, Jinghui; He, Chuan; Yi, Chengqi

    2016-01-01

    Cisplatin, one of the most widely used anticancer drugs, crosslinks DNA and ultimately induces cell death. However, the genomic pattern of cisplatin–DNA adducts has remained unknown owing to the lack of a reliable and sensitive genome-wide method. Herein we present “cisplatin-seq” to identify genome-wide cisplatin crosslinking sites at base resolution. Cisplatin-seq reveals that mitochondrial DNA is a preferred target of cisplatin. For nuclear genomes, cisplatin–DNA adducts are enriched withi...

  14. Cloning and characterization of human liver cDNA encoding a protein S precursor

    International Nuclear Information System (INIS)

    Hoskins, J.; Norman, D.K.; Beckmann, R.J.; Long, G.L.

    1987-01-01

    Human liver cDNA encoding a protein S precursor was isolated from two cDNA libraries by two different techniques. Based upon the frequency of positive clones, the abundance of mRNA for protein S is ≅ 0.01%. Blot hybridization of electrophoretically fractionated poly(A) + RNA revealed a major mRNA ≅ 4 kilobases long and two minor forms of ≅ 3.1 and ≅ 2.6 kilobases. One of the cDNA clones contains a segment encoding a 676 amino acid protein S precursor, as well as 108 and 1132 nucleotides of 5' and 3' noncoding sequence, respectively, plus a poly(A) region at the 3' end. The cDNAs are adenosine plus thymidine-rich (60%) except for the 5' noncoding region, where 78% of the nucleotides are guanosine or cytosine. The protein precursor consists of a 41 amino acid leader peptide followed by 635 amino acids corresponding to mature protein S. Comparison of the mature protein region with homologous vitamin K-dependent plasma proteins shows that it is composed of the following domains: an amino-terminal γ-carboxyglutamic acid-rich region of 37 amino acids; a 36 amino acid linker region rich in hydroxy amino acids; four epidermal growth factor-like segments, each ≅ 45 amino acids long; and a 387 amino acid carboxyl-terminal domain of unrecognized structure and unknown function

  15. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  16. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Comparisons of the M1 genome segments and encoded μ2 proteins of different reovirus isolates

    Directory of Open Access Journals (Sweden)

    Arnold Michelle M

    2004-09-01

    Full Text Available Abstract Background The reovirus M1 genome segment encodes the μ2 protein, a structurally minor component of the viral core, which has been identified as a transcriptase cofactor, nucleoside and RNA triphosphatase, and microtubule-binding protein. The μ2 protein is the most poorly understood of the reovirus structural proteins. Genome segment sequences have been reported for 9 of the 10 genome segments for the 3 prototypic reoviruses type 1 Lang (T1L, type 2 Jones (T2J, and type 3 Dearing (T3D, but the M1 genome segment sequences for only T1L and T3D have been previously reported. For this study, we determined the M1 nucleotide and deduced μ2 amino acid sequences for T2J, nine other reovirus field isolates, and various T3D plaque-isolated clones from different laboratories. Results Determination of the T2J M1 sequence completes the analysis of all ten genome segments of that prototype. The T2J M1 sequence contained a 1 base pair deletion in the 3' non-translated region, compared to the T1L and T3D M1 sequences. The T2J M1 gene showed ~80% nucleotide homology, and the encoded μ2 protein showed ~71% amino acid identity, with the T1L and T3D M1 and μ2 sequences, respectively, making the T2J M1 gene and μ2 proteins amongst the most divergent of all reovirus genes and proteins. Comparisons of these newly determined M1 and μ2 sequences with newly determined M1 and μ2 sequences from nine additional field isolates and a variety of laboratory T3D clones identified conserved features and/or regions that provide clues about μ2 structure and function. Conclusions The findings suggest a model for the domain organization of μ2 and provide further evidence for a role of μ2 in viral RNA synthesis. The new sequences were also used to explore the basis for M1/μ2-determined differences in the morphology of viral factories in infected cells. The findings confirm the key role of Ser/Pro208 as a prevalent determinant of differences in factory morphology

  18. Cloning and Characterization of a cDNA Encoding a Novel Extracellular Peroxidase from Trametes versicolor

    Science.gov (United States)

    Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.

    1999-01-01

    The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906

  19. Whole exome and whole genome sequencing with dried blood spot DNA without whole genome amplification.

    Science.gov (United States)

    Bassaganyas, Laia; Freedman, George; Vaka, Dedeepya; Wan, Eunice; Lao, Richard; Chen, Flavia; Kvale, Mark; Currier, Robert J; Puck, Jennifer M; Kwok, Pui-Yan

    2018-01-01

    Newborn screening (NBS) for rare conditions is performed in all 50 states in the USA. We have partnered with the California Department of Public Health Genetic Disease Laboratory to determine whether sufficient DNA can be extracted from archived dried blood spots (DBS) for next-generation sequencing in the hopes that next-generation sequencing can play a role in NBS. We optimized the DNA extraction and sequencing library preparation protocols for residual infant DBS archived over 20 years ago and successfully obtained acceptable whole exome and whole genome sequencing data. This sequencing study using DBS DNA without whole genome amplification prior to sequencing library preparation provides evidence that properly stored residual newborn DBS are a satisfactory source of DNA for genetic studies. © 2017 Wiley Periodicals, Inc.

  20. Design optimization methods for genomic DNA tiling arrays.

    Science.gov (United States)

    Bertone, Paul; Trifonov, Valery; Rozowsky, Joel S; Schubert, Falk; Emanuelsson, Olof; Karro, John; Kao, Ming-Yang; Snyder, Michael; Gerstein, Mark

    2006-02-01

    A recent development in microarray research entails the unbiased coverage, or tiling, of genomic DNA for the large-scale identification of transcribed sequences and regulatory elements. A central issue in designing tiling arrays is that of arriving at a single-copy tile path, as significant sequence cross-hybridization can result from the presence of non-unique probes on the array. Due to the fragmentation of genomic DNA caused by the widespread distribution of repetitive elements, the problem of obtaining adequate sequence coverage increases with the sizes of subsequence tiles that are to be included in the design. This becomes increasingly problematic when considering complex eukaryotic genomes that contain many thousands of interspersed repeats. The general problem of sequence tiling can be framed as finding an optimal partitioning of non-repetitive subsequences over a prescribed range of tile sizes, on a DNA sequence comprising repetitive and non-repetitive regions. Exact solutions to the tiling problem become computationally infeasible when applied to large genomes, but successive optimizations are developed that allow their practical implementation. These include an efficient method for determining the degree of similarity of many oligonucleotide sequences over large genomes, and two algorithms for finding an optimal tile path composed of longer sequence tiles. The first algorithm, a dynamic programming approach, finds an optimal tiling in linear time and space; the second applies a heuristic search to reduce the space complexity to a constant requirement. A Web resource has also been developed, accessible at http://tiling.gersteinlab.org, to generate optimal tile paths from user-provided DNA sequences.

  1. The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability.

    Science.gov (United States)

    Hamperl, Stephan; Cimprich, Karlene A

    2014-07-01

    Accurate DNA replication and DNA repair are crucial for the maintenance of genome stability, and it is generally accepted that failure of these processes is a major source of DNA damage in cells. Intriguingly, recent evidence suggests that DNA damage is more likely to occur at genomic loci with high transcriptional activity. Furthermore, loss of certain RNA processing factors in eukaryotic cells is associated with increased formation of co-transcriptional RNA:DNA hybrid structures known as R-loops, resulting in double-strand breaks (DSBs) and DNA damage. However, the molecular mechanisms by which R-loop structures ultimately lead to DNA breaks and genome instability is not well understood. In this review, we summarize the current knowledge about the formation, recognition and processing of RNA:DNA hybrids, and discuss possible mechanisms by which these structures contribute to DNA damage and genome instability in the cell. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. DNA Vaccines Encoding Toxoplasma gondii Cathepsin C 1 Induce Protection against Toxoplasmosis in Mice.

    Science.gov (United States)

    Han, Yali; Zhou, Aihua; Lu, Gang; Zhao, Guanghui; Sha, Wenchao; Wang, Lin; Guo, Jingjing; Zhou, Jian; Zhou, Huaiyu; Cong, Hua; He, Shenyi

    2017-10-01

    Toxoplasma gondii cathepsin C proteases (TgCPC1, 2, and 3) are important for the growth and survival of T. gondii. In the present study, B-cell and T-cell epitopes of TgCPC1 were predicted using DNAstar and the Immune Epitope Database. A TgCPC1 DNA vaccine was constructed, and its ability to induce protective immune responses against toxoplasmosis in BALB/c mice was evaluated in the presence or absence of the adjuvant α-GalCer. As results, TgCPC1 DNA vaccine with or without adjuvant α-GalCer showed higher levels of IgG and IgG2a in the serum, as well as IL-2 and IFN-γ in the spleen compared to controls (PBS, pEGFP-C1, and α-Galcer). Upon challenge infection with tachyzoites of T. gondii (RH), pCPC1/α-Galcer immunized mice showed the longest survival among all the groups. Mice vaccinated with DNA vaccine without adjuvant (pCPC1) showed better protective immunity compared to other controls (PBS, pEGFP-C1, and α-Galcer). These results indicate that a DNA vaccine encoding TgCPC1 is a potential vaccine candidate against toxoplasmosis.

  4. Homologous recombination-mediated cloning and manipulation of genomic DNA regions using Gateway and recombineering systems.

    Science.gov (United States)

    Rozwadowski, Kevin; Yang, Wen; Kagale, Sateesh

    2008-11-17

    Employing genomic DNA clones to characterise gene attributes has several advantages over the use of cDNA clones, including the presence of native transcription and translation regulatory sequences as well as a representation of the complete repertoire of potential splice variants encoded by the gene. However, working with genomic DNA clones has traditionally been tedious due to their large size relative to cDNA clones and the presence, absence or position of particular restriction enzyme sites that may complicate conventional in vitro cloning procedures. To enable efficient cloning and manipulation of genomic DNA fragments for the purposes of gene expression and reporter-gene studies we have combined aspects of the Gateway system and a bacteriophage-based homologous recombination (i.e. recombineering) system. To apply the method for characterising plant genes we developed novel Gateway and plant transformation vectors that are of small size and incorporate selectable markers which enable efficient identification of recombinant clones. We demonstrate that the genomic coding region of a gene can be directly cloned into a Gateway Entry vector by recombineering enabling its subsequent transfer to Gateway Expression vectors. We also demonstrate how the coding and regulatory regions of a gene can be directly cloned into a plant transformation vector by recombineering. This construct was then rapidly converted into a novel Gateway Expression vector incorporating cognate 5' and 3' regulatory regions by using recombineering to replace the intervening coding region with the Gateway Destination cassette. Such expression vectors can be applied to characterise gene regulatory regions through development of reporter-gene fusions, using the Gateway Entry clones of GUS and GFP described here, or for ectopic expression of a coding region cloned into a Gateway Entry vector. We exemplify the utility of this approach with the Arabidopsis PAP85 gene and demonstrate that the expression

  5. Characterization of noncoding regulatory DNA in the human genome.

    Science.gov (United States)

    Elkon, Ran; Agami, Reuven

    2017-08-08

    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  6. Vaccination with DNA encoding an immunodominant myelin basic protein peptide targeted to Fc of immunoglobulin G suppresses experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Lobell, A; Weissert, R; Storch, M K; Svanholm, C; de Graaf, K L; Lassmann, H; Andersson, R; Olsson, T; Wigzell, H

    1998-05-04

    We explore here if vaccination with DNA encoding an autoantigenic peptide can suppress autoimmune disease. For this purpose we used experimental autoimmune encephalomyelitis (EAE), which is an autoaggressive disease in the central nervous system and an animal model for multiple sclerosis. Lewis rats were vaccinated with DNA encoding an encephalitogenic T cell epitope, guinea pig myelin basic protein peptide 68-85 (MBP68-85), before induction of EAE with MBP68-85 in complete Freund's adjuvant. Compared to vaccination with a control DNA construct, the vaccination suppressed clinical and histopathological signs of EAE, and reduced the interferon gamma production after challenge with MBP68-85. Targeting of the gene product to Fc of IgG was essential for this effect. There were no signs of a Th2 cytokine bias. Our data suggest that DNA vaccines encoding autoantigenic peptides may be useful tools in controlling autoimmune disease.

  7. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Much of the human genome is CpG depleted with the exception of CpG islands which are defined as 200-bp stretches of DNA with a C+G content of 50% and an observed CpG/expected CpG exceeding 0.6(Gardiner-. Garden and Frommer, 1987). In the promotor region of genes CpG islands are abundant ...

  8. Plant DNA flow cytometry and estimation of nuclear genome size

    Czech Academy of Sciences Publication Activity Database

    Doležel, Jaroslav; Bartoš, Jan

    2005-01-01

    Roč. 95, - (2005), s. 99-110 ISSN 0305-7364 R&D Projects: GA ČR GA522/03/0354; GA ČR GA204/04/1207 Institutional research plan: CEZ:AV0Z50380511 Keywords : flow cytometry * nuclear genome size * DNA C-value Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.665, year: 2005

  9. Prospects for exploring the molecular-genomic foundations of therapeutic hypnosis with DNA microarrays.

    Science.gov (United States)

    Rossi, Ernest Lawrence

    A new perspective on how therapeutic hypnosis and neuroscience may be integrated on the molecular-genomic level is offered as a guide for basic research and clinical applications. An update of Watson and Crick's original formulation of molecular biology is proposed to illustrate how psychosocial experiences modulate gene expression, protein synthesis, and brain plasticity during memory trace reactivation for the reorganization of neural networks that encode fear, stress, and traumatic symptoms. Examples of the scientific literature on DNA microarrays are used to explore how this new technology could integrate therapeutic hypnosis, neuroscience, and psychosocial genomics as a new foundation for mind-body medicine. Researchers and clinicians in therapeutic hypnosis need to partner with colleagues in neuroscience and molecular biology that utilize DNA microarray technology. It is recommended that hypnotic susceptibility scales of the future incorporate gene expression data to include the concept of "embodied imagination" and the "ideo-plastic faculty" on a molecular-genomic level as well as the psychological and behavioral level of ideomotor and ideosensory responses that are currently assessed.

  10. Identification of Methylated Deoxyadenosines in Genomic DNA by dA6m DNA Immunoprecipitation

    OpenAIRE

    Koziol, Magdalena J.; Bradshaw, Charles R.; Allen, George E.; Costa, Ana S.H.; Frezza, Christian

    2016-01-01

    dA6m DNA immunoprecipitation followed by deep sequencing (DIP-Seq) is a key tool in identifying and studying the genome-wide distribution of N6-methyldeoxyadenosine (dA6m). The precise function of this novel DNA modification remains to be fully elucidated, but it is known to be absent from transcriptional start sites and excluded from exons, suggesting a role in transcriptional regulation (Koziol et al., 2015). Importantly, its existence suggests that DNA might be more diverse than previously...

  11. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.

    Directory of Open Access Journals (Sweden)

    Shunsuke Suzuki

    2007-04-01

    Full Text Available Among mammals, only eutherians and marsupials are viviparous and have genomic imprinting that leads to parent-of-origin-specific differential gene expression. We used comparative analysis to investigate the origin of genomic imprinting in mammals. PEG10 (paternally expressed 10 is a retrotransposon-derived imprinted gene that has an essential role for the formation of the placenta of the mouse. Here, we show that an orthologue of PEG10 exists in another therian mammal, the marsupial tammar wallaby (Macropus eugenii, but not in a prototherian mammal, the egg-laying platypus (Ornithorhynchus anatinus, suggesting its close relationship to the origin of placentation in therian mammals. We have discovered a hitherto missing link of the imprinting mechanism between eutherians and marsupials because tammar PEG10 is the first example of a differentially methylated region (DMR associated with genomic imprinting in marsupials. Surprisingly, the marsupial DMR was strictly limited to the 5' region of PEG10, unlike the eutherian DMR, which covers the promoter regions of both PEG10 and the adjacent imprinted gene SGCE. These results not only demonstrate a common origin of the DMR-associated imprinting mechanism in therian mammals but provide the first demonstration that DMR-associated genomic imprinting in eutherians can originate from the repression of exogenous DNA sequences and/or retrotransposons by DNA methylation.

  12. A comparative encyclopedia of DNA elements in the mouse genome.

    Science.gov (United States)

    Yue, Feng; Cheng, Yong; Breschi, Alessandra; Vierstra, Jeff; Wu, Weisheng; Ryba, Tyrone; Sandstrom, Richard; Ma, Zhihai; Davis, Carrie; Pope, Benjamin D; Shen, Yin; Pervouchine, Dmitri D; Djebali, Sarah; Thurman, Robert E; Kaul, Rajinder; Rynes, Eric; Kirilusha, Anthony; Marinov, Georgi K; Williams, Brian A; Trout, Diane; Amrhein, Henry; Fisher-Aylor, Katherine; Antoshechkin, Igor; DeSalvo, Gilberto; See, Lei-Hoon; Fastuca, Meagan; Drenkow, Jorg; Zaleski, Chris; Dobin, Alex; Prieto, Pablo; Lagarde, Julien; Bussotti, Giovanni; Tanzer, Andrea; Denas, Olgert; Li, Kanwei; Bender, M A; Zhang, Miaohua; Byron, Rachel; Groudine, Mark T; McCleary, David; Pham, Long; Ye, Zhen; Kuan, Samantha; Edsall, Lee; Wu, Yi-Chieh; Rasmussen, Matthew D; Bansal, Mukul S; Kellis, Manolis; Keller, Cheryl A; Morrissey, Christapher S; Mishra, Tejaswini; Jain, Deepti; Dogan, Nergiz; Harris, Robert S; Cayting, Philip; Kawli, Trupti; Boyle, Alan P; Euskirchen, Ghia; Kundaje, Anshul; Lin, Shin; Lin, Yiing; Jansen, Camden; Malladi, Venkat S; Cline, Melissa S; Erickson, Drew T; Kirkup, Vanessa M; Learned, Katrina; Sloan, Cricket A; Rosenbloom, Kate R; Lacerda de Sousa, Beatriz; Beal, Kathryn; Pignatelli, Miguel; Flicek, Paul; Lian, Jin; Kahveci, Tamer; Lee, Dongwon; Kent, W James; Ramalho Santos, Miguel; Herrero, Javier; Notredame, Cedric; Johnson, Audra; Vong, Shinny; Lee, Kristen; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Canfield, Theresa; Sabo, Peter J; Wilken, Matthew S; Reh, Thomas A; Giste, Erika; Shafer, Anthony; Kutyavin, Tanya; Haugen, Eric; Dunn, Douglas; Reynolds, Alex P; Neph, Shane; Humbert, Richard; Hansen, R Scott; De Bruijn, Marella; Selleri, Licia; Rudensky, Alexander; Josefowicz, Steven; Samstein, Robert; Eichler, Evan E; Orkin, Stuart H; Levasseur, Dana; Papayannopoulou, Thalia; Chang, Kai-Hsin; Skoultchi, Arthur; Gosh, Srikanta; Disteche, Christine; Treuting, Piper; Wang, Yanli; Weiss, Mitchell J; Blobel, Gerd A; Cao, Xiaoyi; Zhong, Sheng; Wang, Ting; Good, Peter J; Lowdon, Rebecca F; Adams, Leslie B; Zhou, Xiao-Qiao; Pazin, Michael J; Feingold, Elise A; Wold, Barbara; Taylor, James; Mortazavi, Ali; Weissman, Sherman M; Stamatoyannopoulos, John A; Snyder, Michael P; Guigo, Roderic; Gingeras, Thomas R; Gilbert, David M; Hardison, Ross C; Beer, Michael A; Ren, Bing

    2014-11-20

    The laboratory mouse shares the majority of its protein-coding genes with humans, making it the premier model organism in biomedical research, yet the two mammals differ in significant ways. To gain greater insights into both shared and species-specific transcriptional and cellular regulatory programs in the mouse, the Mouse ENCODE Consortium has mapped transcription, DNase I hypersensitivity, transcription factor binding, chromatin modifications and replication domains throughout the mouse genome in diverse cell and tissue types. By comparing with the human genome, we not only confirm substantial conservation in the newly annotated potential functional sequences, but also find a large degree of divergence of sequences involved in transcriptional regulation, chromatin state and higher order chromatin organization. Our results illuminate the wide range of evolutionary forces acting on genes and their regulatory regions, and provide a general resource for research into mammalian biology and mechanisms of human diseases.

  13. Complete mitochondrial DNA genome of Microphysogobio brevirostris (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Cheng, Chung-Yao; Wang, Jiang-Ping; Ho, Chuan-Wen; Cheng, Ju-Wen; Ueng, Yih-Tsong

    2015-04-01

    In this study, we sequenced the complete mitochondrial genome of Microphysogobio brevirostris (Cypriniformes, Cyprinidae), an endemic primary freshwater fish in Taiwan. This mitochondrial genome, consisting of 16,608 base pairs (bp), encoded 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a non-coding control region as those found in other vertebrates, with the gene synteny identical to that of typical vertebrates. Control region (D-Loop), of 929 bp lengths long, is located between tRNA(Pro) and tRNA(Phe). The overall base composition of the heavy strand shows T 26.28%, C 26.62%, A 30.26%, and G 16.85%, with a slight AT bias of 56.53%.

  14. Complete mitochondrial DNA genome of Zacco platypus (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Ueng, Yih-Tsong; Chen, Kun-Neng; Han, Chiao-Chuan; Cheng, Chung-Yao; Li, Yi-Min

    2015-04-01

    The complete mitochondrial genome of Zacco platypus (Cypriniformes, Cyprinidae), which has broader distribution range and diverse genetic structure than other species under the genus Zacco, was first determined in this study. The mitochondrial genome is 16,612 base pairs (bp) in length, encoding 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs and 1 non-coding control region. Its gene arrangement and translation direction were identical to those of other typical vertebrate. Control region (D-Loop), of 929 bp lengths long, is located between tRNA(Pro) and tRNA(Phe). The overall base composition of the heavy strand shows T 27.02%, C 26.23%, A 28.94% and G 17.82%, with a slight AT bias of 55.95%.

  15. Characterization of a cDNA encoding metallothionein 3 from cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Jordan, Robin H; Turley, Rickie B; Defauw, Sherri L; Steele, Mark

    2005-04-01

    A cDNA encoding metallothionein (MT) was isolated from a library constructed with poly A(+) RNA purified from 48 h etiolated cotton (Gossypium hirsutum L.) cotyledons. This cDNA encodes a deduced protein with 63 residues and a molecular weight of 6.3 kDa. The protein has 10 cysteines of which 4 are within the CXXCXCXXXXXC amino-terminus motif and six are within the CXCXXXCXCXXCXC carboxyl-terminus motif characteristic of the type III MT (MT3). The cotton MT3 protein sequence is 76.2, 69.8, 66.7, 60.3 and 33.5% identical to MT3 from Carica papaya, Rubus idaeus, Ribes nigrum, Citrus unshiu, and Gossypium hirsutum type I MT, respectively. A fusion protein was constructed by producing PCR primers for the 5' and 3' ends of the cotton MT3 cDNA and ligating the PCR product inframe at the 3' end of a bacterial glutathione S-transferase (GST) gene in the pGEX3 vector. The 5' PCR primer incorporated a segment of the cotton MT3 noncoding region, resulting in an addition of 9 residues to the MT3 (after Factor Xa digestion site) which increased the size of the expressed protein to 72 residues and 7.6 kDa. Expression of the 7.6 kDa protein in bacteria was confirmed by SDS-PAGE. Induction and accumulation of the GST-MT3 protein began inhibiting bacterial growth after 1 h. Addition of Cu (1 muM to 1 mM), 1 mM cysteine, or 1 mM cystine to the media did not rescue growth. Additionally, this protein was evaluated for its ability to bind Cd, Cu, Ni and Zn in the bacterial expression system. We found that cotton MT3 preferentially binds Cu.

  16. Amplification of a Zygosaccharomyces bailii DNA segment in wine yeast genomes by extrachromosomal circular DNA formation.

    Science.gov (United States)

    Galeote, Virginie; Bigey, Frédéric; Beyne, Emmanuelle; Novo, Maite; Legras, Jean-Luc; Casaregola, Serge; Dequin, Sylvie

    2011-03-10

    We recently described the presence of large chromosomal segments resulting from independent horizontal gene transfer (HGT) events in the genome of Saccharomyces cerevisiae strains, mostly of wine origin. We report here evidence for the amplification of one of these segments, a 17 kb DNA segment from Zygosaccharomyces bailii, in the genome of S. cerevisiae strains. The copy number, organization and location of this region differ considerably between strains, indicating that the insertions are independent and that they are post-HGT events. We identified eight different forms in 28 S. cerevisiae strains, mostly of wine origin, with up to four different copies in a single strain. The organization of these forms and the identification of an autonomously replicating sequence functional in S. cerevisiae, strongly suggest that an extrachromosomal circular DNA (eccDNA) molecule serves as an intermediate in the amplification of the Z. bailii region in yeast genomes. We found little or no sequence similarity at the breakpoint regions, suggesting that the insertions may be mediated by nonhomologous recombination. The diversity between these regions in S. cerevisiae represents roughly one third the divergence among the genomes of wine strains, which confirms the recent origin of this event, posterior to the start of wine strain expansion. This is the first report of a circle-based mechanism for the expansion of a DNA segment, mediated by nonhomologous recombination, in natural yeast populations.

  17. Amplification of a Zygosaccharomyces bailii DNA segment in wine yeast genomes by extrachromosomal circular DNA formation.

    Directory of Open Access Journals (Sweden)

    Virginie Galeote

    Full Text Available We recently described the presence of large chromosomal segments resulting from independent horizontal gene transfer (HGT events in the genome of Saccharomyces cerevisiae strains, mostly of wine origin. We report here evidence for the amplification of one of these segments, a 17 kb DNA segment from Zygosaccharomyces bailii, in the genome of S. cerevisiae strains. The copy number, organization and location of this region differ considerably between strains, indicating that the insertions are independent and that they are post-HGT events. We identified eight different forms in 28 S. cerevisiae strains, mostly of wine origin, with up to four different copies in a single strain. The organization of these forms and the identification of an autonomously replicating sequence functional in S. cerevisiae, strongly suggest that an extrachromosomal circular DNA (eccDNA molecule serves as an intermediate in the amplification of the Z. bailii region in yeast genomes. We found little or no sequence similarity at the breakpoint regions, suggesting that the insertions may be mediated by nonhomologous recombination. The diversity between these regions in S. cerevisiae represents roughly one third the divergence among the genomes of wine strains, which confirms the recent origin of this event, posterior to the start of wine strain expansion. This is the first report of a circle-based mechanism for the expansion of a DNA segment, mediated by nonhomologous recombination, in natural yeast populations.

  18. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  19. Intranasal Vaccination against Cutaneous Leishmaniasis with a Particulated Leishmanial Antigen or DNA Encoding LACK

    Science.gov (United States)

    Pinto, Eduardo Fonseca; Pinheiro, Roberta Olmo; Rayol, Alice; Larraga, Vicente; Rossi-Bergmann, Bartira

    2004-01-01

    We have previously demonstrated that oral delivery of a disease-promoting particulated antigen of Leishmania amazonensis (LaAg) partially protects mice against cutaneous leishmaniasis. In the present work, we sought to optimize a mucosal vaccine by using the intranasal route for delivery of different antigen preparations, including (i) LaAg, (ii) soluble recombinant p36/LACK leishmanial antigen (LACK), and (iii) plasmid DNA encoding LACK (LACK DNA). BALB/c mice that received two intranasal doses of 10 μg of LaAg and were challenged 1 week postvaccination with L. amazonensis developed delayed but effective control of lesion growth. A diminished parasite burden was accompanied by enhancement of both gamma interferon (IFN-γ) and interleukin-10 levels in the lesion-draining lymph nodes. The vaccine efficacy improved with time. At 4 months postvaccination, when a strong parasite-specific TH1-type response was present in vivo, the infection was controlled for at least 5 months after challenge. In contrast to the particulated LaAg, soluble LACK (10 μg/dose) had no effect. Interestingly, LACK DNA (30 μg/dose), but not empty DNA, promoted rapid and durable protective immunity. Parasite growth was effectively controlled, and at 5 months after challenge LACK-reactive cells in both the mucosal and lesion-draining lymph nodes produced high levels of IFN-γ. These results demonstrate for the first time the feasibility of using the intranasal route for long-lived memory vaccination against cutaneous leishmaniasis with adjuvant-free crude antigens or DNA. PMID:15271911

  20. Reduced local mutation density in regulatory DNA of cancer genomes is linked to DNA repair.

    Science.gov (United States)

    Polak, Paz; Lawrence, Michael S; Haugen, Eric; Stoletzki, Nina; Stojanov, Petar; Thurman, Robert E; Garraway, Levi A; Mirkin, Sergei; Getz, Gad; Stamatoyannopoulos, John A; Sunyaev, Shamil R

    2014-01-01

    Carcinogenesis and neoplastic progression are mediated by the accumulation of somatic mutations. Here we report that the local density of somatic mutations in cancer genomes is highly reduced specifically in accessible regulatory DNA defined by DNase I hypersensitive sites. This reduction is independent of any known factors influencing somatic mutation density and is observed in diverse cancer types, suggesting a general mechanism. By analyzing individual cancer genomes, we show that the reduced local mutation density within regulatory DNA is linked to intact global genome repair machinery, with nearly complete abrogation of the hypomutation phenomenon in individual cancers that possess mutations in components of the nucleotide excision repair system. Together, our results connect chromatin structure, gene regulation and cancer-associated somatic mutation.

  1. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...... mitochondrial genome of its close relative C. albicans. The complete sequence has implications for both mitochondrial DNA replication and the evolution of linear DNA genomes....

  2. An efficient genomic DNA extraction from whole blood using Nextractor.

    Science.gov (United States)

    Jeong, Tae-Dong; Cho, Young-Uk; Lee, Woochang; Chun, Sail; Min, Won-Ki

    2014-08-05

    We evaluated the performance of the Nextractor NX-48 nucleic acid extractor system for the extraction of genomic DNA from whole blood samples. We compared the performance of the Nextractor to that of the QIAamp DNA Blood Mini Kit and the Maxwell system, using five whole blood samples. Extraction efficiencies were compared based on the total amount of extracted DNA adjusted by input blood volume, and the purity was compared. Polymerase chain reaction analyses were performed using ACTB as a target. The real-time PCR assay was carried out for housekeeping gene GAPDH. Total elapsed time for DNA extraction was compared. Extraction efficiencies for the QIAamp, Maxwell, and Nextractor were 25.4±3.8ng/μL, 9.2±0.6ng/μL, and 31.0±5.6ng/μL, respectively. No significant differences in purity were observed among three methods. DNA extracted using the ACTB was successfully amplified in all three methods. There were no obvious differences in Ct values for GAPDH real-time PCR. Total elapsed time for DNA extraction was about 50min for the QIAamp, 40min for the Maxwell, and 20min for the Nextractor. As the Nextractor is faster and requires less hands-on time than manual procedures, it may be useful for molecular diagnostic testing in clinical laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  4. Complete mitochondrial DNA genome of Pseudobagrus truncatus (Siluriformes: Bagridae).

    Science.gov (United States)

    Liang, Hong-wei; Meng, Yan; Li, Zhong; Zhang, Yan; Zou, Gui-wei

    2014-06-01

    In this study, the complete mitochondrial DNA (mtDNA) sequence of Pseudobagrus truncatus (Siluriformes: Bagridae) was determined. The complete mtDNA genome sequence of P. truncatus is 16,533 bp in size. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and one non-coding control region. The gene order and genes were the same as that found in other previously reported catfishes. The overall-based composition was 31.6% A, 26.7% T, 14.9% G and 26.8% C, with a high A + T content (58.3%). This complete mitogenome of P. truncatus provides a basic data for studies on species identification, molecular systematics and conservation genetics.

  5. Genome-wide DNA methylome alterations in acute coronary syndrome.

    Science.gov (United States)

    Li, Dandan; Yan, Jing; Yuan, Yunlong; Wang, Cheng; Wu, Jia; Chen, Qingwen; Song, Jiaxi; Wang, Junjun

    2018-01-01

    Acute coronary syndrome (ACS) is a common disease with high mortality and morbidity rates. The methylation status of blood DNA may serve as a potential early diagnosis and prevention biomarker for numerous diseases. The present study was designed to explore novel genome-wide aberrant DNA methylation patterns associated with ACS. The Infinium HumanMethylation450 assay was used to examine genome-wide DNA methylation profiles in 3 pairs of ACS and control group samples. Epigenome-wide DNA methylation, genomic distribution, Gene Ontology (GO) term and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed. The results were confirmed using methylation-specific polymerase chain reaction (MSP) and Sequenom MassARRAY analyses in ACS, stable coronary artery disease (SCAD) and control samples. A total of 11,342 differentially methylated (DM) 5'-C-phosphate-G-3' (CpG) sites were identified, including 8,865 hypomethylated and 2,477 hypermethylated CpG sites in the ACS group compared with the control samples. They varied in frequency across genomic compartments, but were particularly notable in gene bodies and shores. The results of GO term and KEGG pathway enrichment analyses revealed that the methylated genes were associated with certain biological processes and pathways. Despite the considerable variability in methylation data, the candidate selected possessed significant methylation alteration in mothers against decapentaplegic homolog 3 (SMAD3) transcription start site 155 (Chr1:67356838-Chr1:67356942). MSP analysis from 81 ACS samples, 74 SCAD samples and 53 healthy samples, and Sequenom MassARRAY analysis, confirmed that differential CpG methylation of SMAD3 was significantly corrected with the reference results of the HumanMethylation450 array. The data identified an ACS-specific DNA methylation profile with a large number of novel DM CpG sites, some of which may serve as candidate markers for the early diagnosis of ACS.

  6. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  7. Molecular cloning and expression of a cDNA encoding a hybrid histidine kinase receptor in tropical periwinkle Catharanthus roseus.

    Science.gov (United States)

    Papon, N; Bremer, J; Vansiri, A; Glévarec, G; Rideau, M; Creche, J

    2006-09-01

    Signalling pathways involving histidine kinase receptors (HKRs) are widely used by prokaryotes and fungi to regulate a large palette of biological processes. In plants, HKRs are known to be implicated in cytokinin, ethylene, and osmosensing transduction pathways. In this work, a full length cDNA named CRCIK was isolated from the tropical species CATHARANTHUS ROSEUS (L.) G. Don. It encodes a 1205 amino acid protein that belongs to the hybrid HKR family. The deduced amino acid sequence shows the highest homology with AtHK1, an osmosensing HKR in ARABIDOPSIS THALIANA. In return, CrCIK protein shares very low identity with the other 10 ARABIDOPSIS HKRs. Southern blot analysis indicates that the CRCIK corresponding gene is either present in multiple copies or has very close homologues in the genome of the tropical periwinkle. The gene is widely expressed in the plant. In C. ROSEUS C20D cell suspension, it is slightly induced after exposure to low temperature, pointing to a putative role in cold-shock signal transduction.

  8. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  9. Toward a cDNA map of the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.; Chen, X.N. [Cedars-Sinai Research Institute, Los Angeles, CA (United States); Adams, M.D.; Venter, J.C. [Institute for Genomic Research, Gaithersburg, MD (United States)

    1995-09-20

    Advances in the Human Genome Project are shaping the strategies for identifying the 50,000-100,000 human genes. High-resolution genetic maps of the human genome combined with sequencing herald an era of rapid regional definition of disease genes. However, only once their chromosomes band location is known will the systematic partial sequencing of thousands of random cDNA clones provide the reagents for the rapid assessment of the genes responsible for the inherited disorders. We now present an approach to the rapid determination of map position and therefore to the creation of a transcribed map of the human genome. Sensitive fluorescence in situ hybridization has been combined with high-resolution chromosome banding and random cDNA sequencing to 41 cDNAs with an average insert size of < 2 kb to single human chromosome bands. The results provide 15 new genes, with database and functional information, as candidates for human disease. These include the large extracellular single-related kinase (HUMERK), the ERK activator kinase (PRKMK1), a new member of the RAS oncogene family, protein phosphotase 2 regulatory subunit B alpha isoform (PPP2R2A), and a novel human gene with very high homology to a plant membrane transport family. Further, an analysis of expressed genes associated with pseudogenes showed that by using these techniques, it is possible to detect accurately the transcribed locus within a multigene or processed pseudogene family in most cases. These findings suggest that direct cDNA mapping using fluorescence in situ hybridization provides an accurate and rapid approach to the definition of a transcribed map of the human genome. This low-cost, high-resolution (205 Mb) mapping greatly enhances the speed with which these genes can be subsequently assigned to contigs. This assignment provides a necessary first step in understanding the relationship of the genes to both acquired and inherited human diseases. 16 refs., 1 fig., 3 tabs.

  10. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  11. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  12. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  13. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase

    Directory of Open Access Journals (Sweden)

    Roozbeh Hushiarian

    2015-12-01

    This technique was found to be reliably repeatable. The indirect detection of genomic DNA using this method is significantly improved and showed high efficiency in small amounts of samples with the detection limit of 5.37 × 10−14 M.

  14. Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome Atlas

    Directory of Open Access Journals (Sweden)

    Theo A. Knijnenburg

    2018-04-01

    Full Text Available Summary: DNA damage repair (DDR pathways modulate cancer risk, progression, and therapeutic response. We systematically analyzed somatic alterations to provide a comprehensive view of DDR deficiency across 33 cancer types. Mutations with accompanying loss of heterozygosity were observed in over 1/3 of DDR genes, including TP53 and BRCA1/2. Other prevalent alterations included epigenetic silencing of the direct repair genes EXO5, MGMT, and ALKBH3 in ∼20% of samples. Homologous recombination deficiency (HRD was present at varying frequency in many cancer types, most notably ovarian cancer. However, in contrast to ovarian cancer, HRD was associated with worse outcomes in several other cancers. Protein structure-based analyses allowed us to predict functional consequences of rare, recurrent DDR mutations. A new machine-learning-based classifier developed from gene expression data allowed us to identify alterations that phenocopy deleterious TP53 mutations. These frequent DDR gene alterations in many human cancers have functional consequences that may determine cancer progression and guide therapy. : Knijnenburg et al. present The Cancer Genome Atlas (TCGA Pan-Cancer analysis of DNA damage repair (DDR deficiency in cancer. They use integrative genomic and molecular analyses to identify frequent DDR alterations across 33 cancer types, correlate gene- and pathway-level alterations with genome-wide measures of genome instability and impaired function, and demonstrate the prognostic utility of DDR deficiency scores. Keywords: The Cancer Genome Atlas PanCanAtlas project, DNA damage repair, somatic mutations, somatic copy-number alterations, epigenetic silencing, DNA damage footprints, mutational signatures, integrative statistical analysis, protein structure analysis

  15. Comparison of three genomic DNA extraction methods to obtain high DNA quality from maize.

    Science.gov (United States)

    Abdel-Latif, Amani; Osman, Gamal

    2017-01-01

    The world's top three cereals, based on their monetary value, are rice, wheat, and corn. In cereal crops, DNA extraction is difficult owing to rigid non-cellulose components in the cell wall of leaves and high starch and protein content in grains. The advanced techniques in molecular biology require pure and quick extraction of DNA. The majority of existing DNA extraction methods rely on long incubation and multiple precipitations or commercially available kits to produce contaminant-free high molecular weight DNA. In this study, we compared three different methods used for the isolation of high-quality genomic DNA from the grains of cereal crop, Zea mays , with minor modifications. The DNA from the grains of two maize hybrids, M10 and M321, was extracted using extraction methods DNeasy Qiagen Plant Mini Kit, CTAB-method (with/without 1% PVP) and modified Mericon extraction. Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain codes for 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS regions show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this study, the genomic DNA was then amplified with PCR using primers specific for ITS gene. PCR products were then visualized on agarose gel. The modified Mericon extraction method was found to be the most efficient DNA extraction method, capable to provide high DNA yields with better quality, affordable cost and less time.

  16. Klebsiella pneumoniae asparagine tDNAs are integration hotspots for different genomic islands encoding microcin E492 production determinants and other putative virulence factors present in hypervirulent strains

    Directory of Open Access Journals (Sweden)

    Andrés Esteban Marcoleta

    2016-06-01

    Full Text Available Due to the developing of multi-resistant and invasive hypervirulent strains, Klebsiella pneumoniae has become one of the most urgent bacterial pathogen threats in the last years. Genomic comparison of a growing number of sequenced isolates has allowed the identification of putative virulence factors, proposed to be acquirable mainly through horizontal gene transfer. In particular, those related with synthesizing the antibacterial peptide microcin E492 (MccE492 and salmochelin siderophores were found to be highly prevalent among hypervirulent strains. The determinants for the production of both molecules were first reported as part of a 13-kbp segment of K. pneumoniae RYC492 chromosome, and were cloned and characterized in E. coli. However, the genomic context of this segment in K. pneumoniae remained uncharacterized.In this work we provided experimental and bioinformatics evidence indicating that the MccE492 cluster is part of a highly conserved 23-kbp genomic island (GI named GIE492, that was integrated in a specific asparagine-tRNA gene (asn-tDNA and was found in a high proportion of isolates from liver abscesses sampled around the world. This element resulted to be unstable and its excision frequency increased after treating bacteria with mytomicin C and upon the overexpression of the island-encoded integrase. Besides the MccE492 genetic cluster, it invariably included an integrase-coding gene, at least 7 protein-coding genes of unknown function, and a putative transfer origin that possibly allows this GI to be mobilized through conjugation. In addition, we analyzed the asn-tDNA loci of all the available K. pneumoniae assembled chromosomes to evaluate them as GI-integration sites. Remarkably, 73% of the strains harbored at least one GI integrated in one of the four asn-tDNA present in this species, confirming them as integration hotspots. Each of these tDNAs was occupied with different frequencies, although they were 100% identical. Also, we

  17. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  18. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  19. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  20. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  1. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  2. Genomic and cDNA cloning of a novel mouse lipoxygenase gene

    NARCIS (Netherlands)

    Willems van Dijk, K.; Steketee, K.; Havekes, L.; Frants, R.; Hofker, M.

    1995-01-01

    A novel 12- and 15-lipoxygenase related gene was isolated from a mouse strain 129 genomic phage library in a screen with a human 15-lipoxygenase cDNA probe. The complete genomic sequence revealed 14 exons and 13 introns covering 7.3 kb of DNA. The splice junctions were verified from the cDNA

  3. The roles of adenoviral vectors and donor DNA structures on genome editing

    NARCIS (Netherlands)

    Holkers, Maarten

    2016-01-01

    Accurate and efficient genome editing is primarily dependent on the generation of a sequence-specific, genomic double-stranded DNA break (DSB) combined with the introduction of an exogenous DNA template into target cells. The exogenous template, called donor DNA, normally contains the foreign

  4. Molecular cloning of the cDNA encoding aspartate aminotransferase from bean root nodules and determination of its role in nodule nitrogen metabolism.

    Science.gov (United States)

    Silvente, Sonia; Camas, Alberto; Lara, Miguel

    2003-06-01

    A cDNA clone encoding aspartate aminotransferase (PVAAT-2) (EC 2.6.1.1) was isolated from the common bean Phaseolus vulgaris nodule cDNA library. The nucleotide sequence analysis of the full-length cDNA allowed its identification by comparison with sequence databases. The amino acid sequence of the bean PvAAT-2 showed high similarity with the AAT-2 isoforms described in other leguminous plants. The amino-terminal region of the PvAAT-2 contains a sequence, which shares common features of plastid transit peptides. Southern blot analysis showed that the PvAAT-2 clone is encoded by a single gene in the P. vulgaris genome. Analysis of the PvAAT-2 mRNA levels suggests that the expression of this gene is nodule enhanced. The PvAAT-2 transcript is more abundant in nodules with increased synthesis of amides and is down-regulated in conditions where ureides accumulate. When plants were supplemented with ureides or with amides, PvAAT-2 expression was reduced, while it was not affected when plants were treated with allopurinol, an inhibitor of ureide synthesis. On the other hand, the expression of asparagine synthetase (another enzyme involved in the synthesis of amides) is not affected either by ureides or amides. These data suggest a role for AAT-2 in the mechanism involved in the synthesis of nitrogen compounds in bean nodules.

  5. Characterization of the dsDNA prophage sequences in the genome of Neisseria gonorrhoeae and visualization of productive bacteriophage

    Directory of Open Access Journals (Sweden)

    Maugel Timothy K

    2007-07-01

    Full Text Available Abstract Background Bioinformatic analysis of the genome sequence of Neisseria gonorrhoeae revealed the presence of nine probable prophage islands. The distribution, conservation and function of many of these sequences, and their ability to produce bacteriophage particles are unknown. Results Our analysis of the genomic sequence of FA1090 identified five genomic regions (NgoΦ1 – 5 that are related to dsDNA lysogenic phage. The genetic content of the dsDNA prophage sequences were examined in detail and found to contain blocks of genes encoding for proteins homologous to proteins responsible for phage DNA replication, structural proteins and proteins responsible for phage assembly. The DNA sequences from NgoΦ1, NgoΦ2 and NgoΦ3 contain some significant regions of identity. A unique region of NgoΦ2 showed very high similarity with the Pseudomonas aeruginosa generalized transducing phage F116. Comparative analysis at the nucleotide and protein levels suggests that the sequences of NgoΦ1 and NgoΦ2 encode functionally active phages, while NgoΦ3, NgoΦ4 and NgoΦ5 encode incomplete genomes. Expression of the NgoΦ1 and NgoΦ2 repressors in Escherichia coli inhibit the growth of E. coli and the propagation of phage λ. The NgoΦ2 repressor was able to inhibit transcription of N. gonorrhoeae genes and Haemophilus influenzae HP1 phage promoters. The holin gene of NgoΦ1 (identical to that encoded by NgoΦ2, when expressed in E. coli, could serve as substitute for the phage λ s gene. We were able to detect the presence of the DNA derived from NgoΦ1 in the cultures of N. gonorrhoeae. Electron microscopy analysis of culture supernatants revealed the presence of multiple forms of bacteriophage particles. Conclusion These data suggest that the genes similar to dsDNA lysogenic phage present in the gonococcus are generally conserved in this pathogen and that they are able to regulate the expression of other neisserial genes. Since phage particles were

  6. Maintenance of Genome Integrity: How Mammalian Cells Orchestrate Genome Duplication by Coordinating Replicative and Specialized DNA Polymerases

    Directory of Open Access Journals (Sweden)

    Ryan Barnes

    2017-01-01

    Full Text Available Precise duplication of the human genome is challenging due to both its size and sequence complexity. DNA polymerase errors made during replication, repair or recombination are central to creating mutations that drive cancer and aging. Here, we address the regulation of human DNA polymerases, specifically how human cells orchestrate DNA polymerases in the face of stress to complete replication and maintain genome stability. DNA polymerases of the B-family are uniquely adept at accurate genome replication, but there are numerous situations in which one or more additional DNA polymerases are required to complete genome replication. Polymerases of the Y-family have been extensively studied in the bypass of DNA lesions; however, recent research has revealed that these polymerases play important roles in normal human physiology. Replication stress is widely cited as contributing to genome instability, and is caused by conditions leading to slowed or stalled DNA replication. Common Fragile Sites epitomize “difficult to replicate” genome regions that are particularly vulnerable to replication stress, and are associated with DNA breakage and structural variation. In this review, we summarize the roles of both the replicative and Y-family polymerases in human cells, and focus on how these activities are regulated during normal and perturbed genome replication.

  7. The immune gene repertoire encoded in the purple sea urchin genome.

    Science.gov (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  8. Transformation of the Methylotrophic Actinomycete Amycolatopis methanolica with Plasmid DNA : Stimulatory Effect of a pMEA300-Encoded Gene

    NARCIS (Netherlands)

    Vrijbloed, J.W.; Madoń, J.; Dijkhuizen, L.

    Amycolatopsis methanolica contains a 13.29-kb plasmid (pMEA300) present both in the free state and integrated at a unique genomic location. A pMEA300-free derivative (strain WV1) was selected, allowing further analysis of pMEA300-encoded functions. Whole cells of strain WV1 could be transformed at

  9. Skin vaccination using microneedles coated with a plasmid DNA cocktail encoding nucleosomal histones of Leishmania spp.

    Science.gov (United States)

    Moreno, Esther; Schwartz, Juana; Calvo, Alba; Blanco, Laura; Larrea, Esther; Irache, Juan M; Sanmartín, Carmen; Coulman, Sion A; Soto, Manuel; Birchall, James C; Espuelas, Socorro

    2017-11-25

    Vaccine delivery using microneedles (MNs) represents a safe, easily disposable and painless alternative to traditional needle immunizations. The MN delivery of DNA vaccines to the dermis may result in a superior immune response and/or an equivalent immune response at a lower vaccine dose (dose-sparing). This could be of special interest for immunization programs against neglected tropical diseases such as leishmaniasis. In this work, we loaded a MN device with 60μg of a plasmid DNA cocktail encoding the Leishmania infantum nucleosomal histones H2A, H2B, H3 and H4 and compared its immunogenicity and protective capacity against conventional s.c. or i.d. injection of the plasmid. Mice immunized with MNs showed increased ratios of IFN-γ/IL-10, IFN-γ/IL-13, IFN-γ/IL-4, and IFN-γ/TGF-β in the spleens and lymph nodes compared with mice immunized by s.c. and i.d. routes. Furthermore, CCXCL9, CXCL10 and CCL2 levels were also higher. These data suggest that the nucleic acid immunization using MNs produced a better bias towards a Th1 response. However, none of the immunizations strategies were able to control Leishmania major infection in BALB/c mice, as illustrated by an increase in lesion size and parasite burden. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Design and Development of a Technology Platform for DNA-Encoded Library Production and Affinity Selection.

    Science.gov (United States)

    Castañón, Jesús; Román, José Pablo; Jessop, Theodore C; de Blas, Jesús; Haro, Rubén

    2018-01-01

    DNA-encoded libraries (DELs) have emerged as an efficient and cost-effective drug discovery tool for the exploration and screening of very large chemical space using small-molecule collections of unprecedented size. Herein, we report an integrated automation and informatics system designed to enhance the quality, efficiency, and throughput of the production and affinity selection of these libraries. The platform is governed by software developed according to a database-centric architecture to ensure data consistency, integrity, and availability. Through its versatile protocol management functionalities, this application captures the wide diversity of experimental processes involved with DEL technology, keeps track of working protocols in the database, and uses them to command robotic liquid handlers for the synthesis of libraries. This approach provides full traceability of building-blocks and DNA tags in each split-and-pool cycle. Affinity selection experiments and high-throughput sequencing reads are also captured in the database, and the results are automatically deconvoluted and visualized in customizable representations. Researchers can compare results of different experiments and use machine learning methods to discover patterns in data. As of this writing, the platform has been validated through the generation and affinity selection of various libraries, and it has become the cornerstone of the DEL production effort at Lilly.

  11. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  12. Bacillus subtilis genome vector-based complete manipulation and reconstruction of genomic DNA for mouse transgenesis.

    Science.gov (United States)

    Iwata, Tetsuo; Kaneko, Shinya; Shiwa, Yuh; Enomoto, Takayuki; Yoshikawa, Hirofumi; Hirota, Junji

    2013-05-03

    The Bacillus subtilis genome (BGM) vector is a novel cloning system for large DNA fragments, in which the entire 4.2 Mb genome of B. subtilis functions as a vector. The BGM vector system has several attractive properties, such as a large cloning capacity of over 3 Mb, stable propagation of cloned DNA and various modification strategies using RecA-mediated homologous recombination. However, genetic modifications using the BGM vector system have not been fully established, and this system has not been applied to transgenesis. In this study, we developed important additions to the genetic modification methods of the BGM vector system. To explore the potential of the BGM vector, we focused on the fish-like odorant receptor (class I OR) gene family, which consists of 158 genes and forms a single gene cluster. Although a cis-acting locus control region is expected to regulate transcription, this has not yet been determined experimentally. Using two contiguous bacterial artificial chromosome clones containing several class I OR genes, we constructed two transgenes in the BGM vector by inserting a reporter gene cassette into one class I OR gene. Because they were oriented in opposite directions, we performed an inversion modification to align their orientation and then fused them to enlarge the genomic structure. DNA sequencing revealed that no mutations occurred during gene manipulations with the BGM vector. We further demonstrated that the modified, reconstructed genomic DNA fragments could be used to generate transgenic mice. Transgenic mice carrying the enlarged transgene recapitulated the expression and axonal projection patterns of the target class I OR gene in the main olfactory system. We offer a complete genetic modification method for the BGM vector system, including insertion, deletion, inversion and fusion, to engineer genomic DNA fragments without any trace of modifications. In addition, we demonstrate that this system can be used for mouse transgenesis. Thus

  13. Sequences related to the ox pancreatic ribonuclease coding region in the genomic DNA of mammalian species.

    Science.gov (United States)

    Breukelman, H J; Beintema, J J; Confalone, E; Costanzo, C; Sasso, M P; Carsana, A; Palmieri, M; Furia, A

    1993-07-01

    Mammalian pancreatic ribonucleases form a family of homologous proteins that has been extensively investigated. The primary structures of these enzymes were used to derive phylogenetic trees. These analyses indicate that the presence of three strictly homologous enzymes in the bovine species (the pancreatic, seminal, and cerebral ribonucleases) is due to gene duplication events which occurred during the evolution of ancestral ruminants. In this paper we present evidence that confirms this finding and that suggests an overall structural conservation of the putative ribonuclease genes in ruminant species. We could also demonstrate that the sequences related to ox ribonuclease coding regions present in genomic DNA of the giraffe species are the orthologues of the bovine genes encoding the three ribonucleases mentioned above.

  14. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng

    2010-01-01

    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  15. Characterization of the legumains encoded by the genome of Theobroma cacao L.

    Science.gov (United States)

    Santana, Juliano Oliveira; Freire, Laís; de Sousa, Aurizangela Oliveira; Fontes Soares, Virgínia Lúcia; Gramacho, Karina Peres; Pirovani, Carlos Priminho

    2016-01-01

    Legumains are cysteine proteases related to plant development, protein degradation, programmed cell death, and defense against pathogens. In this study, we have identified and characterized three legumains encoded by Theobroma cacao genome through in silico analyses, three-dimensional modeling, genetic expression pattern in different tissues and as a response to the inoculation of Moniliophthora perniciosa fungus. The three proteins were named TcLEG3, TcLEG6, and TcLEG9. Histidine and cysteine residue which are part of the catalytic site were conserved among the proteins, and they remained parallel in the loop region in the 3D modeling. Three-dimensional modeling showed that the propeptide, which is located in the terminal C region of legumains blocks the catalytic cleft. Comparing dendrogram data with the relative expression analysis, indicated that TcLEG3 is related to the seed legumain group, TcLEG6 is related with the group of embryogenesis activities, and protein TcLEG9, with processes regarding the vegetative group. Furthermore, the expression analyses proposes a significant role for the three legumains during the development of Theobroma cacao and in its interaction with M. perniciosa. Copyright © 2015 Universidade Estadual de Santa Cruz, CNPJ: 40738999/0001-95. Published by Elsevier Masson SAS.. All rights reserved.

  16. Genomic distribution of H3K9me2 and DNA methylation in a maize genome.

    Directory of Open Access Journals (Sweden)

    Patrick T West

    Full Text Available DNA methylation and dimethylation of lysine 9 of histone H3 (H3K9me2 are two chromatin modifications that can be associated with gene expression or recombination rate. The maize genome provides a complex landscape of interspersed genes and transposons. The genome-wide distribution of DNA methylation and H3K9me2 were investigated in seedling tissue for the maize inbred B73 and compared to patterns of these modifications observed in Arabidopsis thaliana. Most maize transposons are highly enriched for DNA methylation in CG and CHG contexts and for H3K9me2. In contrast to findings in Arabidopsis, maize CHH levels in transposons are generally low but some sub-families of transposons are enriched for CHH methylation and these families exhibit low levels of H3K9me2. The profile of modifications over genes reveals that DNA methylation and H3K9me2 is quite low near the beginning and end of genes. Although elevated CG and CHG methylation are found within gene bodies, CHH and H3K9me2 remain low. Maize has much higher levels of CHG methylation within gene bodies than observed in Arabidopsis and this is partially attributable to the presence of transposons within introns for some maize genes. These transposons are associated with high levels of CHG methylation and H3K9me2 but do not appear to prevent transcriptional elongation. Although the general trend is for a strong depletion of H3K9me2 and CHG near the transcription start site there are some putative genes that have high levels of these chromatin modifications. This study provides a clear view of the relationship between DNA methylation and H3K9me2 in the maize genome and how the distribution of these modifications is shaped by the interplay of genes and transposons.

  17. Genome-wide DNA methylation profiling of non-small cell lung carcinomas.

    Science.gov (United States)

    Carvalho, Rejane Hughes; Haberle, Vanja; Hou, Jun; van Gent, Teus; Thongjuea, Supat; van Ijcken, Wilfred; Kockx, Christel; Brouwer, Rutger; Rijkers, Erikjan; Sieuwerts, Anieta; Foekens, John; van Vroonhoven, Mirjam; Aerts, Joachim; Grosveld, Frank; Lenhard, Boris; Philipsen, Sjaak

    2012-06-22

    Non-small cell lung carcinoma (NSCLC) is a complex malignancy that owing to its heterogeneity and poor prognosis poses many challenges to diagnosis, prognosis and patient treatment. DNA methylation is an important mechanism of epigenetic regulation involved in normal development and cancer. It is a very stable and specific modification and therefore in principle a very suitable marker for epigenetic phenotyping of tumors. Here we present a genome-wide DNA methylation analysis of NSCLC samples and paired lung tissues, where we combine MethylCap and next generation sequencing (MethylCap-seq) to provide comprehensive DNA methylation maps of the tumor and paired lung samples. The MethylCap-seq data were validated by bisulfite sequencing and methyl-specific polymerase chain reaction of selected regions. Analysis of the MethylCap-seq data revealed a strong positive correlation between replicate experiments and between paired tumor/lung samples. We identified 57 differentially methylated regions (DMRs) present in all NSCLC tumors analyzed by MethylCap-seq. While hypomethylated DMRs did not correlate to any particular functional category of genes, the hypermethylated DMRs were strongly associated with genes encoding transcriptional regulators. Furthermore, subtelomeric regions and satellite repeats were hypomethylated in the NSCLC samples. We also identified DMRs that were specific to two of the major subtypes of NSCLC, adenocarcinomas and squamous cell carcinomas. Collectively, we provide a resource containing genome-wide DNA methylation maps of NSCLC and their paired lung tissues, and comprehensive lists of known and novel DMRs and associated genes in NSCLC.

  18. Genome-wide DNA methylation profiling of non-small cell lung carcinomas

    Directory of Open Access Journals (Sweden)

    Carvalho Rejane

    2012-06-01

    Full Text Available Abstract Background Non-small cell lung carcinoma (NSCLC is a complex malignancy that owing to its heterogeneity and poor prognosis poses many challenges to diagnosis, prognosis and patient treatment. DNA methylation is an important mechanism of epigenetic regulation involved in normal development and cancer. It is a very stable and specific modification and therefore in principle a very suitable marker for epigenetic phenotyping of tumors. Here we present a genome-wide DNA methylation analysis of NSCLC samples and paired lung tissues, where we combine MethylCap and next generation sequencing (MethylCap-seq to provide comprehensive DNA methylation maps of the tumor and paired lung samples. The MethylCap-seq data were validated by bisulfite sequencing and methyl-specific polymerase chain reaction of selected regions. Results Analysis of the MethylCap-seq data revealed a strong positive correlation between replicate experiments and between paired tumor/lung samples. We identified 57 differentially methylated regions (DMRs present in all NSCLC tumors analyzed by MethylCap-seq. While hypomethylated DMRs did not correlate to any particular functional category of genes, the hypermethylated DMRs were strongly associated with genes encoding transcriptional regulators. Furthermore, subtelomeric regions and satellite repeats were hypomethylated in the NSCLC samples. We also identified DMRs that were specific to two of the major subtypes of NSCLC, adenocarcinomas and squamous cell carcinomas. Conclusions Collectively, we provide a resource containing genome-wide DNA methylation maps of NSCLC and their paired lung tissues, and comprehensive lists of known and novel DMRs and associated genes in NSCLC.

  19. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  20. A DNA minor groove electronegative potential genome map based on photo-chemical probing

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten

    2011-01-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciated...... resolution of any genome, and it is illustrated how such detailed studies of this sequence dependent, inherent property of the DNA may reflect on genome organization, gene expression and chromosomal condensation....

  1. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Comparative genomics of the family Vibrionaceae reveals the wide distribution of genes encoding virulence-associated proteins

    Directory of Open Access Journals (Sweden)

    Cai Hong

    2010-06-01

    Full Text Available Abstract Background Species of the family Vibrionaceae are ubiquitous in marine environments. Several of these species are important pathogens of humans and marine species. Evidence indicates that genetic exchange plays an important role in the emergence of new pathogenic strains within this family. Data from the sequenced genomes of strains in this family could show how the genes encoded by all these strains, known as the pangenome, are distributed. Information about the core, accessory and panproteome of this family can show how, for example, genes encoding virulence-associated proteins are distributed and help us understand how virulence emerges. Results We deduced the complete set of orthologs for eleven strains from this family. The core proteome consists of 1,882 orthologous groups, which is 28% of the 6,629 orthologous groups in this family. There were 4,411 accessory orthologous groups (i.e., proteins that occurred in from 2 to 10 proteomes and 5,584 unique proteins (encoded once on only one of the eleven genomes. Proteins that have been associated with virulence in V. cholerae were widely distributed across the eleven genomes, but the majority was found only on the genomes of the two V. cholerae strains examined. Conclusions The proteomes are reflective of the differing evolutionary trajectories followed by different strains to similar phenotypes. The composition of the proteomes supports the notion that genetic exchange among species of the Vibrionaceae is widespread and that this exchange aids these species in adapting to their environments.

  3. Genome and Metagenome Sequencing: Using the Human Methyl-Binding Domain to Partition Genomic DNA Derived from Plant Tissues

    Directory of Open Access Journals (Sweden)

    Erbay Yigit

    2014-11-01

    Full Text Available Premise of the study: Variation in the distribution of methylated CpG (methyl-CpG in genomic DNA (gDNA across the tree of life is biologically interesting and useful in genomic studies. We illustrate the use of human methyl-CpG-binding domain (MBD2 to fractionate angiosperm DNA into eukaryotic nuclear (methyl-CpG-rich vs. organellar and prokaryotic (methyl-CpG-poor elements for genomic and metagenomic sequencing projects. Methods: MBD2 has been used to enrich prokaryotic DNA in animal systems. Using gDNA from five model angiosperm species, we apply a similar approach to identify whether MBD2 can fractionate plant gDNA into methyl-CpG-depleted vs. enriched methyl-CpG elements. For each sample, three gDNA libraries were sequenced: (1 untreated gDNA, (2 a methyl-CpG-depleted fraction, and (3 a methyl-CpG-enriched fraction. Results: Relative to untreated gDNA, the methyl-depleted libraries showed a 3.2–11.2-fold and 3.4–11.3-fold increase in chloroplast DNA (cpDNA and mitochondrial DNA (mtDNA, respectively. Methyl-enriched fractions showed a 1.8–31.3-fold and 1.3–29.0-fold decrease in cpDNA and mtDNA, respectively. Discussion: The application of MBD2 enabled fractionation of plant gDNA. The effectiveness was particularly striking for monocot gDNA (Poaceae. When sufficiently effective on a sample, this approach can increase the cost efficiency of sequencing plant genomes as well as prokaryotes living in or on plant tissues.

  4. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-01-01

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  5. An efficient method for genomic DNA extraction from different molluscs species.

    Science.gov (United States)

    Pereira, Jorge C; Chaves, Raquel; Bastos, Estela; Leitão, Alexandra; Guedes-Pinto, Henrique

    2011-01-01

    The selection of a DNA extraction method is a critical step when subsequent analysis depends on the DNA quality and quantity. Unlike mammals, for which several capable DNA extraction methods have been developed, for molluscs the availability of optimized genomic DNA extraction protocols is clearly insufficient. Several aspects such as animal physiology, the type (e.g., adductor muscle or gills) or quantity of tissue, can explain the lack of efficiency (quality and yield) in molluscs genomic DNA extraction procedure. In an attempt to overcome these aspects, this work describes an efficient method for molluscs genomic DNA extraction that was tested in several species from different orders: Veneridae, Ostreidae, Anomiidae, Cardiidae (Bivalvia) and Muricidae (Gastropoda), with different weight sample tissues. The isolated DNA was of high molecular weight with high yield and purity, even with reduced quantities of tissue. Moreover, the genomic DNA isolated, demonstrated to be suitable for several downstream molecular techniques, such as PCR sequencing among others.

  6. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  7. Genome-Wide Discriminatory Information Patterns of Cytosine DNA Methylation

    Directory of Open Access Journals (Sweden)

    Robersy Sanchez

    2016-06-01

    Full Text Available Cytosine DNA methylation (CDM is a highly abundant, heritable but reversible chemical modification to the genome. Herein, a machine learning approach was applied to analyze the accumulation of epigenetic marks in methylomes of 152 ecotypes and 85 silencing mutants of Arabidopsis thaliana. In an information-thermodynamics framework, two measurements were used: (1 the amount of information gained/lost with the CDM changes I R and (2 the uncertainty of not observing a SNP L C R . We hypothesize that epigenetic marks are chromosomal footprints accounting for different ontogenetic and phylogenetic histories of individual populations. A machine learning approach is proposed to verify this hypothesis. Results support the hypothesis by the existence of discriminatory information (DI patterns of CDM able to discriminate between individuals and between individual subpopulations. The statistical analyses revealed a strong association between the topologies of the structured population of Arabidopsis ecotypes based on I R and on LCR, respectively. A statistical-physical relationship between I R and L C R was also found. Results to date imply that the genome-wide distribution of CDM changes is not only part of the biological signal created by the methylation regulatory machinery, but ensures the stability of the DNA molecule, preserving the integrity of the genetic message under continuous stress from thermal fluctuations in the cell environment.

  8. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  9. Animal Mitochondrial DNA as We Do Not Know It: mt-Genome Organization and Evolution in Nonbilaterian Lineages

    Science.gov (United States)

    Pett, Walker

    2016-01-01

    Abstract Animal mitochondrial DNA (mtDNA) is commonly described as a small, circular molecule that is conserved in size, gene content, and organization. Data collected in the last decade have challenged this view by revealing considerable diversity in animal mitochondrial genome organization. Much of this diversity has been found in nonbilaterian animals (phyla Cnidaria, Ctenophora, Placozoa, and Porifera), which, from a phylogenetic perspective, form the main branches of the animal tree along with Bilateria. Within these groups, mt-genomes are characterized by varying numbers of both linear and circular chromosomes, extra genes (e.g. atp9, polB, tatC), large variation in the number of encoded mitochondrial transfer RNAs (tRNAs) (0–25), at least seven different genetic codes, presence/absence of introns, tRNA and mRNA editing, fragmented ribosomal RNA genes, translational frameshifting, highly variable substitution rates, and a large range of genome sizes. This newly discovered diversity allows a better understanding of the evolutionary plasticity and conservation of animal mtDNA and provides insights into the molecular and evolutionary mechanisms shaping mitochondrial genomes. PMID:27557826

  10. ThreaDNA: predicting DNA mechanics' contribution to sequence selectivity of proteins along whole genomes.

    Science.gov (United States)

    Cevost, Jasmin; Vaillant, Cédric; Meyer, Sam; Rost, Burkhard

    2018-02-15

    Many DNA-binding proteins recognize their target sequences indirectly, by sensing DNA's response to mechanical distortion. ThreaDNA estimates this response based on high-resolution structures of the protein-DNA complex of interest. Implementing an efficient nanoscale modeling of DNA deformations involving essentially no adjustable parameters, it returns the profile of deformation energy along whole genomes, at base-pair resolution, within minutes on usual laptop/desktop computers. Our predictions can also be easily combined with estimations of direct selectivity through a generalized form of position-weight-matrices. The formalism of ThreaDNA is accessible to a wide audience. We demonstrate the importance of indirect readout for the nucleosome as well as the bacterial regulators Fis and CRP. Combined with the direct contribution provided by usual sequence motifs, it significantly improves the prediction of sequence selectivity, and allows quantifying the two distinct physical mechanisms underlying it. Python software available at bioinfo.insa-lyon.fr, natively executable on Linux/MacOS systems with a user-friendly graphical interface. Galaxy webserver version available. sam.meyer@insa-lyon.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  11. The complete DNA sequence of the mitochondrial genome of the dermatophyte fungus Epidermophyton floccosum.

    Science.gov (United States)

    Tambor, José Humberto M; Guedes, Raquel F; Nobrega, Marina P; Nobrega, Francisco G

    2006-05-01

    We report here the complete nucleotide sequence of the 30.9-kb mitochondrial genome of the dermatophyte fungus Epidermophyton floccosum. All genes are encoded on the same DNA strand and include seven subunits of the reduced nicotinamide adenine dinucleotide ubiquinone oxireductase (nad1, nad2, nad3, nad4, nad4L, nad5, and nad6), three subunits of cytochrome oxidase (cox1, cox2, and cox3), apocytochrome b (cob), three subunits of ATP synthase (atp6, atp8, and atp9), the small and large ribosomal RNAs (rns and rnl), and 25 tRNAs. A ribosomal protein gene (rps5) is present as an intronic ORF in the large ribosomal subunit. The genes coding for cob and cox1 carry one intron and nad5 carries two introns with ORFs. The mtDNA of E. floccosum has the same gene order as Trichophyton rubrum mtDNA, with the exception of some tRNA genes. Maximum likelihood phylogenetic analysis confirms T. rubrum as a close relative of E. floccosum. This is the first complete mitochondrial sequence of a species of the order Onygenales. This sequence is available under GenBank accession number AY916130.

  12. Gross genomic damage measured by DNA image cytometry independently predicts gastric cancer patient survival

    NARCIS (Netherlands)

    Belien, J.A.M.; Buffart, T.E.; Gill, A.; Broeckaert, M.A.M.; Quirke, P.; Meijer, G.A.; Grabsch, H.

    2009-01-01

    BACKGROUND: DNA aneuploidy reflects gross genomic changes. It can be measured by flow cytometry (FCM-DNA) or image cytometry (ICM-DNA). In gastric cancer, the prevalence of DNA aneuploidy has been reported to range from 27 to 100%, with conflicting associations with clinicopathological variables.

  13. A simple and efficient method for extraction of genomic DNA from ...

    African Journals Online (AJOL)

    DNA extraction in many plants is difficult because of metabolites that interfere with DNA isolation procedures and subsequent applications, such as DNA restriction, amplification and cloning. We have developed a reliable and efficient method for isolating genomic DNA free from polysaccharide, polyphenols and protein ...

  14. Dynamic changes in the genomic localization of DNA replication-related element binding factor during the cell cycle.

    Science.gov (United States)

    Gurudatta, B V; Yang, Jingping; Van Bortle, Kevin; Donlin-Asp, Paul G; Corces, Victor G

    2013-05-15

    DREF was first characterized for its role in the regulation of transcription of genes encoding proteins involved in DNA replication and found to interact with sequences similar to the DNA recognition motif of the BEAF-32 insulator protein. Insulators are DNA-protein complexes that mediate intra- and inter-chromosome interactions. Several DNA-binding insulator proteins have been described in Drosophila, including BEAF-32, dCTCF and Su(Hw). Here we find that DREF and BEAF-32 co-localize at the same genomic sites, but their enrichment shows an inverse correlation. Furthermore, DREF co-localizes in the genome with other insulator proteins, suggesting that the function of this protein may require components of Drosophila insulators. This is supported by the finding that mutations in insulator proteins modulate DREF-induced cell proliferation. DREF persists bound to chromatin during mitosis at a subset of sites where it also co-localizes with dCTCF, BEAF-32 and CP190. These sites are highly enriched for sites where Orc2 and Mcm2 are present during interphase and at the borders of topological domains of chromosomes defined by Hi-C. The results suggest that DREF and insulator proteins may help maintain chromosome organization during the cell cycle and mark a subset of genomic sites for the assembly of pre-replication complexes and gene bookmarking during the M/G1 transition.

  15. Genome-wide DNA methylation scan in major depressive disorder.

    Directory of Open Access Journals (Sweden)

    Sarven Sabunciyan

    Full Text Available While genome-wide association studies are ongoing to identify sequence variation influencing susceptibility to major depressive disorder (MDD, epigenetic marks, such as DNA methylation, which can be influenced by environment, might also play a role. Here we present the first genome-wide DNA methylation (DNAm scan in MDD. We compared 39 postmortem frontal cortex MDD samples to 26 controls. DNA was hybridized to our Comprehensive High-throughput Arrays for Relative Methylation (CHARM platform, covering 3.5 million CpGs. CHARM identified 224 candidate regions with DNAm differences >10%. These regions are highly enriched for neuronal growth and development genes. Ten of 17 regions for which validation was attempted showed true DNAm differences; the greatest were in PRIMA1, with 12-15% increased DNAm in MDD (p = 0.0002-0.0003, and a concomitant decrease in gene expression. These results must be considered pilot data, however, as we could only test replication in a small number of additional brain samples (n = 16, which showed no significant difference in PRIMA1. Because PRIMA1 anchors acetylcholinesterase in neuronal membranes, decreased expression could result in decreased enzyme function and increased cholinergic transmission, consistent with a role in MDD. We observed decreased immunoreactivity for acetylcholinesterase in MDD brain with increased PRIMA1 DNAm, non-significant at p = 0.08.While we cannot draw firm conclusions about PRIMA1 DNAm in MDD, the involvement of neuronal development genes across the set showing differential methylation suggests a role for epigenetics in the illness. Further studies using limbic system brain regions might shed additional light on this role.

  16. Simultaneous Whole Mitochondrial Genome Sequencing with Short Overlapping Amplicons Suitable for Degraded DNA Using the Ion Torrent Personal Genome Machine.

    Science.gov (United States)

    Chaitanya, Lakshmi; Ralf, Arwin; van Oven, Mannis; Kupiec, Tomasz; Chang, Joseph; Lagacé, Robert; Kayser, Manfred

    2015-12-01

    Whole mitochondrial (mt) genome analysis enables a considerable increase in analysis throughput, and improves the discriminatory power to the maximum possible phylogenetic resolution. Most established protocols on the different massively parallel sequencing (MPS) platforms, however, invariably involve the PCR amplification of large fragments, typically several kilobases in size, which may fail due to mtDNA fragmentation in the available degraded materials. We introduce a MPS tiling approach for simultaneous whole human mt genome sequencing using 161 short overlapping amplicons (average 200 bp) with the Ion Torrent Personal Genome Machine. We illustrate the performance of this new method by sequencing 20 DNA samples belonging to different worldwide mtDNA haplogroups. Additional quality control, particularly regarding the potential detection of nuclear insertions of mtDNA (NUMTs), was performed by comparative MPS analysis using the conventional long-range amplification method. Preliminary sensitivity testing revealed that detailed haplogroup inference was feasible with 100 pg genomic input DNA. Complete mt genome coverage was achieved from DNA samples experimentally degraded down to genomic fragment sizes of about 220 bp, and up to 90% coverage from naturally degraded samples. Overall, we introduce a new approach for whole mt genome MPS analysis from degraded and nondegraded materials relevant to resolve and infer maternal genetic ancestry at complete resolution in anthropological, evolutionary, medical, and forensic applications. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

  17. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  18. Genome-Wide Analysis of DNA Methylation in Human Amnion

    Science.gov (United States)

    Kim, Jinsil; Pitlick, Mitchell M.; Christine, Paul J.; Schaefer, Amanda R.; Saleme, Cesar; Comas, Belén; Cosentino, Viviana; Gadow, Enrique; Murray, Jeffrey C.

    2013-01-01

    The amnion is a specialized tissue in contact with the amniotic fluid, which is in a constantly changing state. To investigate the importance of epigenetic events in this tissue in the physiology and pathophysiology of pregnancy, we performed genome-wide DNA methylation profiling of human amnion from term (with and without labor) and preterm deliveries. Using the Illumina Infinium HumanMethylation27 BeadChip, we identified genes exhibiting differential methylation associated with normal labor and preterm birth. Functional analysis of the differentially methylated genes revealed biologically relevant enriched gene sets. Bisulfite sequencing analysis of the promoter region of the oxytocin receptor (OXTR) gene detected two CpG dinucleotides showing significant methylation differences among the three groups of samples. Hypermethylation of the CpG island of the solute carrier family 30 member 3 (SLC30A3) gene in preterm amnion was confirmed by methylation-specific PCR. This work provides preliminary evidence that DNA methylation changes in the amnion may be at least partially involved in the physiological process of labor and the etiology of preterm birth and suggests that DNA methylation profiles, in combination with other biological data, may provide valuable insight into the mechanisms underlying normal and pathological pregnancies. PMID:23533356

  19. Volume visualization of multiple alignment of large genomicDNA

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Nameeta; Dillard, Scott E.; Weber, Gunther H.; Hamann, Bernd

    2005-07-25

    Genomes of hundreds of species have been sequenced to date, and many more are being sequenced. As more and more sequence data sets become available, and as the challenge of comparing these massive ''billion basepair DNA sequences'' becomes substantial, so does the need for more powerful tools supporting the exploration of these data sets. Similarity score data used to compare aligned DNA sequences is inherently one-dimensional. One-dimensional (1D) representations of these data sets do not effectively utilize screen real estate. As a result, tools using 1D representations are incapable of providing informatory overview for extremely large data sets. We present a technique to arrange 1D data in 3D space to allow us to apply state-of-the-art interactive volume visualization techniques for data exploration. We demonstrate our technique using multi-millions-basepair-long aligned DNA sequence data and compare it with traditional 1D line plots. The results show that our technique is superior in providing an overview of entire data sets. Our technique, coupled with 1D line plots, results in effective multi-resolution visualization of very large aligned sequence data sets.

  20. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA.

    Science.gov (United States)

    Shahal, Tamar; Gilat, Noa; Michaeli, Yael; Redy-Keisar, Orit; Shabat, Doron; Ebenstein, Yuval

    2014-08-19

    5-Hydroxymethylcytosine (5hmC), a modified form of the DNA base cytosine, is an important epigenetic mark linked to regulation of gene expression in development, and tumorigenesis. We have developed a spectroscopic method for a global quantification of 5hmC in genomic DNA. The assay is performed within a multiwell plate, which allows simultaneous recording of up to 350 samples. Our quantification procedure of 5hmC is direct, simple, and rapid. It relies on a two-step protocol that consists of enzymatic glucosylation of 5hmC with an azide-modified glucose, followed by a "click reaction" with an alkyne-fluorescent tag. The fluorescence intensity recorded from the DNA sample is proportional to its 5hmC content and can be quantified by a simple plate reader measurement. This labeling technique is specific and highly sensitive, allowing detection of 5hmC down to 0.002% of the total nucleotides. Our results reveal significant variations in the 5hmC content obtained from different mouse tissues, in agreement with previously reported data.

  1. A genome-wide DNA methylation study in colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Dodsworth Charlotte

    2011-06-01

    Full Text Available Abstract Background We performed a genome-wide scan of 27,578 CpG loci covering 14,475 genes to identify differentially methylated loci (DML in colorectal carcinoma (CRC. Methods We used Illumina's Infinium methylation assay in paired DNA samples extracted from 24 fresh frozen CRC tissues and their corresponding normal colon tissues from 24 consecutive diagnosed patients at a tertiary medical center. Results We found a total of 627 DML in CRC covering 513 genes, of which 535 are novel DML covering 465 genes. We also validated the Illumina Infinium methylation data for top-ranking genes by non-bisulfite conversion q-PCR-based methyl profiler assay in a subset of the same samples. We also carried out integration of genome-wide copy number and expression microarray along with methylation profiling to see the functional effect of methylation. Gene Set Enrichment Analysis (GSEA showed that among the major "gene sets" that are hypermethylated in CRC are the sets: "inhibition of adenylate cyclase activity by G-protein signaling", "Rac guanyl-nucleotide exchange factor activity", "regulation of retinoic acid receptor signaling pathway" and "estrogen receptor activity". Two-level nested cross validation showed that DML-based predictive models may offer reasonable sensitivity (around 89%, specificity (around 95%, positive predictive value (around 95% and negative predictive value (around 89%, suggesting that these markers may have potential clinical application. Conclusion Our genome-wide methylation study in CRC clearly supports most of the previous findings; additionally we found a large number of novel DML in CRC tissue. If confirmed in future studies, these findings may lead to identification of genomic markers for potential clinical application.

  2. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  3. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2006-01-01

    .... We attained our goals for the second fiscal year, first, by constructing unique expression plasmids encoding endoglin and co-expressing IL-15 or encoding IL-7, the latter to be co-expressed with endoglin...

  4. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  5. Mining Xanthomonas and Streptomyces genomes for new pectinase-encoding sequences and their heterologous expression in Escherichia coli.

    Science.gov (United States)

    Xiao, Zhizhuang; Boyd, Jason; Grosse, Stephan; Beauchemin, Manon; Coupe, Elizabeth; Lau, Peter C K

    2008-04-01

    Microbial genome sequencing has left a legacy of annotated yet uncharacterized genes or open reading frames, activities that may have useful applications in health and/or the environment. We are interested in the discovery and characterization of potentially new pectinolytic activities for the enzymatic retting of natural bast fibers such as hemp and flax. A highlight in this study is the discovery of a cold-active pectate lyase among five pectate-lyase-encoding sequences and two polygalacturonase-encoding sequences that we have cloned from the genomes of Xanthomonas campestris pv. campestris and Streptomyces coelicolor A3(2). Heterologous expression of these sequences as active pectate lyases and polygalacturonases required their subcloning in Escherichia coli Rosetta cells. The most active recombinant pectate lyase (XcPL NP_638163), a cold-active pectate lyase (XcPL NP_636037), and a polygalacturonase (XcPG NP_638805) were purified to near homogeneity and their kinetic parameters were determined. A significant amount of pectin degradation products was shown to be released by the two pectate lyases but not the polygalacturonase when hemp fiber pectin was used as substrate. Results of this study showed that genome data mining, besides an economical approach to new gene acquisition, may uncover new findings such as the discovery of a cold-active pectate-lyase-encoding sequence from X. campestris, a mesophilic microorganism.

  6. Selective enrichment and sequencing of whole mitochondrial genomes in the presence of nuclear encoded mitochondrial pseudogenes (numts.

    Directory of Open Access Journals (Sweden)

    Jonci N Wolff

    Full Text Available Numts are an integral component of many eukaryote genomes offering a snapshot of the evolutionary process that led from the incorporation of an α-proteobacterium into a larger eukaryotic cell some 1.8 billion years ago. Although numt sequence can be harnessed as molecular marker, these sequences often remain unidentified and are mistaken for genuine mtDNA leading to erroneous interpretation of mtDNA data sets. It is therefore indispensable that during the process of amplifying and sequencing mitochondrial genes, preventive measures are taken to ensure the exclusion of numts to guarantee the recovery of genuine mtDNA. This applies to mtDNA analyses in general but especially to studies where mtDNAs are sequenced de novo as the launch pad for subsequent mtDNA-based research. By using a combination of dilution series and nested rolling circle amplification (RCA, we present a novel strategy to selectively amplify mtDNA and exclude the amplification of numt sequence. We have successfully applied this strategy to de novo sequence the mtDNA of the Black Field Cricket Teleogryllus commodus, a species known to contain numts. Aligning our assembled sequence to the reference genome of Teleogryllus emma (GenBank EU557269.1 led to the identification of a numt sequence in the reference sequence. This unexpected result further highlights the need of a reliable and accessible strategy to eliminate this source of error.

  7. Discovering Drugs with DNA-Encoded Library Technology: From Concept to Clinic with an Inhibitor of Soluble Epoxide Hydrolase.

    Science.gov (United States)

    Belyanskaya, Svetlana L; Ding, Yun; Callahan, James F; Lazaar, Aili L; Israel, David I

    2017-05-04

    DNA-encoded chemical library technology was developed with the vision of its becoming a transformational platform for drug discovery. The hope was that a new paradigm for the discovery of low-molecular-weight drugs would be enabled by combining the vast molecular diversity achievable with combinatorial chemistry, the information-encoding attributes of DNA, the power of molecular biology, and a streamlined selection-based discovery process. Here, we describe the discovery and early clinical development of GSK2256294, an inhibitor of soluble epoxide hydrolase (sEH, EPHX2), by using encoded-library technology (ELT). GSK2256294 is an orally bioavailable, potent and selective inhibitor of sEH that has a long half life and produced no serious adverse events in a first-time-in-human clinical study. To our knowledge, GSK2256294 is the first molecule discovered from this technology to enter human clinical testing and represents a realization of the vision that DNA-encoded chemical library technology can efficiently yield molecules with favorable properties that can be readily progressed into high-quality drugs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Devor, E.J.; Dill-Devor, R.M. [Univ. of Iowa College of Medicine, Iowa City (United States)

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCR assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.

  9. Molecular characterization of transgenic shallots (Allium cepa L.) by adaptor ligation PCR (AL-PCR) and sequencing of genomic DNA flanking T-DNA borders

    NARCIS (Netherlands)

    Zheng, S.J.; Henken, G.; Sofiari, E.; Jacobsen, E.; Krens, F.A.

    2001-01-01

    Genomic DNA blot hybridization is traditionally used to demonstrate that, via genetic transformation, foreign genes are integrated into host genomes. However, in large genome species, such as Allium cepa L., the use of genomic DNA blot hybridization is pushed towards its limits, because a

  10. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  11. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  12. A protocol for large scale genomic DNA isolation for cacao genetics ...

    African Journals Online (AJOL)

    Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the preservation of tissue samples for future use in cacao genome studies. The present study proposes a method for the ...

  13. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  14. A simple and rapid lysis method for preparation of genomic DNA ...

    African Journals Online (AJOL)

    Moreover, the resultant genomic DNA was in good quantity and quality and can be used successfully for restriction endonucleases digestion, PCR amplification and others types of molecular biology manipulations. Keywords: Genomic DNA, lysis, carvacrol, Gram-negative bacteria, Escherichia coli, Erwinia chrysanthemi ...

  15. Thermus thermophilis dnaX homolog encoding gamma- and tau-like proteins of the chromosomal replicase.

    Science.gov (United States)

    Yurieva, O; Skangalis, M; Kuriyan, J; O'Donnell, M

    1997-10-24

    This report identifies the dnaX homolog from Thermus thermophilis. Replicases from bacteria to humans contain subunits that are homologous to one another. These homologs are subunits of a clamp loading apparatus that loads sliding clamps onto DNA, which in turn act as mobile tethers for the replication machinery. In Escherichia coli, two of these subunits (gamma and tau) are encoded by one gene (dnaX) in nearly equal amounts by way of an efficient translational frameshift. The gamma and tau subunits form the central touchpoint that holds together two DNA polymerases with one clamp loading apparatus to form the E. coli chromosomal replicase, DNA polymerase III holoenzyme. The E. coli holoenzyme is an efficient replication machine that simultaneously replicates both strands of duplex DNA. The T. thermophilis dnaX homolog also contains a frameshift signature and produces both tau- and gamma-like proteins. Recombinant T. thermophilis tau- and gamma-like proteins, expressed in E. coli, have an oligomeric state similar to that of their E. coli counterparts and display ATPase activity that is stimulated by DNA. These results imply that T. thermophilis utilizes a DNA polymerase III holoenzyme replication machinery similar to that of E. coli.

  16. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  17. Perlecan and vascular endothelial growth factor-encoding DNA-loaded chitosan scaffolds promote angiogenesis and wound healing.

    Science.gov (United States)

    Lord, Megan S; Ellis, April L; Farrugia, Brooke L; Whitelock, John M; Grenett, Hernan; Li, Chuanyu; O'Grady, Robert L; DeCarlo, Arthur A

    2017-03-28

    The repair of dermal wounds, particularly in the diabetic population, poses a significant healthcare burden. The impaired wound healing of diabetic wounds is attributed to low levels of endogenous growth factors, including vascular endothelial growth factor (VEGF), that normally stimulate multiple phases of wound healing. In this study, chitosan scaffolds were prepared via freeze drying and loaded with plasmid DNA encoding perlecan domain I and VEGF189 and analyzed in vivo for their ability to promote dermal wound healing. The plasmid DNA encoding perlecan domain I and VEGF189 loaded scaffolds promoted dermal wound healing in normal and diabetic rats. This treatment resulted in an increase in the number of blood vessels and sub-epithelial connective tissue matrix components within the wound beds compared to wounds treated with chitosan scaffolds containing control DNA or wounded controls. These results suggest that chitosan scaffolds containing plasmid DNA encoding VEGF189 and perlecan domain I have the potential to induce angiogenesis and wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. ORF 2 from the Bacillus cereus linear plasmid pBClin15 encodes a DNA binding protein.

    Science.gov (United States)

    Stabell, F B; Egge-Jacobsen, W; Risøen, P A; Kolstø, A-B; Økstad, O A

    2009-01-01

    To isolate and identify DNA-binding protein(s) with affinity for the mobile chromosomal repeat element bcr1 in Bacillus cereus group bacteria. A biotinylated bcr1 element was immobilized to streptavidin-coated magnetic beads and used to pull out a 20 kDa DNA-binding protein from a whole cell protein extract of B. cereus ATCC 14579. The protein was identified as the product of ORF 2 encoded by the bacteriophage-related autonomously replicating linear genetic element pBClin15 carried by the strain. DNA binding was not bcr1-specific. By Northern blotting ORF 2 was co-transcribed with ORF 1, and also in certain instances with ORF 3 by transcriptional readthrough of the terminator located between ORF 2 and ORF 3. ORF 2 from pBClin15 encodes a DNA-binding protein. ORF 2 is co-transcribed with its upstream gene ORF 1, and in a subset of the transcripts also with the downstream gene ORF 3 through alternative transcription termination. The B. cereus group contains bacterial species of medical and economic importance. Bacteriophages or phage-encoded proteins from these bacteria have been suggested as potential therapeutic agents. Understanding the biology of bacteriophage-related genetic elements through functional characterization of their genes is of high relevance.

  19. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  20. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  1. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  2. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  3. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH.

    Science.gov (United States)

    Guillaud-Bataille, Marine; Valent, Alexander; Soularue, Pascal; Perot, Christine; Inda, Maria Mar; Receveur, Aline; Smaïli, Sadek; Roest Crollius, Hugues; Bénard, Jean; Bernheim, Alain; Gidrol, Xavier; Danglot, Gisèle

    2004-07-29

    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detection of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical 1 microg usually necessary. Using a discrete series of DNA fragments, we defined the parameters adapted to the most faithful ligation-mediated PCR amplification and the limits of the technique. The optimized protocol allows a 3000-fold DNA amplification, retaining the quantitative characteristics of the initial genome. Validation of the amplification procedure, using DNA from 10 tumour cell lines hybridized to BAC-arrays of 1500 spots, showed almost perfectly superimposed ratios for the non-amplified and amplified DNAs. Correlation coefficients of 0.96 and 0.99 were observed for regions of low-copy-level variations and all regions, respectively (including in vivo amplified oncogenes). Finally, labelling DNA using two nucleotides bearing the same fluorophore led to a significant increase in reproducibility and to the correct detection of one-copy gain or loss in >90% of the analysed data, even for pseudotriploid tumour genomes.

  4. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  5. Genomic and functional characterization of qnr-encoding plasmids from municipal wastewater biosolid Klebsiella pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Ella eKaplan

    2015-12-01

    Full Text Available Municipal wastewater treatment facilities are considered to be hotspots for antibiotic resistance since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp, multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to 5 different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7-9Kbp and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other p

  6. Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

    Science.gov (United States)

    Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

    2017-04-01

    Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing.

    Science.gov (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C

    2017-03-31

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  8. Chemically synthesized silver nanoparticles as cell lysis agent for bacterial genomic DNA isolation

    Science.gov (United States)

    Goswami, Gunajit; Boruah, Himangshu; Gautom, Trishnamoni; Jyoti Hazarika, Dibya; Barooah, Madhumita; Boro, Robin Chandra

    2017-12-01

    Silver nanoparticles (AgNPs) have seen a recent spurt of use in varied fields of science. In this paper, we showed a novel application of AgNP as a promising microbial cell-lysis agent for genomic DNA isolation. We utilized chemically synthesized AgNPs for lysing bacterial cells to isolate their genomic DNA. The AgNPs efficiently lysed bacterial cells to yield good quality DNA that could be subsequently used for several molecular biology works.

  9. Emergence of a daptomycin-non-susceptible Enterococcus faecium strain that encodes mutations in DNA repair genes after high-dose daptomycin therapy.

    Science.gov (United States)

    Matono, Takashi; Hayakawa, Kayoko; Hirai, Risen; Tanimura, Akira; Yamamoto, Kei; Fujiya, Yoshihiro; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Mezaki, Kazuhisa; Ohmagari, Norio; Miyoshi-Akiyama, Tohru

    2016-04-01

    An increasing number of reports have documented the emergence of daptomycin-nonsusceptible Enterococcus in patients during daptomycin therapy. Even though several mechanisms for daptomycin-nonsusceptibility have been suggested, the potential genetic mutations which might contribute to the daptomycin-nonsusceptibility are not fully understood. We isolated a vancomycin-susceptible, daptomycin nonsusceptible Enterococcus faecium strain from a patient with acute lymphocytic leukemia who received high-dose daptomycin therapy for E. faecium endocarditis. Whole-genome sequencing analysis revealed mutations within genes encoding DNA repair proteins MutL and RecJ of the daptomycin-nonsusceptible Enterococcus strain which might have facilitated its emergence. We identified the mutations of DNA mismatch repair genes in a clinical isolate of daptomycin nonsusceptible E. faecium which emerged in spite of high-dose daptomycin therapy. The finding implicates the possible association of DNA repair mechanism and daptomycin resistance. Careful monitoring is necessary to avoid the emergence of daptomycin non-susceptible isolates of E. faecium and particularly in cases of long-term daptomycin use or in immunocompromised patients.

  10. Extraction of human genomic DNA from whole blood using a magnetic microsphere method.

    Science.gov (United States)

    Gong, Rui; Li, Shengying

    2014-01-01

    With the rapid development of molecular biology and the life sciences, magnetic extraction is a simple, automatic, and highly efficient method for separating biological molecules, performing immunoassays, and other applications. Human blood is an ideal source of human genomic DNA. Extracting genomic DNA by traditional methods is time-consuming, and phenol and chloroform are toxic reagents that endanger health. Therefore, it is necessary to find a more convenient and efficient method for obtaining human genomic DNA. In this study, we developed urea-formaldehyde resin magnetic microspheres and magnetic silica microspheres for extraction of human genomic DNA. First, a magnetic microsphere suspension was prepared and used to extract genomic DNA from fresh whole blood, frozen blood, dried blood, and trace blood. Second, DNA content and purity were measured by agarose electrophoresis and ultraviolet spectrophotometry. The human genomic DNA extracted from whole blood was then subjected to polymerase chain reaction analysis to further confirm its quality. The results of this study lay a good foundation for future research and development of a high-throughput and rapid extraction method for extracting genomic DNA from various types of blood samples.

  11. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Hybrid DNA and Enzyme Based Computing for Address Encoding, Link Switching and Error Correction in Molecular Communication

    Science.gov (United States)

    Walsh, Frank; Balasubramaniam, Sasitharan; Botvich, Dmitri; Suda, Tatsuya; Nakano, Tadashi; Bush, Stephen F.; Foghlú, Mícheál Ó.

    This paper proposes a biological cell-based communication protocol to enable communication between biological nanodevices. Inspired by existing communication network protocols, our solution combines two molecular computing techniques (DNA and enzyme computing), to design a protocol stack for molecular communication networks. Based on computational requirements of each layer of the stack, our solution specifies biomolecule address encoding/decoding, error correction and link switching mechanisms for molecular communication networks.

  13. DNA Immunization with the Gene Encoding P4 Nuclease of Leishmania amazonensis Protects Mice against Cutaneous Leishmaniasis

    Science.gov (United States)

    Campbell, Kimberly; Diao, Hong; Ji, Jiaxiang; Soong, Lynn

    2003-01-01

    Infection with the protozoan parasite Leishmania amazonensis can cause diverse clinical forms of leishmaniasis. Immunization with purified P4 nuclease protein has been shown to elicit a protective response in mice challenged with L. amazonensis and L. pifanoi. To explore the potential of a DNA-based vaccine, we tested the L. amazonensis gene encoding P4 nuclease as well as adjuvant constructs encoding murine interleukin-12 (IL-12) and L. amazonensis HSP70. Susceptible BALB/c mice were immunized with the DNA encoding P4 alone, P4/IL-12, or P4/HSP70 prior to challenge with L. amazonensis promastigotes. Mice given P4/IL-12 exhibited no lesion development and had a 3- to 4-log reduction in tissue parasite burdens compared to controls. This protection corresponded to significant increases in gamma interferon and tumor necrosis factor alpha production and a reduction in parasite-specific immunoglobulin G1, suggesting an enhancement in Th1 responses. Moreover, we immunized mice with the L. amazonensis vaccines to determine if this vaccine regimen could provide cross-protection against a genetically diverse species, L. major. While the P4/HSP70 vaccine led to self-healing lesions, the P4/IL-12 vaccine provided negligible protection against L. major infection. This is the first report of successful use of a DNA vaccine to induce protection against L. amazonensis infection. Additionally, our results indicate that different vaccine combinations, including DNA encoding P4, HSP70, or IL-12, can provide significant protection against both Old World and New World cutaneous leishmaniasis. PMID:14573646

  14. Immune protection duration and efficacy stability of DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 against coccidiosis.

    Science.gov (United States)

    Song, Xiaokai; Zhao, Xiaofang; Xu, Lixin; Yan, Ruofeng; Li, Xiangrui

    2017-04-01

    In our previous study, an effective DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 was constructed. In the present study, the immunization dose of the DNA vaccine pVAX1.0-TA4-IL-2 was further optimized. With the optimized dose, the dynamics of antibodies induced by the DNA vaccine was determined using indirect ELISA. To evaluate the immune protection duration of the DNA vaccine, two-week-old chickens were intramuscularly immunized twice and the induced efficacy was evaluated by challenging with E. tenella at 5, 9, 13, 17 and 21weeks post the last immunization (PLI) separately. To evaluate the efficacy stability of the DNA vaccine, two-week-old chickens were immunized with 3 batches of the DNA vaccine, and the induced efficacy was evaluated by challenging with E. tenella. The results showed that the optimal dose was 25μg. The induced antibody level persisted until 10weeks PPI. For the challenge time of 5 and 9weeks PLI, the immunization resulted in ACIs of 182.28 and 162.23 beyond 160, showing effective protection. However, for the challenge time of 13, 17 and 21weeks PLI, the immunization resulted in ACIs below 160 which means poor protection. Therefore, the immune protection duration of the DNA vaccination was at least 9weeks PLI. DNA immunization with three batches DNA vaccine resulted in ACIs of 187.52, 191.57 and 185.22, which demonstrated that efficacies of the three batches DNA vaccine were effective and stable. Overall, our results indicate that DNA vaccine pVAX1.0-TA4-IL-2 has the potential to be developed as effective vaccine against coccidiosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  16. High accuracy genotyping directly from genomic DNA using a rolling circle amplification based assay

    Directory of Open Access Journals (Sweden)

    Du Yuefen

    2003-05-01

    Full Text Available Abstract Background Rolling circle amplification of ligated probes is a simple and sensitive means for genotyping directly from genomic DNA. SNPs and mutations are interrogated with open circle probes (OCP that can be circularized by DNA ligase when the probe matches the genotype. An amplified detection signal is generated by exponential rolling circle amplification (ERCA of the circularized probe. The low cost and scalability of ligation/ERCA genotyping makes it ideally suited for automated, high throughput methods. Results A retrospective study using human genomic DNA samples of known genotype was performed for four different clinically relevant mutations: Factor V Leiden, Factor II prothrombin, and two hemochromatosis mutations, C282Y and H63D. Greater than 99% accuracy was obtained genotyping genomic DNA samples from hundreds of different individuals. The combined process of ligation/ERCA was performed in a single tube and produced fluorescent signal directly from genomic DNA in less than an hour. In each assay, the probes for both normal and mutant alleles were combined in a single reaction. Multiple ERCA primers combined with a quenched-peptide nucleic acid (Q-PNA fluorescent detection system greatly accellerated the appearance of signal. Probes designed with hairpin structures reduced misamplification. Genotyping accuracy was identical from either purified genomic DNA or genomic DNA generated using whole genome amplification (WGA. Fluorescent signal output was measured in real time and as an end point. Conclusions Combining the optimal elements for ligation/ERCA genotyping has resulted in a highly accurate single tube assay for genotyping directly from genomic DNA samples. Accuracy exceeded 99 % for four probe sets targeting clinically relevant mutations. No genotypes were called incorrectly using either genomic DNA or whole genome amplified sample.

  17. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  18. A second actin-like MamK protein in Magnetospirillum magneticum AMB-1 encoded outside the genomic magnetosome island.

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Rioux

    2010-02-01

    Full Text Available Magnetotactic bacteria are able to swim navigating along geomagnetic field lines. They synthesize ferromagnetic nanocrystals that are embedded in cytoplasmic membrane invaginations forming magnetosomes. Regularly aligned in the cytoplasm along cytoskeleton filaments, the magnetosome chain effectively forms a compass needle bestowing on bacteria their magnetotactic behaviour. A large genomic island, conserved among magnetotactic bacteria, contains the genes potentially involved in magnetosome formation. One of the genes, mamK has been described as encoding a prokaryotic actin-like protein which when it polymerizes forms in the cytoplasm filamentous structures that provide the scaffold for magnetosome alignment. Here, we have identified a series of genes highly similar to the mam genes in the genome of Magnetospirillum magneticum AMB-1. The newly annotated genes are clustered in a genomic islet distinct and distant from the known magnetosome genomic island and most probably acquired by lateral gene transfer rather than duplication. We focused on a mamK-like gene whose product shares 54.5% identity with the actin-like MamK. Filament bundles of polymerized MamK-like protein were observed in vitro with electron microscopy and in vivo in E. coli cells expressing MamK-like-Venus fusions by fluorescence microscopy. In addition, we demonstrate that mamK-like is transcribed in AMB-1 wild-type and DeltamamK mutant cells and that the actin-like filamentous structures observed in the DeltamamK strain are probably MamK-like polymers. Thus MamK-like is a new member of the prokaryotic actin-like family. This is the first evidence of a functional mam gene encoded outside the magnetosome genomic island.

  19. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...... protein substantially reduces the replication efficiency of chromatin but not of naked DNA templates....

  20. A novel virus genome discovered in an extreme environment suggests recombination between unrelated groups of RNA and DNA viruses

    Science.gov (United States)

    2012-01-01

    Background Viruses are known to be the most abundant organisms on earth, yet little is known about their collective origin and evolutionary history. With exceptionally high rates of genetic mutation and mosaicism, it is not currently possible to resolve deep evolutionary histories of the known major virus groups. Metagenomics offers a potential means of establishing a more comprehensive view of viral evolution as vast amounts of new sequence data becomes available for comparative analysis. Results Bioinformatic analysis of viral metagenomic sequences derived from a hot, acidic lake revealed a circular, putatively single-stranded DNA virus encoding a major capsid protein similar to those found only in single-stranded RNA viruses. The presence and circular configuration of the complete virus genome was confirmed by inverse PCR amplification from native DNA extracted from lake sediment. The virus genome appears to be the result of a RNA-DNA recombination event between two ostensibly unrelated virus groups. Environmental sequence databases were examined for homologous genes arranged in similar configurations and three similar putative virus genomes from marine environments were identified. This result indicates the existence of a widespread but previously undetected group of viruses. Conclusions This unique viral genome carries implications for theories of virus emergence and evolution, as no mechanism for interviral RNA-DNA recombination has yet been identified, and only scant evidence exists that genetic exchange occurs between such distinct virus lineages. Reviewers This article was reviewed by EK, MK (nominated by PF) and AM. For the full reviews, please go to the Reviewers' comments section. PMID:22515485

  1. The complete chloroplast DNA sequence of the green alga Nephroselmis olivacea: insights into the architecture of ancestral chloroplast genomes.

    Science.gov (United States)

    Turmel, M; Otis, C; Lemieux, C

    1999-08-31

    Green plants seem to form two sister lineages: Chlorophyta, comprising the green algal classes Prasinophyceae, Ulvophyceae, Trebouxiophyceae, and Chlorophyceae, and Streptophyta, comprising the Charophyceae and land plants. We have determined the complete chloroplast DNA (cpDNA) sequence (200,799 bp) of Nephroselmis olivacea, a member of the class (Prasinophyceae) thought to include descendants of the earliest-diverging green algae. The 127 genes identified in this genome represent the largest gene repertoire among the green algal and land plant cpDNAs completely sequenced to date. Of the Nephroselmis genes, 2 (ycf81 and ftsI, a gene involved in peptidoglycan synthesis) have not been identified in any previously investigated cpDNA; 5 genes [ftsW, rnE, ycf62, rnpB, and trnS(cga)] have been found only in cpDNAs of nongreen algae; and 10 others (ndh genes) have been described only in land plant cpDNAs. Nephroselmis and land plant cpDNAs share the same quadripartite structure-which is characterized by the presence of a large rRNA-encoding inverted repeat and two unequal single-copy regions-and very similar sets of genes in corresponding genomic regions. Given that our phylogenetic analyses place Nephroselmis within the Chlorophyta, these structural characteristics were most likely present in the cpDNA of the common ancestor of chlorophytes and streptophytes. Comparative analyses of chloroplast genomes indicate that the typical quadripartite architecture and gene-partitioning pattern of land plant cpDNAs are ancient features that may have been derived from the genome of the cyanobacterial progenitor of chloroplasts. Our phylogenetic data also offer insight into the chlorophyte ancestor of euglenophyte chloroplasts.

  2. A DNA Vaccine Encoding Cu,Zn Superoxide Dismutase of Brucella abortus Induces Protective Immunity in BALB/c Mice

    Science.gov (United States)

    Oñate, Angel A.; Céspedes, Sandra; Cabrera, Alex; Rivers, Rodolfo; González, Andrés; Muñoz, Carola; Folch, Hugo; Andrews, Edilia

    2003-01-01

    This study was conducted to evaluate the immunogenicity and protective efficacy of a DNA vaccine encoding Brucella abortus Cu,Zn superoxide dismutase (SOD). Intramuscular injection of plasmid DNA carrying the SOD gene (pcDNA-SOD) into BALB/c mice elicited both humoral and cellular immune responses. Animals injected with pcDNA-SOD developed SOD-specific antibodies which exhibited a dominance of immunoglobulin G2a (IgG2a) over IgG1. In addition, the DNA vaccine elicited a T-cell-proliferative response and also induced the production of gamma interferon, but not interleukin-10 (IL-10) or IL-4, upon restimulation with either recombinant SOD or crude Brucella protein, suggesting the induction of a typical T-helper-1-dominated immune response in mice. The pcDNA-SOD (but not the control vector) induced a strong, significant level of protection in BALB/c mice against challenge with B. abortus virulent strain 2308; the level of protection was similar to the one induced by B. abortus vaccine strain RB51. Altogether, these data suggest that pcDNA-SOD is a good candidate for use in future studies of vaccination against brucellosis. PMID:12933826

  3. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    Science.gov (United States)

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  4. Influence of Feature Encoding and Choice of Classifier on Disease Risk Prediction in Genome-Wide Association Studies.

    Directory of Open Access Journals (Sweden)

    Florian Mittag

    Full Text Available Various attempts have been made to predict the individual disease risk based on genotype data from genome-wide association studies (GWAS. However, most studies only investigated one or two classification algorithms and feature encoding schemes. In this study, we applied seven different classification algorithms on GWAS case-control data sets for seven different diseases to create models for disease risk prediction. Further, we used three different encoding schemes for the genotypes of single nucleotide polymorphisms (SNPs and investigated their influence on the predictive performance of these models. Our study suggests that an additive encoding of the SNP data should be the preferred encoding scheme, as it proved to yield the best predictive performances for all algorithms and data sets. Furthermore, our results showed that the differences between most state-of-the-art classification algorithms are not statistically significant. Consequently, we recommend to prefer algorithms with simple models like the linear support vector machine (SVM as they allow for better subsequent interpretation without significant loss of accuracy.

  5. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  6. Whole-genome DNA methylation status associated with clinical PTSD measures of OIF/OEF veterans

    Science.gov (United States)

    Hammamieh, R; Chakraborty, N; Gautam, A; Muhie, S; Yang, R; Donohue, D; Kumar, R; Daigle, B J; Zhang, Y; Amara, D A; Miller, S-A; Srinivasan, S; Flory, J; Yehuda, R; Petzold, L; Wolkowitz, O M; Mellon, S H; Hood, L; Doyle, F J; Marmar, C; Jett, M

    2017-01-01

    Emerging knowledge suggests that post-traumatic stress disorder (PTSD) pathophysiology is linked to the patients’ epigenetic changes, but comprehensive studies examining genome-wide methylation have not been performed. In this study, we examined genome-wide DNA methylation in peripheral whole blood in combat veterans with and without PTSD to ascertain differentially methylated probes. Discovery was initially made in a training sample comprising 48 male Operation Enduring Freedom (OEF)/Operation Iraqi Freedom (OIF) veterans with PTSD and 51 age/ethnicity/gender-matched combat-exposed PTSD-negative controls. Agilent whole-genome array detected ~5600 differentially methylated CpG islands (CpGI) annotated to ~2800 differently methylated genes (DMGs). The majority (84.5%) of these CpGIs were hypermethylated in the PTSD cases. Functional analysis was performed using the DMGs encoding the promoter-bound CpGIs to identify networks related to PTSD. The identified networks were further validated by an independent test set comprising 31 PTSD+/29 PTSD− veterans. Targeted bisulfite sequencing was also used to confirm the methylation status of 20 DMGs shown to be highly perturbed in the training set. To improve the statistical power and mitigate the assay bias and batch effects, a union set combining both training and test set was assayed using a different platform from Illumina. The pathways curated from this analysis confirmed 65% of the pool of pathways mined from training and test sets. The results highlight the importance of assay methodology and use of independent samples for discovery and validation of differentially methylated genes mined from whole blood. Nonetheless, the current study demonstrates that several important epigenetically altered networks may distinguish combat-exposed veterans with and without PTSD. PMID:28696412

  7. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    Energy Technology Data Exchange (ETDEWEB)

    Walworth, Nathan G.; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, T.; Goodwin, Lynne A.; Kyrpides, Nikos; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.

    2015-04-07

    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance due to its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and non-pathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus both in culture and in situ. Transcriptome analysis indicates that 86% of the non-coding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and two fold higher than that found in the gene dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium ncRNA secondary structures were predicted between most culture and metagenomic sequences lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high fidelity replication allowed the unusual ‘inflation’ of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  8. A genomic region of lactococcal temperate bacteriophage TP901-1 encoding major virion proteins

    DEFF Research Database (Denmark)

    Johnsen, Mads G.; Appel, Karen Fuglede; Madsen, Hans Peter Lynge

    1996-01-01

    Two major structural proteins, MHP (major head protein) and MTP (major tail protein), from the lactococcal temperate phage TP901-1 were sequenced at their amino acid termini, and derived degenerate oligonucleotides were used to locate the corresponding genes in the phage genome. This genomic regi...

  9. The emerging role of nuclear architecture in DNA repair and genome maintenance.

    Science.gov (United States)

    Misteli, Tom; Soutoglou, Evi

    2009-04-01

    DNA repair and maintenance of genome stability are crucial to cellular and organismal function, and defects in these processes have been implicated in cancer and ageing. Detailed molecular, biochemical and genetic analyses have outlined the molecular framework involved in cellular DNA-repair pathways, but recent cell-biological approaches have revealed important roles for the spatial and temporal organization of the DNA-repair machinery during the recognition of DNA lesions and the assembly of repair complexes. It has also become clear that local higher-order chromatin structure, chromatin dynamics and non-random global genome organization are key factors in genome maintenance. These cell-biological features of DNA repair illustrate an emerging role for nuclear architecture in multiple aspects of genome maintenance.

  10. Extraction of high-molecular-weight genomic DNA for long-read sequencing of single molecules.

    Science.gov (United States)

    Mayjonade, Baptiste; Gouzy, Jérôme; Donnadieu, Cécile; Pouilly, Nicolas; Marande, William; Callot, Caroline; Langlade, Nicolas; Muños, Stéphane

    2016-10-01

    De novo sequencing of complex genomes is one of the main challenges for researchers seeking high-quality reference sequences. Many de novo assemblies are based on short reads, producing fragmented genome sequences. Third-generation sequencing, with read lengths >10 kb, will improve the assembly of complex genomes, but these techniques require high-molecular-weight genomic DNA (gDNA), and gDNA extraction protocols used for obtaining smaller fragments for short-read sequencing are not suitable for this purpose. Methods of preparing gDNA for bacterial artificial chromosome (BAC) libraries could be adapted, but these approaches are time-consuming, and commercial kits for these methods are expensive. Here, we present a protocol for rapid, inexpensive extraction of high-molecular-weight gDNA from bacteria, plants, and animals. Our technique was validated using sunflower leaf samples, producing a mean read length of 12.6 kb and a maximum read length of 80 kb.

  11. Two novel temperate bacteriophages co-existing in Aeromonas sp. ARM81 - characterization of their genomes, proteomes and DNA methyltransferases.

    Science.gov (United States)

    Dziewit, Lukasz; Radlinska, Monika

    2016-08-01

    Aeromonas species are causative agents of a wide spectrum of diseases in animals and humans. Although these bacteria are commonly found in various environments, little is known about their phages. Thus far, only one temperate Aeromonas phage has been characterized. Whole-genome sequencing of an Aeromonas sp. strain ARM81 revealed the presence of two prophage clusters. One of them is integrated into the chromosome and the other was maintained as an extrachromosomal, linear plasmid-like prophage encoding a protelomerase. Both prophages were artificially and spontaneously inducible. We separately isolated both phages and compared their genomes with other known viruses. The novel phages show no similarity to the previously characterized Aeromonas phages and might represent new evolutionary lineages of viruses infecting Aeromonadaceae. Apart from the comparative genomic analyses of these phages, complemented with their structural and molecular characterization, a functional analysis of four DNA methyltransferases encoded by these viruses was conducted. One of the investigated N6-adenine-modifying enzymes shares sequence specificity with a Dam-like methyltransferase of its bacterial host, while another one is non-specific, as it catalyzes adenine methylation in various sequence contexts. The presented results shed new light on the diversity of Aeromonas temperate phages.

  12. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  13. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    Science.gov (United States)

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  14. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp..

    Directory of Open Access Journals (Sweden)

    Jana Čížková

    Full Text Available Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp. are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome and inter-specific crosses between M. acuminata and M. balbisiana (B genome. Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  15. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Science.gov (United States)

    Hitz, Benjamin C; Rowe, Laurence D; Podduturi, Nikhil R; Glick, David I; Baymuradov, Ulugbek K; Malladi, Venkat S; Chan, Esther T; Davidson, Jean M; Gabdank, Idan; Narayana, Aditi K; Onate, Kathrina C; Hilton, Jason; Ho, Marcus C; Lee, Brian T; Miyasato, Stuart R; Dreszer, Timothy R; Sloan, Cricket A; Strattan, J Seth; Tanaka, Forrest Y; Hong, Eurie L; Cherry, J Michael

    2017-01-01

    The Encyclopedia of DNA elements (ENCODE) project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC) for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database) and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data) has been released as a separate Python package.

  16. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  17. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  18. Single-cell genomics reveals pyrrolysine-encoding potential in members of uncultivated archaeal candidate division MSBL1

    KAUST Repository

    Guan, Yue

    2017-05-11

    Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.

  19. Outsourcing the Nucleus: Nuclear Pore Complex Genes are no Longer Encoded in Nucleomorph Genomes

    Directory of Open Access Journals (Sweden)

    Nadja Neumann

    2006-01-01

    Full Text Available The nuclear pore complex (NPC facilitates transport between nucleus and cytoplasm. The protein constituents of the NPC, termed nucleoporins (Nups, are conserved across a wide diversity of eukaryotes. In apparent exception to this, no nucleoporin genes have been identified in nucleomorph genomes. Nucleomorphs, nuclear remnants of once free-living eukaryotes, took up residence as secondary endosymbionts in cryptomonad and chlorarachniophyte algae. As these genomes are highly reduced, Nup genes may have been lost, or relocated to the host nucleus. However, Nup genes are often poorly conserved between species, so absence may be an artifact of low sequence similarity. We therefore constructed an evolutionary bioinformatic screen to establish whether the apparent absence of Nup genes in nucleomorph genomes is due to genuine absence or the inability of current methods to detect homologues. We searched green plant (Arabidopsis and rice, green alga (Chlamydomonas reinhardtii and red alga (Cyanidioschyzon merolae genomes, plus two nucleomorph genomes (Bigelowiella natans and Guillardia theta with profile hidden Markov models (HMMs from curated alignments of known vertebrate/yeast Nups. Since the plant, algal and nucleomorph genomes all belong to the kingdom Plantae, and are evolutionarily distant from the outgroup (vertebrate/yeast training set, we use the plant and algal genomes as internal positive controls for the sensitivity of the searches in nucleomorph genomes. We fi nd numerous Nup homologues in all plant and free-living algal species, but none in either nucleomorph genome. BLAST searches using identified plant and algal Nups also failed to detect nucleomorph homologues. We conclude that nucleomorph Nup genes have either been lost, being replaced by host Nup genes, or, that nucleomorph Nup genes have been transferred to the host nucleus twice independently; once in the evolution of the red algal nucleomorph and once in the green algal nucleomorph.

  20. Epigenetic control of mobile DNA as an interface between experience and genome change

    Directory of Open Access Journals (Sweden)

    James A. Shapiro

    2014-04-01

    Full Text Available Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration.

  1. The emerging role of nuclear architecture in DNA repair and genome maintenance

    OpenAIRE

    Misteli, Tom; Soutoglou, Evi

    2009-01-01

    DNA repair and maintenance of genome stability are crucial to cellular and organismal function, and defects in these processes have been implicated in cancer and ageing. Detailed molecular, biochemical and genetic analyses have outlined the molecular framework involved in cellular DNA-repair pathways, but recent cell-biological approaches have revealed important roles for the spatial and temporal organization of the DNA-repair machinery during the recognition of DNA lesions and the assembly o...

  2. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  3. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

    International Nuclear Information System (INIS)

    Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

    1987-01-01

    Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

  4. Robustness of genome-wide scanning using archived dried blood spot samples as a DNA source.

    Science.gov (United States)

    Hollegaard, Mads V; Grove, Jakob; Grauholm, Jonas; Kreiner-Møller, Eskil; Bønnelykke, Klaus; Nørgaard, Mette; Benfield, Thomas L; Nørgaard-Pedersen, Bent; Mortensen, Preben B; Mors, Ole; Sørensen, Henrik T; Harboe, Zitta B; Børglum, Anders D; Demontis, Ditte; Ørntoft, Torben F; Bisgaard, Hans; Hougaard, David M

    2011-07-04

    The search to identify disease-susceptible genes requires access to biological material from numerous well-characterized subjects. Archived residual dried blood spot (DBS) samples, also known as Guthrie cards, from national newborn screening programs may provide a DNA source for entire populations. Combined with clinical information from medical registries, DBS samples could provide a rich source for productive research. However, the amounts of DNA which can be extracted from these precious samples are minute and may be prohibitive for numerous genotypings. Previously, we demonstrated that DBS DNA can be whole-genome amplified and used for reliable genetic analysis on different platforms, including genome-wide scanning arrays. However, it remains unclear whether this approach is workable on a large sample scale. We examined the robustness of using DBS samples for whole-genome amplification following genome-wide scanning, using arrays from Illumina and Affymetrix. This study is based on 4,641 DBS samples from the Danish Newborn Screening Biobank, extracted for three separate genome-wide association studies. The amount of amplified DNA was significantly (P Biobank represent a reliable resource of DNA for whole-genome amplification and subsequent genome-wide association studies. With call-rates equivalent to high quality DNA samples, our results point to new opportunities for using the neonatal biobanks available worldwide in the hunt for genetic components of disease.

  5. Robustness of genome-wide scanning using archived dried blood spot samples as a DNA source

    Directory of Open Access Journals (Sweden)

    Børglum Anders D

    2011-07-01

    Full Text Available Abstract Background The search to identify disease-susceptible genes requires access to biological material from numerous well-characterized subjects. Archived residual dried blood spot (DBS samples, also known as Guthrie cards, from national newborn screening programs may provide a DNA source for entire populations. Combined with clinical information from medical registries, DBS samples could provide a rich source for productive research. However, the amounts of DNA which can be extracted from these precious samples are minute and may be prohibitive for numerous genotypings. Previously, we demonstrated that DBS DNA can be whole-genome amplified and used for reliable genetic analysis on different platforms, including genome-wide scanning arrays. However, it remains unclear whether this approach is workable on a large sample scale. We examined the robustness of using DBS samples for whole-genome amplification following genome-wide scanning, using arrays from Illumina and Affymetrix. Results This study is based on 4,641 DBS samples from the Danish Newborn Screening Biobank, extracted for three separate genome-wide association studies. The amount of amplified DNA was significantly (P Conclusion Our study indicates that archived DBS samples from the Danish Newborn Screening Biobank represent a reliable resource of DNA for whole-genome amplification and subsequent genome-wide association studies. With call-rates equivalent to high quality DNA samples, our results point to new opportunities for using the neonatal biobanks available worldwide in the hunt for genetic components of disease.

  6. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Doethideomycetes Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabien; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; de Wit, Pierre J. G. M.; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2012-03-13

    The class of Dothideomycetes is one of the largest and most diverse groups of fungi. Many are plant pathogens and pose a serious threat to agricultural crops grown for biofuel, food or feed. Most Dothideomycetes have only a single host and related species can have very diverse host plants. Eighteen genomes of Dothideomycetes have currently been sequenced by the Joint Genome Institute and other sequencing centers. Here we describe the results of comparative analyses of the fungi in this group.

  7. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabian; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; de Wit, Pierre J. G. M.; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2013-03-05

    The class of Dothideomycetes is one of the largest and most diverse groups of fungi. Many are plant pathogens and pose a serious threat to agricultural crops that are grown for biofuel, food or feed. Most Dothideomycetes have only a single host plant, and related species can have very diverse hosts. Eighteen genomes of Dothideomycetes have currently been sequenced by the Joint Genome Institute and other sequencing centers. Here we describe the results of comparative analyses of the fungi in this group.

  8. Genome size and sensitivity to DNA damage by X-rays-plant comets tell the story.

    Science.gov (United States)

    Einset, John; Collins, Andrew R

    2018-02-24

    Among several factors affecting radiation sensitivity, genome size has received limited attention during the last 50 years since research at Brookhaven National Laboratory (USA) and other locations demonstrated substantial differences in radiation sensitivities, e.g. between tree species with large (e.g. conifers such as pines) versus small (e.g. dicots such as oaks) genome sizes. Taking advantage of the wide range of genome sizes among species, we investigated radiation sensitivity which we define in this study as DNA damage (break frequency) measured with the alkaline comet assay in isolated nuclei exposed to X-rays. As a starting point, we considered two possible explanations for the high radiation sensitivity of plants with large genome sizes: (i) inherently higher sensitivity of larger genomes and/or (ii) impaired DNA repair. In terms of genome size effects, experiments exposing isolated nuclei from six different plant species to X-rays, varying in genome sizes from 2.6 to 19.2 Gbp, showed that larger genomes are more sensitive to DNA damage by a relationship approximating the cube-root of the nuclear volume; e.g. a 10-fold increase in genome size increases sensitivity by about 2-fold. With regard to DNA repair, two conifer species, Sawara cypress (Chamaecyparis pisifera, 8.9 Gbp genome size) and Scots pine (Pinus sylvestris, 20 Gbp genome size), both effectively repaired DNA damage within 50 and 70 min, respectively, after acute X-ray exposures. Both species also showed delayed repair of double-strand DNA breaks, as we previously showed with Arabidopsis thaliana and Lolium multiflorum.

  9. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  10. Comprehensive phylogenetic analysis of bacterial group II intron-encoded ORFs lacking the DNA endonuclease domain reveals new varieties.

    Directory of Open Access Journals (Sweden)

    Nicolás Toro

    Full Text Available Group II introns are self-splicing RNAs that act as mobile retroelements in the organelles of plants, fungi and protists. They are also widely distributed in bacteria, and are generally assumed to be the ancestors of nuclear spliceosomal introns. Most bacterial group II introns have a multifunctional intron-encoded protein (IEP ORF within the ribozyme domain IV (DIV. This ORF encodes an N-terminal reverse transcriptase (RT domain, followed by a putative RNA-binding domain with RNA splicing or maturase activity and, in some cases, a C-terminal DNA-binding (D region followed by a DNA endonuclease (En domain. In this study, we focused on bacterial group II intron ORF phylogenetic classes containing only reverse transcriptase/maturase open reading frames, with no recognizable D/En region (classes A, C, D, E, F and unclassified introns. On the basis of phylogenetic analyses of the maturase domain and its C-terminal extension, which appears to be a signature characteristic of ORF phylogenetic class, with support from the phylogeny inferred from the RT domain, we have revised the proposed new class F, defining new intron ORF varieties. Our results increase knowledge of the lineage of group II introns encoding proteins lacking the En-domain.

  11. The ENCODE project: missteps overshadowing a success.

    Science.gov (United States)

    Eddy, Sean R

    2013-04-08

    Two clichés of science journalism have now played out around the ENCODE project. ENCODE's publicity first presented a misleading "all the textbooks are wrong" narrative about noncoding human DNA. Now several critiques of ENCODE's narrative have been published, and one was so vitriolic that it fueled "undignified academic squabble" stories that focused on tone more than substance. Neither story line does justice to our actual understanding of genomes, to ENCODE's results, or to the role of big science in biology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Immunogenicity of a Multi-Epitope DNA Vaccine Encoding Epitopes from Cu–Zn Superoxide Dismutase and Open Reading Frames of Brucella abortus in Mice

    Science.gov (United States)

    Escalona, Emilia; Sáez, Darwin; Oñate, Angel

    2017-01-01

    Brucellosis is a bacterial zoonotic disease affecting several mammalian species that is transmitted to humans by direct or indirect contact with infected animals or their products. In cattle, brucellosis is almost invariably caused by Brucella abortus. Live, attenuated Brucella vaccines are commonly used to prevent illness in cattle, but can cause abortions in pregnant animals. It is, therefore, desirable to design an effective and safer vaccine against Brucella. We have used specific Brucella antigens that induce immunity and protection against B. abortus. A novel recombinant multi-epitope DNA vaccine specific for brucellosis was developed. To design the vaccine construct, we employed bioinformatics tools to predict epitopes present in Cu–Zn superoxide dismutase and in the open reading frames of the genomic island-3 (BAB1_0260, BAB1_0270, BAB1_0273, and BAB1_0278) of Brucella. We successfully designed a multi-epitope DNA plasmid vaccine chimera that encodes and expresses 21 epitopes. This DNA vaccine induced a specific humoral and cellular immune response in BALB/c mice. It induced a typical T-helper 1 response, eliciting production of immunoglobulin G2a and IFN-γ particularly associated with the Th1 cell subset of CD4+ T cells. The production of IL-4, an indicator of Th2 activation, was not detected in splenocytes. Therefore, it is reasonable to suggest that the vaccine induced a predominantly Th1 response. The vaccine induced a statistically significant level of protection in BALB/c mice when challenged with B. abortus 2308. This is the first use of an in silico strategy to a design a multi-epitope DNA vaccine against B. abortus. PMID:28232837

  13. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  14. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in order to establish the storage conditions for the collected samples before DNA extraction. Secondly, the aim was to determine the best protocol for the extraction of high quality DNA, ...

  15. Machine learning classifier for identification of damaging missense mutations exclusive to human mitochondrial DNA-encoded polypeptides.

    Science.gov (United States)

    Martín-Navarro, Antonio; Gaudioso-Simón, Andrés; Álvarez-Jarreta, Jorge; Montoya, Julio; Mayordomo, Elvira; Ruiz-Pesini, Eduardo

    2017-03-07

    Several methods have been developed to predict the pathogenicity of missense mutations but none has been specifically designed for classification of variants in mtDNA-encoded polypeptides. Moreover, there is not available curated dataset of neutral and damaging mtDNA missense variants to test the accuracy of predictors. Because mtDNA sequencing of patients suffering mitochondrial diseases is revealing many missense mutations, it is needed to prioritize candidate substitutions for further confirmation. Predictors can be useful as screening tools but their performance must be improved. We have developed a SVM classifier (Mitoclass.1) specific for mtDNA missense variants. Training and validation of the model was executed with 2,835 mtDNA damaging and neutral amino acid substitutions, previously curated by a set of rigorous pathogenicity criteria with high specificity. Each instance is described by a set of three attributes based on evolutionary conservation in Eukaryota of wildtype and mutant amino acids as well as coevolution and a novel evolutionary analysis of specific substitutions belonging to the same domain of mitochondrial polypeptides. Our classifier has performed better than other web-available tested predictors. We checked performance of three broadly used predictors with the total mutations of our curated dataset. PolyPhen-2 showed the best results for a screening proposal with a good sensitivity. Nevertheless, the number of false positive predictions was too high. Our method has an improved sensitivity and better specificity in relation to PolyPhen-2. We also publish predictions for the complete set of 24,201 possible missense variants in the 13 human mtDNA-encoded polypeptides. Mitoclass.1 allows a better selection of candidate damaging missense variants from mtDNA. A careful search of discriminatory attributes and a training step based on a curated dataset of amino acid substitutions belonging exclusively to human mtDNA genes allows an improved

  16. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

    1992-12-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  17. Cigarette smoking reduces DNA methylation levels at multiple genomic loci but the effect is partially reversible upon cessation.

    Science.gov (United States)

    Tsaprouni, Loukia G; Yang, Tsun-Po; Bell, Jordana; Dick, Katherine J; Kanoni, Stavroula; Nisbet, James; Viñuela, Ana; Grundberg, Elin; Nelson, Christopher P; Meduri, Eshwar; Buil, Alfonso; Cambien, Francois; Hengstenberg, Christian; Erdmann, Jeanette; Schunkert, Heribert; Goodall, Alison H; Ouwehand, Willem H; Dermitzakis, Emmanouil; Spector, Tim D; Samani, Nilesh J; Deloukas, Panos

    2014-10-01

    Smoking is a major risk factor in many diseases. Genome wide association studies have linked genes for nicotine dependence and smoking behavior to increased risk of cardiovascular, pulmonary, and malignant diseases. We conducted an epigenome wide association study in peripheral-blood DNA in 464 individuals (22 current smokers and 263 ex-smokers), using the Human Methylation 450 K array. Upon replication in an independent sample of 356 twins (41 current and 104 ex-smokers), we identified 30 probes in 15 distinct loci, all of which reached genome-wide significance in the combined analysis P peaks (ENCODE data set), which mark regulatory elements. The effect of smoking on DNA methylation was partially reversible upon smoking cessation for longer than 3 months. We report the first statistically significant interaction between a SNP (rs2697768) and cigarette smoking on DNA methylation (cg03329539). We provide evidence that the metSNP for cg03329539 regulates expression of the CHRND gene located circa 95 Kb downstream of the methylation site. Our findings suggest the existence of dynamic, reversible site-specific methylation changes in response to cigarette smoking , which may contribute to the extended health risks associated with cigarette smoking.

  18. Kaposi's sarcoma-associated herpesvirus-encoded LANA recruits topoisomerase IIβ for latent DNA replication of the terminal repeats.

    Science.gov (United States)

    Purushothaman, Pravinkumar; McDowell, Maria E; McGuinness, James; Salas, Ruth; Rumjahn, Sharif M; Verma, Subhash C

    2012-09-01

    The latency-associated nuclear antigen (LANA) encoded by Kaposi's sarcoma-associated herpesvirus (KSHV) plays a major role in maintaining latency and is critical for the perpetual segregation of viral episomes to the progeny nuclei of newly divided cells. LANA binds to KSHV terminal repeat (TR) DNA and tethers the viral episomes to host chromosomes through the association of chromatin-bound cellular proteins. TR elements serve as potential origin sites of KSHV replication and have been shown to play important roles in latent DNA replication and transcription of adjacent genes. Affinity chromatography and proteomics analysis using KSHV TR DNA and the LANA binding site as the affinity column identified topoisomerase IIβ (TopoIIβ) as a LANA-interacting protein. Here, we show that TopoIIβ forms complexes with LANA that colocalize as punctuate bodies in the nucleus of KSHV-infected cells. The specific TopoIIβ binding region of LANA has been identified to its N terminus and the first 32 amino acid residues containing the nucleosome-binding region crucial for binding. Moreover, this region could also act as a dominant negative to disrupt association of TopoIIβ with LANA. TopoIIβ plays an important role in LANA-dependent latent DNA replication, as addition of ellipticine, a selective inhibitor of TopoII, negatively regulated replication mediated by the TR. DNA break labeling and chromatin immunoprecipitation assay using biotin-16-dUTP and terminal deoxynucleotide transferase showed that TopoIIβ mediates a transient DNA break on viral DNA. These studies confirm that LANA recruits TopoIIβ at the origins of latent replication to unwind the DNA for replication.

  19. Genome organisation and expression profiling of ABC protein-encoding genes in Heterobasidion annosum s.l. complex.

    Science.gov (United States)

    Baral, Bikash; Kovalchuk, Andriy; Asiegbu, Fred O

    2016-03-01

    Members of Heterobasidion annosum species complex are widely regarded as the most destructive fungal pathogens of conifer trees in the boreal and temperate zones of Northern hemisphere. To invade and colonise their host trees, Heterobasidion fungi must overcome components of host chemical defence, including terpenoid oleoresin and phenolic compounds. ABC transporters may play an important role in this process participating in the export of toxic host metabolites and maintaining their intracellular concentration below the critical level. We have identified and phylogenetically classified Heterobasidion genes encoding ABC transporters and closely related ABC proteins. The number of ABC proteins in the Heterobasidion genome is one of the lowest among analysed species of Agaricomycotina. Using quantitative RT-PCR, we have analysed transcriptional response of Heterobasidion ABC transporter-encoding genes to monoterpenes as well as their expression profile during growth on pine wood in comparison to the growth on defined media. Several ABC transporters were up-regulated during growth on pine wood. The ABC-transporter encoding gene ABCG1.1 was induced both during growth of H. annosum on pine wood and upon exposure to monoterpenes. Our experimental data demonstrate the differential responses of Heterobasidion ABC genes to growth conditions and chemical stressors. The presented results suggest a potential role of Heterobasidion ABC-G transporters in the resistance to the components of conifer chemical defence. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  20. Genome-wide analysis reveals loci encoding anti-macrophage factors in the human pathogen Burkholderia pseudomallei K96243.

    Directory of Open Access Journals (Sweden)

    Andrea J Dowling

    2010-12-01

    Full Text Available Burkholderia pseudomallei is an important human pathogen whose infection biology is still poorly understood. The bacterium is endemic to tropical regions, including South East Asia and Northern Australia, where it causes melioidosis, a serious disease associated with both high mortality and antibiotic resistance. B. pseudomallei is a Gram-negative facultative intracellular pathogen that is able to replicate in macrophages. However despite the critical nature of its interaction with macrophages, few anti-macrophage factors have been characterized to date. Here we perform a genome-wide gain of function screen of B. pseudomallei strain K96243 to identify loci encoding factors with anti-macrophage activity. We identify a total of 113 such loci scattered across both chromosomes, with positive gene clusters encoding transporters and secretion systems, enzymes/toxins, secondary metabolite, biofilm, adhesion and signal response related factors. Further phenotypic analysis of four of these regions shows that the encoded factors cause striking cellular phenotypes relevant to infection biology, including apoptosis, formation of actin 'tails' and multi-nucleation within treated macrophages. The detailed analysis of the remaining host of loci will facilitate genetic dissection of the interaction of this important pathogen with host macrophages and thus further elucidate this critical part of its infection cycle.

  1. Genomic cloning and characterization of a PPA gene encoding a mannose-binding lectin from Pinellia pedatisecta.

    Science.gov (United States)

    Lin, Juan; Zhou, Xuanwei; Fei, Jiong; Liao, Zhihua; Jin, Wang; Sun, Xiaofen; Tang, Kexuan

    2006-04-01

    A gene encoding a mannose-binding lectin, Pinellia pedatisecta agglutinin (PPA), was isolated from leaves of Pinellia pedatisecta using genomic walker technology. The ppa contained an 1140-bp 5'-upstream region, a 771-bp open reading frame (ORF) and an 829-bp 3'-downstream region. The ORF encoded a precursor polypeptide of 256 amino acid residues with a 24-amino acid signal peptide. There were one putative TATA box and six possible CAAT boxes lying in the 5'-upstream region of ppa. The ppa showed significant similarity at the nucleic acid level with genes encoding mannose-binding lectins from other Araceae species such as Pinellia ternata, Arisaema hererophyllum, Colocasia esculenta and Arum maculatum. At the amino acid level, PPA also shared varying homology (ranging from 40% to 85%) with mannose-binding lectins from other plant species, such as those from Araceae, Alliaceae, Iridaceae, Lillaceae, Amaryllidaceae and Bromeliaceae. The cloning of the ppa gene not only provides a basis for further investigation of PPA's structure, expression and regulation mechanism, but also enables us to test its potential role in controlling pests and fungal diseases by transferring the gene into tobacco and rice in the future.

  2. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  3. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  4. Genomics DNA Profiling in Elite Professional Soccer Players: A Pilot Study

    OpenAIRE

    Kambouris, M; Del Buono, A; Maffulli, N

    2014-01-01

    Functional variants in exonic regions have been associated with development of cardiovascular disease, diabetes and cancer. Athletic performance can be considered a multi-factorial complex phenotype. Genomic DNA was extracted from buccal swabs of seven soccer players from the Fulham football team. Single nucleotide polymorphism (SNPs) genotyping was undertaken. To achieve optimal athletic performance, predictive genomics DNA profiling for sports performance can be used to aid in sport selecti...

  5. Appraising the relevance of DNA copy number loss and gain in prostate cancer using whole genome DNA sequence data.

    Directory of Open Access Journals (Sweden)

    Niedzica Camacho

    2017-09-01

    Full Text Available A variety of models have been proposed to explain regions of recurrent somatic copy number alteration (SCNA in human cancer. Our study employs Whole Genome DNA Sequence (WGS data from tumor samples (n = 103 to comprehensively assess the role of the Knudson two hit genetic model in SCNA generation in prostate cancer. 64 recurrent regions of loss and gain were detected, of which 28 were novel, including regions of loss with more than 15% frequency at Chr4p15.2-p15.1 (15.53%, Chr6q27 (16.50% and Chr18q12.3 (17.48%. Comprehensive mutation screens of genes, lincRNA encoding sequences, control regions and conserved domains within SCNAs demonstrated that a two-hit genetic model was supported in only a minor proportion of recurrent SCNA losses examined (15/40. We found that recurrent breakpoints and regions of inversion often occur within Knudson model SCNAs, leading to the identification of ZNF292 as a target gene for the deletion at 6q14.3-q15 and NKX3.1 as a two-hit target at 8p21.3-p21.2. The importance of alterations of lincRNA sequences was illustrated by the identification of a novel mutational hotspot at the KCCAT42, FENDRR, CAT1886 and STCAT2 loci at the 16q23.1-q24.3 loss. Our data confirm that the burden of SCNAs is predictive of biochemical recurrence, define nine individual regions that are associated with relapse, and highlight the possible importance of ion channel and G-protein coupled-receptor (GPCR pathways in cancer development. We concluded that a two-hit genetic model accounts for about one third of SCNA indicating that mechanisms, such haploinsufficiency and epigenetic inactivation, account for the remaining SCNA losses.

  6. Integrative Analysis of the Caenorhabditis elegans Genome by the modENCODE Project

    Science.gov (United States)

    Gerstein, Mark B.; Lu, Zhi John; Van Nostrand, Eric L.; Cheng, Chao; Arshinoff, Bradley I.; Liu, Tao; Yip, Kevin Y.; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K.; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P.; Barber, Galt; Brdlik, Cathleen M.; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O.; Dernburg, Abby F.; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C.; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A.; Gassmann, Reto; Good, Peter J.; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S.; Habegger, Lukas; Han, Ting; Henikoff, Jorja G.; Henz, Stefan R.; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A. Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W. James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K.; Kolasinska-Zwierz, Paulina; Lai, Eric C.; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F.; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D.; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M.; Muroyama, Andrew; Murray, John I.; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A.; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J.; Slightam, Cindie; Smith, Richard; Spencer, William C.; Stinson, E. O.; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L.; Whittle, Christina M.; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C.; Micklem, Gos; Liu, X. Shirley; Reinke, Valerie; Kim, Stuart K.; Hillier, LaDeana W.; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D.; Waterston, Robert H.

    2011-01-01

    We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor–binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor–binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome. PMID:21177976

  7. Formation of mushrooms and lignocellulose degradation encoded in the genome sequence of Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; de Jong, Jan F.; Lugones, Luis G.; Aerts, Andrea; Kothe, Erika; Stajich, Jason E.; de Vries, Ronald P.; Record, Eric; Levasseur, Anthony; Baker, Scott E.; Bartholomew, Kirk A.; Coutinho, Pedro M.; Erdmann, Susann; Fowler, Thomas J.; Gathman, Allen C.; Lombard, Vincent; Henrissat, Bernard; Knabe, Nicole; Kues, Ursula; Lilly, Walt W.; Lindquist, Erika; Lucas, Susan; Magnuson, Jon K.; Piumi, Francois; Raudaskoski, Marjatta; Salamov, Asaf; Schmutz, Jeremy; Schwarze, Francis W.M.R.; van Kuyk, Patricia A.; Horton, J. Stephen; Grigoriev, Igor V.; Wosten, Han A.B.

    2010-07-12

    The wood degrading fungus Schizophyllum commune is a model system for mushroom development. Here, we describe the 38.5 Mb assembled genome of this basidiomycete and application of whole genome expression analysis to study the 13,210 predicted genes. Comparative analyses of the S. commune genome revealed unique wood degrading machinery and mating type loci with the highest number of reported genes. Gene expression analyses revealed that one third of the 471 identified transcription factor genes were differentially expressed during sexual development. Two of these transcription factor genes were deleted. Inactivation of fst4 resulted in the inability to form mushrooms, whereas inactivation of fst3 resulted in more but smaller mushrooms than wild-type. These data illustrate that mechanisms underlying mushroom formation can be dissected using S. commune as a model. This will impact commercial production of mushrooms and the industrial use of these fruiting bodies to produce enzymes and pharmaceuticals.

  8. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

    1987-01-01

    The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including the DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis

  9. DNA vaccine encoding peptide P10 against experimental paracoccidioidomycosis induces long-term protection in presence of regulatory T cells.

    Science.gov (United States)

    de Amorim, Juliana; Magalhães, Adriana; Muñoz, Julián Esteban; Rittner, Glauce M G; Nosanchuk, Joshua D; Travassos, Luiz R; Taborda, Carlos P

    2013-03-01

    Paracoccidioidomycosis is a granulomatous systemic mycosis endemic in Brazil and other Latin America countries. A DNA vaccine encoding the immunoprotective peptide 10 (P10) significantly reduced the fungal burden in mice when given prior to or after intratracheal challenge with Paracoccidioides brasiliensis. Presently, the generation/expansion of CD4+ CD44hi memory T cells as well as Foxp3+ Treg cells in mice immunized with the DNA vaccine (pcDNA3-P10) before and after infection with P. brasiliensis was investigated. Memory CD4+ CD44hi T cells simultaneously with Foxp3+ Treg cells increased in the spleens and lungs of pcDNA3-P10 immunized mice on day 0, 30, 60 and 120 postinfection. Histopathology of the lung tissue showed minimal inflammation in immunized mice compared with the unimmunized group, suggesting a role for regulatory T cells in controlling the immunopathology. The DNA vaccine shows that the repeated immunization generates memory cells and regulatory T cells that replace the initially protective pro-inflammatory T cells conferring a long term protection while preserving the integrity of the infected tissue. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Characterization of cDNA clones encoding rabbit and human serum paraoxonase: The mature protein retains its signal sequence

    Energy Technology Data Exchange (ETDEWEB)

    Hassett, C.; Richter, R.J.; Humbert, R.; Omiecinski, C.J.; Furlong, C.E. (Univ. of Washington, Seattle (United States)); Chapline, C.; Crabb, J.W. (W.Alton Jones Cell Science Center, Lake Placid, NY (United States))

    1991-10-22

    Serum paraoxonase hydrolyzes the toxic metabolites of a variety of organophosphorus insecticides. High serum paraoxonase levels appear to protect against the neurotoxic effects of organophosphorus substrates of this enzyme. The amino acid sequence accounting for 42% of rabbit paraoxonase was determined. From these data, two oligonucleotide probes were synthesized and used to screen a rabbit liver cDNA library. Human paraoxonase clones were isolated from a liver cDNA library by using the rabbit cDNA as a hybridization probe. Inserts from three of the longest clones were sequenced, and one full-length clone contained an open reading frame encoding 355 amino acids, four less than the rabbit paraoxonase protein. Amino-terminal sequences derived from purified rabbit and human paraoxonase proteins suggested that the signal sequence is retained, with the exception of the initiator methionine residue. Characterization of the rabbit and human paraoxonase cDNA clones confirms that the signal sequences are not processed, except for the N-terminal methionine residue. The rabbit and human cDNA clones demonstrate striking nucleotide and deduced amino acid similarities (greater than 85%), suggesting an important metabolic role and constraints on the evolution of this protein.

  11. Isolation and sequence analysis of the wheat B genome subtelomeric DNA

    Directory of Open Access Journals (Sweden)

    Huneau Cecile

    2009-09-01

    Full Text Available Abstract Background Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. Results The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119 737 bp was annotated. It is composed of 33% transposable elements (TEs, 8.2% Spelt52 (namely, the subfamily Spelt52.2 and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11 666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0. Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Conclusion Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat

  12. Analysis of plastid DNA-like sequences within the nuclear genomes of higher plants.

    Science.gov (United States)

    Ayliffe, M A; Scott, N S; Timmis, J N

    1998-06-01

    A wide-ranging examination of plastid (pt)DNA sequence homologies within higher plant nuclear genomes (promiscuous DNA) was undertaken. Digestion with methylation-sensitive restriction enzymes and Southern analysis was used to distinguish plastid and nuclear DNA in order to assess the extent of variability of promiscuous sequences within and between plant species. Some species, such as Gossypium hirsutum (cotton), Nicotiana tabacum (tobacco), and Chenopodium quinoa, showed homogenity of these sequences, while intraspecific sequence variation was observed among different cultivars of Pisum sativum (pea), Hordeum vulgare (barley), and Triticum aestivum (wheat). Hypervariability of plastid sequence homologies was identified in the nuclear genomes of Spinacea oleracea (spinach) and Beta vulgaris (beet), in which individual plants were shown to possess a unique spectrum of nuclear sequences with ptDNA homology. This hypervariability apparently extended to somatic variation in B. vulgaris. No sequences with ptDNA homology were identified by this method in the nuclear genome of Arabidopsis thaliana.

  13. DNA Oncogenic Virus-Induced Oxidative Stress, Genomic Damage, and Aberrant Epigenetic Alterations

    Directory of Open Access Journals (Sweden)

    Mankgopo Magdeline Kgatle

    2017-01-01

    Full Text Available Approximately 20% of human cancers is attributable to DNA oncogenic viruses such as human papillomavirus (HPV, hepatitis B virus (HBV, and Epstein-Barr virus (EBV. Unrepaired DNA damage is the most common and overlapping feature of these DNA oncogenic viruses and a source of genomic instability and tumour development. Sustained DNA damage results from unceasing production of reactive oxygen species and activation of inflammasome cascades that trigger genomic changes and increased propensity of epigenetic alterations. Accumulation of epigenetic alterations may interfere with genome-wide cellular signalling machineries and promote malignant transformation leading to cancer development. Untangling and understanding the underlying mechanisms that promote these detrimental effects remain the major objectives for ongoing research and hope for effective virus-induced cancer therapy. Here, we review current literature with an emphasis on how DNA damage influences HPV, HVB, and EBV replication and epigenetic alterations that are associated with carcinogenesis.

  14. Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip

    NARCIS (Netherlands)

    Dongre, C.; van Weerd, J.; Besselink, G.A.J.; Osellame, R.; Martínez Vázquez, R.; Cerullo, G.; van Weeghel, R.; van den Vlekkert, H.H.; Hoekstra, Hugo; Pollnau, Markus

    By capillary electrophoresis (CE) in miniaturized lab-on-a-chip devices, integrated DNA sequencing and genetic diagnostics have become feasible. We introduce a principle of parallel optical processing to significantly enhance analysis capabilities. In a commercial microfluidic chip, a plug of DNA

  15. Self-assembly of genetically encoded DNA-protein hybrid nanoscale shapes.

    Science.gov (United States)

    Praetorius, Florian; Dietz, Hendrik

    2017-03-24

    We describe an approach to bottom-up fabrication that allows integration of the functional diversity of proteins into designed three-dimensional structural frameworks. A set of custom staple proteins based on transcription activator-like effector proteins folds a double-stranded DNA template into a user-defined shape. Each staple protein is designed to recognize and closely link two distinct double-helical DNA sequences at separate positions on the template. We present design rules for constructing megadalton-scale DNA-protein hybrid shapes; introduce various structural motifs, such as custom curvature, corners, and vertices; and describe principles for creating multilayer DNA-protein objects with enhanced rigidity. We demonstrate self-assembly of our hybrid nanostructures in one-pot mixtures that include the genetic information for the designed proteins, the template DNA, RNA polymerase, ribosomes, and cofactors for transcription and translation. Copyright © 2017, American Association for the Advancement of Science.

  16. Crucial optimization steps in getting premier quality of Aquilaria malaccensis genomic DNA for molecular activities

    International Nuclear Information System (INIS)

    Muhammad Hanif Azhari; Azhar Mohamad

    2013-01-01

    Gaharu resin is derived from Aquilaria sp. or Agar wood tree in a tropical ecosystem. In Malaysia the Aquilaria species especially A. malaccensis in danger of extinction in the wild due to illegal logging as its resin is highly used for the production of greatly valued incense throughout Asia. A significant tool in fingerprinting the species is through molecular activities of Polymerase Chain Reaction (PCR) application on which requires total genomic DNA as a starting material. This paper, described optimizations of both fresh and dried samples derived from A. malaccensis for genomic DNA. Three main parameters for the optimization were temperature (60, 65, and 70 degree Celsius), incubation period (30, 60, 90 minutes) and concentration of CTAB (1 %, 3 %, 5 %). The experimental design in these work resulted a total of 46 combinations of the parameters in which 0.5 g samples was used in each combination. Nano-drop spectrometer was used in detecting the quantitative genomic DNA at ng/ μl. In fresh samples, incubation temperatures at 65 degree Celsius for 60 minutes in 3 % were yielded 723.2 ng/ μl genomic DNA. Whereas, for dried samples, incubation temperature at 70 degree Celsius for 90 minutes in 5 % CTAB were yielded 70.2 ng/ μl of genomic DNA. Spectrometer reading at OD280/ 260 was 1.9 for both type of samples. The isolated genomic DNA is useful for the molecular activities to identify specific plants between the same species or among the Aquilaria species. (author)

  17. Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine

    Science.gov (United States)

    Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson

    2011-01-01

    Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

  18. Ku-mediated coupling of DNA cleavage and repair during programmed genome rearrangements in the ciliate Paramecium tetraurelia.

    Directory of Open Access Journals (Sweden)

    Antoine Marmignon

    2014-08-01

    Full Text Available During somatic differentiation, physiological DNA double-strand breaks (DSB can drive programmed genome rearrangements (PGR, during which DSB repair pathways are mobilized to safeguard genome integrity. Because of their unique nuclear dimorphism, ciliates are powerful unicellular eukaryotic models to study the mechanisms involved in PGR. At each sexual cycle, the germline nucleus is transmitted to the progeny, but the somatic nucleus, essential for gene expression, is destroyed and a new somatic nucleus differentiates from a copy of the germline nucleus. In Paramecium tetraurelia, the development of the somatic nucleus involves massive PGR, including the precise elimination of at least 45,000 germline sequences (Internal Eliminated Sequences, IES. IES excision proceeds through a cut-and-close mechanism: a domesticated transposase, PiggyMac, is essential for DNA cleavage, and DSB repair at excision sites involves the Ligase IV, a specific component of the non-homologous end-joining (NHEJ pathway. At the genome-wide level, a huge number of programmed DSBs must be repaired during this process to allow the assembly of functional somatic chromosomes. To understand how DNA cleavage and DSB repair are coordinated during PGR, we have focused on Ku, the earliest actor of NHEJ-mediated repair. Two Ku70 and three Ku80 paralogs are encoded in the genome of P. tetraurelia: Ku70a and Ku80c are produced during sexual processes and localize specifically in the developing new somatic nucleus. Using RNA interference, we show that the development-specific Ku70/Ku80c heterodimer is essential for the recovery of a functional somatic nucleus. Strikingly, at the molecular level, PiggyMac-dependent DNA cleavage is abolished at IES boundaries in cells depleted for Ku80c, resulting in IES retention in the somatic genome. PiggyMac and Ku70a/Ku80c co-purify as a complex when overproduced in a heterologous system. We conclude that Ku has been integrated in the Paramecium

  19. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa......-134]. The protein contains a nuclear targeting signal (KKKGK), and fractionation of transformed human amnion cells (AMA) in karyoplasts and cytoplasts confirmed that it is predominantly localized in the nucleus. Database searching indicated that IEF SSP 9502 is a putative human homologue of the Saccharomyces...

  20. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    Directory of Open Access Journals (Sweden)

    Long Qian

    2016-10-01

    Full Text Available The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  1. The zebrafish genome encodes the largest vertebrate repertoire of functional aquaporins with dual paralogy and substrate specificities similar to mammals

    Directory of Open Access Journals (Sweden)

    Chauvigné François

    2010-02-01

    Full Text Available Abstract Background Aquaporins are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. These proteins are vital for maintaining water homeostasis in living organisms. In mammals, thirteen aquaporins (AQP0-12 have been characterized, but in lower vertebrates, such as fish, the diversity, structure and substrate specificity of these membrane channel proteins are largely unknown. Results The screening and isolation of transcripts from the zebrafish (Danio rerio genome revealed eighteen sequences structurally related to the four subfamilies of tetrapod aquaporins, i.e., aquaporins (AQP0, -1 and -4, water and glycerol transporters or aquaglyceroporins (Glps; AQP3 and AQP7-10, a water and urea transporter (AQP8, and two unorthodox aquaporins (AQP11 and -12. Phylogenetic analyses of nucleotide and deduced amino acid sequences demonstrated dual paralogy between teleost and human aquaporins. Three of the duplicated zebrafish isoforms have unlinked loci, two have linked loci, while DrAqp8 was found in triplicate across two chromosomes. Genomic sequencing, structural analysis, and maximum likelihood reconstruction, further revealed the presence of a putative pseudogene that displays hybrid exons similar to tetrapod AQP5 and -1. Ectopic expression of the cloned transcripts in Xenopus laevis oocytes demonstrated that zebrafish aquaporins and Glps transport water or water, glycerol and urea, respectively, whereas DrAqp11b and -12 were not functional in oocytes. Contrary to humans and some rodents, intrachromosomal duplicates of zebrafish AQP8 were water and urea permeable, while the genomic duplicate only transported water. All aquaporin transcripts were expressed in adult tissues and found to have divergent expression patterns. In some tissues, however, redundant expression of transcripts encoding two duplicated paralogs seems to occur. Conclusion The zebrafish genome encodes the largest repertoire of

  2. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi

    NARCIS (Netherlands)

    Ohm, R.A.; Feau, N.; Henrissat, B.; Schoch, C.L.; Horwitz, B.A.; Barry, K.W.; Condon, B.J.; Copeland, A.C.; Dhillon, B.; Glaser, F.; Hesse, C.N.; Kosti, I.; LaButti, K.; Lindquist, E.A.; Lucas, S.; Salamov, A.A.; Bradshaw, R.E.; Ciuffetti, L.; Hamelin, R.C.; Kema, G.H.J.; Lawrence, C.; Scott, J.A.; Spatafora, J.W.; Turgeon, B.G.; Wit, de P.J.G.M.; Zhong, S.; Goodwin, S.B.; Grigoriev, I.V.

    2012-01-01

    The class Dothideomycetes is one of the largest groups of fungi with a high level of ecological diversity including many plant pathogens infecting a broad range of hosts. Here, we compare genome features of 18 members of this class, including 6 necrotrophs, 9 (hemi)biotrophs and 3 saprotrophs, to

  3. Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi.

    Directory of Open Access Journals (Sweden)

    Robin A Ohm

    Full Text Available The class Dothideomycetes is one of the largest groups of fungi with a high level of ecological diversity including many plant pathogens infecting a broad range of hosts. Here, we compare genome features of 18 members of this class, including 6 necrotrophs, 9 (hemibiotrophs and 3 saprotrophs, to analyze genome structure, evolution, and the diverse strategies of pathogenesis. The Dothideomycetes most likely evolved from a common ancestor more than 280 million years ago. The 18 genome sequences differ dramatically in size due to variation in repetitive content, but show much less variation in number of (core genes. Gene order appears to have been rearranged mostly within chromosomal boundaries by multiple inversions, in extant genomes frequently demarcated by adjacent simple repeats. Several Dothideomycetes contain one or more gene-poor, transposable element (TE-rich putatively dispensable chromosomes of unknown function. The 18 Dothideomycetes offer an extensive catalogue of genes involved in cellulose degradation, proteolysis, secondary metabolism, and cysteine-rich small secreted proteins. Ancestors of the two major orders of plant pathogens in the Dothideomycetes, the Capnodiales and Pleosporales, may have had different modes of pathogenesis, with the former having fewer of these genes than the latter. Many of these genes are enriched in proximity to transposable elements, suggesting faster evolution because of the effects of repeat induced point (RIP mutations. A syntenic block of genes, including oxidoreductases, is conserved in most Dothideomycetes and upregulated during infection in L. maculans, suggesting a possible function in response to oxidative stress.

  4. Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; Feau, Nicolas; Henrissat, Bernard; Schoch, Conrad L.; Horwitz, Benjamin A.; Barry, Kerrie W.; Condon, Bradford J.; Copeland, Alex C.; Dhillon, Braham; Glaser, Fabian; Hesse, Cedar N.; Kosti, Idit; LaButti, Kurt; Lindquist, Erika A.; Lucas, Susan; Salamov, Asaf A.; Bradshaw, Rosie E.; Ciuffetti, Lynda; Hamelin, Richard C.; Kema, Gert H. J.; Lawrence, Christopher; Scott, James A.; Spatafora, Joseph W.; Turgeon, B. Gillian; Wit, Pierre J. G. M. de; Zhong, Shaobin; Goodwin, Stephen B.; Grigoriev, Igor V.

    2012-02-29

    The class Dothideomycetes is one of the largest groups of fungi with a high level of ecological diversity including many plant pathogens infecting a broad range of hosts. Here, we compare genome features of 18 members of this class, including 6 necrotrophs, 9 (hemi)biotrophs and 3 saprotrophs, to analyze genome structure, evolution, and the diverse strategies of pathogenesis. The Dothideomycetes most likely evolved from a common ancestor more than 280 million years ago. The 18 genome sequences differ dramatically in size due to variation in repetitive content, but show much less variation in number of (core) genes. Gene order appears to have been rearranged mostly within chromosomal boundaries by multiple inversions, in extant genomes frequently demarcated by adjacent simple repeats. Several Dothideomycetes contain one or more gene-poor, transposable element (TE)-rich putatively dispensable chromosomes of unknown function. The 18 Dothideomycetes offer an extensive catalogue of genes involved in cellulose degradation, proteolysis, secondary metabolism, and cysteine-rich small secreted proteins. Ancestors of the two major orders of plant pathogens in the Dothideomycetes, the Capnodiales and Pleosporales, may have had different modes of pathogenesis, with the former having fewer of these genes than the latter. Many of these genes are enriched in proximity to transposable elements, suggesting faster evolution because of the effects of repeat induced point (RIP) mutations. A syntenic block of genes, including oxidoreductases, is conserved in most Dothideomycetes and upregulated during infection in L. maculans, suggesting a possible function in response to oxidative stress.

  5. Multiple displacement amplification of whole genomic DNA from urediospores of Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Zhang, R; Ma, Z H; Wu, B M

    2015-05-01

    Biotrophic fungi, such as Puccinia striiformis f. sp. tritici, because they cannot be cultured on nutrient media, to obtain adequate quantity of DNA for molecular genetic analysis, are usually propagated on living hosts, wheat plants in case of P. striiformis f. sp. tritici. The propagation process is time-, space- and labor-consuming and has been a bottleneck to molecular genetic analysis of this pathogen. In this study we evaluated multiple displacement amplification (MDA) of pathogen genomic DNA from urediospores as an alternative approach to traditional propagation of urediospores followed by DNA extraction. The quantities of pathogen genomic DNA in the products were further determined via real-time PCR with a pair of primers specific for the β-tubulin gene of P. striiformis f. sp. tritici. The amplified fragment length polymorphism (AFLP) fingerprints were also compared between the DNA products. The results demonstrated that adequate genomic DNA at fragment size larger than 23 Kb could be amplified from 20 to 30 urediospores via MDA method. The real-time PCR results suggested that although fresh urediospores collected from diseased leaves were the best, spores picked from diseased leaves stored for a prolonged period could also be used for amplification. AFLP fingerprints exhibited no significant differences between amplified DNA and DNA extracted with CTAB method, suggesting amplified DNA can represent the pathogen's genomic DNA very well. Therefore, MDA could be used to obtain genomic DNA from small precious samples (dozens of spores) for molecular genetic analysis of wheat stripe rust pathogen, and other fungi that are difficult to propagate.

  6. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    International Nuclear Information System (INIS)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong

    2012-01-01

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  7. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  8. DNA repair defects and genome instability in Hutchinson-Gilford Progeria Syndrome

    OpenAIRE

    Gonzalo, Susana; Kreienkamp, Ray

    2015-01-01

    The integrity of the nuclear lamina has emerged as an important factor in the maintenance of genome stability. In particular, mutations in the LMNA gene, encoding A-type lamins (lamin A/C), alter nuclear morphology and function, and cause genomic instability. LMNA gene mutations are associated with a variety of degenerative diseases and devastating premature aging syndromes such as Hutchinson-Gilford Progeria Syndrome (HGPS) and Restrictive Dermopathy (RD). HGPS is a severe laminopathy, with ...

  9. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  10. Single-tube linear DNA amplification for genome-wide studies using a few thousand cells

    NARCIS (Netherlands)

    Shankaranarayanan, P.; Mendoza-Parra, M.A.; Gool, van W.; Trindade, L.M.; Gronemeyer, H.

    2012-01-01

    Linear amplification of DNA (LinDA) by T7 polymerase is a versatile and robust method for generating sufficient amounts of DNA for genome-wide studies with minute amounts of cells. LinDA can be coupled to a great number of global profiling technologies. Indeed, chromatin immunoprecipitation coupled

  11. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  12. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    enoh

    2012-03-22

    Mar 22, 2012 ... Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of .... Dellaporta's method for isolation of total genomic DNA. Kumari et ..... conserved a-tubulin gene and template DNA from potato plantlets, potato tuber, Brassica and Jatropha, respectively (The.

  13. Genome-wide DNA methylation levels and altered cortisol stress reactivity following childhood trauma in humans

    NARCIS (Netherlands)

    Houtepen, Lotte C.; Vinkers, Christiaan H.; Carrillo-Roa, Tania; Hiemstra, Marieke; Van Lier, Pol A.; Meeus, Wim; Branje, Susan J. T.; Heim, Christine M.; Nemeroff, Charles B.; Mill, Jonathan; Schalkwyk, Leonard C.; Creyghton, Menno P.; Kahn, René S.; Joëls, Marian; Binder, Elisabeth B.; Boks, Marco P

    2016-01-01

    DNA methylation likely plays a role in the regulation of human stress reactivity. Here we show that in a genome-wide analysis of blood DNA methylation in 85 healthy individuals, a locus in the Kit ligand gene (KITLG; cg27512205) showed the strongest association with cortisol stress reactivity (P=5.8

  14. Genome-wide DNA methylation analysis of the porcine hypothalamus-pituitary-ovary axis

    DEFF Research Database (Denmark)

    Yuan, Xiao Long; Zhang, Zhe; Li, Bin

    2017-01-01

    Previous studies have suggested that DNA methylation in both CpG and CpH (where H = C, T or A) contexts plays a critical role in biological functions of different tissues. However, the genome-wide DNA methylation patterns of porcine hypothalamus-pituitary-ovary (HPO) tissues remain virtually unex...

  15. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  16. Excised radicle tips as a source of genomic DNA for PCR-based ...

    Indian Academy of Sciences (India)

    Genomic DNA isolation in cotton is complicated because of the presence of secondary metabolites that are inhibitory to PCR amplification. We report here that radicle tips, but not other parts of cotton seedlings, yield high-quality DNA that is readily amenable for PCR. The radicle-tip-excised seedlings retain viability because ...

  17. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  18. A protocol for large scale genomic DNA isolation for cacao genetics ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-12

    Feb 12, 2014 ... 3Universidade Estadual de Santa Cruz (UESC), 45662-900 Ilhéus-BA, Brazil. Accepted 5 January, 2014. Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the.

  19. DNA mismatch repair, genome instability and cancer in zebrafish

    NARCIS (Netherlands)

    Feitsma, H.

    2008-01-01

    The objective of this study was to find out whether the zebrafish can be an appropriate model for studying DNA repair and cancer. For this purpose three fish lines were used that lack components of an important mechanism for the repair of small DNA damage: DNA mismatch repair. These fish are

  20. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    Nucleotide incorporation by DNA polymerase forms the basis of DNA sequencing-by-synthesis. In current platforms, either the single-stranded DNA or the enzyme is immobilized on a solid surface to locate the incorporation of individual nucleotides in space and/or time. Solid-phase reactions may, ho...

  1. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  2. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2005-01-01

    .... These cells overexpress a glycoprotein called endoglin which stimulates such vessels. We successfully constructed and evaluated an oral endoglin-based DNA vaccine and demonstrated its capability to induce a robust CD8...

  3. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  4. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  5. Recurrent DNA inversion rearrangements in the human genome

    DEFF Research Database (Denmark)

    Flores, Margarita; Morales, Lucía; Gonzaga-Jauregui, Claudia

    2007-01-01

    Several lines of evidence suggest that reiterated sequences in the human genome are targets for nonallelic homologous recombination (NAHR), which facilitates genomic rearrangements. We have used a PCR-based approach to identify breakpoint regions of rearranged structures in the human genome...... to human genomic variation is discussed........ In particular, we have identified intrachromosomal identical repeats that are located in reverse orientation, which may lead to chromosomal inversions. A bioinformatic workflow pathway to select appropriate regions for analysis was developed. Three such regions overlapping with known human genes, located...

  6. Aprataxin resolves adenylated RNA-DNA junctions to maintain genome integrity

    Science.gov (United States)

    Tumbale, Percy; Williams, Jessica S.; Schellenberg, Matthew J.; Kunkel, Thomas A.; Williams, R. Scott

    2014-01-01

    Faithful maintenance and propagation of eukaryotic genomes is ensured by three-step DNA ligation reactions employed by ATP-dependent DNA ligases1,2. Paradoxically, when DNA ligases encounter nicked DNA structures with abnormal DNA termini, DNA ligase catalytic activity can generate and/or exacerbate DNA damage through abortive ligation that produces chemically adducted, toxic 5′-adenylated (5′-AMP) DNA lesions3–6 (Fig. 1a). Aprataxin (Aptx) reverses DNA-adenylation but the context for deadenylation repair is unclear. Here we examine the importance of Aptx to RNaseH2-dependent excision repair (RER) of a lesion that is very frequently introduced into DNA, a ribonucleotide. We show that ligases generate adenylated 5′-ends containing a ribose characteristic of RNaseH2 incision. Aptx efficiently repairs adenylated RNA-DNA, and acting in an RNA-DNA damage response (RDDR), promotes cellular survival and prevents S-phase checkpoint activation in budding yeast undergoing RER. Structure-function studies of human Aptx/RNA-DNA/AMP/Zn complexes define a mechanism for detecting and reversing adenylation at RNA-DNA junctions. This involves A-form RNA-binding, proper protein folding and conformational changes, all of which are impacted by heritable APTX mutations in Ataxia with Oculomotor Apraxia 1 (AOA1). Together, these results suggest that accumulation of adenylated RNA-DNA may contribute to neurological disease. PMID:24362567

  7. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob

    2016-01-01

    be amplified to obtain micrograms of an otherwise limited resource, referred to as whole-genome amplified DNA (wgaDNA). Here we investigate the robustness of exome sequencing of wgaDNA of neonatal DBS samples. We conducted three pilot studies of seven, eight and seven subjects, respectively. For each subject...... from variant calls. No differences were observed substituting 2x3.2 with 2x1.6 mm discs, allowing for additional reduction of sample material in future projects....

  8. Genomic profiling of plastid DNA variation in the Mediterranean olive tree.

    Science.gov (United States)

    Besnard, Guillaume; Hernández, Pilar; Khadari, Bouchaib; Dorado, Gabriel; Savolainen, Vincent

    2011-05-10

    Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea.

  9. Genomic profiling of plastid DNA variation in the Mediterranean olive tree

    Science.gov (United States)

    2011-01-01

    Background Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Results Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. Conclusions We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea. PMID:21569271

  10. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  11. Polymorphism and mutation analysis of genomic DNA on cancer

    International Nuclear Information System (INIS)

    Ohta, Tsutomu

    2003-01-01

    DNA repair is a universal process in living cells that maintains the structural integrity of chromosomal DNA molecules in face of damage. A deficiency in DNA damage repair is associated with an increased cancer risk by increasing a mutation frequency of cancer-related genes. Variation in DNA repair capacity may be genetically determined. Therefore, we searched single-nucleotide polymorphisms (SNPs) in major DNA repair genes. This led to the finding of 600 SNPs and mutations including many novel SNPs in Japanese population. Case-control studies to explore the contribution of the SNPs in DNA repair genes to the risk of lung cancer revealed that five SNPs are associated with lung carcinogenesis. One of these SNPs is found in RAD54L gene, which is involved in double-strand DNA repair. We analyzed and reported activities of Rad54L protein with SNP and mutations. (authors)

  12. The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli

    DEFF Research Database (Denmark)

    Cho, Suhyung; Cho, Yoo-Bok; Kang, Taek Jin

    2015-01-01

    DNA-binding motifs that are recognized by transcription factors (TFs) have been well studied; however, challenges remain in determining the in vivo architecture of TF-DNA complexes on a genome-scale. Here, we determined the in vivo architecture of Escherichia coli arginine repressor (Arg...... facilitate the non-specific contacts between ArgR subunits and the residual sequences. Additionally, our approach may also reveal other fundamental structural features of TF-DNA interactions that have implications for studying genome-scale transcriptional regulatory networks....

  13. in rice encoding a flavin monooxygenase

    Indian Academy of Sciences (India)

    Cloning, characterization and expression of OsFMO(t) in rice encoding a flavin monooxygenase. Jicai Yi, Lanna Liu, Youpei Cao, Jiazuo Li and Mantong Mei. J. Genet. 92, 471–480. Figure 1. Examples of PCR analysis of the presence of the genes for HPT and GUS in transgenic plants. Genomic DNA of putative.

  14. Targeted DNA enrichment and whole genome sequencing of Neisseria meningitidis directly from clinical specimens.

    Science.gov (United States)

    Clark, Stephen A; Doyle, Ronan; Lucidarme, Jay; Borrow, Ray; Breuer, Judith

    2018-03-01

    In England and Wales, approximately one half of all laboratory-confirmed meningococcal disease cases fail to yield a viable invasive isolate, primarily due to the use of antibiotics. Characterisation of non-culture meningococci has been restricted to the detection or sequencing of specific gene targets within clinical specimens. In this study we investigated the ability of the Agilent SureSelectXT kit to facilitate DNA enrichment and genome sequencing of meningococcal DNA within a small panel of blood and CSF specimens. A target-specific RNA oligonucleotide bait library was used to capture and enrich the bacterial DNA prior to next generation sequencing. A positive correlation between meningococcal DNA amount and genome coverage was observed with eight of the ten specimens producing genomes of acceptable quality. All commonly-used typing information derived from each acceptable non-culture genome matched those of an isolate from the same patient and the paired genomes showed a high level of congruence across indexed loci. We estimate that this technique could be used to perform whole genome sequencing on up to ∼45% of the positive specimens received by the Public Health England's Meningococcal Reference Unit. Further optimisation of the extraction and/or enrichment processes may, however, increase the proportion of non-culture cases from which quality genomes can be obtained. Crown Copyright © 2017. Published by Elsevier GmbH. All rights reserved.

  15. Analysis of Current DNA Encoded Library Screening Data Indicates Higher False Negative Rates for Numerically Larger Libraries.

    Science.gov (United States)

    Satz, Alexander L; Hochstrasser, Remo; Petersen, Ann C

    2017-04-10

    To optimize future DNA-encoded library design, we have attempted to quantify the library size at which the signal becomes undetectable. To accomplish this we (i) have calculated that percent yields of individual library members following a screen range from 0.002 to 1%, (ii) extrapolated that ∼1 million copies per library member are required at the outset of a screen, and (iii) from this extrapolation predict that false negative rates will begin to outweigh the benefit of increased diversity at library sizes >10 8 . The above analysis is based upon a large internal data set comprising multiple screens, targets, and libraries; we also augmented our internal data with all currently available literature data. In theory, high false negative rates may be overcome by employing larger amounts of library; however, we argue that using more than currently reported amounts of library (≫10 nmoles) is impractical. The above conclusions may be generally applicable to other DNA encoded library platforms, particularly those platforms that do not allow for library amplification.

  16. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  17. Human Papillomaviruses Preferentially Recruit DNA Repair Factors to Viral Genomes for Rapid Repair and Amplification.

    Science.gov (United States)

    Mehta, Kavi; Laimins, Laimonis

    2018-02-13

    High-risk human papillomaviruses (HPVs) activate the ataxia telangiectasia mutated-dependent (ATM) DNA damage response as well as the ataxia telangiectasia mutated-dependent DNA-related (ATR) pathway in the absence of external DNA damaging agents for differentiation-dependent genome amplification. Through the use of comet assays and pulsed-field gel electrophoresis, our studies showed that these pathways are activated in response to DNA breaks induced by the viral proteins E6 and E7 alone and independently of viral replication. The majority of these virally induced DNA breaks are present in cellular DNAs and only minimally in HPV episomes. Treatment of HPV-positive cells with inhibitors of both ATM and ATR leads to the generation of DNA breaks and the fragmentation of viral episomes, indicating that DNA breaks are introduced into HPV genomes. These breaks, however, are rapidly repaired through the preferential recruitment of homologous recombination repair enzymes, such as RAD51 and BRCA1, to viral genomes at the expense of cellular DNAs. When HPV-positive cells are treated with hydroxyurea, this recruitment of RAD51 and BRCA1 to viral genomes is greatly enhanced with little recruitment to damaged cellular DNAs and with retention of the ability of viral genomes to amplify. Overall, our studies demonstrated that human papillomaviruses induce breaks into cellular and viral DNAs and that the preferential repair of these lesions in viral episomes leads to genome amplification. IMPORTANCE High-risk human papillomaviruses (HPVs) are the etiologic agents of cervical cancer and are linked to the development of many other anogenital and oropharyngeal cancers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM- and Rad3-related (ATR) DNA repair pathways. Our studies have shown that HPVs activate these pathways by inducing double-strand breaks primarily in cellular DNAs and minimally in viral genomes. Breaks are induced in

  18. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  19. Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites.

    Science.gov (United States)

    Serrao, Erik; Cherepanov, Peter; Engelman, Alan N

    2016-03-22

    Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

  20. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  1. Aprataxin resolves adenylated RNA–DNA junctions to maintain genome integrity

    Energy Technology Data Exchange (ETDEWEB)

    Tumbale, Percy [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States). Lab. of Structural Biology; Williams, Jessica S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States). Lab. of Structural Biology; Schellenberg, Matthew J. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States). Lab. of Structural Biology; Kunkel, Thomas A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States). Lab. of Structural Biology and Lab. of Molecular Genetics; Williams, R. Scott [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States). Lab. of Structural Biology and Lab. Molecular Genetics

    2013-12-22

    Faithful maintenance and propagation of eukaryotic genomes is ensured by three-step DNA ligation reactions used by ATP-dependent DNA ligases. Paradoxically, when DNA ligases encounter nicked DNA structures with abnormal DNA termini, DNA ligase catalytic activity can generate and/or exacerbate DNA damage through abortive ligation that produces chemically adducted, toxic 5'-adenylated (5'-AMP) DNA lesions. Aprataxin (APTX) reverses DNA adenylation but the context for deadenylation repair is unclear. Here we examine the importance of APTX to RNase-H2-dependent excision repair (RER) of a lesion that is very frequently introduced into DNA, a ribonucleotide. We show that ligases generate adenylated 5' ends containing a ribose characteristic of RNase H2 incision. APTX efficiently repairs adenylated RNA–DNA, and acting in an RNA–DNA damage response (RDDR), promotes cellular survival and prevents S-phase checkpoint activation in budding yeast undergoing RER. Structure–function studies of human APTX–RNA–DNA–AMP–Zn complexes define a mechanism for detecting and reversing adenylation at RNA–DNA junctions. This involves A-form RNA binding, proper protein folding and conformational changes, all of which are affected by heritable APTX mutations in ataxia with oculomotor apraxia 1. Together, these results indicate that accumulation of adenylated RNA–DNA may contribute to neurological disease.

  2. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  3. Genome Partitioner: A web tool for multi-level partitioning of large-scale DNA constructs for synthetic biology applications.

    Directory of Open Access Journals (Sweden)

    Matthias Christen

    Full Text Available Recent advances in lower-cost DNA synthesis techniques have enabled new innovations in the field of synthetic biology. Still, efficient design and higher-order assembly of genome-scale DNA constructs remains a labor-intensive process. Given the complexity, computer assisted design tools that fragment large DNA sequences into fabricable DNA blocks are needed to pave the way towards streamlined assembly of biological systems. Here, we present the Genome Partitioner software implemented as a web-based interface that permits multi-level partitioning of genome-scale DNA designs. Without the need for specialized computing skills, biologists can submit their DNA designs to a fully automated pipeline that generates the optimal retrosynthetic route for higher-order DNA assembly. To test the algorithm, we partitioned a 783 kb Caulobacter crescentus genome design. We validated the partitioning strategy by assembling a 20 kb test segment encompassing a difficult to synthesize DNA sequence. Successful assembly from 1 kb subblocks into the 20 kb segment highlights the effectiveness of the Genome Partitioner for reducing synthesis costs and timelines for higher-order DNA assembly. The Genome Partitioner is broadly applicable to translate DNA designs into ready to order sequences that can be assembled with standardized protocols, thus offering new opportunities to harness the diversity of microbial genomes for synthetic biology applications. The Genome Partitioner web tool can be accessed at https://christenlab.ethz.ch/GenomePartitioner.

  4. Quantification of trace-level DNA by real-time whole genome amplification.

    Science.gov (United States)

    Kang, Min-Jung; Yu, Hannah; Kim, Sook-Kyung; Park, Sang-Ryoul; Yang, Inchul

    2011-01-01

    Quantification of trace amounts of DNA is a challenge in analytical applications where the concentration of a target DNA is very low or only limited amounts of samples are available for analysis. PCR-based methods including real-time PCR are highly sensitive and widely used for quantification of low-level DNA samples. However, ordinary PCR methods require at least one copy of a specific gene sequence for amplification and may not work for a sub-genomic amount of DNA. We suggest a real-time whole genome amplification method adopting the degenerate oligonucleotide primed PCR (DOP-PCR) for quantification of sub-genomic amounts of DNA. This approach enabled quantification of sub-picogram amounts of DNA independently of their sequences. When the method was applied to the human placental DNA of which amount was accurately determined by inductively coupled plasma-optical emission spectroscopy (ICP-OES), an accurate and stable quantification capability for DNA samples ranging from 80 fg to 8 ng was obtained. In blind tests of laboratory-prepared DNA samples, measurement accuracies of 7.4%, -2.1%, and -13.9% with analytical precisions around 15% were achieved for 400-pg, 4-pg, and 400-fg DNA samples, respectively. A similar quantification capability was also observed for other DNA species from calf, E. coli, and lambda phage. Therefore, when provided with an appropriate standard DNA, the suggested real-time DOP-PCR method can be used as a universal method for quantification of trace amounts of DNA.

  5. Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems differentially distributed in Salmonella serotypes

    Directory of Open Access Journals (Sweden)

    Santiviago Carlos A

    2009-08-01

    Full Text Available Abstract Background The recently described Type VI Secretion System (T6SS represents a new paradigm of protein secretion in bacteria. A number of bioinformatic studies have been conducted to identify T6SS gene clusters in the available bacterial genome sequences. According to these studies, Salmonella harbors a unique T6SS encoded in the Salmonella Pathogenicity Island 6 (SPI-6. Since these studies only considered few Salmonella genomes, the present work aimed to identify novel T6SS loci by in silico analysis of every genome sequence of Salmonella available. Results The analysis of sequencing data from 44 completed or in progress Salmonella genome projects allowed the identification of 3 novel T6SS loci. These clusters are located in differentially-distributed genomic islands we designated SPI-19, SPI-20 and SPI-21, respectively. SPI-19 was identified in a subset of S. enterica serotypes including Dublin, Weltevreden, Agona, Gallinarum and Enteritidis. In the later, an internal deletion eliminated most of the island. On the other hand, SPI-20 and SPI-21 were restricted to S. enterica subspecies arizonae (IIIa serotype 62:z4,z23:-. Remarkably, SPI-21 encodes a VgrG protein containing a C-terminal extension similar to S-type pyocins of Pseudomonas aeruginosa. This is not only the first evolved VgrG described in Salmonella, but also the first evolved VgrG including a pyocin domain described so far in the literature. In addition, the data indicate that SPI-6 T6SS is widely distributed in S. enterica and absent in serotypes Enteritidis, Gallinarum, Agona, Javiana, Paratyphi B, Virchow, IIIa 62:z4,z23:- and IIIb 61:1,v:1,5,(7. Interestingly, while some serotypes harbor multiple T6SS (Dublin, Weltvreden and IIIa 62:z4,z23:- others do not encode for any (Enteritidis, Paratyphi B, Javiana, Virchow and IIIb 61:1,v:1,5,(7. Comparative and phylogenetic analyses indicate that the 4 T6SS loci in Salmonella have a distinct evolutionary history. Finally, we

  6. Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems differentially distributed in Salmonella serotypes.

    Science.gov (United States)

    Blondel, Carlos J; Jiménez, Juan C; Contreras, Inés; Santiviago, Carlos A

    2009-08-04

    The recently described Type VI Secretion System (T6SS) represents a new paradigm of protein secretion in bacteria. A number of bioinformatic studies have been conducted to identify T6SS gene clusters in the available bacterial genome sequences. According to these studies, Salmonella harbors a unique T6SS encoded in the Salmonella Pathogenicity Island 6 (SPI-6). Since these studies only considered few Salmonella genomes, the present work aimed to identify novel T6SS loci by in silico analysis of every genome sequence of Salmonella available. The analysis of sequencing data from 44 completed or in progress Salmonella genome projects allowed the identification of 3 novel T6SS loci. These clusters are located in differentially-distributed genomic islands we designated SPI-19, SPI-20 and SPI-21, respectively. SPI-19 was identified in a subset of S. enterica serotypes including Dublin, Weltevreden, Agona, Gallinarum and Enteritidis. In the later, an internal deletion eliminated most of the island. On the other hand, SPI-20 and SPI-21 were restricted to S. enterica subspecies arizonae (IIIa) serotype 62:z4,z23:-. Remarkably, SPI-21 encodes a VgrG protein containing a C-terminal extension similar to S-type pyocins of Pseudomonas aeruginosa. This is not only the first evolved VgrG described in Salmonella, but also the first evolved VgrG including a pyocin domain described so far in the literature. In addition, the data indicate that SPI-6 T6SS is widely distributed in S. enterica and absent in serotypes Enteritidis, Gallinarum, Agona, Javiana, Paratyphi B, Virchow, IIIa 62:z4,z23:- and IIIb 61:1,v:1,5,(7). Interestingly, while some serotypes harbor multiple T6SS (Dublin, Weltvreden and IIIa 62:z4,z23:-) others do not encode for any (Enteritidis, Paratyphi B, Javiana, Virchow and IIIb 61:1,v:1,5,(7)). Comparative and phylogenetic analyses indicate that the 4 T6SS loci in Salmonella have a distinct evolutionary history. Finally, we identified an orphan Hcp-like protein

  7. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family.

    Science.gov (United States)

    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J H

    2015-01-01

    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members.

  8. Kinetics of carboplatin-DNA binding in genomic DNA and bladder cancer cells as determined by accelerator mass spectrometry

    International Nuclear Information System (INIS)

    Hah, S S; Stivers, K M; Vere White, R; Henderson, P T

    2005-01-01

    Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [ 14 C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [ 14 C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 (micro)g of DNA. This sensitivity may allow the method to be used for clinical applications

  9. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  10. Chromosomal localization of rDNA genes and genomic organization ...

    Indian Academy of Sciences (India)

    somal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias. [Zhu H. P., Lu M. X., Gao F. Y., Huang Z. H., Yang L. P. and Gui J. F. 2010 Chromosomal localization of rDNA genes and ...

  11. USE OF COMPETITIVE DNA HYBRIDIZATION TO IDENTIFY DIFFERENCES IN THE GENOMES OF TWO CLOSELY RELATED FECAL INDICATOR BACTERIA

    Science.gov (United States)

    Although recent technological advances in DNA sequencing and computational biology now allow scientists to compare entire microbial genomes, comparisons of closely related bacterial species and individual isolates by whole-genome sequencing approaches remains prohibitively expens...

  12. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  13. Genomic clone encoding the α chain of the OKM1, LFA-1, and platelet glycoprotein IIb-IIIa molecules

    International Nuclear Information System (INIS)

    Cosgrove, L.J.; Sandrin, M.S.; Rajasekariah, P.; McKenzie, I.F.C.

    1986-01-01

    LFA-1, an antigen involved in cytolytic T lymphocyte-mediated killing, and Mac-1, the receptor for complement component C3bi, constitute a family of structurally and functionally related cell surface glycoproteins involved in cellular interactions. In both mouse and man, Mac-1 (OKM1) and LFA-1 share a common 95-kDa β subunit but are distinguished by their α chains, which have different cellular distributions, apparent molecular masses (165 and 177 kDa, respectively), and peptide maps. The authors report the isolation of a genomic clone from a human genomic library that on transfection into mouse fibroblasts produced a molecule(s) reactive with monoclonal antibodies to OKM1, to LFA-1, and to platelet glycoprotein IIb-IIIa. This gene was cloned by several cycles of transfection of L cells with a human genomic library cloned in λ phase Charon 4A and subsequent rescue of the λ phage. Transfection with the purified recombinant λ DNA yielded a transfectant that expressed the three human α chains of OKM1, LFA-1, and glycoprotein IIb-IIIa, presumably in association with the murine β chain

  14. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  15. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  16. Potential applications of atomic force microscopy of DNA to the human genome project

    Science.gov (United States)

    Hansma, Helen G.; Hansma, Paul K.

    1993-06-01

    A simple calculation shows that the information contained in the base sequence of the human genome could be recorded onto less than two compact discs. To read amounts of information comparable in size to the human genome, scanning probes are used routinely in both biology (i.e., living systems) and technology. The atomic force microscope (AFM) is a scanning probe that is now capable of imaging DNA routinely and reproducibly. The minimum size of structures seen reproducibly along DNA strands with the AFM is presently 2 to 3 nm, which is an order of magnitude less resolution than would be required to sequence DNA. At present, the AFM shows great potential for high-resolution mapping of DNA but is not capable of sequencing DNA without further improvements.

  17. Studies on the Interaction between Zinc-Hydroxybenzoite Complex and Genomic DNA

    Directory of Open Access Journals (Sweden)

    Hacali Necefoglu

    2006-04-01

    Full Text Available Zinc-Hydroxybenzoite ([Zn (H206] (p-HO-C6H4COO22H20 complex which wassynthesized and characterized by instrumental methods and the DNA samples which hadbeen isolated from cattle were allowed to interact at 37 oC for different time periods. Theinteraction of genomic DNA with this complex has been followed by agarose gelelectrophoresis at 50 V for 2 h. When DNA samples were allowed to interact with this metalcomplex, it was found that band intensities changed with the concentrations of the complex.In the result of interaction between this complex and genomic DNA samples, it wasdetermined that the intensities of bands were changed at the different concentrations of thecomplex. The brightness of the bands was increased and mobility of the bands wasdecreased, indicating the occurrence of increased covalent binding of the metal complexwith DNA. In this study it was concluded that the damage effect of ascorbate was reducedby Zinc-Hydroxybenzoite.

  18. Improved method for genomic DNA extraction forOpuntiaMill. (Cactaceae).

    Science.gov (United States)

    Martínez-González, César Ramiro; Ramírez-Mendoza, Rosario; Jiménez-Ramírez, Jaime; Gallegos-Vázquez, Clemente; Luna-Vega, Isolda

    2017-01-01

    Genomic DNA extracted from species of Cactaceae is often contaminated with significant amounts of mucilage and pectin. Pectin is one of the main components of cellular walls, whereas mucilage is a complex polysaccharide with a ramified structure. Thus, pectin- and mucilage-free extraction of DNA is a key step for further downstream PCR-based analyses. We tested our DNA extraction method on cladode tissue (juvenile, adult, and herbaria exemplars) of 17 species of Opuntia Mill., which are characterized by a large quantity of pectin and mucilage. We developed a method for the extraction of gDNA free of inhibitory compounds common in species of Opuntia Mill., such as pectin and mucilage. Compared to previously extraction protocols, our method produced higher yields of high-quality genomic DNA.

  19. Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.

    Directory of Open Access Journals (Sweden)

    Christine Couldrey

    Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.

  20. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  1. Comparison of Eleven Methods for Genomic DNA Extraction Suitable for Large-Scale Whole-Genome Genotyping and Long-Term DNA Banking Using Blood Samples

    Science.gov (United States)

    Psifidi, Androniki; Dovas, Chrysostomos I.; Bramis, Georgios; Lazou, Thomai; Russel, Claire L.; Arsenos, Georgios; Banos, Georgios

    2015-01-01

    Over the recent years, next generation sequencing and microarray technologies have revolutionized scientific research with their applications to high-throughput analysis of biological systems. Isolation of high quantities of pure, intact, double stranded, highly concentrated, not contaminated genomic DNA is prerequisite for successful and reliable large scale genotyping analysis. High quantities of pure DNA are also required for the creation of DNA-banks. In the present study, eleven different DNA extraction procedures, including phenol-chloroform, silica and magnetic beads based extractions, were examined to ascertain their relative effectiveness for extracting DNA from ovine blood samples. The quality and quantity of the differentially extracted DNA was subsequently assessed by spectrophotometric measurements, Qubit measurements, real-time PCR amplifications and gel electrophoresis. Processing time, intensity of labor and cost for each method were also evaluated. Results revealed significant differences among the eleven procedures and only four of the methods yielded satisfactory outputs. These four methods, comprising three modified silica based commercial kits (Modified Blood, Modified Tissue, Modified Dx kits) and an in-house developed magnetic beads based protocol, were most appropriate for extracting high quality and quantity DNA suitable for large-scale microarray genotyping and also for long-term DNA storage as demonstrated by their successful application to 600 individuals. PMID:25635817

  2. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  3. Ultra-barcoding in cacao (Theobroma spp.; Malvaceae) using whole chloroplast genomes and nuclear ribosomal DNA.

    Science.gov (United States)

    Kane, Nolan; Sveinsson, Saemundur; Dempewolf, Hannes; Yang, Ji Yong; Zhang, Dapeng; Engels, Johannes M M; Cronk, Quentin

    2012-02-01

    To reliably identify lineages below the species level such as subspecies or varieties, we propose an extension to DNA-barcoding using next-generation sequencing to produce whole organellar genomes and substantial nuclear ribosomal sequence. Because this method uses much longer versions of the traditional DNA-barcoding loci in the plastid and ribosomal DNA, we call our approach ultra-barcoding (UBC). We used high-throughput next-generation sequencing to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an individual of the related species T. grandiflorum, as well as an additional publicly available whole plastid genome of T. cacao. All individuals of T. cacao examined were uniquely distinguished, and evidence of reticulation and gene flow was observed. Sequence variation was observed in some of the canonical barcoding regions between species, but other regions of the chloroplast were more variable both within species and between species, as were ribosomal spacers. Furthermore, no single region provides the level of data available using the complete plastid genome and rDNA. Our data demonstrate that UBC is a viable, increasingly cost-effective approach for reliably distinguishing varieties and even individual genotypes of T. cacao. This approach shows great promise for applications where very closely related or interbreeding taxa must be distinguished.

  4. Comparative Analysis of the Genomic DNA Isolation Methods on Inula sp. (Asteraceae

    Directory of Open Access Journals (Sweden)

    Emre SEVİNDİK

    2016-12-01

    Full Text Available Simple, fast, low-cost and high throughput protocols are required for DNA isolation of plant species. In this study, phenol chloroform isoamyl alcohol and commercial (Sigma DNA isolation kit methods were applied on some Inula species that belong to Asteraceae family. Genomic DNA amounts, A260, A280, A260/A230 and purity degrees (A260/A280 that were obtained through both methods were measured through electrophoresis and spectrophotometer. Additionally, PCR amplification was realized by primer pairs specific to nrDNA ITS, cpDNA ndhF (972F-1603R and trnL-F regions. Results showed that maximum genomic DNA in nanograms obtained by phenol chloroform isoamyl alcohol method. The study also revealed that I. macrocephala had the maximum DNA and I. heterolepis had the minimum DNA amount. A260/A280 purity degrees showed that the highest and lowest purity in gDNAs obtained through phenol-choloform isoamyl alcohol method were in I.aucheriana and I. salicina, respectively. The highest and lowest purity degrees of gDNAs obtained through commercial kit was observed in I. fragilis and I. macrocephala samples, respectively. PCR amplification results showed that while band profiles of each three regions (ITS, trnL-F and ndhF did not yield positive results in PCR amplifications using phenol-choloform isoamyl alcohol method; PCR band profiles obtained through commercial kit yielded positive results. As a result, it is fair to say that the relation of genomic DNA with PCR was found to be more efficient although the maximum amount of genomic DNA was obtained through phenol chloroform isoamyl alcohol method.

  5. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  6. Massive parallel sequencing of mitochondrial DNA genomes from mother-child pairs using the ion torrent personal genome machine (PGM).

    Science.gov (United States)

    Ma, Ke; Zhao, Xueying; Li, Hui; Cao, Yu; Li, Wei; Ouyang, Jian; Xie, Lu; Liu, Wenbin

    2018-01-01

    Mitochondrial genome analysis is a potent tool in forensic practice and in the understanding of human phylogeny in the maternal lineage. With the development of molecular biology and bioinformatics techniques, high-throughput sequencing has enabled mtDNA analysis during whole genome sequencing, which provides more comprehensive information and raises the power of discrimination. In this study, peripheral blood samples were taken from 194 mother-offspring pairs and sequenced by Ion Torrent Personal Genome Machine and obtained high-coverage mitochondrial sequencing data, demonstrating the mutation levels at each position in the mitochondrial DNA (mtDNA) between maternally related pairs. A total of 14,332 variants were observed at 891 nucleotide positions from 388 individuals, and the result shows that all maternally related pairs shared the same detailed homoplasmic SNPs and haplotypes. With appropriate criteria for avoiding false positives due to sequencing errors and contamination by nuclear mitochondrial pseudogenes, we identified 33 heteroplasmies at a frequency of ≥10% at 32 sites in 30 pairs. The maternally related pairs had the same heteroplasmic sites but with different allele frequencies. The dataset is available through EMPOP under accession number EMP00684 and will serve as an mtDNA reference database in forensic casework in Eastern China. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. DNA-Encoded Antibody Libraries: A Unified Platform for Multiplexed Cell Sorting and Detection of Genes and Proteins

    Science.gov (United States)

    Bailey, Ryan C.; Kwong, Gabriel A.; Radu, Caius G.; Witte, Owen N.; Heath, James R.

    2013-01-01

    Whether for pathological examination or for fundamental biology studies, different classes of biomaterials and biomolecules are each measured from a different region of a typically heterogeneous tissue sample, thus introducing unavoidable sources of noise that are hard to quantitate. We describe the method of DNA-encoded antibody libraries (DEAL) for spatially multiplexed detection of ssDNAs and proteins as well as for cell sorting, all on the same diagnostic platform. DEAL is based upon the coupling of ssDNA oligomers onto antibodies which are then combined with the biological sample of interest. Spotted DNA arrays, which are found to inhibit biofouling, are utilized to spatially stratify the biomolecules or cells of interest. We demonstrate the DEAL technique for: (1) the rapid detection of multiple proteins within a single microfluidic channel, and, with the additional step of electroless amplification of gold-nanoparticle labeled secondary antibodies, we establish a detection limit of 10 femtoMolar for the protein IL-2, 150 times more sensitive than the analog ELISA; (2) the multiplexed, on-chip sorting of both immortalized cell lines and primary immune cells with an efficiency that exceeds surface confined panning approaches; and (3) the co-detection of ssDNAs, proteins and cell populations on the same platform. PMID:17260987

  9. Metabolism, Genomics, and DNA Repair in the Mouse Aging Liver

    Directory of Open Access Journals (Sweden)

    Michel Lebel

    2011-01-01

    Full Text Available The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems.

  10. Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus-1 dsDNA in serum.

    Science.gov (United States)

    Cheng, Cheng; Oueslati, Rania; Wu, Jayne; Chen, Jiangang; Eda, Shigetoshi

    2017-06-01

    This work presents a rapid, highly sensitive, low-cost, and specific capacitive DNA sensor for detection of whole genome human herpesvirus-1 DNA. This sensor is capable of direct DNA detection with a response time of 30 s, and it can be used to test standard buffer or serum samples. The sensing approach for DNA detection is based on alternating current (AC) electrokinetics. By applying an inhomogeneous AC electric field on sensor electrodes, positive dielectrophoresis is induced to accelerate DNA hybridization. The same applied AC signal also directly measures the hybridization of target with the probe on the sensor surface. Experiments are conducted to optimize the AC signal, as well as the buffers for probe immobilization and target DNA hybridization. The assay is highly sensitive and specific, with no response to human herpesvirus-2 DNA at 5 ng/mL and a LOD of 1.0 pg/mL (6.5 copies/μL or 10.7 aM) in standard buffer. When testing the double stranded (ds) DNA spiked in human serum samples, the sensor yields a LOD of 20.0 pg/mL (129.5 copies/μL or 0.21 femtomolar (fM)) in neat serum. In this work, the target is whole genome dsDNA, consequently the test can be performed without the use of enzyme or amplification, which considerably simplifies the sensor operation and is highly suitable for point of care disease diagnosis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Genome-wide Purification of Extrachromosomal Circular DNA from Eukaryotic Cells

    DEFF Research Database (Denmark)

    Møller, Henrik D.; Bojsen, Rasmus Kenneth; Tachibana, Chris

    2016-01-01

    Extrachromosomal circular DNAs (eccDNAs) are common genetic elements in Saccharomyces cerevisiae and are reported in other eukaryotes as well. EccDNAs contribute to genetic variation among somatic cells in multicellular organisms and to evolution of unicellular eukaryotes. Sensitive methods...... for detecting eccDNA are needed to clarify how these elements affect genome stability and how environmental and biological factors induce their formation in eukaryotic cells. This video presents a sensitive eccDNA-purification method called Circle-Seq. The method encompasses column purification of circular DNA...... DNA. Validation of the Circle-Seq method on three S. cerevisiae CEN.PK populations of 10(10) cells detected hundreds of eccDNA profiles in sizes larger than 1 kilobase. Repeated findings of ASP3-1, COS111, CUP1, RSC30, HXT6, HXT7 genes on circular DNA in both S288c and CEN.PK suggests that DNA...

  12. Sensitive enzymatic quantification of 5-hydroxymethylcytosine in genomic DNA

    OpenAIRE

    Szwagierczak, Aleksandra; Bultmann, Sebastian; Schmidt, Christine S.; Spada, Fabio; Leonhardt, Heinrich

    2010-01-01

    The recent discovery of genomic 5-hydroxymethylcytosine (hmC) and mutations affecting the respective Tet hydroxylases in leukemia raises fundamental questions about this epigenetic modification. We present a sensitive method for fast quantification of genomic hmC based on specific transfer of radiolabeled glucose to hmC by a purified glucosyltransferase. We determined hmC levels in various adult tissues and differentiating embryonic stem cells and show a correlation with differential expressi...

  13. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  14. Enhancing Targeted Genomic DNA Editing in Chicken Cells Using the CRISPR/Cas9 System

    Science.gov (United States)

    Wang, Ling; Yang, Likai; Guo, Yijie; Du, Weili; Yin, Yajun; Zhang, Tao; Lu, Hongzhao

    2017-01-01

    The CRISPR/Cas9 system has enabled highly efficient genome targeted editing for various organisms. However, few studies have focused on CRISPR/Cas9 nuclease-mediated chicken genome editing compared with mammalian genomes. The current study combined CRISPR with yeast Rad52 (yRad52) to enhance targeted genomic DNA editing in chicken DF-1 cells. The efficiency of CRISPR/Cas9 nuclease-induced targeted mutations in the chicken genome was increased to 41.9% via the enrichment of the dual-reporter surrogate system. In addition, the combined effect of CRISPR nuclease and yRad52 dramatically increased the efficiency of the targeted substitution in the myostatin gene using 50-mer oligodeoxynucleotides (ssODN) as the donor DNA, resulting in a 36.7% editing efficiency after puromycin selection. Furthermore, based on the effect of yRad52, the frequency of exogenous gene integration in the chicken genome was more than 3-fold higher than that without yRad52. Collectively, these results suggest that ssODN is an ideal donor DNA for targeted substitution and that CRISPR/Cas9 combined with yRad52 significantly enhances chicken genome editing. These findings could be extensively applied in other organisms. PMID:28068387

  15. FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

    Science.gov (United States)

    Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

    2017-01-01

    Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes.

  16. Study on the relationship between DNA-PKcs and genomic instability and hyper-radiosensitivity

    International Nuclear Information System (INIS)

    Yang Kang; Zhu Jiayun; Ding Nan; Li Junhong; Hu Wentao; Su Fengtao; He Jinpeng; Li Sha

    2010-01-01

    To investigate the relationship between DNA-PKcs and genome instability and hyper-radiosensitivity, human glioma cell lines M059K and M059J, as a model expressing wild-type DNA-PKcs and a model defective in DNA-PKcs activity, were exposed to low doses of X-rays. Cells survival fractions were assessed by colony-forming assay and Cytochalasin-B micronucleus assay was employed to detect the genomic instability happening in each single irradiated colony. It has been found that as the post-incubation time increased, M059K cells expressing wild-type DNA-PKcs exhibited low-dose hyper-radiosensitivity and showed a similar genomic instability after 0.2 Gy and 0.6 Gy irradiations, but the M059J cells lacking in DNA-PKcs didn't present low-dose hyper-radiosensitivity and showed a higher genomic instability of 0.6 Gy than that of 0.2 Gy. The results indicate that DNA-PKcs may act as one of the key factors that lead to low-dose hyper-radiosensitivity. (authors)

  17. Repair-mediated duplication by capture of proximal chromosomal DNA has shaped vertebrate genome evolution.

    Directory of Open Access Journals (Sweden)

    John K Pace

    2009-05-01

    Full Text Available DNA double-strand breaks (DSBs are a common form of cellular damage that can lead to cell death if not repaired promptly. Experimental systems have shown that DSB repair in eukaryotic cells is often imperfect and may result in the insertion of extra chromosomal DNA or the duplication of existing DNA at the breakpoint. These events are thought to be a source of genomic instability and human diseases, but it is unclear whether they have contributed significantly to genome evolution. Here we developed an innovative computational pipeline that takes advantage of the repetitive structure of genomes to detect repair-mediated duplication events (RDs that occurred in the germline and created insertions of at least 50 bp of genomic DNA. Using this pipeline we identified over 1,000 probable RDs in the human genome. Of these, 824 were intra-chromosomal, closely linked duplications of up to 619 bp bearing the hallmarks of the synthesis-dependent strand-annealing repair pathway. This mechanism has duplicated hundreds of sequences predicted to be functional in the human genome, including exons, UTRs, intron splice sites and transcription factor binding sites. Dating of the duplication events using comparative genomics and experimental validation revealed that the mechanism has operated continuously but with decreasing intensity throughout primate evolution. The mechanism has produced species-specific duplications in all primate species surveyed and is contributing to genomic variation among humans. Finally, we show that RDs have also occurred, albeit at a lower frequency, in non-primate mammals and other vertebrates, indicating that this mechanism has been an important force shaping vertebrate genome evolution.

  18. TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability

    DEFF Research Database (Denmark)

    Germann, Susanne M; Schramke, Vera; Pedersen, Rune Troelsgaard

    2014-01-01

    yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion......DNA anaphase bridges are a potential source of genome instability that may lead to chromosome breakage or nondisjunction during mitosis. Two classes of anaphase bridges can be distinguished: DAPI-positive chromatin bridges and DAPI-negative ultrafine DNA bridges (UFBs). Here, we establish budding...

  19. Genome Sizes in Hepatica Mill: (Ranunculaceae Show a Loss of DNA, Not a Gain, in Polyploids

    Directory of Open Access Journals (Sweden)

    B. J. M. Zonneveld

    2010-01-01

    , and a possible pentaploid. The somatic nuclear DNA contents (2C-value, as measured by flow cytometry with propidium iodide, were shown to range from 33 to 80 pg. The Asiatic and American species, often considered subspecies of H. nobilis, could be clearly distinguished from European H. nobilis. DNA content confirmed the close relationships in the Asiatic species, and these are here considered as subspecies of H. asiatica. Parents for the allotetraploid species could be suggested based on their nuclear DNA content. Contrary to the increase in genome size suggested earlier for Hepatica, a significant (6%–14% loss of nuclear DNA in the natural allopolyploids was found.

  20. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  1. DNA Data Bank of Japan at work on genome sequence data.

    Science.gov (United States)

    Tateno, Y; Fukami-Kobayashi, K; Miyazaki, S; Sugawara, H; Gojobori, T

    1998-01-01

    We at the DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp) have recently begun receiving, processing and releasing EST and genome sequence data submitted by various Japanese genome projects. The data include those for human, Arabidopsis thaliana, rice, nematode, Synechocystis sp. and Escherichia coli. Since the quantity of data is very large, we organized teams to conduct preliminary discussions with project teams about data submission and handling for release to the public. We also developed a mass submission tool to cope with a large quantity of data. In addition, to provide genome data on WWW, we developed a genome information system using Java. This system (http://mol.genes.nig.ac.jp/ecoli/) can in theory be used for any genome sequence data. These activities will facilitate processing of large quantities of EST and genome data.

  2. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  3. Metalloregulatory DNA-Binding Protein Encoded by the merR Gene: Isolation and Characterization

    Science.gov (United States)

    O'Halloran, Thomas; Walsh, Christopher

    1987-01-01

    The MerR protein mediates the induction of the mercury resistance phenotype in bacteria; it has been isolated in order to study the effects of metal-ion induced changes in the metabolism of prokaryotic cells at the molecular level. After DNA sequences responsible for negative autoregulation were removed, the 16-kilodalton protein was overproduced and purified to more than 90 percent homogeneity by a salt extraction procedure that yields about 5 milligrams of protein per gram of cells. Complementation data, amino terminal analysis, gel filtration, and deoxyribonuclease I protection studies demonstrate that the purified merR gene product is a dimer under nondenaturing conditions and that it binds specifically to DNA, in the presence and absence of mercury, at a palindromic site which is directly between the -10 and -35 regions of the structural genes and adjacent to its own promoter. These initial results indicate that MerR is a DNA-binding metalloregulatory protein that plays a central role in this heavy metal responsive system and they delineate an operator site in the mer operon.

  4. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......We have used available protein sequence data for the anaphylatoxin (C5a) portion of the fifth component of human complement (residues 19-25) to synthesize a mixed-sequence oligonucleotide probe. The labeled oligonucleotide was then used to screen a human liver cDNA library, and a single candidate cDNA...... obtained further predicted an arginine-rich sequence (RPRR) immediately upstream of the N-terminal threonine of C5a, indicating that the promolecule form of C5 is synthesized with a beta alpha-chain orientation as previously shown for pro-C3 and pro-C4. The C5 cDNA clone was sheared randomly by sonication...

  5. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Pongo abelii, Macaca fascicularis, Mus musculus, Bos taurus and Rattus norvegicus are 93.1, 92.5, 92.2, 91.1, 90.6 and 90.0% respectively. The amino acid sequence encoded by RPS20 ...

  6. Genomics DNA profiling in elite professional soccer players: a pilot study.

    Science.gov (United States)

    Kambouris, M; Del Buono, A; Maffulli, N

    2014-04-01

    Functional variants in exonic regions have been associated with development of cardiovascular disease, diabetes and cancer. Athletic performance can be considered a multi-factorial complex phenotype. Genomic DNA was extracted from buccal swabs of seven soccer players from the Fulham football team. Single nucleotide polymorphism (SNPs) genotyping was undertaken. To achieve optimal athletic performance, predictive genomics DNA profiling for sports performance can be used to aid in sport selection and elaboration of personalized training and nutrition programs. Predictive DNA profiling may be able to detect athletes with potential or frank injuries, or screening and selection of future athletes, and can help them to maximize utilization of their potential and improve performance in sports. The aim of this study is to provide a wide scenario of specific genomic variants that an athlete carries, to implement which measures should be taken to maximize the athlete's potential.

  7. Digital Droplet Multiple Displacement Amplification (ddMDA for Whole Genome Sequencing of Limited DNA Samples.

    Directory of Open Access Journals (Sweden)

    Minsoung Rhee

    Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.

  8. Extensive variation in the density and distribution of DNA polymorphism in sorghum genomes.

    Directory of Open Access Journals (Sweden)

    Joseph Evans

    Full Text Available Sorghum genotypes currently used for grain production in the United States were developed from African landraces that were imported starting in the mid-to-late 19(th century. Farmers and plant breeders selected genotypes for grain production with reduced plant height, early flowering, increased grain yield, adaptation to drought, and improved resistance to lodging, diseases and pests. DNA polymorphisms that distinguish three historically important grain sorghum genotypes, BTx623, BTx642 and Tx7000, were characterized by genome sequencing, genotyping by sequencing, genetic mapping, and pedigree-based haplotype analysis. The distribution and density of DNA polymorphisms in the sequenced genomes varied widely, in part because the lines were derived through breeding and selection from diverse Kafir, Durra, and Caudatum race accessions. Genomic DNA spanning dw1 (SBI-09 and dw3 (SBI-07 had identical haplotypes due to selection for reduced height. Lower SNP density in genes located in pericentromeric regions compared with genes located in euchromatic regions is consistent with background selection in these regions of low recombination. SNP density was higher in euchromatic DNA and varied >100-fold in contiguous intervals that spanned up to 300 Kbp. The localized variation in DNA polymorphism density occurred throughout euchromatic regions where recombination is elevated, however, polymorphism density was not correlated with gene density or DNA methylation. Overall, sorghum chromosomes contain distal euchromatic regions characterized by extensive, localized variation in DNA polymorphism density, and large pericentromeric regions of low gene density, diversity, and recombination.

  9. A Network of Multi-Tasking Proteins at the DNA Replication Fork Preserves Genome Stability.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available To elucidate the network that maintains high fidelity genome replication, we have introduced two conditional mutant alleles of DNA2, an essential DNA replication gene, into each of the approximately 4,700 viable yeast deletion mutants and determined the fitness of the double mutants. Fifty-six DNA2-interacting genes were identified. Clustering analysis of genomic synthetic lethality profiles of each of 43 of the DNA2-interacting genes defines a network (consisting of 322 genes and 876 interactions whose topology provides clues as to how replication proteins coordinate regulation and repair to protect genome integrity. The results also shed new light on the functions of the query gene DNA2, which, despite many years of study, remain controversial, especially its proposed role in Okazaki fragment processing and the nature of its in vivo substrates. Because of the multifunctional nature of virtually all proteins at the replication fork, the meaning of any single genetic interaction is inherently ambiguous. The multiplexing nature of the current studies, however, combined with follow-up supporting experiments, reveals most if not all of the unique pathways requiring Dna2p. These include not only Okazaki fragment processing and DNA repair but also chromatin dynamics.

  10. Genotyping performance assessment of whole genome amplified DNA with respect to multiplexing level of assay and its period of storage.

    Directory of Open Access Journals (Sweden)

    Daniel W H Ho

    Full Text Available Whole genome amplification can faithfully amplify genomic DNA (gDNA with minimal bias and substantial genome coverage. Whole genome amplified DNA (wgaDNA has been tested to be workable for high-throughput genotyping arrays. However, issues about whether wgaDNA would decrease genotyping performance at increasing multiplexing levels and whether the storage period of wgaDNA would reduce genotyping performance have not been examined. Using the Sequenom MassARRAY iPLEX Gold assays, we investigated 174 single nucleotide polymorphisms for 3 groups of matched samples: group 1 of 20 gDNA samples, group 2 of 20 freshly prepared wgaDNA samples, and group 3 of 20 stored wgaDNA samples that had been kept frozen at -70°C for 18 months. MassARRAY is a medium-throughput genotyping platform with reaction chemistry different from those of high-throughput genotyping arrays. The results showed that genotyping performance (efficiency and accuracy of freshly prepared wgaDNA was similar to that of gDNA at various multiplexing levels (17-plex, 21-plex, 28-plex and 36-plex of the MassARRAY assays. However, compared with gDNA or freshly prepared wgaDNA, stored wgaDNA was found to give diminished genotyping performance (efficiency and accuracy due to potentially inferior quality. Consequently, no matter whether gDNA or wgaDNA was used, better genotyping efficiency would tend to have better genotyping accuracy.

  11. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Genomes of rumen bacteria encode atypical pathways for fermenting hexoses to short-chain fatty acids.

    Science.gov (United States)

    Hackmann, Timothy J; Ngugi, David Kamanda; Firkins, Jeffrey L; Tao, Junyi

    2017-11-01

    Bacteria have been thought to follow only a few well-recognized biochemical pathways when fermenting glucose or other hexoses. These pathways have been chiseled in the stone of textbooks for decades, with most sources rendering them as they appear in the classic 1986 text by Gottschalk. Still, it is unclear how broadly these pathways apply, given that they were established and delineated biochemically with only a few model organisms. Here, we show that well-recognized pathways often cannot explain fermentation products formed by bacteria. In the most extensive analysis of its kind, we reconstructed pathways for glucose fermentation from genomes of 48 species and subspecies of bacteria from one environment (the rumen). In total, 44% of these bacteria had atypical pathways, including several that are completely unprecedented for bacteria or any organism. In detail, 8% of bacteria had an atypical pathway for acetate formation; 21% of bacteria had an atypical pathway for propionate or succinate formation; 6% of bacteria had an atypical pathway for butyrate formation and 33% of bacteria had an atypical or incomplete Embden-Meyerhof-Parnas pathway. This study shows that reconstruction of metabolic pathways - a common goal of omics studies - could be incorrect if well-recognized pathways are used for reference. Furthermore, it calls for renewed efforts to delineate fermentation pathways biochemically. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Genomes of rumen bacteria encode atypical pathways for fermenting hexoses to short-chain fatty acids

    KAUST Repository

    Hackmann, Timothy J.

    2017-09-11

    Bacteria have been thought to follow only a few well-recognized biochemical pathways when fermenting glucose or other hexoses. These pathways have been chiseled in the stone of textbooks for decades, with most sources rendering them as they appear in the classic 1986 text by Gottschalk. Still, it is unclear how broadly these pathways apply, given that they were established and delineated biochemically with only a few model organisms. Here we show that well-recognized pathways often cannot explain fermentation products formed by bacteria. In the most extensive analysis of its kind, we reconstructed pathways for glucose fermentation from genomes of 48 species and subspecies of bacteria from one environment (the rumen). In total, 44% of these bacteria had atypical pathways, including several that are completely unprecedented for bacteria or any organism. In detail, 8% of bacteria had an atypical pathway for acetate formation; 21% for propionate or succinate formation; 6% for butyrate formation; and 33% had an atypical or incomplete Embden-Meyerhof-Parnas pathway. This study shows that reconstruction of metabolic pathways-a common goal of omics studies-could be incorrect if well-recognized pathways are used for reference. Further, it calls for renewed efforts to delineate fermentation pathways biochemically. This article is protected by copyright. All rights reserved.

  14. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions......, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some......The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many...

  15. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  16. Isolation of a cDNA encoding a CHH-family peptide from the silkworm Bombyx mori.

    Science.gov (United States)

    Endo, H; Nagasawa, H; Watanabe, T

    2000-05-01

    The crustacean hyperglycemic hormone (CHH) peptide family includes four types of neuropeptide in decapod and isopod crustaceans, and the ion-transport peptide in orthopteran insects. To identify a new member of this family in Insecta, a PCR-based search for cDNAs encoding CHH-family peptides was carried out in the silkworm Bombyx mori. A cDNA, named BmCHHL (Bombyx mori CHH-like protein), with an open reading frame of 110 amino acids was isolated. Sequence analyses suggested that the conceptual protein was a precursor of a peptide of 72 amino acids which was amidated at the carboxy terminus. The BmCHHL sequence exhibited significant similarities to members of the CHH family including the orthopteran ion-transport peptide. BmCHHL expression was detected in five or six cells (per hemisphere) in the frontal area of the brain in day 4 fifth instar larvae.

  17. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  18. Brain metabolic DNA in memory processing and genome turnover.

    Science.gov (United States)

    Giuditta, Antonio; Grassi-Zucconi, Gigliola; Sadile, Adolfo G

    2017-01-01

    Sophisticated methods are currently used to investigate the properties of brain DNA and clarify its role under physiological conditions and in neurological and psychiatric disorders. Attention is now called on a DNA fraction present in the adult rat brain that is characterized by an elevated turnover and is not involved in cell division or DNA repair. The fraction, known as brain metabolic DNA (BMD), is modulated by strain, stress, circadian oscillations, exposure to enriched or impoverished environment, and notably by several training protocols and post-trial sleep. BMD is frequently localized in glial cells but is also present in neurons, often in the perinucleolar region. Its distribution in repetitive and non-repetitive DNA fractions shows that BMD differs from native DNA and that in learning rats its profile differs from that of control rats. More detailed knowledge of the molecular, cellular, and time-dependent BMD features will be necessary to define its role in memory acquisition and processing and in the pathogenesis of neurologic disorders.

  19. Optical Detection of Non-amplified Genomic DNA

    Science.gov (United States)

    Li, Di; Fan, Chunhai

    Nucleic acid sequences are unique to every living organisms including animals, plants and even bacteria and virus, which provide a practical molecular target for the identification and diagnosis of various diseases. DNA contains heterocyclic rings that has inherent optical absorbance at 260 nm, which is widely used to quantify single and double stranded DNA in biology. However, this simple quantification method could not differentiate sequences; therefore it is not suitable for sequence-specific analyte detection. In addition to a few exceptions such as chiral-related circular dichroism spectra, DNA hybridization does not produce significant changes in optical signals, thus an optical label is generally needed for sequence-specific DNA detection with optical means. During the last two decades, we have witnessed explosive progress in the area of optical DNA detection, especially with the help of simultaneously rapidly developed nanomaterials. In this chapter, we will summarize recent advances in optical DNA detection including colorimetric, fluorescent, luminescent, surface plasmon resonance (SPR) and Raman scattering assays. Challenges and problems remained to be addressed are also discussed.

  20. Blocking Blood Supply to Breast Carcinoma With a DNA Vaccine Encoding VEGF Receptor-2

    Science.gov (United States)

    2006-03-01

    vaccination: an update. Methods Mol Med 2003;87:377–90. 14. Ambrosini G, Adida C, Altieri DC. A novel anti- apoptosis gene, survivin, expressed in cancer...endothelial cells. Biochem Biophys Res Commun 1999;264:781–8. 26. O’Connor DS, Schechner JS, Adida C, et al. Control of apoptosis during angiogenesis by...minigene DNA vaccine protects mice from tumors of different origins by inducing a T cell-mediated suppression of tumor angiogenesis. From the Department of

  1. [Cloning and functional characterization of a cDNA encoding isopentenyl diphosphate isomerase involved in taxol biosynthesis in Taxus media].

    Science.gov (United States)

    Shen, Tian; Qiu, Fei; Chen, Min; Lan, Xiao-zhong; Liao, Zhi-hua

    2015-05-01

    Taxol is one of the most potent anti-cancer agents, which is extracted from the plants of Taxus species. Isopentenyl diphosphate isomerase (IPI) catalyzes the reversible transformation between IPP and DMAPP, both of which are the general 5-carbon precursors for taxol biosynthesis. In the present study, a new gene encoding IPI was cloned from Taxus media (namely TmIPI with the GenBank Accession Number KP970677) for the first time. The full-length cDNA of TmIPI was 1 232 bps encoding a polypeptide with 233 amino acids, in which the conserved domain Nudix was found. Bioinformatic analysis indicated that the sequence of TmIPI was highly similar to those of other plant IPI proteins, and the phylogenetic analysis showed that there were two clades of plant IPI proteins, including IPIs of angiosperm plants and IPIs of gymnosperm plants. TmIPI belonged to the clade of gymnosperm plant IPIs, and this was consistent with the fact that Taxus media is a plant species of gymnosperm. Southern blotting analysis demonstrated that there was a gene family of IPI in Taxus media. Finally, functional verification was applied to identify the function of TmIPI. The results showed that biosynthesis of β-carotenoid was enhanced by overexpressing TmIPI in the engineered E. coli strain, and this suggested that TmIPI might be a key gene involved in isoprenoid/terpenoid biosynthesis.

  2. Bacterial DNA sifted from the Trichoplax adhaerens (Animalia: Placozoa) genome project reveals a putative rickettsial endosymbiont.

    Science.gov (United States)

    Driscoll, Timothy; Gillespie, Joseph J; Nordberg, Eric K; Azad, Abdu F; Sobral, Bruno W

    2013-01-01

    Eukaryotic genome sequencing projects often yield bacterial DNA sequences, data typically considered as microbial contamination. However, these sequences may also indicate either symbiont genes or lateral gene transfer (LGT) to host genomes. These bacterial sequences can provide clues about eukaryote-microbe interactions. Here, we used the genome of the primitive animal Trichoplax adhaerens (Metazoa: Placozoa), which is known to harbor an uncharacterized Gram-negative endosymbiont, to search for the presence of bacterial DNA sequences. Bioinformatic and phylogenomic analyses of extracted data from the genome assembly (181 bacterial coding sequences [CDS]) and trace read archive (16S rDNA) revealed a dominant proteobacterial profile strongly skewed to Rickettsiales (Alphaproteobacteria) genomes. By way of phylogenetic analysis of 16S rDNA and 113 proteins conserved across proteobacterial genomes, as well as identification of 27 rickettsial signature genes, we propose a Rickettsiales endosymbiont of T. adhaerens (RETA). The majority (93%) of the identified bacterial CDS belongs to small scaffolds containing prokaryotic-like genes; however, 12 CDS were identified on large scaffolds comprised of eukaryotic-like genes, suggesting that T. adhaerens might have recently acquired bacterial genes. These putative LGTs may coincide with the placozoan's aquatic niche and symbiosis with RETA. This work underscores the rich, and relatively untapped, resource of eukaryotic genome projects for harboring data pertinent to host-microbial interactions. The nature of unknown (or poorly characterized) bacterial species may only emerge via analysis of host genome sequencing projects, particularly if these species are resistant to cell culturing, as are many obligate intracellular microbes. Our work provides methodological insight for such an approach.

  3. A versatile genome-scale PCR-based pipeline for high-definition DNA FISH.

    Science.gov (United States)

    Bienko, Magda; Crosetto, Nicola; Teytelman, Leonid; Klemm, Sandy; Itzkovitz, Shalev; van Oudenaarden, Alexander

    2013-02-01

    We developed a cost-effective genome-scale PCR-based method for high-definition DNA FISH (HD-FISH). We visualized gene loci with diffraction-limited resolution, chromosomes as spot clusters and single genes together with transcripts by combining HD-FISH with single-molecule RNA FISH. We provide a database of over 4.3 million primer pairs targeting the human and mouse genomes that is readily usable for rapid and flexible generation of probes.

  4. Origins of DNA Replication and Amplification in the Breast Cancer Genome

    Science.gov (United States)

    2013-09-01

    somatic mutations or other genomic changes. We wish to ask if a genomic change (genetic or epigenetic) might produce novel binding site(s) for the...bacteriophages, animal viruses , and unicellular eukaryotes studied thus far have high AT content, presumably to facilitate unwinding of the DNA. Task (3...have the GC skew, which is more consistent with the base composition of replication origins from bacteria, viruses and yeast.  Performed

  5. High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases

    DEFF Research Database (Denmark)

    Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping

    2011-01-01

    Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point...... mutation, (ii) targeted genomic deletion of up to 100 kb and (iii) targeted insertion of small genetic elements concomitant with large genomic deletions....

  6. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  7. Effects of X-ray irradiation on genomic DNA methylation levels in mouse tissues

    International Nuclear Information System (INIS)

    Tawa, Riichi; Sakurai, Hiromu; Kimura, Yutaka; Komura, Jun-ichiro; Miyamura, Yoshinori; Kurishita, Akihiro; Sasaki, Masao S.; Ono, Tetsuya

    1998-01-01

    Effects of ionizing radiation on the level of genomic DNA methylation in liver, brain and spleen of mouse as well as in two kinds of cultured cells were examined by high-performance liquid chromatography. Ten Gy of whole body X-radiation reduced the 5-methyldeoxycytidine contents by about 40% within 8 hours after irradiation in liver. Similar effects were observed at 4 or 7 Gy of X-ray irradiation. However, no such change was detected in brain, spleen and cultured cells. The data indicate that radiation-induced alteration in genomic DNA methylation is not ubiquitous among different tissues and cells. (author)

  8. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Rattus norvegicus are 93.1, 92.5, 92.2, 91.1, 90.6 and 90.0% respectively. The amino acid sequence encoded by RPS20 gene of the Giant Panda shared a high homology (100%) with those of H. sapiens,. Mac. fascicularis, Mus musculus, B. taurus and R. norvegicus, except for P. abelii (99.88%). Primary.

  9. Genomic signal processing methods for computation of alignment-free distances from DNA sequences.

    Science.gov (United States)

    Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro

    2014-01-01

    Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

  10. [Bacterial infections as seen from the eukaryotic genome: DNA double strand breaks, inflammation and cancer].

    Science.gov (United States)

    Lemercier, Claudie

    2014-01-01

    An increasing number of studies report that infection by pathogenic bacteria alters the host genome, producing highly hazardous DNA double strand breaks for the eukaryotic cell. Even when DNA repair occurs, it often leaves "scars" on chromosomes that might generate genomic instability at the next cell division. Chronic intestinal inflammation promotes the expansion of genotoxic bacteria in the intestinal microbiote which in turn triggers tumor formation and colon carcinomas. Bacteria act at the level of the host DNA repair machinery. They also highjack the host cell cycle to allow themselves time for replication in an appropriate reservoir. However, except in the case of bacteria carrying the CDT nuclease, the molecular mechanisms responsible for DNA lesions are not well understood, even if reactive oxygen species released during infection make good candidates. © 2014 médecine/sciences – Inserm.

  11. Detecting the somatic mutations spectrum of Chinese lung cancer by analyzing the whole mitochondrial DNA genomes.

    Science.gov (United States)

    Fang, Yu; Huang, Jie; Zhang, Jing; Wang, Jun; Qiao, Fei; Chen, Hua-Mei; Hong, Zhi-Peng

    2015-02-01

    To detect the somatic mutations and character its spectrum in Chinese lung cancer patients. In this study, we sequenced the whole mitochondrial DNA (mtDNA) genomes for 10 lung cancer patients including the primary cancerous, matched paracancerous normal and distant normal tissues. By analyzing the 30 whole mtDNA genomes, eight somatic mutations were identified from five patients investigated, which were confirmed with the cloning and sequencing of the somatic mutations. Five of the somatic mutations were detected among control region and the rests were found at the coding region. Heterogeneity was the main character of the somatic mutations in Chinese lung cancer patients. Further potential disease-related screening showed that, except the C deletion at position 309 showed AD-weakly associated, most of them were not disease-related. Although the role of aforementioned somatic mutations was unknown, however, considering the relative higher frequency of somatic mutations among the whole mtDNA genomes, it hints that detecting the somatic mutation(s) from the whole mtDNA genomes can serve as a useful tool for the Chinese lung cancer diagnostic to some extent.

  12. A Legionella pneumophila effector protein encoded in a region of genomic plasticity binds to Dot/Icm-modified vacuoles.

    Directory of Open Access Journals (Sweden)

    Shira Ninio

    2009-01-01

    Full Text Available Legionella pneumophila is an opportunistic pathogen that can cause a severe pneumonia called Legionnaires' disease. In the environment, L. pneumophila is found in fresh water reservoirs in a large spectrum of environmental conditions, where the bacteria are able to replicate within a variety of protozoan hosts. To survive within eukaryotic cells, L. pneumophila require a type IV secretion system, designated Dot/Icm, that delivers bacterial effector proteins into the host cell cytoplasm. In recent years, a number of Dot/Icm substrate proteins have been identified; however, the function of most of these proteins remains unknown, and it is unclear why the bacterium maintains such a large repertoire of effectors to promote its survival. Here we investigate a region of the L. pneumophila chromosome that displays a high degree of plasticity among four sequenced L. pneumophila strains. Analysis of GC content suggests that several genes encoded in this region were acquired through horizontal gene transfer. Protein translocation studies establish that this region of genomic plasticity encodes for multiple Dot/Icm effectors. Ectopic expression studies in mammalian cells indicate that one of these substrates, a protein called PieA, has unique effector activities. PieA is an effector that can alter lysosome morphology and associates specifically with vacuoles that support L. pneumophila replication. It was determined that the association of PieA with vacuoles containing L. pneumophila requires modifications to the vacuole mediated by other Dot/Icm effectors. Thus, the localization properties of PieA reveal that the Dot/Icm system has the ability to spatially and temporally control the association of an effector with vacuoles containing L. pneumophila through activities mediated by other effector proteins.

  13. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific ge