WorldWideScience

Sample records for genomes phylogenetic relationships

  1. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  2. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  3. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  4. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  5. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  6. Phylogenetic Relationships of the Fern Cyrtomium falcatum (Dryopteridaceae from Dokdo Island Based on Chloroplast Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Gurusamy Raman

    2016-12-01

    Full Text Available Cyrtomium falcatum is a popular ornamental fern cultivated worldwide. Native to the Korean Peninsula, Japan, and Dokdo Island in the Sea of Japan, it is the only fern present on Dokdo Island. We isolated and characterized the chloroplast (cp genome of C. falcatum, and compared it with those of closely related species. The genes trnV-GAC and trnV-GAU were found to be present within the cp genome of C. falcatum, whereas trnP-GGG and rpl21 were lacking. Moreover, cp genomes of Cyrtomium devexiscapulae and Adiantum capillus-veneris lack trnP-GGG and rpl21, suggesting these are not conserved among angiosperm cp genomes. The deletion of trnR-UCG, trnR-CCG, and trnSeC in the cp genomes of C. falcatum and other eupolypod ferns indicates these genes are restricted to tree ferns, non-core leptosporangiates, and basal ferns. The C. falcatum cp genome also encoded ndhF and rps7, with GUG start codons that were only conserved in polypod ferns, and it shares two significant inversions with other ferns, including a minor inversion of the trnD-GUC region and an approximate 3 kb inversion of the trnG-trnT region. Phylogenetic analyses showed that Equisetum was found to be a sister clade to Psilotales-Ophioglossales with a 100% bootstrap (BS value. The sister relationship between Pteridaceae and eupolypods was also strongly supported by a 100% BS, but Bayesian molecular clock analyses suggested that C. falcatum diversified in the mid-Paleogene period (45.15 ± 4.93 million years ago and might have moved from Eurasia to Dokdo Island.

  7. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  8. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  9. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  10. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  11. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  12. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  13. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  14. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  15. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  16. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  17. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  18. Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

    Science.gov (United States)

    Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

    2017-12-01

    The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

  19. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  20. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  1. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  2. A 400,000-year-old mitochondrial genome questions phylogenetic relationships amongst archaic hominins

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre

    2014-01-01

    By combining state-of-the-art approaches in ancient genomics, Meyer and co-workers have reconstructed the mitochondrial sequence of an archaic hominin that lived at Sierra de Atapuerca, Spain about 400,000 years ago. This achievement follows recent advances in molecular anthropology that delivere...

  3. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  4. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    The human gut is extremely densely inhabited by bacteria mainly from two phyla, Bacteroidetes and Firmicutes, and there is a great interest in analyzing whole-genome sequences for these species because of their relation to human health and disease. Here, we do whole-genome comparison of 105...... of extracytoplasmic function σ factors (ECF σ factors) and two component systems for extracellular signal transduction compared to other Bacteroidetes/Chlorobi species. A whole-genome phylogenetic analysis shows a very little difference between the Parabacteroides and Bacteroides genera. Further analysis shows...... of members of the Bacteroidetes/Chlorobi phylum by whole genome comparison. Gut living Bacteroides have an enriched set of glycan, vitamin, and cofactor enzymes important for diet digestion....

  5. Mitochondrial genomes of Meloidogyne chitwoodi and M. incognita (Nematoda: Tylenchina): comparative analysis, gene order and phylogenetic relationships with other nematodes.

    Science.gov (United States)

    Humphreys-Pereira, Danny A; Elling, Axel A

    2014-01-01

    Root-knot nematodes (Meloidogyne spp.) are among the most important plant pathogens. In this study, the mitochondrial (mt) genomes of the root-knot nematodes, M. chitwoodi and M. incognita were sequenced. PCR analyses suggest that both mt genomes are circular, with an estimated size of 19.7 and 18.6-19.1kb, respectively. The mt genomes each contain a large non-coding region with tandem repeats and the control region. The mt gene arrangement of M. chitwoodi and M. incognita is unlike that of other nematodes. Sequence alignments of the two Meloidogyne mt genomes showed three translocations; two in transfer RNAs and one in cox2. Compared with other nematode mt genomes, the gene arrangement of M. chitwoodi and M. incognita was most similar to Pratylenchus vulnus. Phylogenetic analyses (Maximum Likelihood and Bayesian inference) were conducted using 78 complete mt genomes of diverse nematode species. Analyses based on nucleotides and amino acids of the 12 protein-coding mt genes showed strong support for the monophyly of class Chromadorea, but only amino acid-based analyses supported the monophyly of class Enoplea. The suborder Spirurina was not monophyletic in any of the phylogenetic analyses, contradicting the Clade III model, which groups Ascaridomorpha, Spiruromorpha and Oxyuridomorpha based on the small subunit ribosomal RNA gene. Importantly, comparisons of mt gene arrangement and tree-based methods placed Meloidogyne as sister taxa of Pratylenchus, a migratory plant endoparasitic nematode, and not with the sedentary endoparasitic Heterodera. Thus, comparative analyses of mt genomes suggest that sedentary endoparasitism in Meloidogyne and Heterodera is based on convergent evolution. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate.

    Science.gov (United States)

    Bracho, Maria Alma; Carrillo-Cruz, Francy Yolima; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    Hepatitis C virus (HCV) is the leading cause of chronic liver disease and is associated with hepatocellular carcinoma. However, there have been few studies on the distribution and genetic diversity of HCV isolates in non-developed countries. Here, the complete genome sequence of an HCV genotype 1 isolate from Equatorial Guinea is reported, the first complete HCV-1 genome of African origin. Phylogenetic analysis revealed that this sequence always grouped with sequences of genotype 1, but did not group clearly with any subtype described so far. An analysis of partial NS5B gene sequences with additional sequences of African origin also failed to find close similarities between the new sequence and any previously known isolate. Genetic divergence of the coding region of this new sequence with respect to the recognized subtypes of HCV-1 ranged from 20 to 22%. It is proposed that this isolate is a representative of a new, distinct variant of HCV subtype 1.

  7. Analysis of Comparative Sequence and Genomic Data to Verify Phylogenetic Relationship and Explore a New Subfamily of Bacterial Lipases.

    Directory of Open Access Journals (Sweden)

    Malihe Masomian

    Full Text Available Thermostable and organic solvent-tolerant enzymes have significant potential in a wide range of synthetic reactions in industry due to their inherent stability at high temperatures and their ability to endure harsh organic solvents. In this study, a novel gene encoding a true lipase was isolated by construction of a genomic DNA library of thermophilic Aneurinibacillus thermoaerophilus strain HZ into Escherichia coli plasmid vector. Sequence analysis revealed that HZ lipase had 62% identity to putative lipase from Bacillus pseudomycoides. The closely characterized lipases to the HZ lipase gene are from thermostable Bacillus and Geobacillus lipases belonging to the subfamily I.5 with ≤ 57% identity. The amino acid sequence analysis of HZ lipase determined a conserved pentapeptide containing the active serine, GHSMG and a Ca(2+-binding motif, GCYGSD in the enzyme. Protein structure modeling showed that HZ lipase consisted of an α/β hydrolase fold and a lid domain. Protein sequence alignment, conserved regions analysis, clustal distance matrix and amino acid composition illustrated differences between HZ lipase and other thermostable lipases. Phylogenetic analysis revealed that this lipase represented a new subfamily of family I of bacterial true lipases, classified as family I.9. The HZ lipase was expressed under promoter Plac using IPTG and was characterized. The recombinant enzyme showed optimal activity at 65 °C and retained ≥ 97% activity after incubation at 50 °C for 1h. The HZ lipase was stable in various polar and non-polar organic solvents.

  8. The phylogenetic relationships of insectivores with special reference to the lesser hedgehog tenrec as inferred from the complete sequence of their mitochondrial genome.

    Science.gov (United States)

    Nikaido, Masato; Cao, Ying; Okada, Norihiro; Hasegawa, Masami

    2003-02-01

    The complete mitochondrial genome of a lesser hedgehog tenrec Echinops telfairi was determined in this study. It is an endemic African insectivore that is found specifically in Madagascar. The tenrec's back is covered with hedgehog-like spines. Unlike other spiny mammals, such as spiny mice, spiny rats, spiny dormice and porcupines, lesser hedgehog tenrecs look amazingly like true hedgehogs (Erinaceidae). However, they are distinguished morphologically from hedgehogs by the absence of a jugal bone. We determined the complete sequence of the mitochondrial genome of a lesser hedgehog tenrec and analyzed the results phylogenetically to determine the relationships between the tenrec and other insectivores (moles, shrews and hedgehogs), as well as the relationships between the tenrec and endemic African mammals, classified as Afrotheria, that have recently been shown by molecular analysis to be close relatives of the tenrec. Our data confirmed the afrotherian status of the tenrec, and no direct relation was recovered between the tenrec and the hedgehog. Comparing our data with those of others, we found that within-species variations in the mitochondrial DNA of lesser hedgehog tenrecs appear to be the largest recognized to date among mammals, apart from orangutans, which might be interesting from the view point of evolutionary history of tenrecs on Madagascar.

  9. Genomic repeat abundances contain phylogenetic signal

    Czech Academy of Sciences Publication Activity Database

    Dodsworth, S.; Chase, M.W.; Kelly, L.J.; Leitch, I.J.; Macas, Jiří; Novák, Petr; Piednoël, M.; Weiß-Schneeweiss, H.; Leitch, A.R.

    2015-01-01

    Roč. 64, č. 1 (2015), s. 112-126 ISSN 1063-5157 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Repetitive DNA * continuous characters * genomics * next-generation sequencing * phylogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.225, year: 2015

  10. A Distance Measure for Genome Phylogenetic Analysis

    Science.gov (United States)

    Cao, Minh Duc; Allison, Lloyd; Dix, Trevor

    Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.

  11. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

    Science.gov (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

    2013-10-10

    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  12. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  13. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  14. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  15. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  16. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  17. Complete genome sequences of three tomato spotted wilt virus isolates from tomato and pepper plants in Korea and their phylogenetic relationship to other TSWV isolates.

    Science.gov (United States)

    Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung

    2011-04-01

    Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.

  18. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    VNTR numbers that occurred over the course of one year. Conclusions The comparative genomic analysis of the SAG clarifies the phylogenetics of these bacteria and supports the distinct species classification. Numerous potential virulence determinants were identified and provide a foundation for further studies into SAG pathogenesis. Furthermore, the data may be used to enable the development of rapid diagnostic assays and therapeutics for these pathogens. PMID:24341328

  19. Utilization of complete chloroplast genomes for phylogenetic studies

    NARCIS (Netherlands)

    Ramlee, Shairul Izan Binti

    2016-01-01

    Chloroplast DNA sequence polymorphisms are a primary source of data in many plant phylogenetic studies. The chloroplast genome is relatively conserved in its evolution making it an ideal molecule to retain phylogenetic signals. The chloroplast genome is also largely, but not completely, free from

  20. Analysis of Acorus calamus chloroplast genome and its phylogenetic implications.

    Science.gov (United States)

    Goremykin, Vadim V; Holland, Barbara; Hirsch-Ernst, Karen I; Hellwig, Frank H

    2005-09-01

    Determining the phylogenetic relationships among the major lines of angiosperms is a long-standing problem, yet the uncertainty as to the phylogenetic affinity of these lines persists. While a number of studies have suggested that the ANITA (Amborella-Nymphaeales-Illiciales-Trimeniales-Aristolochiales) grade is basal within angiosperms, studies of complete chloroplast genome sequences also suggested an alternative tree, wherein the line leading to the grasses branches first among the angiosperms. To improve taxon sampling in the existing chloroplast genome data, we sequenced the chloroplast genome of the monocot Acorus calamus. We generated a concatenated alignment (89,436 positions for 15 taxa), encompassing almost all sequences usable for phylogeny reconstruction within spermatophytes. The data still contain support for both the ANITA-basal and grasses-basal hypotheses. Using simulations we can show that were the ANITA-basal hypothesis true, parsimony (and distance-based methods with many models) would be expected to fail to recover it. The self-evident explanation for this failure appears to be a long-branch attraction (LBA) between the clade of grasses and the out-group. However, this LBA cannot explain the discrepancies observed between tree topology recovered using the maximum likelihood (ML) method and the topologies recovered using the parsimony and distance-based methods when grasses are deleted. Furthermore, the fact that neither maximum parsimony nor distance methods consistently recover the ML tree, when according to the simulations they would be expected to, when the out-group (Pinus) is deleted, suggests that either the generating tree is not correct or the best symmetric model is misspecified (or both). We demonstrate that the tree recovered under ML is extremely sensitive to model specification and that the best symmetric model is misspecified. Hence, we remain agnostic regarding phylogenetic relationships among basal angiosperm lineages.

  1. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  2. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  3. Phylogenetic tree based on complete genomes using fractal and correlation analyses without sequence alignment

    Directory of Open Access Journals (Sweden)

    Zu-Guo Yu

    2006-06-01

    Full Text Available The complete genomes of living organisms have provided much information on their phylogenetic relationships. Similarly, the complete genomes of chloroplasts have helped resolve the evolution of this organelle in photosynthetic eukaryotes. In this review, we describe two algorithms to construct phylogenetic trees based on the theories of fractals and dynamic language using complete genomes. These algorithms were developed by our research group in the past few years. Our distance-based phylogenetic tree of 109 prokaryotes and eukaryotes agrees with the biologists' "tree of life" based on the 16S-like rRNA genes in a majority of basic branchings and most lower taxa. Our phylogenetic analysis also shows that the chloroplast genomes are separated into two major clades corresponding to chlorophytes s.l. and rhodophytes s.l. The interrelationships among the chloroplasts are largely in agreement with the current understanding on chloroplast evolution.

  4. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  5. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  6. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  7. Bacterial phylogenetic reconstruction from whole genomes is robust to recombination but demographic inference is not.

    Science.gov (United States)

    Hedge, Jessica; Wilson, Daniel J

    2014-11-25

    Phylogenetic inference in bacterial genomics is fundamental to understanding problems such as population history, antimicrobial resistance, and transmission dynamics. The field has been plagued by an apparent state of contradiction since the distorting effects of recombination on phylogeny were discovered more than a decade ago. Researchers persist with detailed phylogenetic analyses while simultaneously acknowledging that recombination seriously misleads inference of population dynamics and selection. Here we resolve this paradox by showing that phylogenetic tree topologies based on whole genomes robustly reconstruct the clonal frame topology but that branch lengths are badly skewed. Surprisingly, removing recombining sites can exacerbate branch length distortion caused by recombination. Phylogenetic tree reconstruction is a popular approach for understanding the relatedness of bacteria in a population from differences in their genome sequences. However, bacteria frequently exchange regions of their genomes by a process called homologous recombination, which violates a fundamental assumption of phylogenetic methods. Since many researchers continue to use phylogenetics for recombining bacteria, it is important to understand how recombination affects the conclusions drawn from these analyses. We find that whole-genome sequences afford great accuracy in reconstructing evolutionary relationships despite concerns surrounding the presence of recombination, but the branch lengths of the phylogenetic tree are indeed badly distorted. Surprisingly, methods to reduce the impact of recombination on branch lengths can exacerbate the problem. Copyright © 2014 Hedge and Wilson.

  8. The Complete Chloroplast Genome Sequences of Five Epimedium Species: Lights into Phylogenetic and Taxonomic Analyses

    Science.gov (United States)

    Zhang, Yanjun; Du, Liuwen; Liu, Ao; Chen, Jianjun; Wu, Li; Hu, Weiming; Zhang, Wei; Kim, Kyunghee; Lee, Sang-Choon; Yang, Tae-Jin; Wang, Ying

    2016-01-01

    Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp) genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR) region and the single-copy (SC) boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR) and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants. PMID:27014326

  9. The complete chloroplast genome sequences of five Epimedium species: lights into phylogenetic and taxonomic analyses

    Directory of Open Access Journals (Sweden)

    Yanjun eZhang

    2016-03-01

    Full Text Available Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR region and the single-copy (SC boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants.

  10. Phylogenetic distribution of large-scale genome patchiness

    Directory of Open Access Journals (Sweden)

    Hackenberg Michael

    2008-04-01

    Full Text Available Abstract Background The phylogenetic distribution of large-scale genome structure (i.e. mosaic compositional patchiness has been explored mainly by analytical ultracentrifugation of bulk DNA. However, with the availability of large, good-quality chromosome sequences, and the recently developed computational methods to directly analyze patchiness on the genome sequence, an evolutionary comparative analysis can be carried out at the sequence level. Results The local variations in the scaling exponent of the Detrended Fluctuation Analysis are used here to analyze large-scale genome structure and directly uncover the characteristic scales present in genome sequences. Furthermore, through shuffling experiments of selected genome regions, computationally-identified, isochore-like regions were identified as the biological source for the uncovered large-scale genome structure. The phylogenetic distribution of short- and large-scale patchiness was determined in the best-sequenced genome assemblies from eleven eukaryotic genomes: mammals (Homo sapiens, Pan troglodytes, Mus musculus, Rattus norvegicus, and Canis familiaris, birds (Gallus gallus, fishes (Danio rerio, invertebrates (Drosophila melanogaster and Caenorhabditis elegans, plants (Arabidopsis thaliana and yeasts (Saccharomyces cerevisiae. We found large-scale patchiness of genome structure, associated with in silico determined, isochore-like regions, throughout this wide phylogenetic range. Conclusion Large-scale genome structure is detected by directly analyzing DNA sequences in a wide range of eukaryotic chromosome sequences, from human to yeast. In all these genomes, large-scale patchiness can be associated with the isochore-like regions, as directly detected in silico at the sequence level.

  11. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  12. The Complete Mitochondrial Genome of the Longhorn Beetle Dorysthenes paradoxus (Coleoptera: Cerambycidae: Prionini) and the Implication for the Phylogenetic Relationships of the Cerambycidae Species

    Science.gov (United States)

    Chen, Dong-Bin; Liu, Huan-Huan; Hu, Hua-Lei; Bian, Hai-Xu; Zhang, Ru-Song; Yang, Rui-Sheng; Jiang, Xing-Fu; Shi, Sheng-Lin

    2018-01-01

    Abstract The longhorn beetle Dorysthenes paradoxus (Faldermann, 1833) (Coleoptera: Cerambycidae) is not only a serious agricultural pest but also a traditionally edible insect in China. However, no genetic information on this species has been acquired. In the present study, we report the mitochondrial genome (mitogenome) of Do. paradoxus, as the first complete mitogenome of Prioninae. The circular mitogenome of 15,922 bp encodes 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), and two ribosomal RNAs (rRNAs), and it contains an A+T-rich region. This mitogenome exhibits the lowest A+T content (71.13%) but harbors the largest AT skew (0.116) among the completely sequenced Cerambycidae species. Eleven of the 13 PCGs have a typical ATN start codon, whereas COI and ND1 are tentatively designated by AAT and TTG, respectively. Only 4 of the 13 PCGs harbor a complete termination codon, and the remaining 9 possess incomplete termination codons (T or TA). Apart from tRNASer(AGN), the other 21 tRNAs can fold into a typical clover-leaf secondary structures. The Do. paradoxus A+T-rich region contains two poly-T stretches and a tandem repeat that comprises two 47-bp-long copies. Both Bayesian inference and Maximum likelihood analyses confirmed the subfamily ranks of Cerambycidae ([Prioninae + Cerambycinae] + Lamiinae) and the close relationship between Philinae and Prioninae/Cerambycinae. However, the data did not support the monophyly of Prioninae and Cerambycinae. The mitogenome presented here provides basic genetic information for this economically important species. PMID:29718483

  13. Hal: an automated pipeline for phylogenetic analyses of genomic data.

    Science.gov (United States)

    Robbertse, Barbara; Yoder, Ryan J; Boyd, Alex; Reeves, John; Spatafora, Joseph W

    2011-02-07

    The rapid increase in genomic and genome-scale data is resulting in unprecedented levels of discrete sequence data available for phylogenetic analyses. Major analytical impasses exist, however, prior to analyzing these data with existing phylogenetic software. Obstacles include the management of large data sets without standardized naming conventions, identification and filtering of orthologous clusters of proteins or genes, and the assembly of alignments of orthologous sequence data into individual and concatenated super alignments. Here we report the production of an automated pipeline, Hal that produces multiple alignments and trees from genomic data. These alignments can be produced by a choice of four alignment programs and analyzed by a variety of phylogenetic programs. In short, the Hal pipeline connects the programs BLASTP, MCL, user specified alignment programs, GBlocks, ProtTest and user specified phylogenetic programs to produce species trees. The script is available at sourceforge (http://sourceforge.net/projects/bio-hal/). The results from an example analysis of Kingdom Fungi are briefly discussed.

  14. Resolution of the enigmatic phylogenetic relationship of the critically endangered Western Swamp Tortoise Pseudemydura umbrina (Pleurodira: Chelidae) using a complete mitochondrial genome.

    Science.gov (United States)

    Zhang, Xiuwen; Unmack, Peter J; Kuchling, Gerald; Wang, Yinan; Georges, Arthur

    2017-10-01

    Pseudemydura umbrina is one of the most endangered turtle species in the world, and the imperative for its conservation is its distinctive morphology and relict status among the Chelidae. We use Illumina sequencing to obtain the complete mitogenome for resolving its uncertain phylogenetic position. A novel nuclear paralogue confounded the assembly, and resolution of the authentic mitogenome required further Sanger sequencing. The P. umbrina mitogenome is 16,414bp comprising 37 genes organized in a conserved pattern for other vertebrates. The nuclear paralogue is 547bp, 97.8% identity to the corresponding mitochondrial sequence. Particular features of the mitogenome include an nd3 174+1A frameshift, loss of DHC loop in tRNA Ser (AGN), and a light-strand replication initiation site in Wancy region that extends into an adjacent tRNA gene. Phylogenetic analysis showed that P. umbrina is the monotypic sister lineage to the remaining Australasian Chelidae, a lineage probably dating back to the Cretaceous. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Rong Li

    Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.

  16. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  17. Estimating phylogenetic trees from genome-scale data.

    Science.gov (United States)

    Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V

    2015-12-01

    The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.

  18. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  19. Beyond Linear Sequence Comparisons: The use of genome-levelcharacters for phylogenetic reconstruction

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2004-11-27

    Although the phylogenetic relationships of many organisms have been convincingly resolved by the comparisons of nucleotide or amino acid sequences, others have remained equivocal despite great effort. Now that large-scale genome sequencing projects are sampling many lineages, it is becoming feasible to compare large data sets of genome-level features and to develop this as a tool for phylogenetic reconstruction that has advantages over conventional sequence comparisons. Although it is unlikely that these will address a large number of evolutionary branch points across the broad tree of life due to the infeasibility of such sampling, they have great potential for convincingly resolving many critical, contested relationships for which no other data seems promising. However, it is important that we recognize potential pitfalls, establish reasonable standards for acceptance, and employ rigorous methodology to guard against a return to earlier days of scenario-driven evolutionary reconstructions.

  20. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  1. Comparative analyses of the complete mitochondrial genomes of Dosinia clams and their phylogenetic position within Veneridae.

    Science.gov (United States)

    Lv, Changda; Li, Qi; Kong, Lingfeng

    2018-01-01

    Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.

  2. Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses.

    Science.gov (United States)

    Bracho, Maria A; Saludes, Verónica; Martró, Elisa; Bargalló, Ana; González-Candelas, Fernando; Ausina, Vicent

    2008-06-05

    Hepatitis C virus isolates have been classified into six main genotypes and a variable number of subtypes within each genotype, mainly based on phylogenetic analysis. Analyses of the genetic relationship among genotypes and subtypes are more reliable when complete genome sequences (or at least the full coding region) are used; however, so far 31 of 80 confirmed or proposed subtypes have at least one complete genome available. Of these, 20 correspond to confirmed subtypes of epidemic interest. We present and analyse the first complete genome sequence of a HCV subtype 1g isolate. Phylogenetic and genetic distance analyses reveal that HCV-1g is the most divergent subtype among the HCV-1 confirmed subtypes. Potential genomic recombination events between genotypes or subtype 1 genomes were ruled out. We demonstrate phylogenetic congruence of previously deposited partial sequences of HCV-1g with respect to our sequence. In light of this, we propose changing the current status of its subtype-specific designation from provisional to confirmed.

  3. Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses

    Directory of Open Access Journals (Sweden)

    Bargalló Ana

    2008-06-01

    Full Text Available Abstract Background Hepatitis C virus isolates have been classified into six main genotypes and a variable number of subtypes within each genotype, mainly based on phylogenetic analysis. Analyses of the genetic relationship among genotypes and subtypes are more reliable when complete genome sequences (or at least the full coding region are used; however, so far 31 of 80 confirmed or proposed subtypes have at least one complete genome available. Of these, 20 correspond to confirmed subtypes of epidemic interest. Results We present and analyse the first complete genome sequence of a HCV subtype 1g isolate. Phylogenetic and genetic distance analyses reveal that HCV-1g is the most divergent subtype among the HCV-1 confirmed subtypes. Potential genomic recombination events between genotypes or subtype 1 genomes were ruled out. We demonstrate phylogenetic congruence of previously deposited partial sequences of HCV-1g with respect to our sequence. Conclusion In light of this, we propose changing the current status of its subtype-specific designation from provisional to confirmed.

  4. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  5. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  6. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Cronn Richard

    2009-12-01

    Full Text Available Abstract Background Molecular evolutionary studies share the common goal of elucidating historical relationships, and the common challenge of adequately sampling taxa and characters. Particularly at low taxonomic levels, recent divergence, rapid radiations, and conservative genome evolution yield limited sequence variation, and dense taxon sampling is often desirable. Recent advances in massively parallel sequencing make it possible to rapidly obtain large amounts of sequence data, and multiplexing makes extensive sampling of megabase sequences feasible. Is it possible to efficiently apply massively parallel sequencing to increase phylogenetic resolution at low taxonomic levels? Results We reconstruct the infrageneric phylogeny of Pinus from 37 nearly-complete chloroplast genomes (average 109 kilobases each of an approximately 120 kilobase genome generated using multiplexed massively parallel sequencing. 30/33 ingroup nodes resolved with ≥ 95% bootstrap support; this is a substantial improvement relative to prior studies, and shows massively parallel sequencing-based strategies can produce sufficient high quality sequence to reach support levels originally proposed for the phylogenetic bootstrap. Resampling simulations show that at least the entire plastome is necessary to fully resolve Pinus, particularly in rapidly radiating clades. Meta-analysis of 99 published infrageneric phylogenies shows that whole plastome analysis should provide similar gains across a range of plant genera. A disproportionate amount of phylogenetic information resides in two loci (ycf1, ycf2, highlighting their unusual evolutionary properties. Conclusion Plastome sequencing is now an efficient option for increasing phylogenetic resolution at lower taxonomic levels in plant phylogenetic and population genetic analyses. With continuing improvements in sequencing capacity, the strategies herein should revolutionize efforts requiring dense taxon and character sampling

  7. The complete mitochondrial genome of Somanniathelphusa boyangensis and phylogenetic analysis of Genus Somanniathelphusa (Crustacea: Decapoda: Parathelphusidae.

    Directory of Open Access Journals (Sweden)

    Xin-Nan Jia

    Full Text Available In this study, the authors first obtained the mitochondrial genome of Somanniathelphusa boyangensis. The results showed that the mitochondrial genome is 17,032bp in length, included 13 protein-coding genes, 2 rRNAs genes, 22 tRNAs genes and 1 putative control region, and it has the characteristics of the metazoan mitochondrial genome A+T bias. All tRNA genes display the typical clover-leaf secondary structure except tRNASer(AGN, which has lost the dihydroxyuridine arm. The GenBank database contains the mitochondrial genomes of representatives of approximately 22 families of Brachyura, comprising 56 species, including 4 species of freshwater crab. The authors established the phylogenetic relationships using the maximum likelihood and Bayesian inference methods. The phylogenetic relationship indicated that the molecular taxonomy of S. boyangensis is consistent with current morphological classification, and Parathelphusidae and Potamidae are derived within the freshwater clade or as part of it. In addition, the authors used the COX1 sequence of Somanniathelphusa in GenBank and the COX1 sequence of S. boyangensis to estimated the divergence time of this genus. The result displayed that the divergence time of Somanniathelphusa qiongshanensis is consistent with the separation of Hainan Island from mainland China in the Beibu Gulf, and the divergence time for Somanniathelphusa taiwanensis and Somanniathelphusa amoyensis is consistent with the separation of Taiwan Province from Mainland China at Fujian Province. These data indicate that geologic events influenced speciation of the genus Somanniathelphusa.

  8. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers.

    Science.gov (United States)

    Pan, Ting Shuang; Nie, Pin

    2013-07-01

    Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.

  9. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  10. Comparative analysis of mitochondrial genomes of five aphid species (Hemiptera: Aphididae and phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    Full Text Available Insect mitochondrial genomes (mitogenomes are of great interest in exploring molecular evolution, phylogenetics and population genetics. Only two mitogenomes have been previously released in the insect group Aphididae, which consists of about 5,000 known species including some agricultural, forestry and horticultural pests. Here we report the complete 16,317 bp mitogenome of Cavariella salicicola and two nearly complete mitogenomes of Aphis glycines and Pterocomma pilosum. We also present a first comparative analysis of mitochondrial genomes of aphids. Results showed that aphid mitogenomes share conserved genomic organization, nucleotide and amino acid composition, and codon usage features. All 37 genes usually present in animal mitogenomes were sequenced and annotated. The analysis of gene evolutionary rate revealed the lowest and highest rates for COI and ATP8, respectively. A unique repeat region exclusively in aphid mitogenomes, which included variable numbers of tandem repeats in a lineage-specific manner, was highlighted for the first time. This region may have a function as another origin of replication. Phylogenetic reconstructions based on protein-coding genes and the stem-loop structures of control regions confirmed a sister relationship between Cavariella and pterocommatines. Current evidence suggest that pterocommatines could be formally transferred into Macrosiphini. Our paper also offers methodological instructions for obtaining other Aphididae mitochondrial genomes.

  11. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  12. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  13. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae).

    Science.gov (United States)

    Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L

    2012-12-15

    Members of the Calliphoridae (blowflies) are significant for medical and veterinary management, due to the ability of some species to consume living flesh as larvae, and for forensic investigations due to the ability of others to develop in corpses. Due to the difficulty of accurately identifying larval blowflies to species there is a need for DNA-based diagnostics for this family, however the widely used DNA-barcoding marker, cox1, has been shown to fail for several groups within this family. Additionally, many phylogenetic relationships within the Calliphoridae are still unresolved, particularly deeper level relationships. Sequencing whole mt genomes has been demonstrated both as an effective method for identifying the most informative diagnostic markers and for resolving phylogenetic relationships. Twenty-seven complete, or nearly so, mt genomes were sequenced representing 13 species, seven genera and four calliphorid subfamilies and a member of the related family Tachinidae. PCR and sequencing primers developed for sequencing one calliphorid species could be reused to sequence related species within the same superfamily with success rates ranging from 61% to 100%, demonstrating the speed and efficiency with which an mt genome dataset can be assembled. Comparison of molecular divergences for each of the 13 protein-coding genes and 2 ribosomal RNA genes, at a range of taxonomic scales identified novel targets for developing as diagnostic markers which were 117-200% more variable than the markers which have been used previously in calliphorids. Phylogenetic analysis of whole mt genome sequences resulted in much stronger support for family and subfamily-level relationships. The Calliphoridae are polyphyletic, with the Polleninae more closely related to the Tachinidae, and the Sarcophagidae are the sister group of the remaining calliphorids. Within the Calliphoridae, there was strong support for the monophyly of the Chrysomyinae and Luciliinae and for the sister

  14. Complete Mitochondrial Genome of the Red Fox (Vuples vuples) and Phylogenetic Analysis with Other Canid Species.

    Science.gov (United States)

    Zhong, Hua-Ming; Zhang, Hong-Hai; Sha, Wei-Lai; Zhang, Cheng-De; Chen, Yu-Cai

    2010-04-01

    The whole mitochondrial genome sequence of red fox (Vuples vuples) was determined. It had a total length of 16 723 bp. As in most mammal mitochondrial genome, it contained 13 protein coding genes, two ribosome RNA genes, 22 transfer RNA genes and one control region. The base composition was 31.3% A, 26.1% C, 14.8% G and 27.8% T, respectively. The codon usage of red fox, arctic fox, gray wolf, domestic dog and coyote followed the same pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 3 gene in the red fox. A long tandem repeat rich in AC was found between conserved sequence block 1 and 2 in the control region. In order to confirm the phylogenetic relationships of red fox to other canids, phylogenetic trees were reconstructed by neighbor-joining and maximum parsimony methods using 12 concatenated heavy-strand protein-coding genes. The result indicated that arctic fox was the sister group of red fox and they both belong to the red fox-like clade in family Canidae, while gray wolf, domestic dog and coyote belong to wolf-like clade. The result was in accordance with existing phylogenetic results.

  15. Characterization of the complete mitochondrial genome of Marshallagia marshalli and phylogenetic implications for the superfamily Trichostrongyloidea.

    Science.gov (United States)

    Sun, Miao-Miao; Han, Liang; Zhang, Fu-Kai; Zhou, Dong-Hui; Wang, Shu-Qing; Ma, Jun; Zhu, Xing-Quan; Liu, Guo-Hua

    2018-01-01

    Marshallagia marshalli (Nematoda: Trichostrongylidae) infection can lead to serious parasitic gastroenteritis in sheep, goat, and wild ruminant, causing significant socioeconomic losses worldwide. Up to now, the study concerning the molecular biology of M. marshalli is limited. Herein, we sequenced the complete mitochondrial (mt) genome of M. marshalli and examined its phylogenetic relationship with selected members of the superfamily Trichostrongyloidea using Bayesian inference (BI) based on concatenated mt amino acid sequence datasets. The complete mt genome sequence of M. marshalli is 13,891 bp, including 12 protein-coding genes, 22 transfer RNA genes, and 2 ribosomal RNA genes. All protein-coding genes are transcribed in the same direction. Phylogenetic analyses based on concatenated amino acid sequences of the 12 protein-coding genes supported the monophylies of the families Haemonchidae, Molineidae, and Dictyocaulidae with strong statistical support, but rejected the monophyly of the family Trichostrongylidae. The determination of the complete mt genome sequence of M. marshalli provides novel genetic markers for studying the systematics, population genetics, and molecular epidemiology of M. marshalli and its congeners.

  16. Two mitochondrial genomes in Alcedinidae (Ceryle rudis/Halcyon pileata) and the phylogenetic placement of Coraciiformes.

    Science.gov (United States)

    Sun, Xiaomin; Zhao, Ruoping; Zhang, Ting; Gong, Jie; Jing, Meidong; Huang, Ling

    2017-10-01

    Coraciiformes comprises 209 species belonging to ten families with significant divergence on external morphologies and life styles. The phylogenetic placement of Coraciiformes was still in debate. Here, we determined the complete mitochondrial genomes (mitogenomes) of Crested Kingfisher (Ceryle rudis) and Black-capped Kingfisher (Halcyon pileata). The mitogenomes were 17,355 bp (C. rudis) and 17,612 bp (H. pileata) in length, and both of them contained 37 genes (two rRNA genes, 22 tRNA genes and 13 protein-coding genes) and one control region. The gene organizations and characters of two mitogenomes were similar with those of other mitogenomes in Coraciiformes, however the sizes and nucleotide composition of control regions in different mitogenomes were significantly different. Phylogenetic trees were constructed with both Bayesian and Maximum Likelihood methods based on mitogenome sequences from 11 families of six orders. The trees based on two different data sets supported the basal position of Psittacidae (Psittaciformes), the closest relationship between Cuculiformes (Cuculidae) and Trogoniformes (Trogonidae), and the close relationship between Coraciiformes and Piciformes. The phylogenetic placement of the clade including Cuculiformes and Trogoniformes has not been resolved in present study, which need further investigations with more molecular markers and species. The mitogenome sequences presented here provided valuable data for further taxonomic studies on Coraciiformes and other related groups.

  17. Data for constructing insect genome content matrices for phylogenetic analysis and functional annotation

    Directory of Open Access Journals (Sweden)

    Jeffrey Rosenfeld

    2016-03-01

    Full Text Available Twenty one fully sequenced and well annotated insect genomes were used to construct genome content matrices for phylogenetic analysis and functional annotation of insect genomes. To examine the role of e-value cutoff in ortholog determination we used scaled e-value cutoffs and a single linkage clustering approach.. The present communication includes (1 a list of the genomes used to construct the genome content phylogenetic matrices, (2 a nexus file with the data matrices used in phylogenetic analysis, (3 a nexus file with the Newick trees generated by phylogenetic analysis, (4 an excel file listing the Core (CORE genes and Unique (UNI genes found in five insect groups, and (5 a figure showing a plot of consistency index (CI versus percent of unannotated genes that are apomorphies in the data set for gene losses and gains and bar plots of gains and losses for four consistency index (CI cutoffs.

  18. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  19. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    Science.gov (United States)

    Willerslev, Eske; Gilbert, M Thomas P; Binladen, Jonas; Ho, Simon YW; Campos, Paula F; Ratan, Aakrosh; Tomsho, Lynn P; da Fonseca, Rute R; Sher, Andrei; Kuznetsova, Tatanya V; Nowak-Kemp, Malgosia; Roth, Terri L; Miller, Webb; Schuster, Stephan C

    2009-01-01

    Background The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based) approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which several contradictory phylogenies were proposed on the basis of morphology, then apparently resolved using mitochondrial DNA fragments. Results In this study we report the first complete mitochondrial genome sequences of the extinct ice-age woolly rhinoceros (Coelodonta antiquitatis), and the threatened Javan (Rhinoceros sondaicus), Sumatran (Dicerorhinus sumatrensis), and black (Diceros bicornis) rhinoceroses. In combination with the previously published mitochondrial genomes of the white (Ceratotherium simum) and Indian (Rhinoceros unicornis) rhinoceroses, this data set putatively enables reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i) The black/white, (ii) the woolly/Sumatran, and (iii) the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir) has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae, and this is supported by an investigation of the relative branch lengths. Conclusion Satisfactory resolution of the rhinoceros phylogeny may not be achievable without additional analyses of substantial amounts of nuclear DNA. This study provides a compelling demonstration that, in spite of substantial sequence length, there are significant limitations with single-locus phylogenetics. We expect further examples of this to appear as next-generation, large-scale sequencing of complete mitochondrial

  20. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    Directory of Open Access Journals (Sweden)

    Nowak-Kemp Malgosia

    2009-05-01

    Full Text Available Abstract Background The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which several contradictory phylogenies were proposed on the basis of morphology, then apparently resolved using mitochondrial DNA fragments. Results In this study we report the first complete mitochondrial genome sequences of the extinct ice-age woolly rhinoceros (Coelodonta antiquitatis, and the threatened Javan (Rhinoceros sondaicus, Sumatran (Dicerorhinus sumatrensis, and black (Diceros bicornis rhinoceroses. In combination with the previously published mitochondrial genomes of the white (Ceratotherium simum and Indian (Rhinoceros unicornis rhinoceroses, this data set putatively enables reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i The black/white, (ii the woolly/Sumatran, and (iii the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae, and this is supported by an investigation of the relative branch lengths. Conclusion Satisfactory resolution of the rhinoceros phylogeny may not be achievable without additional analyses of substantial amounts of nuclear DNA. This study provides a compelling demonstration that, in spite of substantial sequence length, there are significant limitations with single-locus phylogenetics. We expect further examples of this to appear as next-generation, large-scale sequencing of complete

  1. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  2. Comprehensive Phylogenetic Analysis of Bovine Non-aureus Staphylococci Species Based on Whole-Genome Sequencing

    Science.gov (United States)

    Naushad, Sohail; Barkema, Herman W.; Luby, Christopher; Condas, Larissa A. Z.; Nobrega, Diego B.; Carson, Domonique A.; De Buck, Jeroen

    2016-01-01

    Non-aureus staphylococci (NAS), a heterogeneous group of a large number of species and subspecies, are the most frequently isolated pathogens from intramammary infections in dairy cattle. Phylogenetic relationships among bovine NAS species are controversial and have mostly been determined based on single-gene trees. Herein, we analyzed phylogeny of bovine NAS species using whole-genome sequencing (WGS) of 441 distinct isolates. In addition, evolutionary relationships among bovine NAS were estimated from multilocus data of 16S rRNA, hsp60, rpoB, sodA, and tuf genes and sequences from these and numerous other single genes/proteins. All phylogenies were created with FastTree, Maximum-Likelihood, Maximum-Parsimony, and Neighbor-Joining methods. Regardless of methodology, WGS-trees clearly separated bovine NAS species into five monophyletic coherent clades. Furthermore, there were consistent interspecies relationships within clades in all WGS phylogenetic reconstructions. Except for the Maximum-Parsimony tree, multilocus data analysis similarly produced five clades. There were large variations in determining clades and interspecies relationships in single gene/protein trees, under different methods of tree constructions, highlighting limitations of using single genes for determining bovine NAS phylogeny. However, based on WGS data, we established a robust phylogeny of bovine NAS species, unaffected by method or model of evolutionary reconstructions. Therefore, it is now possible to determine associations between phylogeny and many biological traits, such as virulence, antimicrobial resistance, environmental niche, geographical distribution, and host specificity. PMID:28066335

  3. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  4. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  5. Compositional and mutational rate heterogeneity in mitochondrial genomes and its effect on the phylogenetic inferences of Cimicomorpha (Hemiptera: Heteroptera).

    Science.gov (United States)

    Yang, Huanhuan; Li, Teng; Dang, Kai; Bu, Wenjun

    2018-04-18

    Mitochondrial genome (mt-genome) data can potentially return artefactual relationships in the higher-level phylogenetic inference of insects due to the biases of accelerated substitution rates and compositional heterogeneity. Previous studies based on mt-genome data alone showed a paraphyly of Cimicomorpha (Insecta, Hemiptera) due to the positions of the families Tingidae and Reduviidae rather than the monophyly that was supported based on morphological characters, morphological and molecular combined data and large scale molecular datasets. Various strategies have been proposed to ameliorate the effects of potential mt-genome biases, including dense taxon sampling, removal of third codon positions or purine-pyrimidine coding and the use of site-heterogeneous models. In this study, we sequenced the mt-genomes of five additional Tingidae species and discussed the compositional and mutational rate heterogeneity in mt-genomes and its effect on the phylogenetic inferences of Cimicomorpha by implementing the bias-reduction strategies mentioned above. Heterogeneity in nucleotide composition and mutational biases were found in mt protein-coding genes, and the third codon exhibited high levels of saturation. Dense taxon sampling of Tingidae and Reduviidae and the other common strategies mentioned above were insufficient to recover the monophyly of the well-established group Cimicomorpha. When the sites with weak phylogenetic signals in the dataset were removed, the remaining dataset of mt-genomes can support the monophyly of Cimicomorpha; this support demonstrates that mt-genomes possess strong phylogenetic signals for the inference of higher-level phylogeny of this group. Comparison of the ratio of the removal of amino acids for each PCG showed that ATP8 has the highest ratio while CO1 has the lowest. This pattern is largely congruent with the evolutionary rate of 13 PCGs that ATP8 represents the highest evolutionary rate, whereas CO1 appears to be the lowest. Notably

  6. Whole Genome Phylogenetic Tree Reconstruction using Colored de Bruijn Graphs

    OpenAIRE

    Lyman, Cole

    2017-01-01

    We present kleuren, a novel assembly-free method to reconstruct phylogenetic trees using the Colored de Bruijn Graph. kleuren works by constructing the Colored de Bruijn Graph and then traversing it, finding bubble structures in the graph that provide phylogenetic signal. The bubbles are then aligned and concatenated to form a supermatrix, from which a phylogenetic tree is inferred. We introduce the algorithm that kleuren uses to accomplish this task, and show its performance on reconstructin...

  7. Complete mitochondrial genome of four pheretimoid earthworms (Clitellata: Oligochaeta) and their phylogenetic reconstruction.

    Science.gov (United States)

    Zhang, Liangliang; Jiang, Jibao; Dong, Yan; Qiu, Jiangping

    2015-12-15

    Among oligochaetes, the Pheretima complex within the Megascolecidae is a major earthworm group. Recently, however, the systematics of the Pheretima complex based on morphology are challenged by molecular studies. Since little comparative analysis of earthworm complete mitochondrial genomes has been reported yet, we sequenced mitogenomes of four pheretimoid earthworm species to explore their phylogenetic relationships. The general earthworm genomic features are also found in four earthworms: all genes transcribed from the same strand, the same initiation codon ATG for each PCGs, and conserved structures of RNA genes. Interestingly we find an extra potential tRNA-leucine (CUN) in Amynthas longisiphonus. The earthworm mitochondrial ATP8 exhibits the highest evolutionary rate, while the gene CO1 evolves slowest. Phylogenetic analysis based on protein-coding genes (PCGs) strongly supports the monophyly of the Clitellata, Hirudinea, Oligochaeta, Megascolecidae and Pheretima complex. Our analysis, however, reveals non-monophyly within the genara Amynthas and Metaphire. Thus the generic divisions based on morphology in the Pheretima complex should be reconsidered. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. The origin and evolution of Basigin(BSG) gene: A comparative genomic and phylogenetic analysis.

    Science.gov (United States)

    Zhu, Xinyan; Wang, Shenglan; Shao, Mingjie; Yan, Jie; Liu, Fei

    2017-07-01

    Basigin (BSG), also known as extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), plays various fundamental roles in the intercellular recognition involved in immunologic phenomena, differentiation, and development. In this study, we aimed to compare the similarities and differences of BSG among organisms and explore possible evolutionary relationships based on the comparison result. We used the extensive BLAST tool to search the metazoan genomes, N-glycosylation sites, the transmembrane region and other functional sites. We then identified BSG homologs from genomic sequences and analyzed their phylogenetic relationships. We identified that BSG genes exist not only in the vertebrate metazoans but also in the invertebrate metazoans such as Amphioxus B. floridae, D. melanogaster, A. mellifera, S. japonicum, C. gigas, and T. patagoniensis. After sequence analysis, we confirmed that only vertebrate metazoans and Cephalochordate (amphioxus B. floridae) have the classic structure (a signal peptide, two Ig-like domains (IgC2 and IgI), a transmembrane region, and an intracellular domain). The invertebrate metazoans (excluding amphioxus B. floridae) lack the N-terminal signal peptides and IgC2 domain. We then generated a phylogenetic tree, genome organization comparison, and chromosomal disposition analysis based on the biological information obtained from the NCBI and Ensembl databases. Finally, we established the possible evolutionary scenario of the BSG gene, which showed the restricted exon rearrangement that has occurred during evolution, forming the present-day BSG gene. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  10. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  11. Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

    Science.gov (United States)

    Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

    2005-04-11

    We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger

  12. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  14. Comparative mitogenomics of Braconidae (Insecta: Hymenoptera) and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects

    Science.gov (United States)

    2010-01-01

    Background Animal mitochondrial genomes are potential models for molecular evolution and markers for phylogenetic and population studies. Previous research has shown interesting features in hymenopteran mitochondrial genomes. Here, we conducted a comparative study of mitochondrial genomes of the family Braconidae, one of the largest families of Hymenoptera, and assessed the utility of mitochondrial genomic data for phylogenetic inference at three different hierarchical levels, i.e., Braconidae, Hymenoptera, and Holometabola. Results Seven mitochondrial genomes from seven subfamilies of Braconidae were sequenced. Three of the four sequenced A+T-rich regions are shown to be inverted. Furthermore, all species showed reversal of strand asymmetry, suggesting that inversion of the A+T-rich region might be a synapomorphy of the Braconidae. Gene rearrangement events occurred in all braconid species, but gene rearrangement rates were not taxonomically correlated. Most rearranged genes were tRNAs, except those of Cotesia vestalis, in which 13 protein-coding genes and 14 tRNA genes changed positions or/and directions through three kinds of gene rearrangement events. Remote inversion is posited to be the result of two independent recombination events. Evolutionary rates were lower in species of the cyclostome group than those of noncyclostomes. Phylogenetic analyses based on complete mitochondrial genomes and secondary structure of rrnS supported a sister-group relationship between Aphidiinae and cyclostomes. Many well accepted relationships within Hymenoptera, such as paraphyly of Symphyta and Evaniomorpha, a sister-group relationship between Orussoidea and Apocrita, and monophyly of Proctotrupomorpha, Ichneumonoidea and Aculeata were robustly confirmed. New hypotheses, such as a sister-group relationship between Evanioidea and Aculeata, were generated. Among holometabolous insects, Hymenoptera was shown to be the sister to all other orders. Mecoptera was recovered as the

  15. Comparative mitogenomics of Braconidae (Insecta: Hymenoptera and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects

    Directory of Open Access Journals (Sweden)

    Shi Min

    2010-06-01

    Full Text Available Abstract Background Animal mitochondrial genomes are potential models for molecular evolution and markers for phylogenetic and population studies. Previous research has shown interesting features in hymenopteran mitochondrial genomes. Here, we conducted a comparative study of mitochondrial genomes of the family Braconidae, one of the largest families of Hymenoptera, and assessed the utility of mitochondrial genomic data for phylogenetic inference at three different hierarchical levels, i.e., Braconidae, Hymenoptera, and Holometabola. Results Seven mitochondrial genomes from seven subfamilies of Braconidae were sequenced. Three of the four sequenced A+T-rich regions are shown to be inverted. Furthermore, all species showed reversal of strand asymmetry, suggesting that inversion of the A+T-rich region might be a synapomorphy of the Braconidae. Gene rearrangement events occurred in all braconid species, but gene rearrangement rates were not taxonomically correlated. Most rearranged genes were tRNAs, except those of Cotesia vestalis, in which 13 protein-coding genes and 14 tRNA genes changed positions or/and directions through three kinds of gene rearrangement events. Remote inversion is posited to be the result of two independent recombination events. Evolutionary rates were lower in species of the cyclostome group than those of noncyclostomes. Phylogenetic analyses based on complete mitochondrial genomes and secondary structure of rrnS supported a sister-group relationship between Aphidiinae and cyclostomes. Many well accepted relationships within Hymenoptera, such as paraphyly of Symphyta and Evaniomorpha, a sister-group relationship between Orussoidea and Apocrita, and monophyly of Proctotrupomorpha, Ichneumonoidea and Aculeata were robustly confirmed. New hypotheses, such as a sister-group relationship between Evanioidea and Aculeata, were generated. Among holometabolous insects, Hymenoptera was shown to be the sister to all other orders

  16. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  17. Complete mitochondrial genomes of five skippers (Lepidoptera: Hesperiidae) and phylogenetic reconstruction of Lepidoptera.

    Science.gov (United States)

    Kim, Min Jee; Wang, Ah Rha; Park, Jeong Sun; Kim, Iksoo

    2014-10-01

    We sequenced mitogenomes of five skippers (family Hesperiidae, Lepidoptera) to obtain further insight into the characteristics of butterfly mitogenomes and performed phylogenetic reconstruction using all available gene sequences (PCGs, rRNAs, and tRNAs) from 85 species (20 families in eight superfamilies). The general genomic features found in the butterflies also were found in the five skippers: a high A+T composition (79.3%-80.9%), dominant usage of TAA stop codon, similar skewness pattern in both strands, consistently length intergenic spacer sequence between tRNA(Gln) and ND2 (64-87 bp), conserved ATACTAA motif between tRNA(Ser (UCN)) and ND1, and characteristic features of the A+T-rich region (the ATAGA motif, varying length of poly-T stretch, and poly-A stretch). The start codon for COI was CGA in four skippers as typical, but Lobocla bifasciatus evidently possessed canonical ATG as start codon. All species had the ancestral arrangement tRNA(Asn)/tRNA(Ser (AGN)), instead of the rearrangement tRNA(Ser (AGN))/tRNA(Asn), found in another skipper species (Erynnis). Phylogenetic analyses using all available genes (PCGs, rRNAS, and tRNAs) yielded the consensus superfamilial relationships ((((((Bombycoidea+Noctuoidea+Geometroidea)+Pyraloidea)+Papilionoidea)+Tortricoidea)+Yponomeutoidea)+Hepialoidea), confirming the validity of Macroheterocera (Bombycoidea, Noctuoidea, and Geometroidea in this study) and its sister relationship to Pyraloidea. Within Rhopalocera (butterflies and skippers) the familial relationships (Papilionidae+(Hesperiidae+(Pieridae+((Lycaenidae+Riodinidae)+Nymphalidae)))) were strongly supported in all analyses (0.98-1 by BI and 96-100 by ML methods), rendering invalid the superfamily status for Hesperioidea. On the other hand, current mitogenome-based phylogeny did not find consistent superfamilial relationships among Noctuoidea, Geometroidea, and Bombycoidea and the familial relationships within Bombycoidea between analyses, requiring further

  18. Isolation, Genome Phylogenetic Analysis and In vitro Rescue of a Newly Emerging Porcine Circovirus Type 2

    Directory of Open Access Journals (Sweden)

    Weijuan Zhu and Xiaofeng Ren*

    2012-05-01

    Full Text Available Porcine circovirus type 2 (PCV2 is the major causative agent of post-weaning multisystemic wasting syndrome (PMWS. Infection by PCV2 may cause heavy losses in pig industry. In this study, we report the isolation of a newly emerging PCV2 from northeastern China. The complete genome of the PCV2 isolate named PCV2-LJR contains 1766 nucleotides and was compared with reference sequences published in GenBank followed by topology analysis of the resulting phylogenetic tree. The data indicated that the prevalent PCV2 isolates in the northeastern China had close relationship, although various genotypes of PCV2 existed. In addition, by gene recombination and transfection techniques, the PCV2 infectious clone was achieved and was able to rescue virus in vitro determined by indirect immunofluorescence assay and PCR. The obtained biological materials may be used for biological characterization of PCV2.

  19. Complete mitochondrial genome of the Indian peafowl (Pavo cristatus), with phylogenetic analysis in phasianidae.

    Science.gov (United States)

    Zhou, Tai-Cheng; Sha, Tao; Irwin, David M; Zhang, Ya-Ping

    2015-01-01

    Pavo cristatus, known as the Indian peafowl, is endemic to India and Sri Lanka and has been domesticated for its ornamental and food value. However, its phylogenetic status is still debated. Here, to clarify the phylogenetic status of P. cristatus within Phasianidae, we analyzed its mitochondrial genome (mtDNA). The complete mitochondrial DNA (mtDNA) genome was determined using 34 pairs of primers. Our data show that the mtDNA genome of P. cristatus is 16,686 bp in length. Molecular phylogenetic analyses of P. cristatus was performed along with 22 complete mtDNA genomes belonging to other species in Phasianidae using Bayesian and maximum likelihood methods, where Aythya americana and Anas platyrhynchos were used as outgroups. Our results show that P. critatus has its closest genetic affinity with Pavo muticus and belongs to clade that contains Gallus, Bambusicola and Francolinus.

  20. The complete mitochondrial genome of rabbit pinworm Passalurus ambiguus: genome characterization and phylogenetic analysis.

    Science.gov (United States)

    Liu, Guo-Hua; Li, Sheng; Zou, Feng-Cai; Wang, Chun-Ren; Zhu, Xing-Quan

    2016-01-01

    Passalurus ambiguus (Nematda: Oxyuridae) is a common pinworm which parasitizes in the caecum and colon of rabbits. Despite its significance as a pathogen, the epidemiology, genetics, systematics, and biology of this pinworm remain poorly understood. In the present study, we sequenced the complete mitochondrial (mt) genome of P. ambiguus. The circular mt genome is 14,023 bp in size and encodes of 36 genes, including 12 protein-coding, two ribosomal RNA, and 22 transfer RNA genes. The mt gene order of P. ambiguus is the same as that of Wellcomia siamensis, but distinct from that of Enterobius vermicularis. Phylogenetic analyses based on concatenated amino acid sequences of 12 protein-coding genes by Bayesian inference (BI) showed that P. ambiguus was more closely related to W. siamensis than to E. vermicularis. This mt genome provides novel genetic markers for studying the molecular epidemiology, population genetics, systematics of pinworm of animals and humans, and should have implications for the diagnosis, prevention, and control of passaluriasis in rabbits and other animals.

  1. The complete mitochondrial genome of Meloidogyne graminicola (Tylenchina: a unique gene arrangement and its phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Longhua Sun

    Full Text Available Meloidogyne graminicola is one of the most economically important plant parasitic-nematodes (PPNs. In the present study, we determined the complete mitochondrial (mt DNA genome sequence of this plant pathogen. Compared with other PPNs genera, this genome (19,589 bp is only slightly smaller than that of Pratylenchus vulnus (21,656 bp. The nucleotide composition of the whole mtDNA sequence of M. graminicola is significantly biased toward A and T, with T being the most favored nucleotide and C being the least favored. The A+T content of the entire genome is 83.51%. The mt genome of M. graminicola contains 36 genes (lacking atp8 that are transcribed in the same direction. The gene arrangement of the mt genome of M. graminicola is unique. A total of 21 out of 22 tRNAs possess a DHU loop only, while tRNASer(AGN lacks a DHU loop. The two large noncoding regions (2,031 bp and 5,063 bp are disrupted by tRNASer(UCN. Phylogenetic analysis based on concatenated amino acid sequences of 12 protein-coding genes support the monophylies of the three orders Rhabditida, Mermithida and Trichinellida, the suborder Rhabditina and the three infraorders Spiruromorpha, Oxyuridomorpha and Ascaridomorpha, but do not support the monophylies of the two suborders Spirurina and Tylenchina, and the three infraorders Rhabditomorpha, Panagrolaimomorpha and Tylenchomorpha. The four Tylenchomorpha species including M. graminicola, P. vulnus, H. glycines and R. similis from the superfamily Tylenchoidea are placed within a well-supported monophyletic clade, but far from the other two Tylenchomorpha species B. xylophilus and B. mucronatus of Aphelenchoidea. In the clade of Tylenchoidea, M. graminicola is sister to P. vulnus, and H. glycines is sister to R. similis, which suggests root-knot nematodes has a closer relationship to Pratylenchidae nematodes than to cyst nematodes.

  2. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  3. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  4. Phylogenetic signal from rearrangements in 18 Anopheles species by joint scaffolding extant and ancestral genomes.

    Science.gov (United States)

    Anselmetti, Yoann; Duchemin, Wandrille; Tannier, Eric; Chauve, Cedric; Bérard, Sèverine

    2018-05-09

    Genomes rearrangements carry valuable information for phylogenetic inference or the elucidation of molecular mechanisms of adaptation. However, the detection of genome rearrangements is often hampered by current deficiencies in data and methods: Genomes obtained from short sequence reads have generally very fragmented assemblies, and comparing multiple gene orders generally leads to computationally intractable algorithmic questions. We present a computational method, ADSEQ, which, by combining ancestral gene order reconstruction, comparative scaffolding and de novo scaffolding methods, overcomes these two caveats. ADSEQ provides simultaneously improved assemblies and ancestral genomes, with statistical supports on all local features. Compared to previous comparative methods, it runs in polynomial time, it samples solutions in a probabilistic space, and it can handle a significantly larger gene complement from the considered extant genomes, with complex histories including gene duplications and losses. We use ADSEQ to provide improved assemblies and a genome history made of duplications, losses, gene translocations, rearrangements, of 18 complete Anopheles genomes, including several important malaria vectors. We also provide additional support for a differentiated mode of evolution of the sex chromosome and of the autosomes in these mosquito genomes. We demonstrate the method's ability to improve extant assemblies accurately through a procedure simulating realistic assembly fragmentation. We study a debated issue regarding the phylogeny of the Gambiae complex group of Anopheles genomes in the light of the evolution of chromosomal rearrangements, suggesting that the phylogenetic signal they carry can differ from the phylogenetic signal carried by gene sequences, more prone to introgression.

  5. Construction of a phylogenetic tree of photosynthetic prokaryotes based on average similarities of whole genome sequences.

    Directory of Open Access Journals (Sweden)

    Soichirou Satoh

    Full Text Available Phylogenetic trees have been constructed for a wide range of organisms using gene sequence information, especially through the identification of orthologous genes that have been vertically inherited. The number of available complete genome sequences is rapidly increasing, and many tools for construction of genome trees based on whole genome sequences have been proposed. However, development of a reasonable method of using complete genome sequences for construction of phylogenetic trees has not been established. We have developed a method for construction of phylogenetic trees based on the average sequence similarities of whole genome sequences. We used this method to examine the phylogeny of 115 photosynthetic prokaryotes, i.e., cyanobacteria, Chlorobi, proteobacteria, Chloroflexi, Firmicutes and nonphotosynthetic organisms including Archaea. Although the bootstrap values for the branching order of phyla were low, probably due to lateral gene transfer and saturated mutation, the obtained tree was largely consistent with the previously reported phylogenetic trees, indicating that this method is a robust alternative to traditional phylogenetic methods.

  6. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  7. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  8. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  9. The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha

    Science.gov (United States)

    Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying

    2015-01-01

    Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

  10. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  11. Characterization of the complete mitochondrial genome of Acanthoscelides obtectus (Coleoptera: Chrysomelidae: Bruchinae) with phylogenetic analysis.

    Science.gov (United States)

    Yao, Jie; Yang, Hong; Dai, Renhuai

    2017-10-01

    Acanthoscelides obtectus is a common species of the subfamily Bruchinae and a worldwide-distributed seed-feeding beetle. The complete mitochondrial genome of A. obtectus is 16,130 bp in length with an A + T content of 76.4%. It contains a positive AT skew and a negative GC skew. The mitogenome of A. obtectus contains 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes and a non-coding region (D-loop). All PCGs start with an ATN codon, and seven (ND3, ATP6, COIII, ND3, ND4L, ND6, and Cytb) of them terminate with TAA, while the remaining five (COI, COII, ND1, ND4, and ND5) terminate with a single T, ATP8 terminates with TGA. Except tRNA Ser , the secondary structures of 21 tRNAs that can be folded into a typical clover-leaf structure were identified. The secondary structures of lrRNA and srRNA were also predicted in this study. There are six domains with 48 helices in lrRNA and three domains with 32 helices in srRNA. The control region of A. obtectus is 1354 bp in size with the highest A + T content (83.5%) in a mitochondrial gene. Thirteen PCGs in 19 species have been used to infer their phylogenetic relationships. Our results show that A. obtectus belongs to the family Chrysomelidae (subfamily-Bruchinae). This is the first study on phylogenetic analyses involving the mitochondrial genes of A. obtectus and could provide basic data for future studies of mitochondrial genome diversities and the evolution of related insect lineages.

  12. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  13. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  14. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae) and phylogenetic position of plecoptera based on mitogenomes.

    Science.gov (United States)

    Yu-Han, Qian; Hai-Yan, Wu; Xiao-Yu, Ji; Wei-Wei, Yu; Yu-Zhou, Du

    2014-01-01

    This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651) and stem-loop 2 (15965-15998). The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  15. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae and phylogenetic position of plecoptera based on mitogenomes.

    Directory of Open Access Journals (Sweden)

    Qian Yu-Han

    Full Text Available This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651 and stem-loop 2 (15965-15998. The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  16. Complete genome sequencing and phylogenetic analysis of dengue type 1 virus isolated from Jeddah, Saudi Arabia.

    Science.gov (United States)

    Azhar, Esam I; Hashem, Anwar M; El-Kafrawy, Sherif A; Abol-Ela, Said; Abd-Alla, Adly M M; Sohrab, Sayed Sartaj; Farraj, Suha A; Othman, Norah A; Ben-Helaby, Huda G; Ashshi, Ahmed; Madani, Tariq A; Jamjoom, Ghazi

    2015-01-16

    Dengue viruses (DENVs) are mosquito-borne viruses which can cause disease ranging from mild fever to severe dengue infection. These viruses are endemic in several tropical and subtropical regions. Multiple outbreaks of DENV serotypes 1, 2 and 3 (DENV-1, DENV-2 and DENV-3) have been reported from the western region in Saudi Arabia since 1994. Strains from at least two genotypes of DENV-1 (Asia and America/Africa genotypes) have been circulating in western Saudi Arabia until 2006. However, all previous studies reported from Saudi Arabia were based on partial sequencing data of the envelope (E) gene without any reports of full genome sequences for any DENV serotypes circulating in Saudi Arabia. Here, we report the isolation and the first complete genome sequence of a DENV-1 strain (DENV-1-Jeddah-1-2011) isolated from a patient from Jeddah, Saudi Arabia in 2011. Whole genome sequence alignment and phylogenetic analysis showed high similarity between DENV-1-Jeddah-1-2011 strain and D1/H/IMTSSA/98/606 isolate (Asian genotype) reported from Djibouti in 1998. Further analysis of the full envelope gene revealed a close relationship between DENV-1-Jeddah-1-2011 strain and isolates reported between 2004-2006 from Jeddah as well as recent isolates from Somalia, suggesting the widespread of the Asian genotype in this region. These data suggest that strains belonging to the Asian genotype might have been introduced into Saudi Arabia long before 2004 most probably by African pilgrims and continued to circulate in western Saudi Arabia at least until 2011. Most importantly, these results indicate that pilgrims from dengue endemic regions can play an important role in the spread of new DENVs in Saudi Arabia and the rest of the world. Therefore, availability of complete genome sequences would serve as a reference for future epidemiological studies of DENV-1 viruses.

  17. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  18. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  19. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  20. Genome-wide comparative analysis of phylogenetic trees: the prokaryotic forest of life.

    Science.gov (United States)

    Puigbò, Pere; Wolf, Yuri I; Koonin, Eugene V

    2012-01-01

    Genome-wide comparison of phylogenetic trees is becoming an increasingly common approach in evolutionary genomics, and a variety of approaches for such comparison have been developed. In this article, we present several methods for comparative analysis of large numbers of phylogenetic trees. To compare phylogenetic trees taking into account the bootstrap support for each internal branch, the Boot-Split Distance (BSD) method is introduced as an extension of the previously developed Split Distance method for tree comparison. The BSD method implements the straightforward idea that comparison of phylogenetic trees can be made more robust by treating tree splits differentially depending on the bootstrap support. Approaches are also introduced for detecting tree-like and net-like evolutionary trends in the phylogenetic Forest of Life (FOL), i.e., the entirety of the phylogenetic trees for conserved genes of prokaryotes. The principal method employed for this purpose includes mapping quartets of species onto trees to calculate the support of each quartet topology and so to quantify the tree and net contributions to the distances between species. We describe the application of these methods to analyze the FOL and the results obtained with these methods. These results support the concept of the Tree of Life (TOL) as a central evolutionary trend in the FOL as opposed to the traditional view of the TOL as a "species tree."

  1. The complete mitochondrial genome and phylogenetic position of the Philippines spurdog, Squalus montalbani.

    Science.gov (United States)

    Kemper, Jenny M; Naylor, Gavin J P

    2016-11-01

    We present the complete mitochondrial genome sequence (16 555 bp) of the Philippines spurdog, Squalus montalbani, currently listed as Vulnerable due to population declines and fishing pressures. A phylogenetic analysis was carried out on S. montalbani and representative shark mitogenomes. Squalus montalbani was placed within the Squaliformes as a sister taxon to Squalus acanthias and Cirrhigaleus australis.

  2. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  3. Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae, a mammalian family that experienced rapid speciation

    Directory of Open Access Journals (Sweden)

    Ryder Oliver A

    2007-10-01

    Full Text Available Abstract Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other

  4. Genomic and phylogenetic evidence of VIPER retrotransposon domestication in trypanosomatids

    Directory of Open Access Journals (Sweden)

    Adriana Ludwig

    Full Text Available Transposable elements are important residents of eukaryotic genomes and eventually the host can domesticate them to serve cellular functions. We reported here a possible domestication event of the vestigial interposed retroelement (VIPER in trypanosomatids. We found a large gene in a syntenic location in Leishmania braziliensis, L. panamensis, Leptomanas pyrrhocoris, and Crithidia fasciculata whose products share similarity in the C-terminal portion with the third protein of VIPER. No remnants of other VIPER regions surrounding the gene sequence were found. We hypothesise that the domestication event occurred more than 50 mya and the conservation of this gene suggests it might perform some function in the host species.

  5. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  6. Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata: phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa

    Directory of Open Access Journals (Sweden)

    Jang Kuem

    2009-04-01

    Full Text Available Abstract Background The phylogenetic position of Bryozoa is one of the most controversial issues in metazoan phylogeny. In an attempt to address this issue, the first bryozoan mitochondrial genome from Flustrellidra hispida (Gymnolaemata, Ctenostomata was recently sequenced and characterized. Unfortunately, it has extensive gene translocation and extremely reduced size. In addition, the phylogenies obtained from the result were conflicting, so they failed to assign a reliable phylogenetic position to Bryozoa or to clarify lophophorate phylogeny. Thus, it is necessary to characterize further mitochondrial genomes from slowly-evolving bryozoans to obtain a more credible lophophorate phylogeny. Results The complete mitochondrial genome (15,433 bp of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata, one of the most widely distributed cheliostome bryozoans, is sequenced. This second bryozoan mitochondrial genome contains the set of 37 components generally observed in other metazoans, differing from that of F. hispida (Bryozoa, Gymnolaemata, Ctenostomata, which has only 36 components with loss of tRNAser(ucn genes. The B. neritina mitochondrial genome possesses 27 multiple noncoding regions. The gene order is more similar to those of the two remaining lophophorate phyla (Brachiopoda and Phoronida and a chiton Katharina tunicate than to that of F. hispida. Phylogenetic analyses based on the nucleotide sequences or amino acid residues of 12 protein-coding genes showed consistently that, within the Lophotrochozoa, the monophyly of the bryozoan class Gymnolaemata (B. neritina and F. hispida was strongly supported and the bryozoan clade was grouped with brachiopods. Echiura appeared as a subtaxon of Annelida, and Entoprocta as a sister taxon of Phoronida. The clade of Bryozoa + Brachiopoda was clustered with either the clade of Annelida-Echiura or that of Phoronida + Entoprocta. Conclusion This study presents the complete mitochondrial genome of a

  7. The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.

    Science.gov (United States)

    Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo

    2018-02-01

    The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.

  8. Evaluating Phylogenetic Congruence in the Post-Genomic Era

    Science.gov (United States)

    Leigh, Jessica W.; Lapointe, François-Joseph; Lopez, Philippe; Bapteste, Eric

    2011-01-01

    Congruence is a broadly applied notion in evolutionary biology used to justify multigene phylogeny or phylogenomics, as well as in studies of coevolution, lateral gene transfer, and as evidence for common descent. Existing methods for identifying incongruence or heterogeneity using character data were designed for data sets that are both small and expected to be rarely incongruent. At the same time, methods that assess incongruence using comparison of trees test a null hypothesis of uncorrelated tree structures, which may be inappropriate for phylogenomic studies. As such, they are ill-suited for the growing number of available genome sequences, most of which are from prokaryotes and viruses, either for phylogenomic analysis or for studies of the evolutionary forces and events that have shaped these genomes. Specifically, many existing methods scale poorly with large numbers of genes, cannot accommodate high levels of incongruence, and do not adequately model patterns of missing taxa for different markers. We propose the development of novel incongruence assessment methods suitable for the analysis of the molecular evolution of the vast majority of life and support the investigation of homogeneity of evolutionary process in cases where markers do not share identical tree structures. PMID:21712432

  9. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  10. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis.

    Science.gov (United States)

    Yang, Yilong; Davis, Thomas M

    2017-12-01

    The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Access Array system and 454 sequencing platform. About 24 single-copy or low-copy nuclear genes distributed across the genome were amplified and sequenced from 96 genomic DNA samples representing 16 Fragaria species from diploid (2×) to decaploid (10×), including the most extensive sampling of octoploid taxa yet reported. Individual gene trees were constructed by different tree-building methods. Mosaic genomic structures of diploid Fragaria species consisting of sequences at different phylogenetic positions were observed. Our findings support the presence in octoploid species of genetic signatures from at least five diploid ancestors (F. vesca, F. iinumae, F. bucharica, F. viridis, and at least one additional allele contributor of unknown identity), and questions the extent to which distinct subgenomes are preserved over evolutionary time in the allopolyploid Fragaria species. In addition, our data support divergence between the two wild octoploid species, F. virginiana and F. chiloensis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. The first two mitochondrial genomes from Taeniopterygidae (Insecta: Plecoptera): Structural features and phylogenetic implications.

    Science.gov (United States)

    Chen, Zhi-Teng; Du, Yu-Zhou

    2018-05-01

    The complete mitochondrial genomes (mitogenomes) of Taeniopteryx ugola and Doddsia occidentalis (Plecoptera: Taeniopterygidae) were firstly sequenced from the family Taeniopterygidae. The 15,353-bp long mitogenome of T. ugola and the 16,020-bp long mitogenome of D. occidentalis each contained 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), two ribosomal RNA genes (rRNAs) and a control region (CR). The mitochondrial gene arrangement of the two taeniopterygids and other stoneflies was identical with the putative ancestral mitogenome of Drosophila yakuba. Most PCGs used standard ATN start codons and TAN termination codons. Twenty-one of the 22 tRNAs in each mitogenome could fold into the cloverleaf secondary structures, while the dihydrouridine (DHU) arm of trnSer (AGN) was reduced or absent. Stem-loop (SL) structures, poly-T stretch, poly-[AT] n stretch and tandem repeats were found in the CRs of the two mitogenomes. The phylogenetic analyses using Bayesian inference (BI) and maximum likelihood methods (ML) generated identical results, both supporting the monophyly of all stonefly families and the two infraorders, Systellognatha and Euholognatha. Taeniopterygidae was grouped with another two families from Euholognatha. The relationships within Plecoptera were recovered as (((Perlidae+Peltoperlidae)+((Pteronarcyidae+Chloroperlidae)+Styloperlidae))+((Capniidae+Taeniopterygidae)+Nemouridae))+Gripopterygidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. [Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

    Science.gov (United States)

    Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

    2013-01-01

    Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

  13. Phylogenetic reconstruction of the Legionella pneumophila Philadelphia-1 laboratory strains through comparative genomics.

    Directory of Open Access Journals (Sweden)

    Chitong Rao

    Full Text Available Over 20 years ago, two groups independently domesticated Legionella pneumophila from a clinical isolate of bacteria collected during the first recognized outbreak of Legionnaires' disease (at the 1976 American Legion's convention in Philadelphia. These two laboratory strains, JR32 and Lp01, along with their derivatives, have been disseminated to a number of laboratories around the world and form the cornerstone of much of the research conducted on this important pathogen to date. Nevertheless, no exhaustive examination of the genetic distance between these strains and their clinical progenitor has been performed thus far. Such information is of paramount importance for making sense of several phenotypic differences observed between these strains. As environmental replication of L. pneumophila is thought to exclusively occur within natural protozoan hosts, retrospective analysis of the domestication and axenic culture of the Philadelphia-1 progenitor strain by two independent groups also provides an excellent opportunity to uncover evidence of adaptation to the laboratory environment. To reconstruct the phylogenetic relationships between the common laboratory strains of L. pneumophila Philadelphia-1 and their clinical ancestor, we performed whole-genome Illumina resequencing of the two founders of each laboratory lineage: JR32 and Lp01. As expected from earlier, targeted studies, Lp01 and JR32 contain large deletions in the lvh and tra regions, respectively. By sequencing additional strains derived from Lp01 (Lp02 and Lp03, we retraced the phylogeny of these strains relative to their reported ancestor, thereby reconstructing the evolutionary dynamics of each laboratory lineage from genomic data.

  14. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  15. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  16. An integrative and applicable phylogenetic footprinting framework for cis-regulatory motifs identification in prokaryotic genomes.

    Science.gov (United States)

    Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin

    2016-08-09

    Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance

  17. Next-Generation Sequencing Reveals the Impact of Repetitive DNA Across Phylogenetically Closely Related Genomes of Orobanchaceae

    Science.gov (United States)

    Piednoël, Mathieu; Aberer, Andre J.; Schneeweiss, Gerald M.; Macas, Jiri; Novak, Petr; Gundlach, Heidrun; Temsch, Eva M.; Renner, Susanne S.

    2013-01-01

    We used next-generation sequencing to characterize the genomes of nine species of Orobanchaceae of known phylogenetic relationships, different life forms, and including a polyploid species. The study species are the autotrophic, nonparasitic Lindenbergia philippensis, the hemiparasitic Schwalbea americana, and seven nonphotosynthetic parasitic species of Orobanche (Orobanche crenata, Orobanche cumana, Orobanche gracilis (tetraploid), and Orobanche pancicii) and Phelipanche (Phelipanche lavandulacea, Phelipanche purpurea, and Phelipanche ramosa). Ty3/Gypsy elements comprise 1.93%–28.34% of the nine genomes and Ty1/Copia elements comprise 8.09%–22.83%. When compared with L. philippensis and S. americana, the nonphotosynthetic species contain higher proportions of repetitive DNA sequences, perhaps reflecting relaxed selection on genome size in parasitic organisms. Among the parasitic species, those in the genus Orobanche have smaller genomes but higher proportions of repetitive DNA than those in Phelipanche, mostly due to a diversification of repeats and an accumulation of Ty3/Gypsy elements. Genome downsizing in the tetraploid O. gracilis probably led to sequence loss across most repeat types. PMID:22723303

  18. A preliminary mitochondrial genome phylogeny of Orthoptera (Insecta) and approaches to maximizing phylogenetic signal found within mitochondrial genome data.

    Science.gov (United States)

    Fenn, J Daniel; Song, Hojun; Cameron, Stephen L; Whiting, Michael F

    2008-10-01

    The phylogenetic utility of mitochondrial genomes (mtgenomes) is examined using the framework of a preliminary phylogeny of Orthoptera. This study presents five newly sequenced genomes from four orthopteran families. While all ensiferan and polyneopteran taxa retain the ancestral gene order, all caeliferan lineages including the newly sequenced caeliferan species contain a tRNA rearrangement from the insect ground plan tRNA(Lys)(K)-tRNA(Asp)(D) swapping to tRNA(Asp) (D)-tRNA(Lys) (K) confirming that this rearrangement is a possible molecular synapomorphy for this suborder. The phylogenetic signal in mtgenomes is rigorously examined under the analytical regimens of parsimony, maximum likelihood and Bayesian inference, along with how gene inclusion/exclusion, data recoding, gap coding, and different partitioning schemes influence the phylogenetic reconstruction. When all available data are analyzed simultaneously, the monophyly of Orthoptera and its two suborders, Caelifera and Ensifera, are consistently recovered in the context of our taxon sampling, regardless of the optimality criteria. When protein-coding genes are analyzed as a single partition, nearly identical topology to the combined analyses is recovered, suggesting that much of the signals of the mtgenome come from the protein-coding genes. Transfer and ribosomal RNAs perform poorly when analyzed individually, but contribute signal when analyzed in combination with the protein-coding genes. Inclusion of third codon position of the protein-coding genes does not negatively affect the phylogenetic reconstruction when all genes are analyzed together, whereas recoding of the protein-coding genes into amino acid sequences introduces artificial resolution. Over-partitioning in a Bayesian framework appears to have a negative effect in achieving convergence. Our findings suggest that the best phylogenetic inferences are made when all available nucleotide data from the mtgenome are analyzed simultaneously, and that

  19. Description of new mitochondrial genomes (Spodoptera litura, Noctuoidea and Cnaphalocrocis medinalis, Pyraloidea) and phylogenetic reconstruction of Lepidoptera with the comment on optimization schemes.

    Science.gov (United States)

    Wan, Xinlong; Kim, Min Jee; Kim, Iksoo

    2013-11-01

    We newly sequenced mitochondrial genomes of Spodoptera litura and Cnaphalocrocis medinalis belonging to Lepidoptera to obtain further insight into mitochondrial genome evolution in this group and investigated the influence of optimal strategies on phylogenetic reconstruction of Lepidoptera. Estimation of p-distances of each mitochondrial gene for available taxonomic levels has shown the highest value in ND6, whereas the lowest values in COI and COII at the nucleotide level, suggesting different utility of each gene for different hierarchical group when individual genes are utilized for phylogenetic analysis. Phylogenetic analyses mainly yielded the relationships (((((Bombycoidea + Geometroidea) + Noctuoidea) + Pyraloidea) + Papilionoidea) + Tortricoidea), evidencing the polyphyly of Macrolepidoptera. The Noctuoidea concordantly recovered the familial relationships (((Arctiidae + Lymantriidae) + Noctuidae) + Notodontidae). The tests of optimality strategies, such as exclusion of third codon positions, inclusion of rRNA and tRNA genes, data partitioning, RY recoding approach, and recoding nucleotides into amino acids suggested that the majority of the strategies did not substantially alter phylogenetic topologies or nodal supports, except for the sister relationship between Lycaenidae and Pieridae only in the amino acid dataset, which was in contrast to the sister relationship between Lycaenidae and Nymphalidae in Papilionoidea in the remaining datasets.

  20. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  1. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  2. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  3. Complete mitochondrial genomes reveal phylogeny relationship and evolutionary history of the family Felidae.

    Science.gov (United States)

    Zhang, W Q; Zhang, M H

    2013-09-03

    Many mitochondrial DNA sequences are used to estimate phylogenetic relationships among animal taxa and perform molecular phylogenetic evolution analysis. With the continuous development of sequencing technology, numerous mitochondrial sequences have been released in public databases, especially complete mitochondrial DNA sequences. Using multiple sequences is better than using single sequences for phylogenetic analysis of animals because multiple sequences have sufficient information for evolutionary process reconstruction. Therefore, we performed phylogenetic analyses of 14 species of Felidae based on complete mitochondrial genome sequences, with Canis familiaris as an outgroup, using neighbor joining, maximum likelihood, maximum parsimony, and Bayesian inference methods. The consensus phylogenetic trees supported the monophyly of Felidae, and the family could be divided into 2 subfamilies, Felinae and Pantherinae. The genus Panthera and species tigris were also studied in detail. Meanwhile, the divergence of this family was estimated by phylogenetic analysis using the Bayesian method with a relaxed molecular clock, and the results shown were consistent with previous studies. In summary, the evolution of Felidae was reconstructed by phylogenetic analysis based on mitochondrial genome sequences. The described method may be broadly applicable for phylogenetic analyses of anima taxa.

  4. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  5. Phylogenetics and differentiation of Salmonella Newport lineages by whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Guojie Cao

    Full Text Available Salmonella Newport has ranked in the top three Salmonella serotypes associated with foodborne outbreaks from 1995 to 2011 in the United States. In the current study, we selected 26 S. Newport strains isolated from diverse sources and geographic locations and then conducted 454 shotgun pyrosequencing procedures to obtain 16-24 × coverage of high quality draft genomes for each strain. Comparative genomic analysis of 28 S. Newport strains (including 2 reference genomes and 15 outgroup genomes identified more than 140,000 informative SNPs. A resulting phylogenetic tree consisted of four sublineages and indicated that S. Newport had a clear geographic structure. Strains from Asia were divergent from those from the Americas. Our findings demonstrated that analysis using whole genome sequencing data resulted in a more accurate picture of phylogeny compared to that using single genes or small sets of genes. We selected loci around the mutS gene of S. Newport to differentiate distinct lineages, including those between invH and mutS genes at the 3' end of Salmonella Pathogenicity Island 1 (SPI-1, ste fimbrial operon, and Clustered, Regularly Interspaced, Short Palindromic Repeats (CRISPR associated-proteins (cas. These genes in the outgroup genomes held high similarity with either S. Newport Lineage II or III at the same loci. S. Newport Lineages II and III have different evolutionary histories in this region and our data demonstrated genetic flow and homologous recombination events around mutS. The findings suggested that S. Newport Lineages II and III diverged early in the serotype evolution and have evolved largely independently. Moreover, we identified genes that could delineate sublineages within the phylogenetic tree and that could be used as potential biomarkers for trace-back investigations during outbreaks. Thus, whole genome sequencing data enabled us to better understand the genetic background of pathogenicity and evolutionary history of S

  6. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  7. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  8. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  9. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  10. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  11. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  13. The first complete organellar genomes of an Antarctic red alga, Pyropia endiviifolia: insights into its genome architecture and phylogenetic position within genus Pyropia (Bangiales, Rhodophyta)

    Science.gov (United States)

    Xu, Kuipeng; Tang, Xianghai; Bi, Guiqi; Cao, Min; Wang, Lu; Mao, Yunxiang

    2017-08-01

    Pyropia species grow in the intertidal zone and are cold-water adapted. To date, most of the information about the whole plastid and mitochondrial genomes (ptDNA and mtDNA) of this genus is limited to Northern Hemisphere species. Here, we report the sequencing of the ptDNA and mtDNA of the Antarctic red alga Pyropia endiviifolia using the Illumina platform. The plastid genome (195 784 bp, 33.28% GC content) contains 210 protein-coding genes, 37 tRNA genes and 6 rRNA genes. The mitochondrial genome (34 603 bp, 30.5% GC content) contains 26 protein-coding genes, 25 tRNA genes and 2 rRNA genes. Our results suggest that the organellar genomes of Py. endiviifolia have a compact organization. Although the collinearity of these genomes is conserved compared with other Pyropia species, the genome sizes show significant differences, mainly because of the different copy numbers of rDNA operons in the ptDNA and group II introns in the mtDNA. The other Pyropia species have 2u20133 distinct intronic ORFs in their cox 1 genes, but Py. endiviifolia has no introns in its cox 1 gene. This has led to a smaller mtDNA than in other Pyropia species. The phylogenetic relationships within Pyropia were examined using concatenated gene sets from most of the available organellar genomes with both the maximum likelihood and Bayesian methods. The analysis revealed a sister taxa affiliation between the Antarctic species Py. endiviifolia and the North American species Py. kanakaensis.

  14. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  15. Phylogenetic relationships of the genus Quercus L. (Fageceae) from ...

    African Journals Online (AJOL)

    ProBook

    2016-10-05

    Oct 5, 2016 ... Department of Molecular Biology and Genetics, Faculty of Science and Arts, Uşak University, 64200 Uşak, ... genomic structure of different taxa that belong to oaks ..... Directorate of Scientific Research Projects (BAP) for.

  16. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  17. A comparative study and a phylogenetic exploration of the compositional architectures of mammalian nuclear genomes.

    Directory of Open Access Journals (Sweden)

    Eran Elhaik

    2014-11-01

    Full Text Available For the past four decades the compositional organization of the mammalian genome posed a formidable challenge to molecular evolutionists attempting to explain it from an evolutionary perspective. Unfortunately, most of the explanations adhered to the "isochore theory," which has long been rebutted. Recently, an alternative compositional domain model was proposed depicting the human and cow genomes as composed mostly of short compositionally homogeneous and nonhomogeneous domains and a few long ones. We test the validity of this model through a rigorous sequence-based analysis of eleven completely sequenced mammalian and avian genomes. Seven attributes of compositional domains are used in the analyses: (1 the number of compositional domains, (2 compositional domain-length distribution, (3 density of compositional domains, (4 genome coverage by the different domain types, (5 degree of fit to a power-law distribution, (6 compositional domain GC content, and (7 the joint distribution of GC content and length of the different domain types. We discuss the evolution of these attributes in light of two competing phylogenetic hypotheses that differ from each other in the validity of clade Euarchontoglires. If valid, the murid genome compositional organization would be a derived state and exhibit a high similarity to that of other mammals. If invalid, the murid genome compositional organization would be closer to an ancestral state. We demonstrate that the compositional organization of the murid genome differs from those of primates and laurasiatherians, a phenomenon previously termed the "murid shift," and in many ways resembles the genome of opossum. We find no support to the "isochore theory." Instead, our findings depict the mammalian genome as a tapestry of mostly short homogeneous and nonhomogeneous domains and few long ones thus providing strong evidence in favor of the compositional domain model and seem to invalidate clade Euarchontoglires.

  18. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  19. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  20. Phylogenetic conservatism of thermal traits explains dispersal limitation and genomic differentiation of Streptomyces sister-taxa.

    Science.gov (United States)

    Choudoir, Mallory J; Buckley, Daniel H

    2018-06-07

    The latitudinal diversity gradient is a pattern of biogeography observed broadly in plants and animals but largely undocumented in terrestrial microbial systems. Although patterns of microbial biogeography across broad taxonomic scales have been described in a range of contexts, the mechanisms that generate biogeographic patterns between closely related taxa remain incompletely characterized. Adaptive processes are a major driver of microbial biogeography, but there is less understanding of how microbial biogeography and diversification are shaped by dispersal limitation and drift. We recently described a latitudinal diversity gradient of species richness and intraspecific genetic diversity in Streptomyces by using a geographically explicit culture collection. Within this geographically explicit culture collection, we have identified Streptomyces sister-taxa whose geographic distribution is delimited by latitude. These sister-taxa differ in geographic distribution, genomic diversity, and ecological traits despite having nearly identical SSU rRNA gene sequences. Comparative genomic analysis reveals genomic differentiation of these sister-taxa consistent with restricted gene flow across latitude. Furthermore, we show phylogenetic conservatism of thermal traits between the sister-taxa suggesting that thermal trait adaptation limits dispersal and gene flow across climate regimes as defined by latitude. Such phylogenetic conservatism of thermal traits is commonly associated with latitudinal diversity gradients for plants and animals. These data provide further support for the hypothesis that the Streptomyces latitudinal diversity gradient was formed as a result of historical demographic processes defined by dispersal limitation and driven by paleoclimate dynamics.

  1. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  2. Chromosome sizes and phylogenetic relationships between serotypes of Actinobacillus pleuropneumoniae

    OpenAIRE

    Chevallier, Bruno; Dugourd, Dominique; Tarasiuk, Kazimirez; Harel, Josée; Gottschalk, Marcelo; Kobisch, Marylène; Frey, Joachim

    2017-01-01

    The genome size of Actinobacillus pleuropneumoniae was determined by pulsed field gel electrophoresis of AscI and ApaI digested chromosomal DNA. The genome size of the type strain 4074T (serotype 1) was determined to be 2404±40 kb. The chromosome sizes for the reference strains of the other serotypes range between 2.3 and 2.4 Mb. The restriction pattern profiles of AscI, ApaI and NheI digested chromosomes showed a high degree of polymorphism among the different serotype reference strains and ...

  3. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  4. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  5. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  6. Cytological and genome size data analyzed in a phylogenetic frame: Evolutionary implications concerning Sisyrinchium taxa (Iridaceae: Iridoideae

    Directory of Open Access Journals (Sweden)

    Paula Burchardt

    2018-03-01

    Full Text Available Abstract Sisyrinchium is the largest genus of Iridaceae in the Americas and has the greatest amount of cytological data available. This study aimed at investigating how genomes evolved in this genus. Chromosome number, genome size and altitude from species of sect. Viperella were analyzed in a phylogenetic context. Meiotic and pollen analyses were performed to assess reproductive success of natural populations, especially from those polyploid taxa. Character optimizations revealed that the common ancestor of sect. Viperella was probably diploid (2n = 2x =18 with two subsequent polyplodization events. Total DNA content (2C varied considerably across the phylogeny with larger genomes detected mainly in polyploid species. Altitude also varied across the phylogeny, however no significant relationship was found between DNA content changes and altitude in our data set. All taxa presented regular meiosis and pollen viability (> 87%, except for S. sp. nov. aff. alatum (22.70%, suggesting a recent hybrid origin. Chromosome number is mostly constant within this section and polyploidy is the only source of modification. Although 2C varied considerably among the 20 taxa investigated, the diversity observed cannot be attributed only to polyploidy events because large variations of DNA content were also observed among diploids.

  7. Avian papillomaviruses: the parrot Psittacus erithacus papillomavirus (PePV genome has a unique organization of the early protein region and is phylogenetically related to the chaffinch papillomavirus

    Directory of Open Access Journals (Sweden)

    Jenson A Bennett

    2002-07-01

    Full Text Available Abstract Background An avian papillomavirus genome has been cloned from a cutaneous exophytic papilloma from an African grey parrot (Psittacus erithacus. The nucleotide sequence, genome organization, and phylogenetic position of the Psittacus erithacus papillomavirus (PePV were determined. This PePV sequence represents the first complete avian papillomavirus genome defined. Results The PePV genome (7304 basepairs differs from other papillomaviruses, in that it has a unique organization of the early protein region lacking classical E6 and E7 open reading frames. Phylogenetic comparison of the PePV sequence with partial E1 and L1 sequences of the chaffinch (Fringilla coelebs papillomavirus (FPV reveals that these two avian papillomaviruses form a monophyletic cluster with a common branch that originates near the unresolved center of the papillomavirus evolutionary tree. Conclusions The PePV genome has a unique layout of the early protein region which represents a novel prototypic genomic organization for avian papillomaviruses. The close relationship between PePV and FPV, and between their Psittaciformes and Passeriformes hosts, supports the hypothesis that papillomaviruses have co-evolved and speciated together with their host species throughout evolution.

  8. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  9. Genomic diversity and phylogenetic relationships in the genus Parthenium (Asteraceae)

    Science.gov (United States)

    Guayule (Parthenium argentatum A. Gray) is a perennial hardwood shrub native to the North American Chihuahuan Desert that holds promise as a sustainable source of natural rubber and hypoallergenic latex. The improvement of guayule for commercial-scale production could be potentially accelerated thro...

  10. Mitochondrial genome and phylogenetic position of the sliteye shark Loxodon macrorhinus.

    Science.gov (United States)

    Wang, Junjie; Chen, Hao; Lin, Lingling; Ai, Weiming; Chen, Xiao

    2016-11-01

    The sliteye shark Loxodon macrorhinus is the only member of the genus Loxodon in the family Carcharhinidae. In this study, we first present the complete mitochondrial genome of L. macrorhinus and determine its phylogenetic position within Carcharhinidae based on relative mitogenomes. The mitochondrial genome was 16 702 bp in length with the typical gene order in vertebrates. The overall base composition of the H-strand was 31.7% A, 25.8% C, 13.1% G, and 29.4% T. Two start codons (ATG and GTG) and three stop codons (TAG, AGG, and TAA/T) were found in the protein-coding genes. The tRNA genes ranged from 67 bp to 75 bp. Loxodon macrorhinus was placed as sister to the genus Scoliodon in the Bayesian tree.

  11. Phylogenetic and genomic characterization of a novel atypical porcine pestivirus in China.

    Science.gov (United States)

    Zhang, H; Wen, W; Hao, G; Hu, Y; Chen, H; Qian, P; Li, X

    2018-02-01

    Atypical porcine pestivirus (APPV) has been considered a novel pestivirus and causative agent of congenital tremor type A-II. An APPV CH-GX2016 strain was characterized from newly born piglets with clinical symptoms of congenital tremor in Guangxi, China. The genome of APPV CH-GX 2016 strain was 11,475 bp in length and encoded a polyprotein composed of the 3,635 amino acids. This genome sequence exhibited 88.0% to 90.8% nucleotide sequence homology with other APPV reference sequences in GenBank. Phylogenetic analysis further showed that APPV CH-GX is a novel pestivirus compared with previously described classical pestivirus strains. Therefore, APPV is present in pigs in China. © 2017 Blackwell Verlag GmbH.

  12. Phylogenetic relationships among East African haplochromine fish as revealed by short interspersed elements (SINEs).

    Science.gov (United States)

    Terai, Yohey; Takezaki, Naoko; Mayer, Werner E; Tichy, Herbert; Takahata, Naoyuki; Klein, Jan; Okada, Norihiro

    2004-01-01

    Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine (cichlid) fish and used to isolate and characterize a set of short interspersed elements (SINEs). The distribution and sequences of the SINEs were used to infer phylogenetic relationships among East African haplochromines. The SINE-based classification divides the fish into four groups, which, in order of their divergence from a stem lineage, are the endemic Lake Tanganyika flock (group 1); fish of the nonendemic, monotypic, widely distributed genus Astatoreochromis (group 2); the endemic Lake Malawi flock (group 3); and group 4, which contains fish from widely dispersed East African localities including Lakes Victoria, Edward, George, Albert, and Rukwa, as well as many rivers. The group 4 haplochromines are characterized by a subset of polymorphic SINEs, each of which is present in some individuals and absent in others of the same population at a given locality, the same morphologically defined species, and the same mtDNA-defined haplogroup. SINE-defined group 4 contains six of the seven previously described mtDNA haplogroups. One of the polymorphic SINEs appears to be fixed in the endemic Lake Victoria flock; four others display the presence-or-absence polymorphism within the species of this flock. These findings have implications for the origin of Lake Victoria cichlids and for their founding population sizes.

  13. Phylogenetic relationships of North American Gomphidae and their close relatives

    Science.gov (United States)

    Intrafamilial relationships among clubtail dragonflies (Gomphidae) have been the subject of many morphological studies, but have not yet been systematically evaluated using molecular data. Here we present the first molecular phylogeny of Gomphidae. We include six of the eight sub...

  14. Fast and accurate phylogenetic reconstruction from high-resolution whole-genome data and a novel robustness estimator.

    Science.gov (United States)

    Lin, Y; Rajan, V; Moret, B M E

    2011-09-01

    The rapid accumulation of whole-genome data has renewed interest in the study of genomic rearrangements. Comparative genomics, evolutionary biology, and cancer research all require models and algorithms to elucidate the mechanisms, history, and consequences of these rearrangements. However, even simple models lead to NP-hard problems, particularly in the area of phylogenetic analysis. Current approaches are limited to small collections of genomes and low-resolution data (typically a few hundred syntenic blocks). Moreover, whereas phylogenetic analyses from sequence data are deemed incomplete unless bootstrapping scores (a measure of confidence) are given for each tree edge, no equivalent to bootstrapping exists for rearrangement-based phylogenetic analysis. We describe a fast and accurate algorithm for rearrangement analysis that scales up, in both time and accuracy, to modern high-resolution genomic data. We also describe a novel approach to estimate the robustness of results-an equivalent to the bootstrapping analysis used in sequence-based phylogenetic reconstruction. We present the results of extensive testing on both simulated and real data showing that our algorithm returns very accurate results, while scaling linearly with the size of the genomes and cubically with their number. We also present extensive experimental results showing that our approach to robustness testing provides excellent estimates of confidence, which, moreover, can be tuned to trade off thresholds between false positives and false negatives. Together, these two novel approaches enable us to attack heretofore intractable problems, such as phylogenetic inference for high-resolution vertebrate genomes, as we demonstrate on a set of six vertebrate genomes with 8,380 syntenic blocks. A copy of the software is available on demand.

  15. Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae.

    Science.gov (United States)

    Liu, Zhi-Qiang; Liu, Yan-Feng; Kuermanali, Nuer; Wang, Deng-Feng; Chen, Shi-Jun; Guo, Hui-Ling; Zhao, Li; Wang, Jun-Wei; Han, Tao; Wang, Yuan-Zhi; Wang, Jie; Shen, Chen-Feng; Zhang, Zhuang-Zhi; Chen, Chuang-Fu

    2018-01-01

    Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that

  16. Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates.

    Science.gov (United States)

    Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina

    2018-05-10

    Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.

  17. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  18. Comparative Genomic and Phylogenetic Analysis of a Shiga Toxin Producing Shigella sonnei (STSS Strain

    Directory of Open Access Journals (Sweden)

    Domonkos Sváb

    2017-05-01

    Full Text Available Shigella strains are important agents of bacillary dysentery, and in recent years Shigella sonnei has emerged as the leading cause of shigellosis in industrialized and rapidly developing countries. More recently, several S. sonnei and Shigella flexneri strains producing Shiga toxin (Stx have been reported from sporadic cases and from an outbreak in America. In the present study we aimed to shed light on the evolution of a recently identified Shiga toxin producing S. sonnei (STSS isolated in Europe. Here we report the first completely assembled whole genome sequence of a multidrug resistant (MDR Stx-producing S. sonnei (STSS clinical strain and reveal its phylogenetic relations. STSS 75/02 proved to be resistant to ampicillin, streptomycin, tetracycline, chloramphenicol, thrimetoprim, and sulfomethoxazol. The genome of STSS 75/02 contains a 4,891,717 nt chromosome and seven plasmids including the 214 kb invasion plasmid (pInv harboring type III secretion system genes and associated effectors. The chromosome harbors 23 prophage regions including the Stx1 converting prophage. The genome carries all virulence determinants necessary for an enteroinvasive lifestyle, as well as the Stx1 encoding gene cluster within an earlier described inducible converting prophage. In silico SNP genotyping of the assembled genome as well as 438 complete or draft S. sonnei genomes downloaded from NCBI GenBank revealed that S. sonnei 75/02 belongs to the more recently diverged global MDR lineage (IIIc. Targeted screening of 1131 next-generation sequencing projects taken from NCBI Short Read Archive of confirms that only a few S. sonnei isolates are Stx positive. Our results suggest that the acquisition of Stx phages could have occurred in different environments as independent events and that multiple horizontal transfers are responsible for the appearance of Stx phages in S. sonnei strains.

  19. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  20. An improved model for whole genome phylogenetic analysis by Fourier transform.

    Science.gov (United States)

    Yin, Changchuan; Yau, Stephen S-T

    2015-10-07

    DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees

  1. Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes

    Science.gov (United States)

    Gallus, Susanne; Janke, Axel

    2017-01-01

    Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298

  2. Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

    Science.gov (United States)

    Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

    2017-10-01

    Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  4. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  5. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  6. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  7. Sequencing, description and phylogenetic analysis of the mitochondrial genome of Sarcocheilichthys sinensis sinensis (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Li, Chen; He, Liping; Chen, Chong; Cai, Lingchao; Chen, Pingping; Yang, Shoubao

    2016-01-01

    Sarcocheilichthys sinensis sinensis (Bleeker, 1871), is a small benthopelagic freshwater species with high nutritional and ornamental value. In this study, the complete mitochondrial genome of S. sinensis sinensis was determined; the phylogenetic analysis with another individual and closely related species of Sarcocheilichthys fishes was carried out. The complete mitogenome of S. sinensis sinensis was 16683 bp in length, consist of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 2 non-coding regions: (D-loop and OL). It indicated that D-loop, ND2, and CytB may be appropriate molecular markers for studying population genetics and conservation biology of Sarcocheilichthys fishes.

  8. Estimation of main diversification time-points of hantaviruses using phylogenetic analyses of complete genomes.

    Science.gov (United States)

    Castel, Guillaume; Tordo, Noël; Plyusnin, Alexander

    2017-04-02

    Because of the great variability of their reservoir hosts, hantaviruses are excellent models to evaluate the dynamics of virus-host co-evolution. Intriguing questions remain about the timescale of the diversification events that influenced this evolution. In this paper we attempted to estimate the first ever timing of hantavirus diversification based on thirty five available complete genomes representing five major groups of hantaviruses and the assumption of co-speciation of hantaviruses with their respective mammal hosts. Phylogenetic analyses were used to estimate the main diversification points during hantavirus evolution in mammals while host diversification was mostly estimated from independent calibrators taken from fossil records. Our results support an earlier developed hypothesis of co-speciation of known hantaviruses with their respective mammal hosts and hence a common ancestor for all hantaviruses carried by placental mammals. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Complete mitochondrial genome and the phylogenetic position of the Blotchy swell shark Cephaloscyllium umbratile.

    Science.gov (United States)

    Chen, Hao; Lin, Lingling; Chen, Xiao; Ai, Weiming; Chen, Shaobo

    2016-07-01

    In this study, the complete mitochondrial genome of the Blotchy swell shark Cephaloscyllium umbratile was determined. It was a circle molecular (16 698 bp), contained 37 genes with typical order to that of most other vertebrates. The nucleotide composition was 31.0% A, 24.0% C, 14.0% G, and 31.3% T. There were 26 bp short intergenic spaces located in 11 gene junctions and 28 bp overlaps located in 7 gene junctions in the whole mitogenome. Two start codons (GTG and ATG) and two stop codons (TAG and TAA/T) were used in the protein-coding genes. The phylogenetic result showed that C. umbratile was clustered with Scyliorhinus canicula and formed the Scyliorhinidae clade, which was the most basal clade within Carcharhiniformes, and Carcharhinidae is not monophyletic.

  10. Complete mitochondrial genome and phylogenetic position of the Sicklefin weasel shark Hemigaleus microstoma.

    Science.gov (United States)

    Mai, Quanfa; Li, Weidong; Chen, Hao; Ai, Weiming; Chen, Xiao

    2016-09-01

    The complete mitochondrial genome of the Sicklefin weasel shark Hemigaleus microstoma was first presented in this study. It was 16 701 bp in length with the typical gene arrangement in vertebrates. A total of 25 bp short intergenic spaces and 33 bp overlaps located in 12 and 9 gene junctions, respectively. The overall nucleotide composition was 31.0% A, 26.4% C, 13.5% G and 29.1% T. Two start (ATG and GTG) and three stop (TAG, AGG and TAA/T) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. In the phylogenetic tree, H. microstoma (Hemigaleidae) was placed as sister to Galeocerdo cuvier (Carcharhinidae).

  11. Multigene analysis of lophophorate and chaetognath phylogenetic relationships.

    Science.gov (United States)

    Helmkampf, Martin; Bruchhaus, Iris; Hausdorf, Bernhard

    2008-01-01

    Maximum likelihood and Bayesian inference analyses of seven concatenated fragments of nuclear-encoded housekeeping genes indicate that Lophotrochozoa is monophyletic, i.e., the lophophorate groups Bryozoa, Brachiopoda and Phoronida are more closely related to molluscs and annelids than to Deuterostomia or Ecdysozoa. Lophophorates themselves, however, form a polyphyletic assemblage. The hypotheses that they are monophyletic and more closely allied to Deuterostomia than to Protostomia can be ruled out with both the approximately unbiased test and the expected likelihood weights test. The existence of Phoronozoa, a putative clade including Brachiopoda and Phoronida, has also been rejected. According to our analyses, phoronids instead share a more recent common ancestor with bryozoans than with brachiopods. Platyhelminthes is the sister group of Lophotrochozoa. Together these two constitute Spiralia. Although Chaetognatha appears as the sister group of Priapulida within Ecdysozoa in our analyses, alternative hypothesis concerning chaetognath relationships could not be rejected.

  12. Mitochondrial genome of Pteronotus personatus (Chiroptera: Mormoopidae): comparison with selected bats and phylogenetic considerations.

    Science.gov (United States)

    López-Wilchis, Ricardo; Del Río-Portilla, Miguel Ángel; Guevara-Chumacero, Luis Manuel

    2017-02-01

    We described the complete mitochondrial genome (mitogenome) of the Wagner's mustached bat, Pteronotus personatus, a species belonging to the family Mormoopidae, and compared it with other published mitogenomes of bats (Chiroptera). The mitogenome of P. personatus was 16,570 bp long and contained a typically conserved structure including 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and one control region (D-loop). Most of the genes were encoded on the H-strand, except for eight tRNA and the ND6 genes. The order of protein-coding and rRNA genes was highly conserved in all mitogenomes. All protein-coding genes started with an ATG codon, except for ND2, ND3, and ND5, which initiated with ATA, and terminated with the typical stop codon TAA/TAG or the codon AGA. Phylogenetic trees constructed using Maximum Parsimony, Maximum Likelihood, and Bayesian inference methods showed an identical topology and indicated the monophyly of different families of bats (Mormoopidae, Phyllostomidae, Vespertilionidae, Rhinolophidae, and Pteropopidae) and the existence of two major clades corresponding to the suborders Yangochiroptera and Yinpterochiroptera. The mitogenome sequence provided here will be useful for further phylogenetic analyses and population genetic studies in mormoopid bats.

  13. Chromosomal Speciation in the Genomics Era: Disentangling Phylogenetic Evolution of Rock-wallabies.

    Science.gov (United States)

    Potter, Sally; Bragg, Jason G; Blom, Mozes P K; Deakin, Janine E; Kirkpatrick, Mark; Eldridge, Mark D B; Moritz, Craig

    2017-01-01

    The association of chromosome rearrangements (CRs) with speciation is well established, and there is a long history of theory and evidence relating to "chromosomal speciation." Genomic sequencing has the potential to provide new insights into how reorganization of genome structure promotes divergence, and in model systems has demonstrated reduced gene flow in rearranged segments. However, there are limits to what we can understand from a small number of model systems, which each only tell us about one episode of chromosomal speciation. Progressing from patterns of association between chromosome (and genic) change, to understanding processes of speciation requires both comparative studies across diverse systems and integration of genome-scale sequence comparisons with other lines of evidence. Here, we showcase a promising example of chromosomal speciation in a non-model organism, the endemic Australian marsupial genus Petrogale . We present initial phylogenetic results from exon-capture that resolve a history of divergence associated with extensive and repeated CRs. Yet it remains challenging to disentangle gene tree heterogeneity caused by recent divergence and gene flow in this and other such recent radiations. We outline a way forward for better integration of comparative genomic sequence data with evidence from molecular cytogenetics, and analyses of shifts in the recombination landscape and potential disruption of meiotic segregation and epigenetic programming. In all likelihood, CRs impact multiple cellular processes and these effects need to be considered together, along with effects of genic divergence. Understanding the effects of CRs together with genic divergence will require development of more integrative theory and inference methods. Together, new data and analysis tools will combine to shed light on long standing questions of how chromosome and genic divergence promote speciation.

  14. The Complete Plastid Genome Sequence of Madagascar Periwinkle Catharanthus roseus (L.) G. Don: Plastid Genome Evolution, Molecular Marker Identification, and Phylogenetic Implications in Asterids

    Science.gov (United States)

    Ku, Chuan; Chung, Wan-Chia; Chen, Ling-Ling; Kuo, Chih-Horng

    2013-01-01

    The Madagascar periwinkle ( Catharanthus roseus in the family Apocynaceae) is an important medicinal plant and is the source of several widely marketed chemotherapeutic drugs. It is also commonly grown for its ornamental values and, due to ease of infection and distinctiveness of symptoms, is often used as the host for studies on phytoplasmas, an important group of uncultivated plant pathogens. To gain insights into the characteristics of apocynaceous plastid genomes (plastomes), we used a reference-assisted approach to assemble the complete plastome of C . roseus , which could be applied to other C . roseus -related studies. The C . roseus plastome is the second completely sequenced plastome in the asterid order Gentianales. We performed comparative analyses with two other representative sequences in the same order, including the complete plastome of Coffea arabica (from the basal Gentianales family Rubiaceae) and the nearly complete plastome of Asclepias syriaca (Apocynaceae). The results demonstrated considerable variations in gene content and plastome organization within Apocynaceae, including the presence/absence of three essential genes (i.e., accD, clpP, and ycf1) and large size changes in non-coding regions (e.g., rps2-rpoC2 and IRb-ndhF). To find plastome markers of potential utility for Catharanthus breeding and phylogenetic analyses, we identified 41 C . roseus -specific simple sequence repeats. Furthermore, five intergenic regions with high divergence between C . roseus and three other euasterids I taxa were identified as candidate markers. To resolve the euasterids I interordinal relationships, 82 plastome genes were used for phylogenetic inference. With the addition of representatives from Apocynaceae and sampling of most other asterid orders, a sister relationship between Gentianales and Solanales is supported. PMID:23825699

  15. Characterization of the Complete Mitochondrial Genome Sequence of the Globose Head Whiptail Cetonurus globiceps (Gadiformes: Macrouridae and Its Phylogenetic Analysis.

    Directory of Open Access Journals (Sweden)

    Xiaofeng Shi

    Full Text Available The particular environmental characteristics of deep water such as its immense scale and high pressure systems, presents technological problems that have prevented research to broaden our knowledge of deep-sea fish. Here, we described the mitogenome sequence of a deep-sea fish, Cetonurus globiceps. The genome is 17,137 bp in length, with a standard set of 22 transfer RNA genes (tRNAs, two ribosomal RNA genes, 13 protein-coding genes, and two typical non-coding control regions. Additionally, a 70 bp tRNA(Thr-tRNA(Pro intergenic spacer is present. The C. globiceps mitogenome exhibited strand-specific asymmetry in nucleotide composition. The AT-skew and GC-skew values in the whole genome of C. globiceps were 0 and -0.2877, respectively, revealing that the H-strand had equal amounts of A and T and that the overall nucleotide composition was C skewed. All of the tRNA genes could be folded into cloverleaf secondary structures, while the secondary structure of tRNA(Ser(AGY lacked a discernible dihydrouridine stem. By comparing this genome sequence with the recognition sites in teleost species, several conserved sequence blocks were identified in the control region. However, the GTGGG-box, the typical characteristic of conserved sequence block E (CSB-E, was absent. Notably, tandem repeats were identified in the 3' portion of the control region. No similar repetitive motifs are present in most of other gadiform species. Phylogenetic analysis based on 12 protein coding genes provided strong support that C. globiceps was the most derived in the clade. Some relationships however, are in contrast with those presented in previous studies. This study enriches our knowledge of mitogenomes of the genus Cetonurus and provides valuable information on the evolution of Macrouridae mtDNA and deep-sea fish.

  16. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    Directory of Open Access Journals (Sweden)

    Allen Eric E

    2008-10-01

    Full Text Available Abstract Background The process of horizontal gene transfer (HGT is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogenetically atypical genes on a genome-wide basis, provides a means to solve this problem through lineage probability index (LPI ranking scores. LPI scores inversely reflect phylogenetic distance between a test amino acid sequence and its closest available database matches. Proteins with low LPI scores are good horizontal gene transfer candidates; those with high scores are not. Description The DarkHorse algorithm has been applied to 955 microbial genome sequences, and the results organized into a web-searchable relational database, called the DarkHorse HGT Candidate Resource http://darkhorse.ucsd.edu. Users can select individual genomes or groups of genomes to screen by LPI score, search for protein functions by descriptive annotation or amino acid sequence similarity, or select proteins with unusual G+C composition in their underlying coding sequences. The search engine reports LPI scores for match partners as well as query sequences, providing the opportunity to explore whether potential HGT donor sequences are phylogenetically typical or atypical within their own genomes. This information can be used to predict whether or not sufficient information is available to build a well-supported phylogenetic tree using the potential donor sequence. Conclusion The DarkHorse HGT Candidate database provides a powerful, flexible set of tools for identifying phylogenetically atypical proteins, allowing researchers to explore both individual HGT events in single genomes, and

  17. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  18. Characterization of the Complete Mitochondrion Genome of Diurnal Moth Amata emma (Butler) (Lepidoptera: Erebidae) and Its Phylogenetic Implications

    Science.gov (United States)

    Lu, Hui-Fen; Su, Tian-Juan; Luo, A-Rong; Zhu, Chao-Dong; Wu, Chun-Sheng

    2013-01-01

    Mitogenomes can provide information for phylogenetic analyses and evolutionary biology. The complete mitochondrial genome of Amata emma (Lepidoptera: Erebidae) was sequenced and analyzed in the study. The circular genome is 15,463 bp in size, with the gene content, orientation and order identical to other ditrysian insects. The genome composition of the major strand shows highly A+T biased and exhibits negative AT-skew and GC-skew. The initial codons are the canonical putative start codons ATN with the exception of cox1 gene which uses CGA instead. Ten genes share complete termination codons TAA, and three genes use incomplete stop codons TA or T. Additionally, the codon distribution and Relative Synonymous Codon Usage of the 13 PCGs in the A. emma mitogenome are consistent with those in other Noctuid mitogenomes. All tRNA genes have typical cloverleaf secondary structures, except for the trnS1 (AGN) gene, in which the dihydrouridine (DHU) arm is simplified down to a loop. The secondary structures of two rRNA genes broadly conform with the models proposed for these genes of other Lepidopteran insects. Except for the A+T-rich region, there are three major intergenic spacers, spanning at least 10 bp and five overlapping regions. There are obvious differences in the A+T-rich region between A. emma and other Lepidopteran insects reported previously except that the A+T-rich region contains an ‘ATAGA’ -like motif followed by a 19 bp poly-T stretch and a (AT)9 element preceded by the ‘ATTTA’ motif. It neither has a poly-A (in the α strand) upstream trnM nor potential stem-loop structures and just has some simple structures like (AT)nGTAT. The phylogenetic relationships based on nucleotide sequences of 13 PCGs using Bayesian inference and maximum likelihood methods provided a well-supported a broader outline of Lepidoptera and which agree with the traditional morphological classification and recently working, but with a much higher support. PMID:24069145

  19. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  20. Maximum likelihood phylogenetic reconstruction from high-resolution whole-genome data and a tree of 68 eukaryotes.

    Science.gov (United States)

    Lin, Yu; Hu, Fei; Tang, Jijun; Moret, Bernard M E

    2013-01-01

    The rapid accumulation of whole-genome data has renewed interest in the study of the evolution of genomic architecture, under such events as rearrangements, duplications, losses. Comparative genomics, evolutionary biology, and cancer research all require tools to elucidate the mechanisms, history, and consequences of those evolutionary events, while phylogenetics could use whole-genome data to enhance its picture of the Tree of Life. Current approaches in the area of phylogenetic analysis are limited to very small collections of closely related genomes using low-resolution data (typically a few hundred syntenic blocks); moreover, these approaches typically do not include duplication and loss events. We describe a maximum likelihood (ML) approach for phylogenetic analysis that takes into account genome rearrangements as well as duplications, insertions, and losses. Our approach can handle high-resolution genomes (with 40,000 or more markers) and can use in the same analysis genomes with very different numbers of markers. Because our approach uses a standard ML reconstruction program (RAxML), it scales up to large trees. We present the results of extensive testing on both simulated and real data showing that our approach returns very accurate results very quickly. In particular, we analyze a dataset of 68 high-resolution eukaryotic genomes, with from 3,000 to 42,000 genes, from the eGOB database; the analysis, including bootstrapping, takes just 3 hours on a desktop system and returns a tree in agreement with all well supported branches, while also suggesting resolutions for some disputed placements.

  1. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  2. A genome-wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land.

    Science.gov (United States)

    Caputi, Lorenzo; Malnoy, Mickael; Goremykin, Vadim; Nikiforova, Svetlana; Martens, Stefan

    2012-03-01

    For almost a decade, our knowledge on the organisation of the family 1 UDP-glycosyltransferases (UGTs) has been limited to the model plant A. thaliana. The availability of other plant genomes represents an opportunity to obtain a broader view of the family in terms of evolution and organisation. Family 1 UGTs are known to glycosylate several classes of plant secondary metabolites. A phylogeny reconstruction study was performed to get an insight into the evolution of this multigene family during the adaptation of plants to life on land. The organisation of the UGTs in the different organisms was also investigated. More than 1500 putative UGTs were identified in 12 fully sequenced and assembled plant genomes based on the highly conserved PSPG motif. Analyses by maximum likelihood (ML) method were performed to reconstruct the phylogenetic relationships existing between the sequences. The results of this study clearly show that the UGT family expanded during the transition from algae to vascular plants and that in higher plants the clustering of UGTs into phylogenetic groups appears to be conserved, although gene loss and gene gain events seem to have occurred in certain lineages. Interestingly, two new phylogenetic groups, named O and P, that are not present in A. thaliana were discovered. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  3. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

    Science.gov (United States)

    Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

    2016-09-02

    Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal

  4. Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

    Science.gov (United States)

    Wen, Chiu-Ming

    2017-08-01

    An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

  5. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    Science.gov (United States)

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Exploring the Genomic Roadmap and Molecular Phylogenetics Associated with MODY Cascades Using Computational Biology.

    Science.gov (United States)

    Chakraborty, Chiranjib; Bandyopadhyay, Sanghamitra; Doss, C George Priya; Agoramoorthy, Govindasamy

    2015-04-01

    Maturity onset diabetes of the young (MODY) is a metabolic and genetic disorder. It is different from type 1 and type 2 diabetes with low occurrence level (1-2%) among all diabetes. This disorder is a consequence of β-cell dysfunction. Till date, 11 subtypes of MODY have been identified, and all of them can cause gene mutations. However, very little is known about the gene mapping, molecular phylogenetics, and co-expression among MODY genes and networking between cascades. This study has used latest servers and software such as VarioWatch, ClustalW, MUSCLE, G Blocks, Phylogeny.fr, iTOL, WebLogo, STRING, and KEGG PATHWAY to perform comprehensive analyses of gene mapping, multiple sequences alignment, molecular phylogenetics, protein-protein network design, co-expression analysis of MODY genes, and pathway development. The MODY genes are located in chromosomes-2, 7, 8, 9, 11, 12, 13, 17, and 20. Highly aligned block shows Pro, Gly, Leu, Arg, and Pro residues are highly aligned in the positions of 296, 386, 437, 455, 456 and 598, respectively. Alignment scores inform us that HNF1A and HNF1B proteins have shown high sequence similarity among MODY proteins. Protein-protein network design shows that HNF1A, HNF1B, HNF4A, NEUROD1, PDX1, PAX4, INS, and GCK are strongly connected, and the co-expression analyses between MODY genes also show distinct association between HNF1A and HNF4A genes. This study has used latest tools of bioinformatics to develop a rapid method to assess the evolutionary relationship, the network development, and the associations among eleven MODY genes and cascades. The prediction of sequence conservation, molecular phylogenetics, protein-protein network and the association between the MODY cascades enhances opportunities to get more insights into the less-known MODY disease.

  7. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  8. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  9. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  10. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  11. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  12. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  13. Prevalence, complete genome sequencing and phylogenetic analysis of porcine deltacoronavirus in South Korea, 2014-2016.

    Science.gov (United States)

    Jang, G; Lee, K-K; Kim, S-H; Lee, C

    2017-10-01

    Porcine deltacoronavirus (PDCoV) is a newly emerged enterotropic swine coronavirus that causes enteritis and diarrhoea in piglets. Here, a nested reverse transcription (RT)-PCR approach for the detection of PDCoV was developed to identify and characterize aetiologic agent(s) associated with diarrhoeal diseases in piglets in South Korea. A PCR-based method was applied to investigate the presence of PDCoV in 683 diarrhoeic samples collected from 449 commercial pig farms in South Korea from January 2014 to December 2016. The molecular-based survey indicated a relatively high prevalence of PDCoV (19.03%) in South Korea. Among those, the monoinfection of PDCoV (9.66%) and co-infection of PDCoV (6.30%) with porcine epidemic diarrhoea (PEDV) were predominant in diarrhoeal samples. The full-length genomes or the complete spike genes of the most recent strains identified in 2016 (KNU16-07, KNU16-08 and KNU16-11) were sequenced and analysed to characterize PDCoV currently prevalent in South Korea. We found a single insertion-deletion signature and dozens of genetic changes in the spike (S) genes of the KNU16 isolates. Phylogenetic analysis based on the entire genome and spike protein sequences of these strains indicated that they are most closely related to other Korean isolates grouped with the US strains. However, Korean PDCoV strains formed different branches within the same cluster, implying continuous evolution in the field. Our data will advance the understanding of the molecular epidemiology and evolutionary characteristics of PDCoV circulating in South Korea. © 2017 Blackwell Verlag GmbH.

  14. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  15. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  16. Distinct gene number-genome size relationships for eukaryotes and non-eukaryotes: gene content estimation for dinoflagellate genomes.

    Directory of Open Access Journals (Sweden)

    Yubo Hou

    Full Text Available The ability to predict gene content is highly desirable for characterization of not-yet sequenced genomes like those of dinoflagellates. Using data from completely sequenced and annotated genomes from phylogenetically diverse lineages, we investigated the relationship between gene content and genome size using regression analyses. Distinct relationships between log(10-transformed protein-coding gene number (Y' versus log(10-transformed genome size (X', genome size in kbp were found for eukaryotes and non-eukaryotes. Eukaryotes best fit a logarithmic model, Y' = ln(-46.200+22.678X', whereas non-eukaryotes a linear model, Y' = 0.045+0.977X', both with high significance (p0.91. Total gene number shows similar trends in both groups to their respective protein coding regressions. The distinct correlations reflect lower and decreasing gene-coding percentages as genome size increases in eukaryotes (82%-1% compared to higher and relatively stable percentages in prokaryotes and viruses (97%-47%. The eukaryotic regression models project that the smallest dinoflagellate genome (3x10(6 kbp contains 38,188 protein-coding (40,086 total genes and the largest (245x10(6 kbp 87,688 protein-coding (92,013 total genes, corresponding to 1.8% and 0.05% gene-coding percentages. These estimates do not likely represent extraordinarily high functional diversity of the encoded proteome but rather highly redundant genomes as evidenced by high gene copy numbers documented for various dinoflagellate species.

  17. Extracting phylogenetic signal and accounting for bias in whole-genome data sets supports the Ctenophora as sister to remaining Metazoa.

    Science.gov (United States)

    Borowiec, Marek L; Lee, Ernest K; Chiu, Joanna C; Plachetzki, David C

    2015-11-23

    Understanding the phylogenetic relationships among major lineages of multicellular animals (the Metazoa) is a prerequisite for studying the evolution of complex traits such as nervous systems, muscle tissue, or sensory organs. Transcriptome-based phylogenies have dramatically improved our understanding of metazoan relationships in recent years, although several important questions remain. The branching order near the base of the tree, in particular the placement of the poriferan (sponges, phylum Porifera) and ctenophore (comb jellies, phylum Ctenophora) lineages is one outstanding issue. Recent analyses have suggested that the comb jellies are sister to all remaining metazoan phyla including sponges. This finding is surprising because it suggests that neurons and other complex traits, present in ctenophores and eumetazoans but absent in sponges or placozoans, either evolved twice in Metazoa or were independently, secondarily lost in the lineages leading to sponges and placozoans. To address the question of basal metazoan relationships we assembled a novel dataset comprised of 1080 orthologous loci derived from 36 publicly available genomes representing major lineages of animals. From this large dataset we procured an optimized set of partitions with high phylogenetic signal for resolving metazoan relationships. This optimized data set is amenable to the most appropriate and computationally intensive analyses using site-heterogeneous models of sequence evolution. We also employed several strategies to examine the potential for long-branch attraction to bias our inferences. Our analyses strongly support the Ctenophora as the sister lineage to other Metazoa. We find no support for the traditional view uniting the ctenophores and Cnidaria. Our findings are supported by Bayesian comparisons of topological hypotheses and we find no evidence that they are biased by long-branch attraction. Our study further clarifies relationships among early branching metazoan lineages

  18. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  19. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  20. Comparative Genomic Analysis of Clinical and Environmental Vibrio Vulnificus Isolates Revealed Biotype 3 Evolutionary Relationships

    Directory of Open Access Journals (Sweden)

    Yael eKotton

    2015-01-01

    Full Text Available In 1996 a common-source outbreak of severe soft tissue and bloodstream infections erupted among Israeli fish farmers and fish consumers due to changes in fish marketing policies. The causative pathogen was a new strain of Vibrio vulnificus, named biotype 3, which displayed a unique biochemical and genotypic profile. Initial observations suggested that the pathogen erupted as a result of genetic recombination between two distinct populations. We applied a whole genome shotgun sequencing approach using several V. vulnificus strains from Israel in order to study the pan genome of V. vulnificus and determine the phylogenetic relationship of biotype 3 with existing populations. The core genome of V. vulnificus based on 16 draft and complete genomes consisted of 3068 genes, representing between 59% and 78% of the whole genome of 16 strains. The accessory genome varied in size from 781 kbp to 2044 kbp. Phylogenetic analysis based on whole, core, and accessory genomes displayed similar clustering patterns with two main clusters, clinical (C and environmental (E, all biotype 3 strains formed a distinct group within the E cluster. Annotation of accessory genomic regions found in biotype 3 strains and absent from the core genome yielded 1732 genes, of which the vast majority encoded hypothetical proteins, phage-related proteins, and mobile element proteins. A total of 1916 proteins (including 713 hypothetical proteins were present in all human pathogenic strains (both biotype 3 and non-biotype 3 and absent from the environmental strains. Clustering analysis of the non-hypothetical proteins revealed 148 protein clusters shared by all human pathogenic strains; these included transcriptional regulators, arylsulfatases, methyl-accepting chemotaxis proteins, acetyltransferases, GGDEF family proteins, transposases, type IV secretory system (T4SS proteins, and integrases. Our study showed that V. vulnificus biotype 3 evolved from environmental populations and

  1. Light in the darkness: New perspective on lanternfish relationships and classification using genomic and morphological data.

    Science.gov (United States)

    Martin, Rene P; Olson, Emily E; Girard, Matthew G; Smith, Wm Leo; Davis, Matthew P

    2018-04-01

    Massive parallel sequencing allows scientists to gather DNA sequences composed of millions of base pairs that can be combined into large datasets and analyzed to infer organismal relationships at a genome-wide scale in non-model organisms. Although the use of these large datasets is becoming more widespread, little to no work has been done in estimating phylogenetic relationships using UCEs in deep-sea fishes. Among deep-sea animals, the 257 species of lanternfishes (Myctophiformes) are among the most important open-ocean lineages, representing half of all mesopelagic vertebrate biomass. With this relative abundance, they are key members of the midwater food web where they feed on smaller invertebrates and fishes in addition to being a primary prey item for other open-ocean animals. Understanding the evolution and relationships of midwater organisms generally, and this dominant group of fishes in particular, is necessary for understanding and preserving the underexplored deep-sea ecosystem. Despite substantial congruence in the evolutionary relationships among deep-sea lanternfishes at higher classification levels in previous studies, the relationships among tribes, genera, and species within Myctophidae often conflict across phylogenetic studies or lack resolution and support. Herein we provide the first genome-scale phylogenetic analysis of lanternfishes, and we integrate these data from across the nuclear genome with additional protein-coding gene sequences and morphological data to further test evolutionary relationships among lanternfishes. Our phylogenetic hypotheses of relationships among lanternfishes are entirely congruent across a diversity of analyses that vary in methods, taxonomic sampling, and data analyzed. Within the Myctophiformes, the Neoscopelidae is inferred to be monophyletic and sister to a monophyletic Myctophidae. The current classification of lanternfishes is incongruent with our phylogenetic tree, so we recommend revisions that retain much

  2. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  3. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  4. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  5. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  6. Comparative genomics of the relationship between gene structure and expression

    NARCIS (Netherlands)

    Ren, X.

    2006-01-01

    The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene

  7. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  8. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  9. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  10. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  11. Using phylogenetic and ionomic relationships to predict the uptake of radionuclides by any plant species

    Energy Technology Data Exchange (ETDEWEB)

    Willey, Neil J.; Siasou, Eleni [Centre for Research In Biosciences, University of the West of England, Coldharbour Lane, Frenchay, Bristol BS16 1QY (United Kingdom)

    2014-07-01

    It is not practical to empirically derive soil-to-plant TFs for all soil-plant combinations that are important in radiological assessments, so predictions for a range of species on different soils types are frequently impossible because TFs are unknown. This severely hampers predictions of both doses to biota and of the contamination of a variety of food chains with radioisotopes. Compilations of TFs in themselves provide no fundamental understanding of the plant factors that control the soil-to-plant transfer of radionuclides and thus no method of prediction. We have developed methods for the meta-analyses of radionuclide transfer data that can be used to make predictions of the transfer of radionuclides into any plants species for which TFs do not exist based on an understand of the plant factors that control radionuclide uptake. There is no reason a priori to think that variation in TF should be constrained by species. The species is, essentially, a reproductive unit and variation in many plant traits, some of which might control radionuclide uptake, occurs at taxonomic levels above the species. In the last 15 years genomic information has transformed the understanding of the evolutionary relationships of the living world so that new 'trees of life' (phylogenies) are now available. Using a Residual Maximum Likelihood modeling procedure to compile a significant proportion of all existing TF data onto a single scale, we here present a synthesis of the influence of phylogeny on variation in soil-to-plant TFs for radioisotopes of Cs, Sr, Co, I, Tc, and S. We show that a significant proportion of variation in TF is associated with major branches of the phylogeny of angiosperms (flowering plants) so that knowledge of a species' position on the phylogeny can be used to make predictions of transfer relative to other species. These phylogenetically-based predictions of relative transfer to any species can be used to make absolute predictions to any species

  12. Sequence Capture and Phylogenetic Utility of Genomic Ultraconserved Elements Obtained from Pinned Insect Specimens.

    Directory of Open Access Journals (Sweden)

    Bonnie B Blaimer

    Full Text Available Obtaining sequence data from historical museum specimens has been a growing research interest, invigorated by next-generation sequencing methods that allow inputs of highly degraded DNA. We applied a target enrichment and next-generation sequencing protocol to generate ultraconserved elements (UCEs from 51 large carpenter bee specimens (genus Xylocopa, representing 25 species with specimen ages ranging from 2-121 years. We measured the correlation between specimen age and DNA yield (pre- and post-library preparation DNA concentration and several UCE sequence capture statistics (raw read count, UCE reads on target, UCE mean contig length and UCE locus count with linear regression models. We performed piecewise regression to test for specific breakpoints in the relationship of specimen age and DNA yield and sequence capture variables. Additionally, we compared UCE data from newer and older specimens of the same species and reconstructed their phylogeny in order to confirm the validity of our data. We recovered 6-972 UCE loci from samples with pre-library DNA concentrations ranging from 0.06-9.8 ng/μL. All investigated DNA yield and sequence capture variables were significantly but only moderately negatively correlated with specimen age. Specimens of age 20 years or less had significantly higher pre- and post-library concentrations, UCE contig lengths, and locus counts compared to specimens older than 20 years. We found breakpoints in our data indicating a decrease of the initial detrimental effect of specimen age on pre- and post-library DNA concentration and UCE contig length starting around 21-39 years after preservation. Our phylogenetic results confirmed the integrity of our data, giving preliminary insights into relationships within Xylocopa. We consider the effect of additional factors not measured in this study on our age-related sequence capture results, such as DNA fragmentation and preservation method, and discuss the promise of the UCE

  13. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  14. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  15. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  16. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  17. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  20. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  1. Characterization and phylogenetic analysis of complete mitochondrial genomes for two desert cyprinodontoid fishes, Empetrichthys latos and Crenichthys baileyi.

    Science.gov (United States)

    Jimenez, Miguel; Goodchild, Shawn C; Stockwell, Craig A; Lema, Sean C

    2017-08-30

    The Pahrump poolfish (Empetrichthys latos) and White River springfish (Crenichthys baileyi) are small-bodied teleost fishes (order Cyprinodontiformes) endemic to the arid Great Basin and Mojave Desert regions of western North America. These taxa survive as small, isolated populations in remote streams and springs and evolved to tolerate extreme conditions of high temperature and low dissolved oxygen. Both species have experienced severe population declines over the last 50-60years that led to some subspecies being categorized with protected status under the U.S. Endangered Species Act. Here we report the first sequencing of the complete mitochondrial DNA genomes for both E. l. latos and the moapae subspecies of C. baileyi. Complete mitogenomes of 16,546bp nucleotides were obtained from two E. l. latos individuals collected from introduced populations at Spring Mountain Ranch State Park and Shoshone Ponds Natural Area, Nevada, USA, while a single mitogenome of 16,537bp was sequenced for C. b. moapae. The mitogenomes of both species contain 13 protein-encoding genes, twenty-two tRNAs, and two rRNAs (12S and 18S) following the syntenic arrangement typical of Actinopterygiian fish mitogenomes, as well as D-loop control regions of 858bp for E. latos and 842bp for C. baileyi moapae. The two E. latos individuals exhibited only 0.0181% nucleotide sequence divergence across the entire mitogenome, implying little intraspecific mtDNA genetic variation. Comparative phylogenetic analysis of the poolfish and springfish mitochondrial genomes to available mitogenomes of other Cyprinodontoid fishes confirmed the close relationship of these oviparous Empetrichthys and Crenichthys genera to the viviparous goodeid fishes of central Mexico, and showed the combined clade of these fishes to be a sister group to the Profundulidae killifishes. Despite several significant life history and morphological differences between the Empetrichthyinae and Goodienae, estimates of evolutionary genetic

  2. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  3. Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

    Directory of Open Access Journals (Sweden)

    Edgar E. Lara-Ramírez

    2014-01-01

    Full Text Available The increasing number of dengue virus (DENV genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4 has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3 as well as the effective number of codons (ENC, ENCp versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA and clustering analysis on relative synonymous codon usage (RSCU within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution.

  4. Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

    Science.gov (United States)

    Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

    2014-01-01

    The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

  5. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  6. Next-generation sequencing and phylogenetic signal of complete mitochondrial genomes for resolving the evolutionary history of leaf-nosed bats (Phyllostomidae).

    Science.gov (United States)

    Botero-Castro, Fidel; Tilak, Marie-ka; Justy, Fabienne; Catzeflis, François; Delsuc, Frédéric; Douzery, Emmanuel J P

    2013-12-01

    Leaf-nosed bats (Phyllostomidae) are one of the most studied groups within the order Chiroptera mainly because of their outstanding species richness and diversity in morphological and ecological traits. Rapid diversification and multiple homoplasies have made the phylogeny of the family difficult to solve using morphological characters. Molecular data have contributed to shed light on the evolutionary history of phyllostomid bats, yet several relationships remain unresolved at the intra-familial level. Complete mitochondrial genomes have proven useful to deal with this kind of situation in other groups of mammals by providing access to a large number of molecular characters. At present, there are only two mitogenomes available for phyllostomid bats hinting at the need for further exploration of the mitogenomic approach in this group. We used both standard Sanger sequencing of PCR products and next-generation sequencing (NGS) of shotgun genomic DNA to obtain new complete mitochondrial genomes from 10 species of phyllostomid bats, including representatives of major subfamilies, plus one outgroup belonging to the closely-related mormoopids. We then evaluated the contribution of mitogenomics to the resolution of the phylogeny of leaf-nosed bats and compared the results to those based on mitochondrial genes and the RAG2 and VWF nuclear makers. Our results demonstrate the advantages of the Illumina NGS approach to efficiently obtain mitogenomes of phyllostomid bats. The phylogenetic signal provided by entire mitogenomes is highly comparable to the one of a concatenation of individual mitochondrial and nuclear markers, and allows increasing both resolution and statistical support for several clades. This enhanced phylogenetic signal is the result of combining markers with heterogeneous evolutionary rates representing a large number of nucleotide sites. Our results illustrate the potential of the NGS mitogenomic approach for resolving the evolutionary history of

  7. The phylogenetic position of the roughskin skate Dipturus trachyderma (Krefft & Stehmann, 1975) (Rajiformes, Rajidae) inferred from the mitochondrial genome.

    Science.gov (United States)

    Vargas-Caro, Carolina; Bustamante, Carlos; Lamilla, Julio; Bennett, Michael B; Ovenden, Jennifer R

    2016-07-01

    The complete mitochondrial genome of the roughskin skate Dipturus trachyderma is described from 1 455 724 sequences obtained using Illumina NGS technology. Total length of the mitogenome was 16 909 base pairs, comprising 2 rRNAs, 13 protein-coding genes, 22 tRNAs and 2 non-coding regions. Phylogenetic analysis based on mtDNA revealed low genetic divergence among longnose skates, in particular, those dwelling the continental shelf and slope off the coasts of Chile and Argentina.

  8. Species delimitation and interspecific relationships of the genus Orychophragmus (Brassicaceae inferred from whole chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Huan Hu

    2016-12-01

    Full Text Available IntroductionIt is rather difficult to delimit recently diverged species and construct their interspecific relationships because of insufficient informative variations of sampled DNA fragments (Schluter, 2000; Arnold, 2006. The genome-scale sequence variations were found to increase the phylogenetic resolutions of both high- and low-taxonomic groups (e.g., Yoder et al., 2013; Lamichhaney et al., 2015. It is still expensive to collect nuclear genome variations between species for most none-model genera without the reference genome. However, chloroplast genomes (plastome are relatively easy to be assembled to examine interspecific relationships for phylogenetic analyses, especially in addressing unresolved relationship at low taxonomic levels (Wu et al., 2010; Nock et al., 2011; Yang et al., 2013; Huang et al., 2014; Carbonell-Caballero et al., 2015. Plastomes are haploid with maternal inheritance in most angiosperms (Corriveau and Coleman, 1988; Zhang and Liu, 2003; Hagemann, 2004 and are highly conservative in gene order and genome structure with rare recombinations (Jansen et al., 2007; Moore et al., 2010. In this study, we aimed to examine species delimitation and interspecific relationships in Orychophragmus through assembling chloroplast genomes of multiple individuals of tentatively delimited species (Hu et al., 2015a. Orychophragmus is a small genus in the mustard family (Brassicaceae, Cruciferae distributed in northern, central, and southeastern China (Zhou et al., 2001. Its plants have been widely cultivated as ornamentals, vegetables, or source of seed oil (Sun et al., 2011. Despite controversial species delimitations in the genus (Zhou et al., 1987; Tan et al., 1998; Wu and Zhao, 2003; Al-Shehbaz and Yang, 2000; Zhou et al., 2001; Sun et al., 2012, our recent study based on nuclear (nr ITS sequence variations suggested the recognition of seven species (Hu et al., 2015a. Orychophragmus is sister to Sinalliaria, which is a genus endemic

  9. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource.

    Science.gov (United States)

    Sharpton, Thomas J; Jospin, Guillaume; Wu, Dongying; Langille, Morgan G I; Pollard, Katherine S; Eisen, Jonathan A

    2012-10-13

    New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as "Sifting Families," or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology-based analyses. We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/).

  10. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  11. Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

    Science.gov (United States)

    Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

    2007-01-01

    The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

  12. The complete mitochondrial genome of the styloperlid stonefly species Styloperla spinicercia Wu (Insecta: Plecoptera) with family-level phylogenetic analyses of the Pteronarcyoidea.

    Science.gov (United States)

    Wang, Ying; Cao, Jinjun; Li, Weihai

    2017-03-13

    We present the complete mitochondrial (mt) genome sequence of the stonefly, Styloperla spinicercia Wu, 1935 (Plecoptera: Styloperlidae), the type species of the genus Styloperla and the first complete mt genome for the family Styloperlidae. The genome is circular, 16,129 base pairs long, has an A+T content of 70.7%, and contains 37 genes including the large and small ribosomal RNA (rRNA) subunits, 13 protein coding genes (PCGs), 22 tRNA genes and a large non-coding region (CR). All of the PCGs use the standard initiation codon ATN except ND1 and ND5, which start with TTG and GTG. Twelve of the PCGs stop with conventional terminal codons TAA and TAG, except ND5 which shows an incomplete terminator signal T. All tRNAs have the classic clover-leaf structures with the dihydrouridine (DHU) arm of tRNASer(AGN) forming a simple loop. Secondary structures of the two ribosomal RNAs are presented with reference to previous models. The structural elements and the variable numbers of tandem repeats are described within the control region. Phylogenetic analyses using both Bayesian (BI) and Maximum Likelihood (ML) methods support the previous hypotheses regarding family level relationships within the Pteronarcyoidea. The genetic distance calculated based on 13 PCGs and two rRNAs between Styloperla sp. and S. spinicercia is provided and interspecific divergence is discussed.

  13. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  14. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  15. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  16. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  17. The complete mitochondrial genome of the enigmatic bigheadedturtle (Platysternon): description of unusual genomic features and thereconciliation of phylogenetic hypotheses based on mitochondrial andnuclear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Parham, James F.; Feldman, Chris R.; Boore, Jeffrey L.

    2005-12-28

    The big-headed turtle (Platysternon megacephalum) from east Asia is the sole living representative of a poorly-studied turtle lineage (Platysternidae). It has no close living relatives, and its phylogenetic position within turtles is one of the outstanding controversies in turtle systematics. Platysternon was traditionally considered to be close to snapping turtles (Chelydridae) based on some studies of its morphology and mitochondrial (mt) DNA, however, other studies of morphology and nuclear (nu) DNA do not support that hypothesis. We sequenced the complete mt genome of Platysternon and the nearly complete mt genomes of two other relevant turtles and compared them to turtle mt genomes from the literature to form the largest molecular dataset used to date to address this issue. The resulting phylogeny robustly rejects the placement of Platysternon with Chelydridae, but instead shows that it is a member of the Testudinoidea, a diverse, nearly globally-distributed group that includes pond turtles and tortoises. We also discovered that Platysternon mtDNA has large-scale gene rearrangements and possesses two, nearly identical, control regions, features that distinguish it from all other studied turtles. Our study robustly determines the phylogenetic placement of Platysternon and provides a well-resolved outline of major turtle lineages, while demonstrating the significantly greater resolving power of comparing large amounts of mt sequence over that of short fragments. Earlier phylogenies placing Platysternon with chelydrids required a temporal gap in the fossil record that is now unnecessary. The duplicated control regions and gene rearrangements of the Platysternon mt DNA probably resulted from the duplication of part of the genome and then the subsequent loss of redundant genes. Although it is possible that having two control regions may provide some advantage, explaining why the control regions would be maintained while some of the duplicated genes were eroded

  18. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis

    OpenAIRE

    Yang, Yilong; Davis, Thomas M

    2017-01-01

    Abstract The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Ac...

  19. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  1. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  2. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  3. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  4. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  5. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  6. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  7. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  8. Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Drautz, Daniela I; Lesk, Arthur M

    2008-01-01

    We report five new complete mitochondrial DNA (mtDNA) genomes of Siberian woolly mammoth (Mammuthus primigenius), sequenced with up to 73-fold coverage from DNA extracted from hair shaft material. Three of the sequences present the first complete mtDNA genomes of mammoth clade II. Analysis...... to indicate any important functional difference between genomes belonging to the two clades, suggesting that the loss of clade II more likely is due to genetic drift than a selective sweep....

  9. Genomic evidence of bitter taste in snakes and phylogenetic analysis of bitter taste receptor genes in reptiles

    Directory of Open Access Journals (Sweden)

    Huaming Zhong

    2017-08-01

    Full Text Available As nontraditional model organisms with extreme physiological and morphological phenotypes, snakes are believed to possess an inferior taste system. However, the bitter taste sensation is essential to distinguish the nutritious and poisonous food resources and the genomic evidence of bitter taste in snakes is largely scarce. To explore the genetic basis of the bitter taste of snakes and characterize the evolution of bitter taste receptor genes (Tas2rs in reptiles, we identified Tas2r genes in 19 genomes (species corresponding to three orders of non-avian reptiles. Our results indicated contractions of Tas2r gene repertoires in snakes, however dramatic gene expansions have occurred in lizards. Phylogenetic analysis of the Tas2rs with NJ and BI methods revealed that Tas2r genes of snake species formed two clades, whereas in lizards the Tas2r genes clustered into two monophyletic clades and four large clades. Evolutionary changes (birth and death of intact Tas2r genes in reptiles were determined by reconciliation analysis. Additionally, the taste signaling pathway calcium homeostasis modulator 1 (Calhm1 gene of snakes was putatively functional, suggesting that snakes still possess bitter taste sensation. Furthermore, Phylogenetically Independent Contrasts (PIC analyses reviewed a significant correlation between the number of Tas2r genes and the amount of potential toxins in reptilian diets, suggesting that insectivores such as some lizards may require more Tas2rs genes than omnivorous and carnivorous reptiles.

  10. Functional Genomics and Phylogenetic Evidence Suggest Genus-Wide Cobalamin Production by the Globally Distributed Marine Nitrogen Fixer Trichodesmium.

    Science.gov (United States)

    Walworth, Nathan G; Lee, Michael D; Suffridge, Christopher; Qu, Pingping; Fu, Fei-Xue; Saito, Mak A; Webb, Eric A; Sañudo-Wilhelmy, Sergio A; Hutchins, David A

    2018-01-01

    Only select prokaryotes can biosynthesize vitamin B 12 (i.e., cobalamins), but these organic co-enzymes are required by all microbial life and can be vanishingly scarce across extensive ocean biomes. Although global ocean genome data suggest cyanobacteria to be a major euphotic source of cobalamins, recent studies have highlighted that >95% of cyanobacteria can only produce a cobalamin analog, pseudo-B 12 , due to the absence of the BluB protein that synthesizes the α ligand 5,6-dimethylbenzimidizole (DMB) required to biosynthesize cobalamins. Pseudo-B 12 is substantially less bioavailable to eukaryotic algae, as only certain taxa can intracellularly remodel it to one of the cobalamins. Here we present phylogenetic, metagenomic, transcriptomic, proteomic, and chemical analyses providing multiple lines of evidence that the nitrogen-fixing cyanobacterium Trichodesmium transcribes and translates the biosynthetic, cobalamin-requiring BluB enzyme. Phylogenetic evidence suggests that the Trichodesmium DMB biosynthesis gene, bluB , is of ancient origin, which could have aided in its ecological differentiation from other nitrogen-fixing cyanobacteria. Additionally, orthologue analyses reveal two genes encoding iron-dependent B 12 biosynthetic enzymes (cbiX and isiB), suggesting that iron availability may be linked not only to new nitrogen supplies from nitrogen fixation, but also to B 12 inputs by Trichodesmium . These analyses suggest that Trichodesmium contains the genus-wide genomic potential for a previously unrecognized role as a source of cobalamins, which may prove to considerably impact marine biogeochemical cycles.

  11. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    Science.gov (United States)

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  12. Biosynthesis of ribose-5-phosphate and erythrose-4-phosphate in archaea: a phylogenetic analysis of archaeal genomes

    Directory of Open Access Journals (Sweden)

    Tim Soderberg

    2005-01-01

    Full Text Available A phylogenetic analysis of the genes encoding enzymes in the pentose phosphate pathway (PPP, the ribulose monophosphate (RuMP pathway, and the chorismate pathway of aromatic amino acid biosynthesis, employing data from 13 complete archaeal genomes, provides a potential explanation for the enigmatic phylogenetic patterns of the PPP genes in archaea. Genomic and biochemical evidence suggests that three archaeal species (Methanocaldococcus jannaschii, Thermoplasma acidophilum and Thermoplasma volcanium produce ribose-5-phosphate via the nonoxidative PPP (NOPPP, whereas nine species apparently lack an NOPPP but may employ a reverse RuMP pathway for pentose synthesis. One species (Halobacterium sp. NRC-1 lacks both the NOPPP and the RuMP pathway but may possess a modified oxidative PPP (OPPP, the details of which are not yet known. The presence of transketolase in several archaeal species that are missing the other two NOPPP genes can be explained by the existence of differing requirements for erythrose-4-phosphate (E4P among archaea: six species use transketolase to make E4P as a precursor to aromatic amino acids, six species apparently have an alternate biosynthetic pathway and may not require the ability to make E4P, and one species (Pyrococcus horikoshii probably does not synthesize aromatic amino acids at all.

  13. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    DEFF Research Database (Denmark)

    Willerslev, Eske; Gilbert, Tom; Binladen, Jonas

    2009-01-01

    BACKGROUND: The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based) approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which...

  14. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  15. Chloroplast Genome of the Folk Medicine and Vegetable Plant Talinum paniculatum (Jacq.) Gaertn.: Gene Organization, Comparative and Phylogenetic Analysis.

    Science.gov (United States)

    Liu, Xia; Li, Yuan; Yang, Hongyuan; Zhou, Boyang

    2018-04-09

    The complete chloroplast (cp) genome of Talinum paniculatum (Caryophyllale), a source of pharmaceutical efficacy similar to ginseng, and a widely distributed and planted edible vegetable, were sequenced and analyzed. The cp genome size of T. paniculatum is 156,929 bp, with a pair of inverted repeats (IRs) of 25,751 bp separated by a large single copy (LSC) region of 86,898 bp and a small single copy (SSC) region of 18,529 bp. The genome contains 83 protein-coding genes, 37 transfer RNA (tRNA) genes, eight ribosomal RNA (rRNA) genes and four pseudogenes. Fifty one (51) repeat units and ninety two (92) simple sequence repeats (SSRs) were found in the genome. The pseudogene rpl23 (Ribosomal protein L23) was insert AATT than other Caryophyllale species by sequence alignment, which located in IRs region. The gene of trnK-UUU (tRNA-Lys) and rpl16 (Ribosomal protein L16) have larger introns in T. paniculatum , and the existence of matK (maturase K) genes, which usually located in the introns of trnK-UUU , rich sequence divergence in Caryophyllale. Complete cp genome comparison with other eight Caryophyllales species indicated that the differences between T. paniculatum and P. oleracea were very slight, and the most highly divergent regions occurred in intergenic spacers. Comparisons of IR boundaries among nine Caryophyllales species showed that T. paniculatum have larger IRs region and the contraction is relatively slight. The phylogenetic analysis among 35 Caryophyllales species and two outgroup species revealed that T. paniculatum and P. oleracea do not belong to the same family. All these results give good opportunities for future identification, barcoding of Talinum species, understanding the evolutionary mode of Caryophyllale cp genome and molecular breeding of T. paniculatum with high pharmaceutical efficacy.

  16. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes

    Science.gov (United States)

    Matthew Parks; Richard Cronn; Aaron Liston

    2009-01-01

    We reconstruct the infrageneric phylogeny of Pinus from 37 nearly-complete chloroplast genomes (average 109 kilobases each of an approximately 120 kilobase genome) generated using multiplexed massively parallel sequencing. We found that 30/33 ingroup nodes resolved wlth > 95-percent bootstrap support; this is a substantial improvement relative...

  17. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  18. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

    2015-01-01

    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  19. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  20. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  1. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  2. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  3. Draft Genomes, Phylogenetic Reconstruction, and Comparative Genomics of Two Novel Cohabiting Bacterial Symbionts Isolated from Frankliniella occidentalis.

    Science.gov (United States)

    Facey, Paul D; Méric, Guillaume; Hitchings, Matthew D; Pachebat, Justin A; Hegarty, Matt J; Chen, Xiaorui; Morgan, Laura V A; Hoeppner, James E; Whitten, Miranda M A; Kirk, William D J; Dyson, Paul J; Sheppard, Sam K; Del Sol, Ricardo

    2015-07-15

    Obligate bacterial symbionts are widespread in many invertebrates, where they are often confined to specialized host cells and are transmitted directly from mother to progeny. Increasing numbers of these bacteria are being characterized but questions remain about their population structure and evolution. Here we take a comparative genomics approach to investigate two prominent bacterial symbionts (BFo1 and BFo2) isolated from geographically separated populations of western flower thrips, Frankliniella occidentalis. Our multifaceted approach to classifying these symbionts includes concatenated multilocus sequence analysis (MLSA) phylogenies, ribosomal multilocus sequence typing (rMLST), construction of whole-genome phylogenies, and in-depth genomic comparisons. We showed that the BFo1 genome clusters more closely to species in the genus Erwinia, and is a putative close relative to Erwinia aphidicola. BFo1 is also likely to have shared a common ancestor with Erwinia pyrifoliae/Erwinia amylovora and the nonpathogenic Erwinia tasmaniensis and genetic traits similar to Erwinia billingiae. The BFo1 genome contained virulence factors found in the genus Erwinia but represented a divergent lineage. In contrast, we showed that BFo2 belongs within the Enterobacteriales but does not group closely with any currently known bacterial species. Concatenated MLSA phylogenies indicate that it may have shared a common ancestor to the Erwinia and Pantoea genera, and based on the clustering of rMLST genes, it was most closely related to Pantoea ananatis but represented a divergent lineage. We reconstructed a core genome of a putative common ancestor of Erwinia and Pantoea and compared this with the genomes of BFo bacteria. BFo2 possessed none of the virulence determinants that were omnipresent in the Erwinia and Pantoea genera. Taken together, these data are consistent with BFo2 representing a highly novel species that maybe related to known Pantoea. © The Author(s) 2015. Published by

  4. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  5. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  6. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  7. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  8. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  9. Genomic and phylogenetic characterization of luminous bacteria symbiotic with the deep-sea fish Chlorophthalmus albatrossis (Aulopiformes: Chlorophthalmidae).

    Science.gov (United States)

    Dunlap, Paul V; Ast, Jennifer C

    2005-02-01

    Bacteria forming light-organ symbiosis with deep-sea chlorophthalmid fishes (Aulopiformes: Chlorophthalmidae) are considered to belong to the species Photobacterium phosphoreum. The identification of these bacteria as P. phosphoreum, however, was based exclusively on phenotypic traits, which may not discriminate between phenetically similar but evolutionarily distinct luminous bacteria. Therefore, to test the species identification of chlorophthalmid symbionts, we carried out a genomotypic (repetitive element palindromic PCR genomic profiling) and phylogenetic analysis on strains isolated from the perirectal light organ of Chlorophthalmus albatrossis. Sequence analysis of the 16S rRNA gene of 10 strains from 5 fish specimens placed these bacteria in a cluster related to but phylogenetically distinct from the type strain of P. phosphoreum, ATCC 11040(T), and the type strain of Photobacterium iliopiscarium, ATCC 51760(T). Analysis of gyrB resolved the C. albatrossis strains as a strongly supported clade distinct from P. phosphoreum and P. iliopiscarium. Genomic profiling of 109 strains from the 5 C. albatrossis specimens revealed a high level of similarity among strains but allowed identification of genomotypically different types from each fish. Representatives of each type were then analyzed phylogenetically, using sequence of the luxABFE genes. As with gyrB, analysis of luxABFE resolved the C. albatrossis strains as a robustly supported clade distinct from P. phosphoreum. Furthermore, other strains of luminous bacteria reported as P. phosphoreum, i.e., NCIMB 844, from the skin of Merluccius capensis (Merlucciidae), NZ-11D, from the light organ of Nezumia aequalis (Macrouridae), and pjapo.1.1, from the light organ of Physiculus japonicus (Moridae), grouped phylogenetically by gyrB and luxABFE with the C. albatrossis strains, not with ATCC 11040(T). These results demonstrate that luminous bacteria symbiotic with C. albatrossis, together with certain other strains of

  10. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

    Directory of Open Access Journals (Sweden)

    Sharpton Thomas J

    2012-10-01

    Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.

  11. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  12. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  13. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  14. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  15. The complete mitochondrial genome of Strongylus equinus (Chromadorea: Strongylidae): Comparison with other closely related species and phylogenetic analyses.

    Science.gov (United States)

    Xu, Wen-Wen; Qiu, Jian-Hua; Liu, Guo-Hua; Zhang, Yan; Liu, Ze-Xuan; Duan, Hong; Yue, Dong-Mei; Chang, Qiao-Cheng; Wang, Chun-Ren; Zhao, Xing-Cun

    2015-12-01

    The roundworms of genus Strongylus are the common parasitic nematodes in the large intestine of equine, causing significant economic losses to the livestock industries. In spite of its importance, the genetic data and epidemiology of this parasite are not entirely understood. In the present study, the complete S. equinus mitochondrial (mt) genome was determined. The length of S. equinus mt genome DNA sequence is 14,545 bp, containing 36 genes, of which 12 code for protein, 22 for transfer RNA, and two for ribosomal RNA, but lacks atp8 gene. All 36 genes are encoded in the same direction which is consistent with all other Chromadorea nematode mtDNAs published to date. Phylogenetic analysis based on concatenated amino acid sequence data of all 12 protein-coding genes showed that there were two large branches in the Strongyloidea nematodes, and S. equinus is genetically closer to S. vulgaris than to Cylicocyclus insignis in Strongylidae. This new mt genome provides a source of genetic markers for the molecular phylogeny and population genetics of equine strongyles. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  17. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae employing mitochondrial COI gene sequence data

    Directory of Open Access Journals (Sweden)

    Monte Tainá CC

    2012-11-01

    Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  18. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data

    Science.gov (United States)

    2012-01-01

    Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987

  19. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data.

    Science.gov (United States)

    Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo

    2012-11-06

    The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  20. Genome Analysis and Phylogenetic Relatedness of Gallibacterium anatis Strains from Poultry

    Science.gov (United States)

    Johnson, Timothy J.; Danzeisen, Jessica L.; Trampel, Darrell; Nolan, Lisa K.; Seemann, Torsten; Bager, Ragnhild J.; Bojesen, Anders M.

    2013-01-01

    Peritonitis is the major disease problem of laying hens in commercial table egg and parent stock operations. Despite its importance, the etiology and pathogenesis of this disease have not been completely clarified. Although avian pathogenic Escherichia coli (APEC) isolates have been incriminated as the causative agent of laying hen peritonitis, Gallibacterium anatis are frequently isolated from peritonitis lesions. Despite recent studies suggesting a role for G. anatis in the pathogenesis of peritonitis, little is known about the organism’s virulence mechanisms, genomic composition and population dynamics. Here, we compared the genome sequences of three G. anatis isolates in an effort to understand its virulence mechanisms and identify novel antigenic traits. A multilocus sequence typing method was also established for G. anatis and used to characterize the genotypic relatedness of 71 isolates from commercial laying hens in Iowa and 18 international reference isolates. Genomic comparisons suggest that G. anatis is a highly diverse bacterial species, with some strains possessing previously described and potential virulence factors, but with a core genome containing several antigenic candidates. Multilocus sequence typing effectively distinguished 82 sequence types and several clonal complexes of G. anatis, and some clones seemed to predominate among G. anatis populations from commercial layers in Iowa. Biofilm formation and resistance to antimicrobial agents was also observed in several clades. Overall, the genomic diversity of G. anatis suggests that multiple lineages exist with differing pathogenic potential towards birds. PMID:23359626

  1. Genome analysis and phylogenetic relatedness of Gallibacterium anatis strains from poultry.

    Directory of Open Access Journals (Sweden)

    Timothy J Johnson

    Full Text Available Peritonitis is the major disease problem of laying hens in commercial table egg and parent stock operations. Despite its importance, the etiology and pathogenesis of this disease have not been completely clarified. Although avian pathogenic Escherichia coli (APEC isolates have been incriminated as the causative agent of laying hen peritonitis, Gallibacterium anatis are frequently isolated from peritonitis lesions. Despite recent studies suggesting a role for G. anatis in the pathogenesis of peritonitis, little is known about the organism's virulence mechanisms, genomic composition and population dynamics. Here, we compared the genome sequences of three G. anatis isolates in an effort to understand its virulence mechanisms and identify novel antigenic traits. A multilocus sequence typing method was also established for G. anatis and used to characterize the genotypic relatedness of 71 isolates from commercial laying hens in Iowa and 18 international reference isolates. Genomic comparisons suggest that G. anatis is a highly diverse bacterial species, with some strains possessing previously described and potential virulence factors, but with a core genome containing several antigenic candidates. Multilocus sequence typing effectively distinguished 82 sequence types and several clonal complexes of G. anatis, and some clones seemed to predominate among G. anatis populations from commercial layers in Iowa. Biofilm formation and resistance to antimicrobial agents was also observed in several clades. Overall, the genomic diversity of G. anatis suggests that multiple lineages exist with differing pathogenic potential towards birds.

  2. Discovery of Conservation and Diversification of miR171 Genes by Phylogenetic Analysis based on Global Genomes

    Directory of Open Access Journals (Sweden)

    Xudong Zhu

    2015-07-01

    Full Text Available The microRNA171 (miR171 family is widely distributed and highly conserved in a range of species and plays critical roles in regulating plant growth and development through repressing expression of ( transcription factors. However, information on the evolutionary conservation and functional diversification of the miRNA171 family members remains scanty. We reconstructed the phylogenetic relationships among miR171 precursor and mature sequences so as to investigate the extent and degree of evolutionary conservation of miR171 in (L. Heynh. (ath, grape ( L. (vvi, poplar ( Torr. & A.Gray ex Hook. (ptc, and rice ( L. (osa. Despite strong conservation of over 80%, some mature miR171 sequences, such as , and and , -, and -, have undergone critical sequence variation, leading to functional diversification, since they target non gene transcript(s. Phylogenetic analyses revealed a combination of old ancestral relationships and recent lineage-specific diversification in the miR171 family within the four model plants. The -regulatory motifs on the upstream promoter sequences of genes were highly divergent and shared some similar elements, indicating their possible contribution to the functional variation observed within the miR171 family. This study will buttress our understanding of the functional differentiation of miRNAs and the relationships of miRNA–target pairs based on the evolutionary history of genes.

  3. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  4. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  5. Complete mitochondrial genome from South American catfish Pseudoplatystoma reticulatum (Eigenmann & Eigenmann) and its impact in Siluriformes phylogenetic tree.

    Science.gov (United States)

    Villela, Luciana Cristine Vasques; Alves, Anderson Luis; Varela, Eduardo Sousa; Yamagishi, Michel Eduardo Beleza; Giachetto, Poliana Fernanda; da Silva, Naiara Milagres Augusto; Ponzetto, Josi Margarete; Paiva, Samuel Rezende; Caetano, Alexandre Rodrigues

    2017-02-01

    The cachara (Pseudoplatystoma reticulatum) is a Neotropical freshwater catfish from family Pimelodidae (Siluriformes) native to Brazil. The species is of relative economic importance for local aquaculture production and basic biological information is under development to help boost efforts to domesticate and raise the species in commercial systems. The complete cachara mitochondrial genome was obtained by assembling Illumina RNA-seq data from pooled samples. The full mitogenome was found to be 16,576 bp in length, showing the same basic structure, order, and genetic organization observed in other Pimelodidae, with 13 protein-coding genes, 2 rNA genes, 22 trNAs, and a control region. Observed base composition was 24.63% T, 28.47% C, 31.45% A, and 15.44% G. With the exception of NAD6 and eight tRNAs, all of the observed mitochondrial genes were found to be coded on the H strand. A total of 107 SNPs were identified in P. reticulatum mtDNA, 67 of which were located in coding regions. Of these SNPs, 10 result in amino acid changes. Analysis of the obtained sequence with 94 publicly available full Siluriformes mitogenomes resulted in a phylogenetic tree that generally agreed with available phylogenetic proposals for the order. The first report of the complete Pseudoplatystoma reticulatum mitochondrial genome sequence revealed general gene organization, structure, content, and order similar to most vertebrates. Specific sequence and content features were observed and may have functional attributes which are now available for further investigation.

  6. Component identification of electron transport chains in curdlan-producing Agrobacterium sp. ATCC 31749 and its genome-specific prediction using comparative genome and phylogenetic trees analysis.

    Science.gov (United States)

    Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang

    2011-06-01

    Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.

  7. Whole genome sequencing as a tool for phylogenetic analysis of clinical strains of Mitis group streptococci

    DEFF Research Database (Denmark)

    Rasmusen, L. H.; Dargis, R.; Iversen, Katrine Højholt

    2016-01-01

    observed in single gene analyses. Species identification based on single gene analysis showed their limitations when more strains were included. In contrast, analyses incorporating more sequence data, like MLSA, SNPs and core-genome analyses, provided more distinct clustering. The core-genome tree showed......Identification of Mitis group streptococci (MGS) to the species level is challenging for routine microbiology laboratories. Correct identification is crucial for the diagnosis of infective endocarditis, identification of treatment failure, and/or infection relapse. Eighty MGS from Danish patients...

  8. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  9. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  10. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  11. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia.

    Science.gov (United States)

    Liu, Tong; Sun, Keping; Park, Yung Chul; Feng, Jiang

    2016-01-01

    The greater horseshoe bat, Rhinolophus ferrumequinum , is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  12. Genomic characterization and phylogenetic position of two new species in Rhabdoviridae infecting the parasitic copepod, salmon louse (Lepeophtheirus salmonis).

    Science.gov (United States)

    Økland, Arnfinn Lodden; Nylund, Are; Øvergård, Aina-Cathrine; Blindheim, Steffen; Watanabe, Kuninori; Grotmol, Sindre; Arnesen, Carl-Erik; Plarre, Heidrun

    2014-01-01

    Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar) farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11,600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses.

  13. Genomic Characterization and Phylogenetic Position of Two New Species in Rhabdoviridae Infecting the Parasitic Copepod, Salmon Louse (Lepeophtheirus salmonis)

    Science.gov (United States)

    Økland, Arnfinn Lodden; Nylund, Are; Øvergård, Aina-Cathrine; Blindheim, Steffen; Watanabe, Kuninori; Grotmol, Sindre; Arnesen, Carl-Erik; Plarre, Heidrun

    2014-01-01

    Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar) farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11 600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses. PMID:25402203

  14. Genomic characterization and phylogenetic position of two new species in Rhabdoviridae infecting the parasitic copepod, salmon louse (Lepeophtheirus salmonis.

    Directory of Open Access Journals (Sweden)

    Arnfinn Lodden Økland

    Full Text Available Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11,600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses.

  15. Whole Genome Characterization, Phylogenetic and Genome Signature Analysis of Human Pandemic H1N1 Virus in Thailand, 2009–2012

    Science.gov (United States)

    Makkoch, Jarika; Suwannakarn, Kamol; Payungporn, Sunchai; Prachayangprecha, Slinporn; Cheiocharnsin, Thaweesak; Linsuwanon, Piyada; Theamboonlers, Apiradee; Poovorawan, Yong

    2012-01-01

    Background Three waves of human pandemic influenza occurred in Thailand in 2009–2012. The genome signature features and evolution of pH1N1 need to be characterized to elucidate the aspects responsible for the multiple waves of pandemic. Methodology/Findings Forty whole genome sequences and 584 partial sequences of pH1N1 circulating in Thailand, divided into 1st, 2nd and 3rd wave and post-pandemic were characterized and 77 genome signatures were analyzed. Phylogenetic trees of concatenated whole genome and HA gene sequences were constructed calculating substitution rate and dN/dS of each gene. Phylogenetic analysis showed a distinct pattern of pH1N1 circulation in Thailand, with the first two isolates from May, 2009 belonging to clade 5 while clades 5, 6 and 7 co-circulated during the first wave of pH1N1 pandemic in Thailand. Clade 8 predominated during the second wave and different proportions of the pH1N1 viruses circulating during the third wave and post pandemic period belonged to clades 8, 11.1 and 11.2. The mutation analysis of pH1N1 revealed many adaptive mutations which have become the signature of each clade and may be responsible for the multiple pandemic waves in Thailand, especially with regard to clades 11.1 and 11.2 as evidenced with V731I, G154D of PB1 gene, PA I330V, HA A214T S160G and S202T. The substitution rate of pH1N1 in Thailand ranged from 2.53×10−3±0.02 (M2 genes) to 5.27×10−3±0.03 per site per year (NA gene). Conclusions All results suggested that this virus is still adaptive, maybe to evade the host's immune response and tends to remain in the human host although the dN/dS were under purifying selection in all 8 genes. Due to the gradual evolution of pH1N1 in Thailand, continuous monitoring is essential for evaluation and surveillance to be prepared for and able to control future influenza activities. PMID:23251479

  16. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  17. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  18. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Phylogenetic relationships in Epidendroideae (Orchidaceae), one of the great flowering plant radiations: progressive specialization and diversification.

    Science.gov (United States)

    Freudenstein, John V; Chase, Mark W

    2015-03-01

    The largest subfamily of orchids, Epidendroideae, represents one of the most significant diversifications among flowering plants in terms of pollination strategy, vegetative adaptation and number of species. Although many groups in the subfamily have been resolved, significant relationships in the tree remain unclear, limiting conclusions about diversification and creating uncertainty in the classification. This study brings together DNA sequences from nuclear, plastid and mitochrondrial genomes in order to clarify relationships, to test associations of key characters with diversification and to improve the classification. Sequences from seven loci were concatenated in a supermatrix analysis for 312 genera representing most of epidendroid diversity. Maximum-likelihood and parsimony analyses were performed on this matrix and on subsets of the data to generate trees and to investigate the effect of missing values. Statistical character-associated diversification analyses were performed. Likelihood and parsimony analyses yielded highly resolved trees that are in strong agreement and show significant support for many key clades. Many previously proposed relationships among tribes and subtribes are supported, and some new relationships are revealed. Analyses of subsets of the data suggest that the relatively high number of missing data for the full analysis is not problematic. Diversification analyses show that epiphytism is most strongly associated with diversification among epidendroids, followed by expansion into the New World and anther characters that are involved with pollinator specificity, namely early anther inflexion, cellular pollinium stalks and the superposed pollinium arrangement. All tested characters show significant association with speciation in Epidendroideae, suggesting that no single character accounts for the success of this group. Rather, it appears that a succession of key features appeared that have contributed to diversification, sometimes in

  20. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  1. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers.

    Science.gov (United States)

    Kelchner, Scot A

    2013-05-01

    Bamboos are large perennial grasses of temperate and tropical forests worldwide. Two general growth forms exist: the economically and ecologically important woody bamboos (tribes Arundinarieae and Bambuseae), and the understory herbaceous bamboos (tribe Olyreae). Evolutionary relationships among the 1400+described species have been difficult to resolve with confidence. Comparative analysis of bamboo plastid (chloroplast) DNA has revealed three to five major lineages that show distinct biogeographic distributions. Taxon sampling across tribes and subtribes has been incomplete and most published data sets include a relatively small number of nucleotide characters. Branching order among lineages is often poorly supported, and in more than one study herbaceous bamboos form a clade within the woody bamboos. In this paper, the Bamboo Phylogeny Group presents the most complete phylogeny estimation to date of bamboo tribes and subtribes using 6.7 kb of coding and noncoding sequence data and 37 microstructural characters from the chloroplast genome. Quality of data is assessed, as is the possibility of long branch attraction, the degree of character conflict at key nodes in the tree, and the legitimacy of three alternative hypotheses of relationship. Four major plastid lineages are recognized: temperate woody, paleotropical woody, neotropical woody, and herbaceous bamboos. Woody bamboos are resolved as paraphyletic with respect to Olyreae but SH tests cannot reject monophyly of woody species (Arundinarieae+Bambuseae). Published by Elsevier Inc.

  2. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  3. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  5. Comparative genomic and phylogenetic approaches to characterize the role of genetic recombination in mycobacterial evolution.

    Science.gov (United States)

    Smith, Silvia E; Showers-Corneli, Patrice; Dardenne, Caitlin N; Harpending, Henry H; Martin, Darren P; Beiko, Robert G

    2012-01-01

    The genus Mycobacterium encompasses over one hundred named species of environmental and pathogenic organisms, including the causative agents of devastating human diseases such as tuberculosis and leprosy. The success of these human pathogens is due in part to their ability to rapidly adapt to their changing environment and host. Recombination is the fastest way for bacterial genomes to acquire genetic material, but conflicting results about the extent of recombination in the genus Mycobacterium have been reported. We examined a data set comprising 18 distinct strains from 13 named species for evidence of recombination. Genomic regions common to all strains (accounting for 10% to 22% of the full genomes of all examined species) were aligned and concatenated in the chromosomal order of one mycobacterial reference species. The concatenated sequence was screened for evidence of recombination using a variety of statistical methods, with each proposed event evaluated by comparing maximum-likelihood phylogenies of the recombinant section with the non-recombinant portion of the dataset. Incongruent phylogenies were identified by comparing the site-wise log-likelihoods of each tree using multiple tests. We also used a phylogenomic approach to identify genes that may have been acquired through horizontal transfer from non-mycobacterial sources. The most frequent associated lineages (and potential gene transfer partners) in the Mycobacterium lineage-restricted gene trees are other members of suborder Corynebacterinae, but more-distant partners were identified as well. In two examined cases of potentially frequent and habitat-directed transfer (M. abscessus to Segniliparus and M. smegmatis to Streptomyces), observed sequence distances were small and consistent with a hypothesis of transfer, while in a third case (M. vanbaalenii to Streptomyces) distances were larger. The analyses described here indicate that whereas evidence of recombination in core regions within the genus is

  6. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  7. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  9. Phylogenomic relationship of feijoa (Acca sellowiana (O.Berg) Burret) with other Myrtaceae based on complete chloroplast genome sequences.

    Science.gov (United States)

    Machado, Lilian de Oliveira; Vieira, Leila do Nascimento; Stefenon, Valdir Marcos; Oliveira Pedrosa, Fábio de; Souza, Emanuel Maltempi de; Guerra, Miguel Pedro; Nodari, Rubens Onofre

    2017-04-01

    Given their distribution, importance, and richness, Myrtaceae species comprise a model system for studying the evolution of tropical plant diversity. In addition, chloroplast (cp) genome sequencing is an efficient tool for phylogenetic relationship studies. Feijoa [Acca sellowiana (O. Berg) Burret; CN: pineapple-guava] is a Myrtaceae species that occurs naturally in southern Brazil and northern Uruguay. Feijoa is known for its exquisite perfume and flavorful fruits, pharmacological properties, ornamental value and increasing economic relevance. In the present work, we reported the complete cp genome of feijoa. The feijoa cp genome is a circular molecule of 159,370 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC 88,028 bp) and a Small Single Copy region (SSC 18,598 bp) separated by Inverted Repeat regions (IRs 26,372 bp). The genome structure, gene order, GC content and codon usage are similar to those of typical angiosperm cp genomes. When compared to other cp genome sequences of Myrtaceae, feijoa showed closest relationship with pitanga (Eugenia uniflora L.). Furthermore, a comparison of pitanga synonymous (Ks) and nonsynonymous (Ka) substitution rates revealed extremely low values. Maximum Likelihood and Bayesian Inference analyses produced phylogenomic trees identical in topology. These trees supported monophyly of three Myrtoideae clades.

  10. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  11. Mitochondrial genome and phylogenetic position of the tawny nurse shark (Nebrius ferrugineus).

    Science.gov (United States)

    Wang, Junjie; Chen, Hao; Lin, Lingling; Ai, Weiming; Chen, Xiao

    2017-01-01

    The complete mitochondrial genome of the tawny nurse shark (Nebrius ferrugineus) was first presented in this study. It was 16 693 bp in length with the typical gene order in vertebrates. The overall base composition was 33.6% A, 25.6% C, 12.7% G and 28.1% T. Two start (ATG and GTG) and two stop (TAG and TAA/T--) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. The origin of L-strand replication could form a hairpin structure. All nodes strongly supported that N. ferrugineus was placed as sister to Rhincodon typus in the Bayesian tree.

  12. Genome-wide identification, phylogenetic classification, and exon-intron structure characterisation of the tubulin and actin genes in flax (Linum usitatissimum).

    Science.gov (United States)

    Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2018-06-08

    Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.

  13. SWPhylo - A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees.

    Science.gov (United States)

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA.

  14. SWPhylo – A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees

    Science.gov (United States)

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA. PMID:29511354

  15. Phylogenetic relationships and acaricidal effects of Beauveria bassiana obtained from cattle farm soils against Rhipicephalus microplus.

    Science.gov (United States)

    Fernández-Salas, Agustin; Alonso Díaz, Miguel Angel; Alonso Morales, Rogelio Alejandro; Lezama-Gutierrez, Roberto; Cervantes-Chávez, José Antonio

    2018-03-16

    The objectives of the present study were to isolate Beauveria bassiana strains from cattle farms soils, to analyze the phylogenetic relationships among the isolated fungi strains, and to determine the acaricidal effect of B. bassiana isolates on Rhipicephalus microplus engorged ticks, resistant or susceptible to chemical acaricides. Six strains of Beauveria bassiana were obtained and isolated from cattle farms soils by Galleria bait method in Mexican tropics and the acaricidal effect was assessed against 2 populations of R. microplus ("Media Joya" resistant strain or "CLAR" susceptible strain to chemical acaricides) using the adult immersion test. The BbV03 strain produced an 86.7% and a 60% of mortality on resistant and susceptible ticks on day 20, respectively; whereas the mortality scored with the BbV04 strain was 66.7% and 53.5% on resistant and susceptible ticks at the same day, respectively. The BbV03 and BbV04 strains reduced egg-laying on both R. microplus populations. There were not statistical differences in the acaricidal effect of B. bassiana strains, between the R. microplus susceptible or resistant populations (P > 0.05). The BbV03 strain was the most virulent against R. microplus with a LC50 of 2 x 107 and a LC99 of 7 x 108 conidia/ml. We found that the 6 B. bassiana isolated were clustered into the same clade with other previously reported B. bassiana strains (from GenBank); however, they were separated into 3 different sub-clades. This study shows that some B. bassiana strains might be a promising coadjuvant alternative for biological tick control, including those that are resistant to chemical acaricides. Beauveria bassiana is present in the pastures of tropic cattle farms and there are genetic variations between members of the bassiana specie that are living in this ecosystem. This last showed that B. bassiana might play an important roll in the natural control of R. microplus at paddocks of cattle farms.

  16. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  17. First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications.

    Science.gov (United States)

    Chen, Zhi-Teng; Du, Yu-Zhou

    2017-05-05

    The complete mitochondrial genome (mitogenome) of Nemoura nankinensis (Plecoptera: Nemouridae) was sequenced as the first reported mitogenome from the family Nemouridae. The N. nankinensis mitogenome was the longest (16,602 bp) among reported plecopteran mitogenomes, and it contains 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes. Most PCGs used standard ATN as start codons, and TAN as termination codons. All tRNA genes of N. nankinensis could fold into the cloverleaf secondary structures except for trnSer ( AGN ), whose dihydrouridine (DHU) arm was reduced to a small loop. There was also a large non-coding region (control region, CR) in the N. nankinensis mitogenome. The 1751 bp CR was the longest and had the highest A+T content (81.8%) among stoneflies. A large tandem repeat region, five potential stem-loop (SL) structures, four tRNA-like structures and four conserved sequence blocks (CSBs) were detected in the elongated CR. The presence of these tRNA-like structures in the CR has never been reported in other plecopteran mitogenomes. These novel features of the elongated CR in N. nankinensis may have functions associated with the process of replication and transcription. Finally, phylogenetic reconstruction suggested that Nemouridae was the sister-group of Capniidae.

  18. A phylogenetic method to perform genome-wide association studies in microbes that accounts for population structure and recombination.

    Directory of Open Access Journals (Sweden)

    Caitlin Collins

    2018-02-01

    Full Text Available Genome-Wide Association Studies (GWAS in microbial organisms have the potential to vastly improve the way we understand, manage, and treat infectious diseases. Yet, microbial GWAS methods established thus far remain insufficiently able to capitalise on the growing wealth of bacterial and viral genetic sequence data. Facing clonal population structure and homologous recombination, existing GWAS methods struggle to achieve both the precision necessary to reject spurious findings and the power required to detect associations in microbes. In this paper, we introduce a novel phylogenetic approach that has been tailor-made for microbial GWAS, which is applicable to organisms ranging from purely clonal to frequently recombining, and to both binary and continuous phenotypes. Our approach is robust to the confounding effects of both population structure and recombination, while maintaining high statistical power to detect associations. Thorough testing via application to simulated data provides strong support for the power and specificity of our approach and demonstrates the advantages offered over alternative cluster-based and dimension-reduction methods. Two applications to Neisseria meningitidis illustrate the versatility and potential of our method, confirming previously-identified penicillin resistance loci and resulting in the identification of both well-characterised and novel drivers of invasive disease. Our method is implemented as an open-source R package called treeWAS which is freely available at https://github.com/caitiecollins/treeWAS.

  19. Genome-wide identification, phylogenetic analysis, and expression profiling of polyamine synthesis gene family members in tomato.

    Science.gov (United States)

    Liu, Taibo; Huang, Binbin; Chen, Lin; Xian, Zhiqiang; Song, Shiwei; Chen, Riyuan; Hao, Yanwei

    2018-06-30

    Polyamines (PAs), including putrescine (Put), spermidine (Spd), spermine (Spm), and thermospermine (T-Spm), play key roles in plant development, including fruit setting and ripening, morphogenesis, and abiotic/biotic stress. Their functions appear to be intimately related to their synthesis, which occurs via arginine/ornithine decarboxylase (ADC/ODC), Spd synthase (SPDS), Spm synthase (SPMS), and Acaulis5 (ACL5), respectively. Unfortunately, the expression and function of these PA synthesis-relate genes during specific developmental process or under stress have not been fully elucidated. Here, we present the results of a genome-wide analysis of the PA synthesis genes (ADC, ODC, SPDS, SPMS, ACL5) in the tomato (Solanum lycopersicum). In total, 14 PA synthesis-related genes were identified. Further analysis of their structures, conserved domains, phylogenetic trees, predicted subcellular localization, and promoter cis-regulatory elements were analyzed. Furthermore, we also performed experiments to evaluate their tissue expression patterns and under hormone and various stress treatments. To our knowledge, this is the first study to elucidate the mechanisms underlying PA function in this variety of tomato. Taken together, these data provide valuable information for future functional characterization of specific genes in the PA synthesis pathway in this and other plant species. Although additional research is required, the insight gained by this and similar studies can be used to improve our understanding of PA metabolism ultimately leading to more effective and consistent plant cultivation. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  1. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  2. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  3. Draft genome and sequence variant data of the oomycete Pythium insidiosum strain Pi45 from the phylogenetically-distinct Clade-III

    Directory of Open Access Journals (Sweden)

    Weerayuth Kittichotirat

    2017-12-01

    Full Text Available Pythium insidiosum is a unique oomycete microorganism, capable of infecting humans and animals. The organism can be phylogenetically categorized into three distinct clades: Clade-I (strains from the Americas; Clade-II (strains from Asia and Australia, and Clade–III (strains from Thailand and the United States. Two draft genomes of the P. insidiosum Clade-I strain CDC-B5653 and Clade-II strain Pi-S are available in the public domain. The genome of P. insidiosum from the distinct Clade-III, which is distantly-related to the other two clades, is lacking. Here, we report the draft genome sequence of the P. insidiosum strain Pi45 (also known as MCC13; isolated from a Thai patient with pythiosis; accession numbers BCFM01000001-BCFM01017277 as a representative strain of the phylogenetically-distinct Clade-III. We also report a genome-scale data set of sequence variants (i.e., SNPs and INDELs found in P. insidiosum (accessible online at the Mendeley database: http://dx.doi.org/10.17632/r75799jy6c.1. Keywords: Pythium insidiosum, Pythiosis, Draft genome, Sequence variant

  4. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  5. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  6. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  7. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  8. Comprehensive transcriptome analysis provides new insights into nutritional strategies and phylogenetic relationships of chrysophytes

    Directory of Open Access Journals (Sweden)

    Daniela Beisser

    2017-01-01

    Full Text Available Background Chrysophytes are protist model species in ecology and ecophysiology and important grazers of bacteria-sized microorganisms and primary producers. However, they have not yet been investigated in detail at the molecular level, and no genomic and only little transcriptomic information is available. Chrysophytes exhibit different trophic modes: while phototrophic chrysophytes perform only photosynthesis, mixotrophs can gain carbon from bacterial food as well as from photosynthesis, and heterotrophs solely feed on bacteria-sized microorganisms. Recent phylogenies and megasystematics demonstrate an immense complexity of eukaryotic diversity with numerous transitions between phototrophic and heterotrophic organisms. The question we aim to answer is how the diverse nutritional strategies, accompanied or brought about by a reduction of the plasmid and size reduction in heterotrophic strains, affect physiology and molecular processes. Results We sequenced the mRNA of 18 chrysophyte strains on the Illumina HiSeq platform and analysed the transcriptomes to determine relations between the trophic mode (mixotrophic vs. heterotrophic and gene expression. We observed an enrichment of genes for photosynthesis, porphyrin and chlorophyll metabolism for phototrophic and mixotrophic strains that can perform photosynthesis. Genes involved in nutrient absorption, environmental information processing and various transporters (e.g., monosaccharide, peptide, lipid transporters were present or highly expressed only in heterotrophic strains that have to sense, digest and absorb bacterial food. We furthermore present a transcriptome-based alignment-free phylogeny construction approach using transcripts assembled from short reads to determine the evolutionary relationships between the strains and the possible influence of nutritional strategies on the reconstructed phylogeny. We discuss the resulting phylogenies in comparison to those from established approaches

  9. Zebrafish syntenic relationship to human/mouse genomes revealed by radiation hybrid mapping

    International Nuclear Information System (INIS)

    Samonte, Irene E.

    2007-01-01

    Zebrafish (Danio rerio) is an excellent model system for vertebrate developmental analysis and a new model for human disorders. In this study, however, zebrafish was used to determine its syntenic relationship to human/mouse genomes using the zebrafish-hamster radiation hybrid panel. The focus was on genes residing on chromosomes 6 and 17 of human and mouse, respectively, and some other genes of either immunologic or evolutionary importance. Gene sequences of interest and zebrafish expressed sequence tags deposited in the GenBank were used in identifying zebrafish homologs. Polymerase chain reaction (PCR) amplification, cloning and subcloning, sequencing, and phylogenetic analysis were done to confirm the homology of the candidate genes in zebrafish. The promising markers were then tested in the 94 zebrafish-hamster radiation hybrid panel cell lines and submitted for logarithm of the odds (LOD) score analysis to position genes on the zebrafish map. A total of 19 loci were successfully mapped to zebrafish linkage groups 1, 14, 15, 19, and 20. Four of these loci were positioned in linkage group 20, whereas, 3 more loci were added in linkage group 19, thus increasing to 34 loci the number of human genes syntenic to the group. With the sequencing of the zebrafish genome, about 20 more MHC genes were reported linked on the same group. (Author)

  10. Genomic, proteomic, morphological, and phylogenetic analyses of vB_EcoP_SU10, a podoviridae phage with C3 morphology.

    Directory of Open Access Journals (Sweden)

    Mohammadali Khan Mirzaei

    Full Text Available A recently isolated phage, vB_EcoP_SU10 (SU10, with the unusual elongated C3 morphotype, can infect a wide range of Escherichia coli strains. We have sequenced the genome of this phage and characterized it further by mass spectrometry based proteomics, transmission electron microscopy (TEM, scanning electron microscopy (SEM, and ultra-thin section electron microscopy. The genome size is 77,327 base pairs and its genes, and genome architecture, show high similarity to the phiEco32 phage genes and genome. The TEM images reveal that SU10 have a quite long tail for being a Podoviridae phage, and that the tail also changes conformation upon infection. The ultra-thin section electron microscopy images of phages at the stage of replication within the host cell show that the phages form a honeycomb-like structure under packaging of genomes and assembly of mature capsids. This implies a tight link between the replication and cutting of the concatemeric genome, genome packaging, and capsid assembly. We have also performed a phylogenetic analysis of the structural genes common between Podoviridae phages of the C1 and C3 morphotypes. The result shows that the structural genes have coevolved, and that they form two distinct groups linked to their morphotypes. The structural genes of C1 and C3 phages appear to have diverged around 280 million years ago applying a molecular clock calibrated according to the presumed split between the Escherichia - Salmonella genera.

  11. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  12. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Congruent Deep Relationships in the Grape Family (Vitaceae) Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Science.gov (United States)

    Zhang, Ning; Wen, Jun; Zimmer, Elizabeth A

    2015-01-01

    Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera). The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera) methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  14. Congruent Deep Relationships in the Grape Family (Vitaceae Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera. The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  15. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  16. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  17. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  18. Genomic organization and phylogenetic utility of deer mouse (Peromyscus maniculatus lymphotoxin-alpha and lymphotoxin-beta

    Directory of Open Access Journals (Sweden)

    Prescott Joseph

    2008-10-01

    Full Text Available Abstract Background Deer mice (Peromyscus maniculatus are among the most common mammals in North America and are important reservoirs of several human pathogens, including Sin Nombre hantavirus (SNV. SNV can establish a life-long apathogenic infection in deer mice, which can shed virus in excrement for transmission to humans. Patients that die from hantavirus cardiopulmonary syndrome (HCPS have been found to express several proinflammatory cytokines, including lymphotoxin (LT, in the lungs. It is thought that these cytokines contribute to the pathogenesis of HCPS. LT is not expressed by virus-specific CD4+ T cells from infected deer mice, suggesting a limited role for this pathway in reservoir responses to hantaviruses. Results We have cloned the genes encoding deer mouse LTα and LTβ and have found them to be highly similar to orthologous rodent sequences but with some differences in promoters elements. The phylogenetic analyses performed on the LTα, LTβ, and combined data sets yielded a strongly-supported sister-group relationship between the two murines (the house mouse and the rat. The deer mouse, a sigmodontine, appeared as the sister group to the murine clade in all of the analyses. High bootstrap values characterized the grouping of murids. Conclusion No conspicuous differences compared to other species are present in the predicted amino acid sequences of LTα or LTβ; however, some promoter differences were noted in LTβ. Although more extensive taxonomic sampling is required to confirm the results of our analyses, the preliminary findings indicate that both genes (analyzed both separately and in combination hold potential for resolving relationships among rodents and other mammals at the subfamily level.

  19. Comparative genomic characterization of a Thailand-Myanmar isolate, MS6, of Vibrio cholerae O1 El Tor, which is phylogenetically related to a "US Gulf Coast" clone.

    Science.gov (United States)

    Okada, Kazuhisa; Na-Ubol, Mathukorn; Natakuathung, Wirongrong; Roobthaisong, Amonrattana; Maruyama, Fumito; Nakagawa, Ichiro; Chantaroj, Siriporn; Hamada, Shigeyuki

    2014-01-01

    The cholera outbreaks in Thailand during 2007-2010 were exclusively caused by the Vibrio cholerae O1 El Tor variant carrying the cholera toxin gene of the classical biotype. We previously isolated a V. cholerae O1 El Tor strain from a patient with diarrhea and designated it MS6. Multilocus sequence-typing analysis revealed that MS6 is most closely related to the U. S. Gulf Coast clone with the exception of two novel housekeeping genes. The nucleotide sequence of the genome of MS6 was determined and compared with those of 26 V. cholerae strains isolated from clinical and environmental sources worldwide. We show here that the MS6 isolate is distantly related to the ongoing seventh pandemic V. cholerae O1 El Tor strains. These strains differ with respect to polymorphisms in housekeeping genes, seventh pandemic group-specific markers, CTX phages, two genes encoding predicted transmembrane proteins, the presence of metY (MS6_A0927) or hchA/luxR in a highly conserved region of the V. cholerae O1 serogroup, and a superintegron (SI). We found that V. cholerae species carry either hchA/luxR or metY and that the V. cholerae O1 clade commonly possesses hchA/luxR, except for MS6 and U. S. Gulf Coast strains. These findings illuminate the evolutionary relationships among V. cholerae O1 strains. Moreover, the MS6 SI carries a quinolone-resistance gene cassette, which was closely related with those present in plasmid-borne integrons of other gram-negative bacteria. Phylogenetic analysis reveals that MS6 is most closely related to a U. S. Gulf Coast clone, indicating their divergence before that of the El Tor biotype strains from a common V. cholerae O1 ancestor. We propose that MS6 serves as an environmental aquatic reservoir of V. cholerae O1.

  20. Phylogenetic comparison of F-Box (FBX gene superfamily within the plant kingdom reveals divergent evolutionary histories indicative of genomic drift.

    Directory of Open Access Journals (Sweden)

    Zhihua Hua

    Full Text Available The emergence of multigene families has been hypothesized as a major contributor to the evolution of complex traits and speciation. To help understand how such multigene families arose and diverged during plant evolution, we examined the phylogenetic relationships of F-Box (FBX genes, one of the largest and most polymorphic superfamilies known in the plant kingdom. FBX proteins comprise the target recognition subunit of SCF-type ubiquitin-protein ligases, where they individually recruit specific substrates for ubiquitylation. Through the extensive analysis of 10,811 FBX loci from 18 plant species, ranging from the alga Chlamydomonas reinhardtii to numerous monocots and eudicots, we discovered strikingly diverse evolutionary histories. The number of FBX loci varies widely and appears independent of the growth habit and life cycle of land plants, with a little as 198 predicted for Carica papaya to as many as 1350 predicted for Arabidopsis lyrata. This number differs substantially even among closely related species, with evidence for extensive gains/losses. Despite this extraordinary inter-species variation, one subset of FBX genes was conserved among most species examined. Together with evidence of strong purifying selection and expression, the ligases synthesized from these conserved loci likely direct essential ubiquitylation events. Another subset was much more lineage specific, showed more relaxed purifying selection, and was enriched in loci with little or no evidence of expression, suggesting that they either control more limited, species-specific processes or arose from genomic drift and thus may provide reservoirs for evolutionary innovation. Numerous FBX loci were also predicted to be pseudogenes with their numbers tightly correlated with the total number of FBX genes in each species. Taken together, it appears that the FBX superfamily has independently undergone substantial birth/death in many plant lineages, with its size and rapid

  1. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Revisiting Francisella tularensis subsp. holarctica, Causative Agent of Tularemia in Germany With Bioinformatics: New Insights in Genome Structure, DNA Methylation and Comparative Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Anne Busch

    2018-03-01

    Full Text Available Francisella (F. tularensis is a highly virulent, Gram-negative bacterial pathogen and the causative agent of the zoonotic disease tularemia. Here, we generated, analyzed and characterized a high quality circular genome sequence of the F. tularensis subsp. holarctica strain 12T0050 that caused fatal tularemia in a hare. Besides the genomic structure, we focused on the analysis of oriC, unique to the Francisella genus and regulating replication in and outside hosts and the first report on genomic DNA methylation of a Francisella strain. The high quality genome was used to establish and evaluate a diagnostic whole genome sequencing pipeline. A genotyping strategy for F. tularensis was developed using various bioinformatics tools for genotyping. Additionally, whole genome sequences of F. tularensis subsp. holarctica isolates isolated in the years 2008–2015 in Germany were generated. A phylogenetic analysis allowed to determine the genetic relatedness of these isolates and confirmed the highly conserved nature of F. tularensis subsp. holarctica.

  3. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  4. Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

    Science.gov (United States)

    Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

    2007-04-01

    We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

  5. Evaluation of phylogenetic reconstruction methods using bacterial whole genomes: a simulation based study [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    John A. Lees

    2018-03-01

    Full Text Available Background: Phylogenetic reconstruction is a necessary first step in many analyses which use whole genome sequence data from bacterial populations. There are many available methods to infer phylogenies, and these have various advantages and disadvantages, but few unbiased comparisons of the range of approaches have been made. Methods: We simulated data from a defined “true tree” using a realistic evolutionary model. We built phylogenies from this data using a range of methods, and compared reconstructed trees to the true tree using two measures, noting the computational time needed for different phylogenetic reconstructions. We also used real data from Streptococcus pneumoniae alignments to compare individual core gene trees to a core genome tree. Results: We found that, as expected, maximum likelihood trees from good quality alignments were the most accurate, but also the most computationally intensive. Using less accurate phylogenetic reconstruction methods, we were able to obtain results of comparable accuracy; we found that approximate results can rapidly be obtained using genetic distance based methods. In real data we found that highly conserved core genes, such as those involved in translation, gave an inaccurate tree topology, whereas genes involved in recombination events gave inaccurate branch lengths. We also show a tree-of-trees, relating the results of different phylogenetic reconstructions to each other. Conclusions: We recommend three approaches, depending on requirements for accuracy and computational time. Quicker approaches that do not perform full maximum likelihood optimisation may be useful for many analyses requiring a phylogeny, as generating a high quality input alignment is likely to be the major limiting factor of accurate tree topology. We have publicly released our simulated data and code to enable further comparisons.

  6. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  7. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  8. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae).

    Science.gov (United States)

    Eamsobhana, Praphathip; Lim, Phaik Eem; Zhang, Hongman; Gan, Xiaoxian; Yong, Hoi Sen

    2010-12-01

    The phylogenetic relationships and molecular differentiation of three species of angiostrongylid nematodes (Angiostrongylus cantonensis, Angiostrongylus costaricensis and Angiostrongylus malaysiensis) were studied using the AC primers for a 66-kDa protein gene of A. cantonensis. The AC primers successfully amplified the genomic DNA of these angiostrongylid nematodes. No amplification was detected for the DNA of Ascaris lumbricoides, Ascaris suum, Anisakis simplex, Gnathostoma spinigerum, Toxocara canis, and Trichinella spiralis. The maximum-parsimony (MP) consensus tree and the maximum-likelihood (ML) tree both showed that the Angiostrongylus taxa could be divided into two major clades - Clade 1 (A. costaricensis) and Clade 2 (A. cantonensis and A. malaysiensis) with a full support bootstrap value. A. costaricensis is the most distant taxon. A. cantonensis is a sister group to A. malaysiensis; these two taxa (species) are clearly separated. There is no clear distinction between the A. cantonensis samples from four different geographical localities (Thailand, China, Japan and Hawaii); only some of the samples are grouped ranging from no support or low support to moderate support of bootstrap values. The published nucleotide sequences of A. cantonensis adult-specific native 66kDa protein mRNA, clone L5-400 from Taiwan (U17585) appear to be very distant from the A. cantonensis samples from Thailand, China, Japan and Hawaii, with the uncorrected p-distance values ranging from 26.87% to 29.92%.

  9. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  10. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  12. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  13. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Multi-population Genomic Relationships for Estimating Current Genetic Variances Within and Genetic Correlations Between Populations.

    Science.gov (United States)

    Wientjes, Yvonne C J; Bijma, Piter; Vandenplas, Jérémie; Calus, Mario P L

    2017-10-01

    Different methods are available to calculate multi-population genomic relationship matrices. Since those matrices differ in base population, it is anticipated that the method used to calculate genomic relationships affects the estimate of genetic variances, covariances, and correlations. The aim of this article is to define the multi-population genomic relationship matrix to estimate current genetic variances within and genetic correlations between populations. The genomic relationship matrix containing two populations consists of four blocks, one block for population 1, one block for population 2, and two blocks for relationships between the populations. It is known, based on literature, that by using current allele frequencies to calculate genomic relationships within a population, current genetic variances are estimated. In this article, we theoretically derived the properties of the genomic relationship matrix to estimate genetic correlations between populations and validated it using simulations. When the scaling factor of across-population genomic relationships is equal to the product of the square roots of the scaling factors for within-population genomic relationships, the genetic correlation is estimated unbiasedly even though estimated genetic variances do not necessarily refer to the current population. When this property is not met, the correlation based on estimated variances should be multiplied by a correction factor based on the scaling factors. In this study, we present a genomic relationship matrix which directly estimates current genetic variances as well as genetic correlations between populations. Copyright © 2017 by the Genetics Society of America.

  15. Insights into the Bamboo Genome: Syntenic Relationships to Rice and Sorghum

    Institute of Scientific and Technical Information of China (English)

    Yi-Jie Gui; Nai-Xun Ma; Tian-Zhen Zhang; Long-Jiang Fan; Yan Zhou; Yu Wang; Sheng Wang; Sheng-Yue Wang; Yan Hu; Shi-Ping Bo; Huan Chen; Chang-Ping Zhou

    2010-01-01

    Bamboo occupies an important phylogenetic node in the grass family and plays a significant role in the forest industry.We produced 1.2 Mb of tetraploid moso bamboo(Phyllostachys pubescens E.Mazel ex H.de Leh.)sequences from 13 bacterial artificial chromosome(BAC)clones,and these are the largest genomic sequences available so far from the subfamily Bambusoideae.The content of repetitive elements(36.2%)in bamboo is similar to that in rice.Both rice and sorghum exhibit high genomic synteny with bamboo,which suggests that rice and sorghum may be useful as models for decoding Bambusoideae genomes.

  16. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

    Science.gov (United States)

    Kuzmin, I V; Hughes, G J; Rupprecht, C E

    2006-08-01

    Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

  17. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

    Directory of Open Access Journals (Sweden)

    Maritza Barrera

    2017-01-01

    Full Text Available In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV, clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  19. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  20. Phylogenetic relationships of three new microsporidian isolates from the silkworm, Bombyx mori.

    Science.gov (United States)

    Nageswara Rao, S; Muthulakshmi, M; Kanginakudru, S; Nagaraju, J

    2004-07-01

    The pathogenicity, mode of transmission, tissue specificity of infection and the small subunit rRNA (SSU-rRNA) gene sequences of the three new microsporidian isolates from the silkworm Bombyx mori were studied. Out of the three, NIK-2r revealed life cycle features and SSU-rRNA gene sequence similar to Nosema bombycis, suggesting that it is N. bombycis. The other two, NIK-4m and NIK-3h, differed from each other as well as from N. bombycis. NIK-4m was highly pathogenic and did not show any vertical transmission, in accordance with the apparent lack of gonadal infection, whereas NIK-3h was less pathogenic and vertical transmission was not detected but could not be excluded. Phylogenetic analysis based on SSU-rRNA gene sequence placed NIK-3h and NIK-4m in a distinct clade that included almost all the Vairimorpha species and Nosema species that infect lepidopteran and non-lepidopteran hosts, while NIK-2r was included in a clade containing almost all the Nosema isolates that infect only lepidopteran hosts. Thus, we have presented molecular evidence that one of the three isolates is in fact the type species N. bombycis, while the other two isolates are Vairimorpha spp. There was distinct separation of microsporidian isolates infecting only lepidopteran hosts and those infecting lepidopteran and non-lepidopteran hosts, reflecting possible co-evolution of hosts and microsporidian isolates.

  1. Coptobrycon bilineatus (Ellis, 1911 (Characiformes: Characidae: redescription and comments on its phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Francisco Langeani

    Full Text Available Coptobrycon bilineatus (Ellis, 1911 is redescribed on the basis of specimens from the District of Paranapiacaba, Municipality of Santo André, upper rio Tietê, and additional ones recently collected in a small coastal river system of Serra do Mar, very near the headwaters of the rio Tietê. The genus was compared to other Characidae lacking a supraorbital, and it seems to be more phylogenetically related to Grundulus based on the possession of various putative apomorphic character states related to: the absence of a rhinosphenoid and fourth, fifth (sometimes and sixth infraorbitals; nasal pores separated; nares with up to six nasal lamellae; cephalic laterosensory system poorly developed on supraorbital and infraorbital series; and a globose scapula. Furthermore, Coptobrycon and Grundulus are characterized by the absence of the adipose fin, of the supraorbital laterosensory series on the parietal, and of the humeral spot, and by the reduction of lateral musculature in front of the first pleural rib and between the first and second pleural ribs. Biogeographic comments are also provided.

  2. Phylogenetic Characterization of Encephalitozoon Romaleae (Microsporidia) from a Grasshopper Host: Relationship to Encephalitozoon spp. Infecting Humans

    Science.gov (United States)

    Encephalitozoon species are the most common microsporidian pathogens of humans and domesticated animals. We recently discovered a new microsporidium, Encephalitozoon romaleae, infecting the eastern lubber grasshopper Romalea microptera. To understand its evolutionary relationships, we compared par...

  3. Exploring relationships between host genome and microbiome: new insights from genome-wide association studies.

    Directory of Open Access Journals (Sweden)

    Muslihudeen Abdul-Razaq Abdul-Aziz

    2016-10-01

    Full Text Available As our understanding of the human microbiome expands, impacts on health and disease continue to be revealed. Alterations in the microbiome can result in dysbiosis, which has now been linked to subsequent autoimmune and metabolic diseases, highlighting the need to identify factors that shape the microbiome. Research has identified that the composition and functions of the human microbiome can be influenced by diet, age, gender, and environment. More recently, studies have explored how human genetic variation may also influence the microbiome. Here, we review several recent analytical advances in this new research area, including those that use genome-wide association studies to examine host genome-microbiome interactions, while controlling for the influence of other factors. We find that current research is limited by small sample sizes, lack of cohort replication, and insufficient confirmatory mechanistic studies. In addition, we discuss the importance of understanding long-term interactions between the host genome and microbiome, as well as the potential impacts of disrupting this relationship, and explore new research avenues that may provide information about the co-evolutionary history of humans and their microorganisms.

  4. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  5. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  7. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  8. The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres)

    Science.gov (United States)

    Worthy, Trevor H.; Degrange, Federico J.; Handley, Warren D.; Lee, Michael S. Y.

    2017-10-01

    The extinct dromornithids, gastornithids and phorusrhacids are among the most spectacular birds to have ever lived, with some giants exceeding 500 kg. The affinities and evolution of these and other related extinct birds remain contentious, with previous phylogenetic analyses being affected by widespread convergence and limited taxon sampling. We address these problems using both parsimony and tip-dated Bayesian approaches on an expansive taxon set that includes all key extinct flightless and flighted (e.g. Vegavis and lithornithids) forms, an extensive array of extant fowl (Galloanseres), representative Neoaves and palaeognaths. The Paleogene volant Lithornithidae are recovered as stem palaeognaths in the Bayesian analyses. The Galloanseres comprise four clades inferred to have diverged in the Late Cretaceous on Gondwana. In addition to Anseriformes and Galliformes, we recognize a robust new clade (Gastornithiformes) for the giant flightless Dromornithidae (Australia) and Gastornithidae (Eurasia, North America). This clade exhibits parallels to ratite palaeognaths in that flight presumably was lost and giant size attained multiple times. A fourth clade is represented by the Cretaceous Vegavis (Antarctica), which was strongly excluded from Anseriformes; thus, a crucial molecular calibration point needs to be reconsidered. The presbyornithids Wilaru (Australia) and Presbyornis (Northern Hemisphere) are robustly found to be the sister group to Anatoidea (Anseranatidae + Anatidae), a relatively more basal position than hitherto recognized. South America's largest bird, Brontornis, is not a galloansere, but a member of Neoaves related to Cariamiformes; therefore, giant Galloanseres remain unknown from this continent. Trait analyses showed that while gigantism and flightlessness evolved repeatedly in groups, diet is constrained by phylogeny: all giant Galloanseres and palaeognaths are herbivores or mainly herbivorous, and giant neoavians are zoophagous or omnivorous.

  9. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  10. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  11. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  12. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    elasmobranch cestodes. Across analyses, the sister group to the clade of "terrestrial" cestode orders was found to be an elasmobranch-hosted genus, as was the sister to the freshwater fish- and tetrapod-hosted Proteocephalidea. Whilst further data are required to resolve outstanding nomenclatural and phylogenetic issues, the present analyses contribute significantly to an understanding of the evolutionary radiation of the entire Cestoda. Clearly, elasmobranch tapeworms comprise the backbone of cestode phylogeny. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  13. Mitochondrial genome sequences reveal evolutionary relationships of the Phytophthora 1c clade species.

    Science.gov (United States)

    Lassiter, Erica S; Russ, Carsten; Nusbaum, Chad; Zeng, Qiandong; Saville, Amanda C; Olarte, Rodrigo A; Carbone, Ignazio; Hu, Chia-Hui; Seguin-Orlando, Andaine; Samaniego, Jose A; Thorne, Jeffrey L; Ristaino, Jean B

    2015-11-01

    Phytophthora infestans is one of the most destructive plant pathogens of potato and tomato globally. The pathogen is closely related to four other Phytophthora species in the 1c clade including P. phaseoli, P. ipomoeae, P. mirabilis and P. andina that are important pathogens of other wild and domesticated hosts. P. andina is an interspecific hybrid between P. infestans and an unknown Phytophthora species. We have sequenced mitochondrial genomes of the sister species of P. infestans and examined the evolutionary relationships within the clade. Phylogenetic analysis indicates that the P. phaseoli mitochondrial lineage is basal within the clade. P. mirabilis and P. ipomoeae are sister lineages and share a common ancestor with the Ic mitochondrial lineage of P. andina. These lineages in turn are sister to the P. infestans and P. andina Ia mitochondrial lineages. The P. andina Ic lineage diverged much earlier than the P. andina Ia mitochondrial lineage and P. infestans. The presence of two mitochondrial lineages in P. andina supports the hybrid nature of this species. The ancestral state of the P. andina Ic lineage in the tree and its occurrence only in the Andean regions of Ecuador, Colombia and Peru suggests that the origin of this species hybrid in nature may occur there.

  14. Phylogenetic relationships of geckos of the genus Nactus and their relatives (Squamata: Gekkonidae

    Directory of Open Access Journals (Sweden)

    Todd R. Jackman

    2008-05-01

    Full Text Available We employed nuclear and mitochondrial DNA sequence data to investigate relationships within the gekkonid genus Nactus and between Nactus and other gekkonid genera. Nuclear (RAG-1, PDC and mitochondrial (ND2 data provide strong support for conflicting patterns of relationship among bisexual New Guinean species of Nactus and the unisexual oceanic form N. pelagicus. This may be explained by an ancient mitochondrial introgression event between N. sphaerodactylodes and N. vankampeni, a recent selective sweep of mitochondrial DNA throughout N. vankampeni, and gene conflict stemming from the hybrid event that gave rise to N. pelagicus. Strong support from all data partitions is obtained for the sister group relationship of Nactus to a clade consisting of the Australian Heteronotia and the Southeast Asian Dixonius. Putative synapomorphies of the Nactus/Heteronotia/Dixonius clade include the reduction of the second phalanx of digit IV of the manus and the presence of regular rows of keeled (sometimes multicarinate dorsal tubercles on the dorsum. Nactus and Heteronotia both include parthenogenetic species formed via hybridogenesis. This is rare among geckos, and vertebrates in general, and at some level may also be synapomorphic. Dixonius is not known to have any all-female species, but “D. siamensis” consists of multiple chromosome “races” that mirror morphologically cryptic, but karyotypically distinct, species in the other two genera. The strong support for the Nactus/Heteronotia/Dixonius clade demonstrates that the leaf-toed digital morphology of Dixonius has evolved multiple times within the Gekkonidae and suggests that superficial digital morphology may be misleading with respect to gekkonid suprageneric relationships.

  15. Genomic and phylogenetic evidence that Maize rough dwarf and Rice black-streaked dwarf fijiviruses should be classified as different geographic strains of a single species.

    Science.gov (United States)

    Xie, L; Lv, M-F; Yang, J; Chen, J-P; Zhang, H-M

    Maize rough dwarf disease (MRDD) has long been known as one of the most devastating viral diseases of maize worldwide and is caused by single or complex infection by four fijiviruses: Maize rough dwarf virus (MRDV) in Europe and the Middle East, Mal de Rio Cuarto virus (MRCV) in South America, rice black-streaked dwarf virus (RBSDV), and Southern rice black-streaked dwarf virus (SRBSDV or Rice black-streaked dwarf virus 2, RBSDV-2) in East Asia. These are currently classified as four distinct species in the genus Fijivirus, family Reoviridae, but their taxonomic status has been questioned. To help resolve this, the nucleotide sequences of the ten genomic segments of an Italian isolate of MRDV have been determined, providing the first complete genomic sequence of this virus. Its genome has 29144 nucleotides and is similar in organization to those of RBSDV, SRBSDV, and MRCV. The 13 ORFs always share highest identities (81.3-97.2%) with the corresponding ORFs of RBSDV and phylogenetic analyses of the different genome segments and ORFs all confirm that MRDV clusters most closely with RBSDV and that MRCV and SRBSDV are slightly more distantly related. The results suggest that MRDV and RBSDV should be classified as different geographic strains of the same virus species and we suggest the name cereal black-streaked dwarf fijivirus (CBSDV) for consideration.

  16. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio).

    Science.gov (United States)

    Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  17. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio)

    Science.gov (United States)

    Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731

  18. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC Transporter Genes in Common Carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Xiang Liu

    Full Text Available The ATP-binding cassette (ABC gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  19. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  20. Assessment of genomic relationship between Oryza sativa and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-01

    Mar 1, 2010 ... For genomic in situ hybridization, genomic DNA from O. australiensis was used as probe for the mitotic and meiotic ... Wide hybridization is one of the plant breeding approaches ..... Disease and insect resistance in rice.

  1. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  2. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  3. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  4. The complete chloroplast genome sequence of Aster spathulifolius (Asteraceae); genomic features and relationship with Asteraceae.

    Science.gov (United States)

    Choi, Kyoung Su; Park, SeonJoo

    2015-11-10

    Aster spathulifolius, a member of the Asteraceae family, is distributed along the coast of Japan and Korea. This plant is used for medicinal and ornamental purposes. The complete chloroplast (cp) genome of A. sphathulifolius consists of 149,473 bp that include a pair of inverted repeats of 24,751 bp separated by a large single copy region of 81,998 bp and a small single copy region of 17,973 bp. The chloroplast genome contains 78 coding genes, four rRNA genes and 29 tRNA genes. When compared to other cpDNA sequences of Asteraceae, A. spathulifolius showed the closest relationship with Jacobaea vulgaris, and its atpB gene was found to be a pseudogene, unlike J. vulgaris. Furthermore, evaluation of the gene compositions of J. vulgaris, Helianthus annuus, Guizotia abyssinica and A. spathulifolius revealed that 13.6-kb showed inversion from ndhF to rps15, unlike Lactuca of Asteraceae. Comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates with J. vulgaris revealed that synonymous genes related to a small subunit of the ribosome showed the highest value (0.1558), while nonsynonymous rates of genes related to ATP synthase genes were highest (0.0118). These findings revealed that substitution has occurred at similar rates in most genes, and the substitution rates suggested that most genes is a purified selection. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Whole-Genome Analysis of a Novel Fish Reovirus (MsReV Discloses Aquareovirus Genomic Structure Relationship with Host in Saline Environments

    Directory of Open Access Journals (Sweden)

    Zhong-Yuan Chen

    2015-08-01

    Full Text Available Aquareoviruses are serious pathogens of aquatic animals. Here, genome characterization and functional gene analysis of a novel aquareovirus, largemouth bass Micropterus salmoides reovirus (MsReV, was described. It comprises 11 dsRNA segments (S1–S11 covering 24,024 bp, and encodes 12 putative proteins including the inclusion forming-related protein NS87 and the fusion-associated small transmembrane (FAST protein NS22. The function of NS22 was confirmed by expression in fish cells. Subsequently, MsReV was compared with two representative aquareoviruses, saltwater fish turbot Scophthalmus maximus reovirus (SMReV and freshwater fish grass carp reovirus strain 109 (GCReV-109. MsReV NS87 and NS22 genes have the same structure and function with those of SMReV, whereas GCReV-109 is either missing the coiled-coil region in NS79 or the gene-encoding NS22. Significant similarities are also revealed among equivalent genome segments between MsReV and SMReV, but a difference is found between MsReV and GCReV-109. Furthermore, phylogenetic analysis showed that 13 aquareoviruses could be divided into freshwater and saline environments subgroups, and MsReV was closely related to SMReV in saline environments. Consequently, these viruses from hosts in saline environments have more genomic structural similarities than the viruses from hosts in freshwater. This is the first study of the relationships between aquareovirus genomic structure and their host environments.

  6. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  7. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  8. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  9. Unraveling the evolutionary history of the phosphoryl-transfer chain of the phosphoenolpyruvate:phosphotransferase system through phylogenetic analyses and genome context

    Directory of Open Access Journals (Sweden)

    Zúñiga Manuel

    2008-05-01

    Full Text Available Abstract Background The phosphoenolpyruvate phosphotransferase system (PTS plays a major role in sugar transport and in the regulation of essential physiological processes in many bacteria. The PTS couples solute transport to its phosphorylation at the expense of phosphoenolpyruvate (PEP and it consists of general cytoplasmic phosphoryl transfer proteins and specific enzyme II complexes which catalyze the uptake and phosphorylation of solutes. Previous studies have suggested that the evolution of the constituents of the enzyme II complexes has been driven largely by horizontal gene transfer whereas vertical inheritance has been prevalent in the general phosphoryl transfer proteins in some bacterial groups. The aim of this work is to test this hypothesis by studying the evolution of the phosphoryl transfer proteins of the PTS. Results We have analyzed the evolutionary history of the PTS phosphoryl transfer chain (PTS-ptc components in 222 complete genomes by combining phylogenetic methods and analysis of genomic context. Phylogenetic analyses alone were not conclusive for the deepest nodes but when complemented with analyses of genomic context and functional information, the main evolutionary trends of this system could be depicted. Conclusion The PTS-ptc evolved in bacteria after the divergence of early lineages such as Aquificales, Thermotogales and Thermus/Deinococcus. The subsequent evolutionary history of the PTS-ptc varied in different bacterial lineages: vertical inheritance and lineage-specific gene losses mainly explain the current situation in Actinobacteria and Firmicutes whereas horizontal gene transfer (HGT also played a major role in Proteobacteria. Most remarkably, we have identified a HGT event from Firmicutes or Fusobacteria to the last common ancestor of the Enterobacteriaceae, Pasteurellaceae, Shewanellaceae and Vibrionaceae. This transfer led to extensive changes in the metabolic and regulatory networks of these bacteria

  10. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  11. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  12. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  13. Resolution among major placental mammal interordinal relationships with genome data imply that speciation influenced their earliest radiations

    Directory of Open Access Journals (Sweden)

    Janke Axel

    2008-05-01

    Full Text Available Abstract Background A number of the deeper divergences in the placental mammal tree are still inconclusively resolved despite extensive phylogenomic analyses. A recent analysis of 200 kbp of protein coding sequences yielded only limited support for the relationships among Laurasiatheria (cow, dog, bat and shrew, probably because the divergences occurred only within a few million years from each other. It is generally expected that increasing the amount of data and improving the taxon sampling enhance the resolution of narrow divergences. Therefore these and other difficult splits were examined by phylogenomic analysis of the hitherto largest sequence alignment. The increasingly complete genome data of placental mammals also allowed developing a novel and stringent data search method. Results The rigorous data handling, recursive BLAST, successfully removed the sequences from gene families, including those from well-known families hemoglobin, olfactory, myosin and HOX genes, thus avoiding alignment of possibly paralogous sequences. The current phylogenomic analysis of 3,012 genes (2,844,615 nucleotides from a total of 22 species yielded statistically significant support for most relationships. While some major clades were confirmed using genomic sequence data, the placement of the treeshrew, bat and the relationship between Boreoeutheria, Xenarthra and Afrotheria remained problematic to resolve despite the size of the alignment. Phylogenomic analysis of divergence times dated the basal placental mammal splits at 95–100 million years ago. Many of the following divergences occurred only a few (2–4 million years later. Relationships with narrow divergence time intervals received unexpectedly limited support even from the phylogenomic analyses. Conclusion The narrow temporal window within which some placental divergences took place suggests that inconsistencies and limited resolution of the mammalian tree may have their natural explanation in

  14. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  15. Phylogenetic relationships and pathogenicity variation of two Newcastle disease viruses isolated from domestic ducks in Southern China.

    Science.gov (United States)

    Kang, Yinfeng; Li, Yanling; Yuan, Runyu; Li, Xianwei; Sun, Minhua; Wang, Zhaoxiong; Feng, Minsha; Jiao, Peirong; Ren, Tao

    2014-08-12

    Newcastle disease (ND) is an OIE listed disease caused by virulent avian paramyxovirus type 1 (APMV-1) strains, which is enzootic and causes large economic losses in the poultry sector. Genotype VII and genotype IX NDV viruses were the predominant circulating genotype in China, which may possibly be responsible for disease outbreaks in chicken flocks in recent years. While ducks and geese usually have exhibited inapparent infections. In the present study, we investigate the complete genome sequence, the clinicopathological characterization and transmission of two virulent Newcastle disease viruses, SS-10 and NH-10, isolated from domestic ducks in Southern China in 2010. F, and the complete gene sequences based on phylogenetic analysis demonstrated that SS-10 (genotype VII) and NH-10 (genotype IX) belongs to class II. The deduced amino acid sequence was (112)R-R-Q-K/R-R-F(117) at the fusion protein cleavage site. Animal experiment results showed that the SS-10 virus isolated from ducks was highly pathogenic for chickens and geese, but low pathogenic for ducks. It could be detected from spleen, lung, kidney, trachea, small intestine, bursa of fabricius, thymus, pancreas and cecal tonsils, oropharyngeal and cloacal swabs, and could transmit to the naive contact birds. Moreover, it could transmit to chickens, ducks and geese by naive contact. However, the NH-10 virus isolated from ducks could infect some chickens, ducks and geese, but only caused chickens to die. Additionally, it could transmit to the naive contact chickens, ducks, and geese. The two NDV isolates exhibited different biological properties with respect to pathogenicity and transmission in chickens, ducks and geese. Therefore, no species-preference exists for chicken, duck or goose viruses and more attention should be paid to the trans-species transmission of VII NDVs between ducks, geese and chickens for the control and eradication of ND.

  16. Phylogenetic Relationships between Four Salix L. Species Based on DArT Markers

    Directory of Open Access Journals (Sweden)

    Jerzy A. Przyborowski

    2013-12-01

    Full Text Available The objectives of this study were to evaluate the usefulness of DArT markers in genotypic identification of willow species and describe genetic relationships between four willow species: Salix viminalis, S. purpurea, S. alba and S. triandra. The experimental plant material comprised 53 willow genotypes of these four species, which are popularly grown in Poland. DArT markers seem to identify Salix species with a high degree of accuracy. As a result, the examined species were divided into four distinct groups which corresponded to the four analyzed species. In our study, we observed that S. triandra was very different genetically from the other species, including S. alba which is generally classified into the same subgenus of Salix. The above corroborates the findings of other authors who relied on molecular methods to reveal that the classification of S. triandra to the subgenus Salix was erroneous. The Principal Coordinate Analysis (PCoA and the neighbor-joining dendrogram also confirmed the clear division of the studied willow genotypes into four clusters corresponding to individual species. This confirmed the usefulness of DArT markers in taxonomic analyses and identification of willow species.

  17. Phylogenetic relationships of Vepris (Rutaceae inferred from chloroplast, nuclear, and morphological data.

    Directory of Open Access Journals (Sweden)

    Cynthia M Morton

    Full Text Available The tribe Toddalieae Hook. F. (Rutaceae has been controversial since its inception by Bentham and Hooker. The nine taxa examined, Acronychia J.R. & G.Foster, Diphasia Pierre, Diphasiopsis Mendonca, Fagaropsis Mildbr.ex. Siebenl., Oricia Pierre, Teclea Delile, Toddaliopsis Engl., Toddalia Juss. and Vepris Comm. ex. A. Juss, have been recognized under the tribe Toddalieae or Tribes Acronychia, Phellodendron and Toddalia. More recently Araliopsis Engl., Diphasia, Diphasiopsis, Oricia, Teclea, and Toddaliopsis have been incorporated into the genus Vepris, while Toddalia and Fagaropsis have continued to be recognized as closely related. For this study, sequence data of one non-coding chloroplast region (trnL-F and one nuclear region (ITS and various morphological characters, based on Mziray's taxonomic studies were examined to try to elucidate these relationships. This study found that the taxa Diphasia, Diphasiopsis, Oricia, Teclea, Toddaliopsis, Vepris, Toddalia eugeniifolia Engl. and Toddalia glomerata F. Hoffm. form a monophyletic group. Due to the amount of intrageneric and intraspecific variation, species delimitations were difficult to determine; however, these genera should be united into Vepris. The analyses also confirmed that Toddalia asiatica (L. Lam., Zanthoxylon sp. and Fagaropsis angolensis (Engl. H.M. Gardner are the closest relatives to this group.

  18. Phylogenetic relationships among Lactuca (Asteraceae) species and related genera based on ITS-1 DNA sequences.

    Science.gov (United States)

    Koopman, W J; Guetta, E; van de Wiel, C C; Vosman, B; van den Berg, R G

    1998-11-01

    Internal transcribed spacer (ITS-1) sequences from 97 accessions representing 23 species of Lactuca and related genera were determined and used to evaluate species relationships of Lactuca sensu lato (s.l.). The ITS-1 phylogenies, calculated using PAUP and PHYLIP, correspond better to the classification of Feráková than to other classifications evaluated, although the inclusion of sect. Lactuca subsect. Cyanicae is not supported. Therefore, exclusion of subsect. Cyanicae from Lactuca sensu Feráková is proposed. The amended genus contains the entire gene pool (sensu Harlan and De Wet) of cultivated lettuce (Lactuca sativa). The position of the species in the amended classification corresponds to their position in the lettuce gene pool. In the ITS-1 phylogenies, a clade with L. sativa, L. serriola, L. dregeana, L. altaica, and L. aculeata represents the primary gene pool. L. virosa and L. saligna, branching off closest to this clade, encompass the secondary gene pool. L. virosa is possibly of hybrid origin. The primary and secondary gene pool species are classified in sect. Lactuca subsect. Lactuca. The species L. quercina, L. viminea, L. sibirica, and L. tatarica, branching off next, represent the tertiary gene pool. They are classified in Lactuca sect. Lactucopsis, sect. Phaenixopus, and sect. Mulgedium, respectively. L. perennis and L. tenerrima, classified in sect. Lactuca subsect. Cyanicae, form clades with species from related genera and are not part of the lettuce gene pool.

  19. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  20. Genome-wide identification of aquaporin encoding genes in Brassica oleracea and their phylogenetic sequence comparison to Brassica crops and Arabidopsis

    Science.gov (United States)

    Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.

    2015-01-01

    Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of

  1. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum".

    Directory of Open Access Journals (Sweden)

    Sophie R Ullrich

    Full Text Available Members of the genus "Ferrovum" are ubiquitously distributed in acid mine drainage (AMD waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain "Ferrovum myxofaciens" P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus "Ferrovum" is extremely scarce.In order to access the wider genetic pool of the genus "Ferrovum" we sequenced the genome of a "Ferrovum"-containing mixed culture and successfully assembled the almost complete genome sequence of the novel "Ferrovum" strain JA12.The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct "Ferrovum" species. "Ferrovum" strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that "Ferrovum" strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively.The potential utilisation of urea by "Ferrovum" strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs "Ferrovum" strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin and Acidithiobacillus ferrivorans (iron oxidase indicates the existence of a modified pathway in "Ferrovum" strain JA12

  2. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand

    Directory of Open Access Journals (Sweden)

    Kittisak Buddhachat

    2018-01-01

    Full Text Available Taxonomic uncertainty of the Asian tree frog Polypedates leucomystax complex presents the challenging task of inferring its biogeographical history. Here, we describe its dispersion and the genetic relationships among different populations in Thailand, where we connect the population of the P. leucomystax complex of the Sunda Islands to the Indochina (mainland population based on analyses of 266 sequences of the mitochondrial cytochrome c oxidase subunit I (COI gene. Our maternal genealogy implies that there are four well-supported lineages in Thailand, consisting of Northern A (clade A: Polypedates sp., Nan (clade B: P. cf. impresus, Southern (clade C: P. cf. leucomystax and Northern D (clade D: P. cf. megacephalus, with Bayesian posterior probability >0.9. Phylogeny and haplotype networks indicate that clades A, B and D are sympatric. In contrast, clade C (P. cf. leucomystax and clade D (P. cf. megacephalus are genetically divergent due to the geographical barrier of the Isthmus of Kra, resulting in an allopatric distribution. Climatic conditions, in particular differences in rainfall on each side of the Isthmus of Kra, may play an important role in limiting the immigration of both clades. For the within-populations of either clades C or D, there was no significant correlation between geographic and genetic distance by the isolation-by-distance test, indicating intraspecific-dispersal of each clade. Population expansion occurred in clade C, whereas clade D showed a constant population. Taken together, the P. leucomystax complex in South East Asia may have diversified under climatic pressure, leading to allopatric and/or sympatric speciation.

  3. Phylogenetic relationships in the Festuca-Lolium complex (Loliinae; Poaceae: New insights from chloroplast sequences

    Directory of Open Access Journals (Sweden)

    Yajuan Cheng

    2016-07-01

    Full Text Available The species within the Lolium/Festuca grass complex have dispersed and colonized large areas of temperate global grasslands both naturally and by human intervention. The species within this grass complex represent some of the most important grass species both for amenity and agricultural use worldwide. There has been renewed interest by grass breeders in producing hybrid combinations between these species and several countries now market Festulolium varieties as a combination of genes from both genera. The two genera have been differentiated by their inflorescence structure, but controversy has surrounded the taxonomic classification of the Lolium-Festuca complex species for several decades. In order to better understand the complexities within the Lolium/Festuca complex and their genetic background, the phylogeny of important examplers from the Lolium-Festuca complex were reconstructed. In total 40 taxa representing the Festuca and Lolium species with Vulpia myuros and Brachypodium distachyon as outgroups were sampled, using two noncoding intergenic spacers (trnQ-rps16, trnH-psbA and one coding gene (rbcL. Maximum parsimony (MP, Bayesian inference (BI analyses based on each partition and combined plastid DNA dataset, and median-jointing network analysis were employed. The outcomes strongly suggested that the subgen. Schedonorus has a close relationship to Lolium, and it is also proposed to move the sect. Leucopoa from subgen. Leucopoa to Subgen. Schedonorus and to separate sect. Breviaristatae from the subgen. Leucopoa. We found that F. californica could be a lineage of hybrid origin because of its intermediate placement between the broad-leaved and fine-leaved clade.

  4. Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

    Science.gov (United States)

    Semina, A V; Polyakova, N E; Brykov, Vl A

    2007-12-01

    To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

  5. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  6. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    OpenAIRE

    Henrique Machado; Henrique Machado; Lone Gram

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationship...

  7. Genomic and phylogenetic analyses of an adenovirus isolated from a corn snake (Elaphe guttata) imply a common origin with members of the proposed new genus Atadenovirus.

    Science.gov (United States)

    Farkas, Szilvia L; Benko, Mária; Elo, Péter; Ursu, Krisztina; Dán, Adám; Ahne, Winfried; Harrach, Balázs

    2002-10-01

    Approximately 60% of the genome of an adenovirus isolated from a corn snake (Elaphe guttata) was cloned and sequenced. The results of homology searches showed that the genes of the corn snake adenovirus (SnAdV-1) were closest to their counterparts in members of the recently proposed new genus ATADENOVIRUS: In phylogenetic analyses of the complete hexon and protease genes, SnAdV-1 indeed clustered together with the atadenoviruses. The characteristic features in the genome organization of SnAdV-1 included the presence of a gene homologous to that for protein p32K, the lack of structural proteins V and IX and the absence of homologues of the E1A and E3 regions. These characteristics are in accordance with the genus-defining markers of atadenoviruses. Comparison of the cleavage sites of the viral protease in core protein pVII also confirmed SnAdV-1 as a candidate member of the genus ATADENOVIRUS: Thus, the hypothesis on the possible reptilian origin of atadenoviruses (Harrach, Acta Veterinaria Hungarica 48, 484-490, 2000) seems to be supported. However, the base composition of DNA sequence (>18 kb) determined from the SnAdV-1 genome showed an equilibrated GC content of 51%, which is unusual for an atadenovirus.

  8. Phylogenetic analysis of Puumala virus strains from Central Europe highlights the need for a full-genome perspective on hantavirus evolution.

    Science.gov (United States)

    Szabó, Róbert; Radosa, Lukáš; Ličková, Martina; Sláviková, Monika; Heroldová, Marta; Stanko, Michal; Pejčoch, Milan; Osterberg, Anja; Laenen, Lies; Schex, Susanne; Ulrich, Rainer G; Essbauer, Sandra; Maes, Piet; Klempa, Boris

    2017-12-01

    Puumala virus (PUUV), carried by bank voles (Myodes glareolus), is the medically most important hantavirus in Central and Western Europe. In this study, a total of 523 bank voles (408 from Germany, 72 from Slovakia, and 43 from Czech Republic) collected between the years 2007-2012 were analyzed for the presence of hantavirus RNA. Partial PUUV genome segment sequences were obtained from 51 voles. Phylogenetic analyses of all three genome segments showed that the newfound strains cluster with other Central and Western European PUUV strains. The new sequences from Šumava (Bohemian Forest), Czech Republic, are most closely related to the strains from the neighboring Bavarian Forest, a known hantavirus disease outbreak region. Interestingly, the Slovak strains clustered with the sequences from Bohemian and Bavarian Forests only in the M but not S segment analyses. This well-supported topological incongruence suggests a segment reassortment event or, as we analyzed only partial sequences, homologous recombination. Our data highlight the necessity of sequencing all three hantavirus genome segments and of a broader bank vole screening not only in recognized endemic foci but also in regions with no reported human hantavirus disease cases.

  9. Characterization of the genome of a phylogenetically distinct tospovirus and its interactions with the local lesion-induced host Chenopodium quinoa by whole-transcriptome analyses.

    Science.gov (United States)

    Chou, Wan-Chen; Lin, Shih-Shun; Yeh, Shyi-Dong; Li, Siang-Ling; Peng, Ying-Che; Fan, Ya-Hsu; Chen, Tsung-Chi

    2017-01-01

    Chenopodium quinoa is a natural local lesion host of numerous plant viruses, including tospoviruses (family Bunyaviridae). Groundnut chlorotic fan-spot tospovirus (GCFSV) has been shown to consistently induce local lesions on the leaves of C. quinoa 4 days post-inoculation (dpi). To reveal the whole genome of GCFSV and its interactions with C. quinoa, RNA-seq was performed to determine the transcriptome profiles of C. quinoa leaves. The high-throughput reads from infected C. quinoa leaves were used to identify the whole genome sequence of GCFSV and its single nucleotide polymorphisms. Our results indicated that GCFSV is a phylogenetically distinct tospovirus. Moreover, 27,170 coding and 29,563 non-coding sequences of C. quinoa were identified through de novo assembly, mixing reads from mock and infected samples. Several key genes involved in the modulation of hypersensitive response (HR) were identified. The expression levels of 4,893 deduced complete genes annotated using the Arabidopsis genome indicated that several HR-related orthologues of pathogenesis-related proteins, transcription factors, mitogen-activated protein kinases, and defense proteins were significantly expressed in leaves that formed local lesions. Here, we also provide new insights into the replication progression of a tospovirus and the molecular regulation of the C. quinoa response to virus infection.

  10. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  11. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  13. Polytomy identification in microbial phylogenetic reconstruction

    Directory of Open Access Journals (Sweden)

    Lin Guan

    2011-12-01

    Full Text Available Abstract Background A phylogenetic tree, showing ancestral relations among organisms, is commonly represented as a rooted tree with sets of bifurcating branches (dichotomies for simplicity, although polytomies (multifurcating branches may reflect more accurate evolutionary relationships. To represent the true evolutionary relationships, it is important to systematically identify the polytomies from a bifurcating tree and generate a taxonomy-compatible multifurcating tree. For this purpose we propose a novel approach, "PolyPhy", which would classify a set of bifurcating branches of a phylogenetic tree into a set of branches with dichotomies and polytomies by considering genome distances among genomes and tree topological properties. Results PolyPhy employs a machine learning technique, BLR (Bayesian logistic regression classifier, to identify possible bifurcating subtrees as polytomies from the trees resulted from ComPhy. Other than considering genome-scale distances between all pairs of species, PolyPhy also takes into account different properties of tree topology between dichotomy and polytomy, such as long-branch retraction and short-branch contraction, and quantifies these properties into comparable rates among different sub-branches. We extract three tree topological features, 'LR' (Leaf rate, 'IntraR' (Intra-subset branch rate and 'InterR' (Inter-subset branch rate, all of which are calculated from bifurcating tree branch sets for classification. We have achieved F-measure (balanced measure between precision and recall of 81% with about 0.9 area under the curve (AUC of ROC. Conclusions PolyPhy is a fast and robust method to identify polytomies from phylogenetic trees based on genome-wide inference of evolutionary relationships among genomes. The software package and test data can be downloaded from http://digbio.missouri.edu/ComPhy/phyloTreeBiNonBi-1.0.zip.

  14. Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Walter H B Demczuk

    Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

  15. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  16. Genomic characterization, phylogenetic analysis, and identification of virulence factors in Aerococcus sanguinicola and Aerococcus urinae strains isolated from infection episodes

    DEFF Research Database (Denmark)

    Carkaci, Derya; Højholt, Katrine; Nielsen, Xiaohui Chen

    2017-01-01

    Aerococcus sanguinicola and Aerococcus urinae are emerging pathogens in clinical settings mostly being causative agents of urinary tract infections (UTIs), urogenic sepsis and more seldomly complicated infective endocarditis (IE). Limited knowledge exists concerning the pathogenicity of these two...... species. Eight clinical A. sanguinicola (isolated from 2009 to 2015) and 40 clinical A. urinae (isolated from 1984 to 2015) strains from episodes of UTIs, bacteremia, and IE were whole-genome sequenced (WGS) to analyze genomic diversity and characterization of virulence genes involved in the bacterial....... In conclusion, this is the first study dealing with WGS and comparative genomics of clinical A. sanguinicola and A. urinae strains from episodes of UTIs, bacteremia, and IE. Gene homologs associated with antiphagocytosis and bacterial adherence were identified and genetic variability was observed within A...

  17. Genomic predictions across Nordic Holstein and Nordic Red using the genomic best linear unbiased prediction model with different genomic relationship matrices.

    Science.gov (United States)

    Zhou, L; Lund, M S; Wang, Y; Su, G

    2014-08-01

    This study investigated genomic predictions across Nordic Holstein and Nordic Red using various genomic relationship matrices. Different sources of information, such as consistencies of linkage disequilibrium (LD) phase and marker effects, were used to construct the genomic relationship matrices (G-matrices) across these two breeds. Single-trait genomic best linear unbiased prediction (GBLUP) model and two-trait GBLUP model were used for single-breed and two-breed genomic predictions. The data included 5215 Nordic Holstein bulls and 4361 Nordic Red bulls, which was composed of three populations: Danish Red, Swedish Red and Finnish Ayrshire. The bulls were genotyped with 50 000 SNP chip. Using the two-breed predictions with a joint Nordic Holstein and Nordic Red reference population, accuracies increased slightly for all traits in Nordic Red, but only for some traits in Nordic Holstein. Among the three subpopulations of Nordic Red, accuracies increased more for Danish Red than for Swedish Red and Finnish Ayrshire. This is because closer genetic relationships exist between Danish Red and Nordic Holstein. Among Danish Red, individuals with higher genomic relationship coefficients with Nordic Holstein showed more increased accuracies in the two-breed predictions. Weighting the two-breed G-matrices by LD phase consistencies, marker effects or both did not further improve accuracies of the two-breed predictions. © 2014 Blackwell Verlag GmbH.

  18. Use of the p-SINE1-r2 in inferring evolutionary relationships of Thai rice varieties with AA genome

    Directory of Open Access Journals (Sweden)

    Preecha Prathepha

    2006-01-01

    Full Text Available In a previous study we described the prevalence and distribution in Thailand of the retroposon p- SINE1-r2, in the intron 10 of the waxy gene in cultivated and wild rice with the AA genome. In this study, additional varieties of rice were collected and sequencing was used to further characterize p-SINE1-r2. It was found that the length of the p-SINE1-r2 nucleotide sequences was about 125 bp, flanked by identical direct repeats of a 14 bp sequence. These sequences were compared and found to be similar to the sequences of p- SINE1-r2 found in Nipponbare, a rice strain discussed in a separate study. However, when compared the 48 DNA sequences identified in this study, much dissimilarity was found within the nucleotide sequences of p- SINE1-r2, in the form of base substitution mutations. Phylogenetic relationships inferred from the nucleotide sequences of these elements in cultivated rice (O. sativa and wild rice (O. nivara. It was found that rice accessions collected from the same geographical distribution have been placed in the same clade. The phylogenetic tree supports the origin and distribution of these rice strains.

  19. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  20. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.