WorldWideScience

Sample records for genome nucleotide sequences

  1. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  2. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  3. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  4. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  5. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  6. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  7. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  8. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  9. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  10. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  11. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  12. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  13. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  14. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  15. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  16. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  17. Templated sequence insertion polymorphisms in the human genome

    Science.gov (United States)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  18. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  19. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  20. The diploid genome sequence of an Asian individual

    DEFF Research Database (Denmark)

    Wang, Jun; Wang, Wei; Li, Ruiqiang

    2008-01-01

    Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we...... used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP...... identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J...

  1. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  2. Population genetic analysis of shotgun assemblies of genomic sequences from multiple individuals

    DEFF Research Database (Denmark)

    Hellmann, Ines; Mang, Yuan; Gu, Zhiping

    2008-01-01

    We introduce a simple, broadly applicable method for obtaining estimates of nucleotide diversity from genomic shotgun sequencing data. The method takes into account the special nature of these data: random sampling of genomic segments from one or more individuals and a relatively high error rate...... for individual reads. Applying this method to data from the Celera human genome sequencing and SNP discovery project, we obtain estimates of nucleotide diversity in windows spanning the human genome and show that the diversity to divergence ratio is reduced in regions of low recombination. Furthermore, we show...

  3. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  4. Human Genome Sequencing in Health and Disease

    Science.gov (United States)

    Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.

    2013-01-01

    Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320

  5. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  6. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  7. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  8. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  9. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    Directory of Open Access Journals (Sweden)

    McGuire Patrick E

    2010-12-01

    Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

  10. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  11. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  13. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  14. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  15. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  16. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  17. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  18. Complete Genome Sequence of the Soybean Symbiont Bradyrhizobium japonicum Strain USDA6T

    Directory of Open Access Journals (Sweden)

    Nobukazu Uchiike

    2011-10-01

    Full Text Available The complete nucleotide sequence of the genome of the soybean symbiont Bradyrhizobium japonicum strain USDA6T was determined. The genome of USDA6T is a single circular chromosome of 9,207,384 bp. The genome size is similar to that of the genome of another soybean symbiont, B. japonicum USDA110 (9,105,828 bp. Comparison of the whole-genome sequences of USDA6T and USDA110 showed colinearity of major regions in the two genomes, although a large inversion exists between them. A significantly high level of sequence conservation was detected in three regions on each genome. The gene constitution and nucleotide sequence features in these three regions indicate that they may have been derived from a symbiosis island. An ancestral, large symbiosis island, approximately 860 kb in total size, appears to have been split into these three regions by unknown large-scale genome rearrangements. The two integration events responsible for this appear to have taken place independently, but through comparable mechanisms, in both genomes.

  19. Reference genome sequence of the model plant Setaria.

    Science.gov (United States)

    Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M

    2012-05-13

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  20. Reference genome sequence of the model plant Setaria

    Energy Technology Data Exchange (ETDEWEB)

    Bennetzen, Jeffrey L [ORNL; Schmutz, Jeremy [Hudson Alpha Institute of Biotechnology; Wang, Hao [University of Georgia, Athens, GA; Percifield, Ryan [University of Georgia, Athens, GA; Hawkins, Jennifer [University of Georgia, Athens, GA; Pontaroli, Ana C. [University of Georgia, Athens, GA; Estep, Matt [University of Georgia, Athens, GA; Feng, Liang [University of Georgia, Athens, GA; Vaughn, Justin N [ORNL; Grimwood, Jane [Hudson Alpha Institute of Biotechnology; Jenkins, Jerry [Hudson Alpha Institute of Biotechnology; Barry, Kerrie [U.S. Department of Energy, Joint Genome Institute; Lindquist, Erika [U.S. Department of Energy, Joint Genome Institute; Hellsten, Uffe [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Wang, Xuewen [University of Georgia, Athens, GA; Wu, Xiaomei [University of Georgia, Athens, GA; Mitros, Therese [University of California, Berkeley; Triplett, Jimmy [University of Missouri, St. Louis; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Mauro-Herrera, Margarita [Oklahoma State University; Wang, Lin [Cornell University; Li, Pinghua [Cornell University; Sharma, Manoj [University of California, Davis; Sharma, Rita [University of California, Davis; Ronald, Pamela [University of California, Davis; Panaud, Olivier [Universite de Perpignan, Perpignan, France; Kellogg, Elizabeth A. [University of Missouri, St. Louis; Brutnell, Thomas P. [Cornell University; Doust, Andrew N. [Oklahoma State University; Tuskan, Gerald A [ORNL; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Devos, Katrien M [ORNL

    2012-01-01

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  1. Reference genome sequence of the model plant Setaria

    Energy Technology Data Exchange (ETDEWEB)

    Bennetzen, Jeffrey L [ORNL; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tuskan, Gerald A [ORNL

    2012-01-01

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  2. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  3. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  4. NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

    Directory of Open Access Journals (Sweden)

    Barker Michael S

    2010-08-01

    Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

  5. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  6. Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

    Science.gov (United States)

    Wen, Chiu-Ming

    2017-08-01

    An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

  7. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  8. First complete genome sequence of canine bocavirus 2 in mainland China

    Directory of Open Access Journals (Sweden)

    S.-L. Zhai

    2017-07-01

    Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

  9. The characterization of twenty sequenced human genomes.

    Directory of Open Access Journals (Sweden)

    Kimberly Pelak

    2010-09-01

    Full Text Available We present the analysis of twenty human genomes to evaluate the prospects for identifying rare functional variants that contribute to a phenotype of interest. We sequenced at high coverage ten "case" genomes from individuals with severe hemophilia A and ten "control" genomes. We summarize the number of genetic variants emerging from a study of this magnitude, and provide a proof of concept for the identification of rare and highly-penetrant functional variants by confirming that the cause of hemophilia A is easily recognizable in this data set. We also show that the number of novel single nucleotide variants (SNVs discovered per genome seems to stabilize at about 144,000 new variants per genome, after the first 15 individuals have been sequenced. Finally, we find that, on average, each genome carries 165 homozygous protein-truncating or stop loss variants in genes representing a diverse set of pathways.

  10. First Complete Genome Sequence of Suakwa aphid-borne yellows virus from East Timor

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel

    2016-01-01

    We present here the first complete genomic RNA sequence of the polerovirus Suakwa aphid-borne yellows virus (SABYV), from East Timor. The isolate sequenced came from a virus-infected pumpkin plant. The East Timorese genome had a nucleotide identity of 86.5% with the only other SABYV genome available, which is from Taiwan. PMID:27469955

  11. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

    2001-01-01

    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  12. Intra-species sequence comparisons for annotating genomes

    Energy Technology Data Exchange (ETDEWEB)

    Boffelli, Dario; Weer, Claire V.; Weng, Li; Lewis, Keith D.; Shoukry, Malak I.; Pachter, Lior; Keys, David N.; Rubin, Edward M.

    2004-07-15

    Analysis of sequence variation among members of a single species offers a potential approach to identify functional DNA elements responsible for biological features unique to that species. Due to its high rate of allelic polymorphism and ease of genetic manipulability, we chose the sea squirt, Ciona intestinalis, to explore intra-species sequence comparisons for genome annotation. A large number of C. intestinalis specimens were collected from four continents and a set of genomic intervals amplified, resequenced and analyzed to determine the mutation rates at each nucleotide in the sequence. We found that regions with low mutation rates efficiently demarcated functionally constrained sequences: these include a set of noncoding elements, which we showed in C intestinalis transgenic assays to act as tissue-specific enhancers, as well as the location of coding sequences. This illustrates that comparisons of multiple members of a species can be used for genome annotation, suggesting a path for the annotation of the sequenced genomes of organisms occupying uncharacterized phylogenetic branches of the animal kingdom and raises the possibility that the resequencing of a large number of Homo sapiens individuals might be used to annotate the human genome and identify sequences defining traits unique to our species. The sequence data from this study has been submitted to GenBank under accession nos. AY667278-AY667407.

  13. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  14. Comparison of two Next Generation sequencing platforms for full genome sequencing of Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk

    2013-01-01

    to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...

  15. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  16. DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

    Directory of Open Access Journals (Sweden)

    Inês Soares

    Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

  17. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  18. Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

    Science.gov (United States)

    Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

    2012-01-01

    Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

  19. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  20. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    OpenAIRE

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; Ludergnani, Nicholas; McMullen, Allison

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends.

  1. Whole-genome sequencing of a laboratory-evolved yeast strain

    Directory of Open Access Journals (Sweden)

    Dunham Maitreya J

    2010-02-01

    Full Text Available Abstract Background Experimental evolution of microbial populations provides a unique opportunity to study evolutionary adaptation in response to controlled selective pressures. However, until recently it has been difficult to identify the precise genetic changes underlying adaptation at a genome-wide scale. New DNA sequencing technologies now allow the genome of parental and evolved strains of microorganisms to be rapidly determined. Results We sequenced >93.5% of the genome of a laboratory-evolved strain of the yeast Saccharomyces cerevisiae and its ancestor at >28× depth. Both single nucleotide polymorphisms and copy number amplifications were found, with specific gains over array-based methodologies previously used to analyze these genomes. Applying a segmentation algorithm to quantify structural changes, we determined the approximate genomic boundaries of a 5× gene amplification. These boundaries guided the recovery of breakpoint sequences, which provide insights into the nature of a complex genomic rearrangement. Conclusions This study suggests that whole-genome sequencing can provide a rapid approach to uncover the genetic basis of evolutionary adaptations, with further applications in the study of laboratory selections and mutagenesis screens. In addition, we show how single-end, short read sequencing data can provide detailed information about structural rearrangements, and generate predictions about the genomic features and processes that underlie genome plasticity.

  2. Precise detection of de novo single nucleotide variants in human genomes.

    Science.gov (United States)

    Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

    2018-05-07

    The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

  3. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    Science.gov (United States)

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; McMullen, Allison; Mirza, Sohail A.; Thrift, Noah; Vaughan, Donald P.; Worley, Grace; Ejikemeuwa, Amara; Zaw, May; Albritton, Claude F.; Bertrand, Sarah C.; Chaudhry, Shanzay S.; Cheema, Vzair A.; Do, Camilla; Do, Michael L.; Duong, Huyen M.; El-Desoky, Dalia H.; Green, Kelsey M.; Lee, Rhea N.; Thornton, Lauren A.; Vu, James M.; Zahra, Mah Noor; Stoner, Ty H.; Garlena, Rebecca A.; Jacobs-Sera, Deborah; Russell, Daniel A.

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends. PMID:29122864

  4. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  5. The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

    Science.gov (United States)

    Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

    2016-10-11

    Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

  6. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  7. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  8. Evaluation of whole genome sequencing for outbreak detection of Salmonella enterica

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Nielsen, Eva M.; Kaas, Rolf Sommer

    2014-01-01

    Salmonella enterica is a common cause of minor and large food borne outbreaks. To achieve successful and nearly ‘real-time’ monitoring and identification of outbreaks, reliable sub-typing is essential. Whole genome sequencing (WGS) shows great promises for using as a routine epidemiological typing....... Enteritidis and 5 S. Derby were also sequenced and used for comparison. A number of different bioinformatics approaches were applied on the data; including pan-genome tree, k-mer tree, nucleotide difference tree and SNP tree. The outcome of each approach was evaluated in relation to the association...... of the isolates to specific outbreaks. The pan-genome tree clustered 65% of the S. Typhimurium isolates according to the pre-defined epidemiology, the k-mer tree 88%, the nucleotide difference tree 100% and the SNP tree 100% of the strains within S. Typhimurium. The resulting outcome of the four phylogenetic...

  9. Genome sequence of herpes simplex virus 1 strain KOS.

    Science.gov (United States)

    Macdonald, Stuart J; Mostafa, Heba H; Morrison, Lynda A; Davido, David J

    2012-06-01

    Herpes simplex virus type 1 (HSV-1) strain KOS has been extensively used in many studies to examine HSV-1 replication, gene expression, and pathogenesis. Notably, strain KOS is known to be less pathogenic than the first sequenced genome of HSV-1, strain 17. To understand the genotypic differences between KOS and other phenotypically distinct strains of HSV-1, we sequenced the viral genome of strain KOS. When comparing strain KOS to strain 17, there are at least 1,024 small nucleotide polymorphisms (SNPs) and 172 insertions/deletions (indels). The polymorphisms observed in the KOS genome will likely provide insights into the genes, their protein products, and the cis elements that regulate the biology of this HSV-1 strain.

  10. The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1.

    Science.gov (United States)

    Vaz, Paola K; Mahony, Timothy J; Hartley, Carol A; Fowler, Elizabeth V; Ficorilli, Nino; Lee, Sang W; Gilkerson, James R; Browning, Glenn F; Devlin, Joanne M

    2016-01-22

    While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1). The MaHV-1 viral genome was sequenced using an Illumina MiSeq sequencer, de novo assembly was performed and the genome was annotated. The MaHV-1 genome was 140 kbp in length and clustered phylogenetically with the primate simplexviruses, sharing 67% nucleotide sequence identity with Human herpesviruses 1 and 2. The MaHV-1 genome contained 66 predicted open reading frames (ORFs) homologous to those in other herpesvirus genomes, but lacked homologues of UL3, UL4, UL56 and glycoprotein J. This is the first alphaherpesvirus genome that has been found to lack the UL3 and UL4 homologues. We identified six novel ORFs and confirmed their transcription by RT-PCR. This is the first genome sequence of a herpesvirus that infects metatherians, a taxonomically unique mammalian clade. Members of the Simplexvirus genus are remarkably conserved, so the absence of ORFs otherwise retained in eutherian and avian alphaherpesviruses contributes to our understanding of the Alphaherpesvirinae. Further study of metatherian herpesvirus genetics and pathogenesis provides a unique approach to understanding herpesvirus-mammalian interactions.

  11. Draft genome sequence of the silver pomfret fish, Pampus argenteus.

    Science.gov (United States)

    AlMomin, Sabah; Kumar, Vinod; Al-Amad, Sami; Al-Hussaini, Mohsen; Dashti, Talal; Al-Enezi, Khaznah; Akbar, Abrar

    2016-01-01

    Silver pomfret, Pampus argenteus, is a fish species from coastal waters. Despite its high commercial value, this edible fish has not been sequenced. Hence, its genetic and genomic studies have been limited. We report the first draft genome sequence of the silver pomfret obtained using a Next Generation Sequencing (NGS) technology. We assembled 38.7 Gb of nucleotides into scaffolds of 350 Mb with N50 of about 1.5 kb, using high quality paired end reads. These scaffolds represent 63.7% of the estimated silver pomfret genome length. The newly sequenced and assembled genome has 11.06% repetitive DNA regions, and this percentage is comparable to that of the tilapia genome. The genome analysis predicted 16 322 genes. About 91% of these genes showed homology with known proteins. Many gene clusters were annotated to protein and fatty-acid metabolism pathways that may be important in the context of the meat texture and immune system developmental processes. The reference genome can pave the way for the identification of many other genomic features that could improve breeding and population-management strategies, and it can also help characterize the genetic diversity of P. argenteus.

  12. The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus)

    OpenAIRE

    Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

    2011-01-01

    The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% iden...

  13. A first report and complete genome sequence of alfalfa enamovirus from Sudan

    Science.gov (United States)

    A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...

  14. Mapping copy number variation by population-scale genome sequencing

    DEFF Research Database (Denmark)

    Mills, Ryan E.; Walter, Klaudia; Stewart, Chip

    2011-01-01

    Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is......, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications...

  15. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    Science.gov (United States)

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  16. Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

    Science.gov (United States)

    Bergman, Casey M; Haddrill, Penelope R

    2015-01-01

    To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

  17. Genome Sequence of Novel Human Parechovirus Type 17

    OpenAIRE

    B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica

    2017-01-01

    ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.

  18. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  19. The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

    Science.gov (United States)

    Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

    2012-01-01

    The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

  20. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  1. Genome-wide SNP identification by high-throughput sequencing and selective mapping allows sequence assembly positioning using a framework genetic linkage map

    Directory of Open Access Journals (Sweden)

    Xu Xiangming

    2010-12-01

    Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.

  2. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  3. Draft Genome Sequences of Three Novel Low-Abundance Species Strains Isolated from Kefir Grain.

    Science.gov (United States)

    Kim, Yongkyu; Blasche, Sonja; Patil, Kiran R

    2017-09-28

    We report here the genome sequences of three novel bacterial species strains- Bacillus kefirresidentii Opo, Rothia kefirresidentii KRP, and Streptococcus kefirresidentii YK-isolated from kefir grains collected in Germany. The draft genomes of these isolates were remarkably dissimilar (average nucleotide identities, 77.80%, 89.01%, and 92.10%, respectively) to those of the previously sequenced strains. Copyright © 2017 Kim et al.

  4. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  5. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

    Science.gov (United States)

    An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

    2017-09-11

    Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

  7. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  8. Protecting genomic sequence anonymity with generalization lattices.

    Science.gov (United States)

    Malin, B A

    2005-01-01

    Current genomic privacy technologies assume the identity of genomic sequence data is protected if personal information, such as demographics, are obscured, removed, or encrypted. While demographic features can directly compromise an individual's identity, recent research demonstrates such protections are insufficient because sequence data itself is susceptible to re-identification. To counteract this problem, we introduce an algorithm for anonymizing a collection of person-specific DNA sequences. The technique is termed DNA lattice anonymization (DNALA), and is based upon the formal privacy protection schema of k -anonymity. Under this model, it is impossible to observe or learn features that distinguish one genetic sequence from k-1 other entries in a collection. To maximize information retained in protected sequences, we incorporate a concept generalization lattice to learn the distance between two residues in a single nucleotide region. The lattice provides the most similar generalized concept for two residues (e.g. adenine and guanine are both purines). The method is tested and evaluated with several publicly available human population datasets ranging in size from 30 to 400 sequences. Our findings imply the anonymization schema is feasible for the protection of sequences privacy. The DNALA method is the first computational disclosure control technique for general DNA sequences. Given the computational nature of the method, guarantees of anonymity can be formally proven. There is room for improvement and validation, though this research provides the groundwork from which future researchers can construct genomics anonymization schemas tailored to specific datasharing scenarios.

  9. The sequence and de novo assembly of the giant panda genome

    Science.gov (United States)

    Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

    2013-01-01

    Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

  10. An integrated semiconductor device enabling non-optical genome sequencing.

    Science.gov (United States)

    Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

    2011-07-20

    The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

  11. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  12. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  13. [Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

    2009-08-01

    Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

  14. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments

    Directory of Open Access Journals (Sweden)

    Tcherepanov Vasily

    2004-07-01

    Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  15. Rapid Genome-wide Single Nucleotide Polymorphism Discovery in Soybean and Rice via Deep Resequencing of Reduced Representation Libraries with the Illumina Genome Analyzer

    Directory of Open Access Journals (Sweden)

    Stéphane Deschamps

    2010-07-01

    Full Text Available Massively parallel sequencing platforms have allowed for the rapid discovery of single nucleotide polymorphisms (SNPs among related genotypes within a species. We describe the creation of reduced representation libraries (RRLs using an initial digestion of nuclear genomic DNA with a methylation-sensitive restriction endonuclease followed by a secondary digestion with the 4bp-restriction endonuclease This strategy allows for the enrichment of hypomethylated genomic DNA, which has been shown to be rich in genic sequences, and the digestion with serves to increase the number of common loci resequenced between individuals. Deep resequencing of these RRLs performed with the Illumina Genome Analyzer led to the identification of 2618 SNPs in rice and 1682 SNPs in soybean for two representative genotypes in each of the species. A subset of these SNPs was validated via Sanger sequencing, exhibiting validation rates of 96.4 and 97.0%, in rice ( and soybean (, respectively. Comparative analysis of the read distribution relative to annotated genes in the reference genome assemblies indicated that the RRL strategy was primarily sampling within genic regions for both species. The massively parallel sequencing of methylation-sensitive RRLs for genome-wide SNP discovery can be applied across a wide range of plant species having sufficient reference genomic sequence.

  16. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  17. The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).

    Science.gov (United States)

    Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

    2011-05-01

    The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.

  18. High-resolution genetic map for understanding the effect of genome-wide recombination rate on nucleotide diversity in watermelon.

    Science.gov (United States)

    Reddy, Umesh K; Nimmakayala, Padma; Levi, Amnon; Abburi, Venkata Lakshmi; Saminathan, Thangasamy; Tomason, Yan R; Vajja, Gopinath; Reddy, Rishi; Abburi, Lavanya; Wehner, Todd C; Ronin, Yefim; Karol, Abraham

    2014-09-15

    We used genotyping by sequencing to identify a set of 10,480 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1096 cM for watermelon. We assessed the genome-wide variation in recombination rate (GWRR) across the map and found an association between GWRR and genome-wide nucleotide diversity. Collinearity between the map and the genome-wide reference sequence for watermelon was studied to identify inconsistency and chromosome rearrangements. We assessed genome-wide nucleotide diversity, linkage disequilibrium (LD), and selective sweep for wild, semi-wild, and domesticated accessions of Citrullus lanatus var. lanatus to track signals of domestication. Principal component analysis combined with chromosome-wide phylogenetic study based on 1563 SNPs obtained after LD pruning with minor allele frequency of 0.05 resolved the differences between semi-wild and wild accessions as well as relationships among worldwide sweet watermelon. Population structure analysis revealed predominant ancestries for wild, semi-wild, and domesticated watermelons as well as admixture of various ancestries that were important for domestication. Sliding window analysis of Tajima's D across various chromosomes was used to resolve selective sweep. LD decay was estimated for various chromosomes. We identified a strong selective sweep on chromosome 3 consisting of important genes that might have had a role in sweet watermelon domestication. Copyright © 2014 Reddy et al.

  19. Complete genome sequence of a recent panzootic virulent Newcastle disease virus from Pakistan

    Science.gov (United States)

    Complete genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Lahore-611/2013) is reported. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15192 nucleotides in length and is classified as sub-genotype V...

  20. Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags.

    Directory of Open Access Journals (Sweden)

    Paul A Hohenlohe

    2010-02-01

    Full Text Available Next-generation sequencing technology provides novel opportunities for gathering genome-scale sequence data in natural populations, laying the empirical foundation for the evolving field of population genomics. Here we conducted a genome scan of nucleotide diversity and differentiation in natural populations of threespine stickleback (Gasterosteus aculeatus. We used Illumina-sequenced RAD tags to identify and type over 45,000 single nucleotide polymorphisms (SNPs in each of 100 individuals from two oceanic and three freshwater populations. Overall estimates of genetic diversity and differentiation among populations confirm the biogeographic hypothesis that large panmictic oceanic populations have repeatedly given rise to phenotypically divergent freshwater populations. Genomic regions exhibiting signatures of both balancing and divergent selection were remarkably consistent across multiple, independently derived populations, indicating that replicate parallel phenotypic evolution in stickleback may be occurring through extensive, parallel genetic evolution at a genome-wide scale. Some of these genomic regions co-localize with previously identified QTL for stickleback phenotypic variation identified using laboratory mapping crosses. In addition, we have identified several novel regions showing parallel differentiation across independent populations. Annotation of these regions revealed numerous genes that are candidates for stickleback phenotypic evolution and will form the basis of future genetic analyses in this and other organisms. This study represents the first high-density SNP-based genome scan of genetic diversity and differentiation for populations of threespine stickleback in the wild. These data illustrate the complementary nature of laboratory crosses and population genomic scans by confirming the adaptive significance of previously identified genomic regions, elucidating the particular evolutionary and demographic history of such

  1. The diploid genome sequence of an individual human.

    Directory of Open Access Journals (Sweden)

    Samuel Levy

    2007-09-01

    Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.

  2. Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan

    Directory of Open Access Journals (Sweden)

    Jenn-Tzong Chang

    2017-11-01

    Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.

  3. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  4. Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

    Directory of Open Access Journals (Sweden)

    Michal Strouhal

    2017-09-01

    Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

  5. [Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

    2010-01-01

    Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses

  6. A sequence-based survey of the complex structural organization of tumor genomes

    Energy Technology Data Exchange (ETDEWEB)

    Collins, Colin; Raphael, Benjamin J.; Volik, Stanislav; Yu, Peng; Wu, Chunxiao; Huang, Guiqing; Linardopoulou, Elena V.; Trask, Barbara J.; Waldman, Frederic; Costello, Joseph; Pienta, Kenneth J.; Mills, Gordon B.; Bajsarowicz, Krystyna; Kobayashi, Yasuko; Sridharan, Shivaranjani; Paris, Pamela; Tao, Quanzhou; Aerni, Sarah J.; Brown, Raymond P.; Bashir, Ali; Gray, Joe W.; Cheng, Jan-Fang; de Jong, Pieter; Nefedov, Mikhail; Ried, Thomas; Padilla-Nash, Hesed M.; Collins, Colin C.

    2008-04-03

    The genomes of many epithelial tumors exhibit extensive chromosomal rearrangements. All classes of genome rearrangements can be identified using End Sequencing Profiling (ESP), which relies on paired-end sequencing of cloned tumor genomes. In this study, brain, breast, ovary and prostate tumors along with three breast cancer cell lines were surveyed with ESP yielding the largest available collection of sequence-ready tumor genome breakpoints and providing evidence that some rearrangements may be recurrent. Sequencing and fluorescence in situ hybridization (FISH) confirmed translocations and complex tumor genome structures that include coamplification and packaging of disparate genomic loci with associated molecular heterogeneity. Comparison of the tumor genomes suggests recurrent rearrangements. Some are likely to be novel structural polymorphisms, whereas others may be bona fide somatic rearrangements. A recurrent fusion transcript in breast tumors and a constitutional fusion transcript resulting from a segmental duplication were identified. Analysis of end sequences for single nucleotide polymorphisms (SNPs) revealed candidate somatic mutations and an elevated rate of novel SNPs in an ovarian tumor. These results suggest that the genomes of many epithelial tumors may be far more dynamic and complex than previously appreciated and that genomic fusions including fusion transcripts and proteins may be common, possibly yielding tumor-specific biomarkers and therapeutic targets.

  7. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  8. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  9. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus

    OpenAIRE

    Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan

    2016-01-01

    Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing

  10. Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.

    Science.gov (United States)

    Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G

    2018-03-01

    Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.

  11. The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

    NARCIS (Netherlands)

    Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

    2002-01-01

    The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

  12. Mapping and characterizing N6-methyladenine in eukaryotic genomes using single molecule real-time sequencing.

    Science.gov (United States)

    Zhu, Shijia; Beaulaurier, John; Deikus, Gintaras; Wu, Tao; Strahl, Maya; Hao, Ziyang; Luo, Guanzheng; Gregory, James A; Chess, Andrew; He, Chuan; Xiao, Andrew; Sebra, Robert; Schadt, Eric E; Fang, Gang

    2018-05-15

    N6-methyladenine (m6dA) has been discovered as a novel form of DNA methylation prevalent in eukaryotes, however, methods for high resolution mapping of m6dA events are still lacking. Single-molecule real-time (SMRT) sequencing has enabled the detection of m6dA events at single-nucleotide resolution in prokaryotic genomes, but its application to detecting m6dA in eukaryotic genomes has not been rigorously examined. Herein, we identified unique characteristics of eukaryotic m6dA methylomes that fundamentally differ from those of prokaryotes. Based on these differences, we describe the first approach for mapping m6dA events using SMRT sequencing specifically designed for the study of eukaryotic genomes, and provide appropriate strategies for designing experiments and carrying out sequencing in future studies. We apply the novel approach to study two eukaryotic genomes. For green algae, we construct the first complete genome-wide map of m6dA at single nucleotide and single molecule resolution. For human lymphoblastoid cells (hLCLs), joint analyses of SMRT sequencing and independent sequencing data suggest that putative m6dA events are enriched in the promoters of young, full length LINE-1 elements (L1s). These analyses demonstrate a general method for rigorous mapping and characterization of m6dA events in eukaryotic genomes. Published by Cold Spring Harbor Laboratory Press.

  13. The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

    Science.gov (United States)

    Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

    2015-01-01

    Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

  14. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  15. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  16. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  17. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus

    Directory of Open Access Journals (Sweden)

    Yookyung Lee

    2016-03-01

    Full Text Available Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing

  18. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China.

    Science.gov (United States)

    Sun, Qiang; Zhao, Qiumin; An, Xiaoping; Guo, Xiaofang; Zuo, Shuqing; Zhang, Xianglilan; Pei, Guangqian; Liu, Wenli; Cheng, Shi; Wang, Yunfei; Shu, Peng; Mi, Zhiqiang; Huang, Yong; Zhang, Zhiyi; Tong, Yigang; Zhou, Hongning; Zhang, Jiusong

    2017-04-01

    Menghai rhabdovirus (MRV) was isolated from Aedes albopictus in Menghai county of Yunnan Province, China, in August 2010. Whole-genome sequencing of MRV was performed using an Ion PGM™ Sequencer. We found that MRV is a single-stranded, negative-sense RNA virus. The complete genome of MRV has 10,744 nt, with short inverted repeat termini, encoding five typical rhabdovirus proteins (N, P, M, G, and L) and an additional small hypothetical protein. Nucleotide BLAST analysis using the BLASTn method showed that the genome sequence most similar to that of MRV is that of Arboretum virus (NC_025393.1), with a Max score of 322, query coverage of 14%, and 66% identity. Genomic and phylogenetic analyses both demonstrated that MRV should be considered a member of a novel species of the family Rhabdoviridae.

  19. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  20. Molecular Characterization of Five Potyviruses Infecting Korean Sweet Potatoes Based on Analyses of Complete Genome Sequences

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2015-12-01

    Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.

  1. Genomic multiple sequence alignments: refinement using a genetic algorithm

    Directory of Open Access Journals (Sweden)

    Lefkowitz Elliot J

    2005-08-01

    Full Text Available Abstract Background Genomic sequence data cannot be fully appreciated in isolation. Comparative genomics – the practice of comparing genomic sequences from different species – plays an increasingly important role in understanding the genotypic differences between species that result in phenotypic differences as well as in revealing patterns of evolutionary relationships. One of the major challenges in comparative genomics is producing a high-quality alignment between two or more related genomic sequences. In recent years, a number of tools have been developed for aligning large genomic sequences. Most utilize heuristic strategies to identify a series of strong sequence similarities, which are then used as anchors to align the regions between the anchor points. The resulting alignment is globally correct, but in many cases is suboptimal locally. We describe a new program, GenAlignRefine, which improves the overall quality of global multiple alignments by using a genetic algorithm to improve local regions of alignment. Regions of low quality are identified, realigned using the program T-Coffee, and then refined using a genetic algorithm. Because a better COFFEE (Consistency based Objective Function For alignmEnt Evaluation score generally reflects greater alignment quality, the algorithm searches for an alignment that yields a better COFFEE score. To improve the intrinsic slowness of the genetic algorithm, GenAlignRefine was implemented as a parallel, cluster-based program. Results We tested the GenAlignRefine algorithm by running it on a Linux cluster to refine sequences from a simulation, as well as refine a multiple alignment of 15 Orthopoxvirus genomic sequences approximately 260,000 nucleotides in length that initially had been aligned by Multi-LAGAN. It took approximately 150 minutes for a 40-processor Linux cluster to optimize some 200 fuzzy (poorly aligned regions of the orthopoxvirus alignment. Overall sequence identity increased only

  2. Structure, sequence and expression of the hepatitis delta (δ) viral genome

    Science.gov (United States)

    Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

    1986-10-01

    Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

  3. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  4. Genome survey sequencing and genetic background characterization of Gracilariopsis lemaneiformis (Rhodophyta) based on next-generation sequencing.

    Science.gov (United States)

    Zhou, Wei; Hu, Yiyi; Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin

    2013-01-01

    Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon.

  5. Genome Survey Sequencing and Genetic Background Characterization of Gracilariopsis lemaneiformis (Rhodophyta) Based on Next-Generation Sequencing

    Science.gov (United States)

    Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin

    2013-01-01

    Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon. PMID:23875008

  6. Whole-genome sequencing and genetic variant analysis of a Quarter Horse mare.

    KAUST Repository

    Doan, Ryan; Cohen, Noah D; Sawyer, Jason; Ghaffari, Noushin; Johnson, Charlie D; Dindot, Scott V

    2012-01-01

    BACKGROUND: The catalog of genetic variants in the horse genome originates from a few select animals, the majority originating from the Thoroughbred mare used for the equine genome sequencing project. The purpose of this study was to identify genetic variants, including single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (INDELs), and copy number variants (CNVs) in the genome of an individual Quarter Horse mare sequenced by next-generation sequencing. RESULTS: Using massively parallel paired-end sequencing, we generated 59.6 Gb of DNA sequence from a Quarter Horse mare resulting in an average of 24.7X sequence coverage. Reads were mapped to approximately 97% of the reference Thoroughbred genome. Unmapped reads were de novo assembled resulting in 19.1 Mb of new genomic sequence in the horse. Using a stringent filtering method, we identified 3.1 million SNPs, 193 thousand INDELs, and 282 CNVs. Genetic variants were annotated to determine their impact on gene structure and function. Additionally, we genotyped this Quarter Horse for mutations of known diseases and for variants associated with particular traits. Functional clustering analysis of genetic variants revealed that most of the genetic variation in the horse's genome was enriched in sensory perception, signal transduction, and immunity and defense pathways. CONCLUSIONS: This is the first sequencing of a horse genome by next-generation sequencing and the first genomic sequence of an individual Quarter Horse mare. We have increased the catalog of genetic variants for use in equine genomics by the addition of novel SNPs, INDELs, and CNVs. The genetic variants described here will be a useful resource for future studies of genetic variation regulating performance traits and diseases in equids.

  7. Whole-genome sequencing and genetic variant analysis of a Quarter Horse mare.

    KAUST Repository

    Doan, Ryan

    2012-02-17

    BACKGROUND: The catalog of genetic variants in the horse genome originates from a few select animals, the majority originating from the Thoroughbred mare used for the equine genome sequencing project. The purpose of this study was to identify genetic variants, including single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (INDELs), and copy number variants (CNVs) in the genome of an individual Quarter Horse mare sequenced by next-generation sequencing. RESULTS: Using massively parallel paired-end sequencing, we generated 59.6 Gb of DNA sequence from a Quarter Horse mare resulting in an average of 24.7X sequence coverage. Reads were mapped to approximately 97% of the reference Thoroughbred genome. Unmapped reads were de novo assembled resulting in 19.1 Mb of new genomic sequence in the horse. Using a stringent filtering method, we identified 3.1 million SNPs, 193 thousand INDELs, and 282 CNVs. Genetic variants were annotated to determine their impact on gene structure and function. Additionally, we genotyped this Quarter Horse for mutations of known diseases and for variants associated with particular traits. Functional clustering analysis of genetic variants revealed that most of the genetic variation in the horse\\'s genome was enriched in sensory perception, signal transduction, and immunity and defense pathways. CONCLUSIONS: This is the first sequencing of a horse genome by next-generation sequencing and the first genomic sequence of an individual Quarter Horse mare. We have increased the catalog of genetic variants for use in equine genomics by the addition of novel SNPs, INDELs, and CNVs. The genetic variants described here will be a useful resource for future studies of genetic variation regulating performance traits and diseases in equids.

  8. Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

    2014-01-01

    nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

  9. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  10. Genome sequence data from 17 accessions of Ensete ventricosum, a staple food crop for millions in Ethiopia

    Directory of Open Access Journals (Sweden)

    Zerihun Yemataw

    2018-06-01

    Full Text Available We present raw sequence reads and genome assemblies derived from 17 accessions of the Ethiopian orphan crop plant enset (Ensete ventricosum (Welw. Cheesman using the Illumina HiSeq and MiSeq platforms. Also presented is a catalogue of single-nucleotide polymorphisms inferred from the sequence data at an average density of approximately one per kilobase of genomic DNA.

  11. Sequence- vs. chip-assisted genomic selection: accurate biological information is advised.

    Science.gov (United States)

    Pérez-Enciso, Miguel; Rincón, Juan C; Legarra, Andrés

    2015-05-09

    The development of next-generation sequencing technologies (NGS) has made the use of whole-genome sequence data for routine genetic evaluations possible, which has triggered a considerable interest in animal and plant breeding fields. Here, we investigated whether complete or partial sequence data can improve upon existing SNP (single nucleotide polymorphism) array-based selection strategies by simulation using a mixed coalescence - gene-dropping approach. We simulated 20 or 100 causal mutations (quantitative trait nucleotides, QTN) within 65 predefined 'gene' regions, each 10 kb long, within a genome composed of ten 3-Mb chromosomes. We compared prediction accuracy by cross-validation using a medium-density chip (7.5 k SNPs), a high-density (HD, 17 k) and sequence data (335 k). Genetic evaluation was based on a GBLUP method. The simulations showed: (1) a law of diminishing returns with increasing number of SNPs; (2) a modest effect of SNP ascertainment bias in arrays; (3) a small advantage of using whole-genome sequence data vs. HD arrays i.e. ~4%; (4) a minor effect of NGS errors except when imputation error rates are high (≥20%); and (5) if QTN were known, prediction accuracy approached 1. Since this is obviously unrealistic, we explored milder assumptions. We showed that, if all SNPs within causal genes were included in the prediction model, accuracy could also dramatically increase by ~40%. However, this criterion was highly sensitive to either misspecification (including wrong genes) or to the use of an incomplete gene list; in these cases, accuracy fell rapidly towards that reached when all SNPs from sequence data were blindly included in the model. Our study shows that, unless an accurate prior estimate on the functionality of SNPs can be included in the predictor, there is a law of diminishing returns with increasing SNP density. As a result, use of whole-genome sequence data may not result in a highly increased selection response over high

  12. Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

    Science.gov (United States)

    The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

  13. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nigg, Jared C.; Nouri, Shahideh; Falk, Bryce W.

    2016-01-01

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri. Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera.

  14. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  15. Complete genome sequence of a divergent strain of lettuce chlorosis virus from Periwinkle in China

    Science.gov (United States)

    A novel strain of Lettuce chlorosis virus (LCV) was identified from periwinkle in China (PW) with foliar interveinal chlorosis and plant dwarfing. Complete nucleotide (nt) sequences of genomic RNA1 and RNA2 of the virus are 8,602 nt and 8,456 nt, respectively. The genomic organization of LCV-PW rese...

  16. Genome-wide sequence variations among Mycobacterium avium subspecies paratuberculosis.

    Directory of Open Access Journals (Sweden)

    Chung-Yi eHsu

    2011-12-01

    Full Text Available Mycobacterium avium subspecies paratuberculosis (M. ap, the causative agent of Johne’s disease (JD, infects many farmed ruminants, wildlife animals and humans. To better understand the molecular pathogenesis of these infections, we analyzed the whole genome sequences of several M. ap and M. avium subspecies avium (M. avium strains isolated from various hosts and environments. Using Next-generation sequencing technology, all 6 M. ap isolates showed a high percentage of homology (98% to the reference genome sequence of M. ap K-10 isolated from cattle. However, 2 M. avium isolates (DT 78 and Env 77 showed significant sequence diversity from the reference strain M. avium 104. The genomes of M. avium isolates DT 78 and Env 77 exhibited only 87% and 40% homology, respectively, to the M. avium 104 reference genome. Within the M. ap isolates, genomic rearrangements (insertions/deletions, Indels were not detected, and only unique single nucleotide polymorphisms (SNPs were observed among the 6 M. ap strains. While most of the SNPs (~100 in M. ap genomes were non-synonymous, a total of ~ 6000 SNPs were detected among M. avium genomes, most of them were synonymous suggesting a differential selective pressure between M. ap and M. avium isolates. In addition, SNPs-based phylo-genomic analysis showed that isolates from goat and Oryx are closely related to the cattle (K-10 strain while the human isolate (M. ap 4B is closely related to the environmental strains, indicating environmental source to human infections. Overall, SNPs were the most common variations among M. ap isolates while SNPs in addition to Indels were prevalent among M. avium isolates. Genomic variations will be useful in designing host-specific markers for the analysis of mycobacterial evolution and for developing novel diagnostics directed against Johne’s disease in animals.

  17. Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

    Science.gov (United States)

    Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

    2017-09-14

    The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

  18. SOLiD sequencing of four Vibrio vulnificus genomes enables comparative genomic analysis and identification of candidate clade-specific virulence genes

    Directory of Open Access Journals (Sweden)

    Telonis-Scott Marina

    2010-09-01

    Full Text Available Abstract Background Vibrio vulnificus is the leading cause of reported death from consumption of seafood in the United States. Despite several decades of research on molecular pathogenesis, much remains to be learned about the mechanisms of virulence of this opportunistic bacterial pathogen. The two complete and annotated genomic DNA sequences of V. vulnificus belong to strains of clade 2, which is the predominant clade among clinical strains. Clade 2 strains generally possess higher virulence potential in animal models of disease compared with clade 1, which predominates among environmental strains. SOLiD sequencing of four V. vulnificus strains representing different clades (1 and 2 and biotypes (1 and 2 was used for comparative genomic analysis. Results Greater than 4,100,000 bases were sequenced of each strain, yielding approximately 100-fold coverage for each of the four genomes. Although the read lengths of SOLiD genomic sequencing were only 35 nt, we were able to make significant conclusions about the unique and shared sequences among the genomes, including identification of single nucleotide polymorphisms. Comparative analysis of the newly sequenced genomes to the existing reference genomes enabled the identification of 3,459 core V. vulnificus genes shared among all six strains and 80 clade 2-specific genes. We identified 523,161 SNPs among the six genomes. Conclusions We were able to glean much information about the genomic content of each strain using next generation sequencing. Flp pili, GGDEF proteins, and genomic island XII were identified as possible virulence factors because of their presence in virulent sequenced strains. Genomic comparisons also point toward the involvement of sialic acid catabolism in pathogenesis.

  19. Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?

    Science.gov (United States)

    Robins-Browne, Roy M.; Holt, Kathryn E.; Ingle, Danielle J.; Hocking, Dianna M.; Yang, Ji; Tauschek, Marija

    2016-01-01

    The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E.coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli. Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli, which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods. PMID:27917373

  20. CloVR-Comparative: automated, cloud-enabled comparative microbial genome sequence analysis pipeline.

    Science.gov (United States)

    Agrawal, Sonia; Arze, Cesar; Adkins, Ricky S; Crabtree, Jonathan; Riley, David; Vangala, Mahesh; Galens, Kevin; Fraser, Claire M; Tettelin, Hervé; White, Owen; Angiuoli, Samuel V; Mahurkar, Anup; Fricke, W Florian

    2017-04-27

    The benefit of increasing genomic sequence data to the scientific community depends on easy-to-use, scalable bioinformatics support. CloVR-Comparative combines commonly used bioinformatics tools into an intuitive, automated, and cloud-enabled analysis pipeline for comparative microbial genomics. CloVR-Comparative runs on annotated complete or draft genome sequences that are uploaded by the user or selected via a taxonomic tree-based user interface and downloaded from NCBI. CloVR-Comparative runs reference-free multiple whole-genome alignments to determine unique, shared and core coding sequences (CDSs) and single nucleotide polymorphisms (SNPs). Output includes short summary reports and detailed text-based results files, graphical visualizations (phylogenetic trees, circular figures), and a database file linked to the Sybil comparative genome browser. Data up- and download, pipeline configuration and monitoring, and access to Sybil are managed through CloVR-Comparative web interface. CloVR-Comparative and Sybil are distributed as part of the CloVR virtual appliance, which runs on local computers or the Amazon EC2 cloud. Representative datasets (e.g. 40 draft and complete Escherichia coli genomes) are processed in genomics projects, while eliminating the need for on-site computational resources and expertise.

  1. Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus.

    Science.gov (United States)

    Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A

    2012-09-01

    The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.

  2. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

    2016-07-28

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

  3. Identification of novel biomass-degrading enzymes from genomic dark matter: Populating genomic sequence space with functional annotation.

    Science.gov (United States)

    Piao, Hailan; Froula, Jeff; Du, Changbin; Kim, Tae-Wan; Hawley, Erik R; Bauer, Stefan; Wang, Zhong; Ivanova, Nathalia; Clark, Douglas S; Klenk, Hans-Peter; Hess, Matthias

    2014-08-01

    Although recent nucleotide sequencing technologies have significantly enhanced our understanding of microbial genomes, the function of ∼35% of genes identified in a genome currently remains unknown. To improve the understanding of microbial genomes and consequently of microbial processes it will be crucial to assign a function to this "genomic dark matter." Due to the urgent need for additional carbohydrate-active enzymes for improved production of transportation fuels from lignocellulosic biomass, we screened the genomes of more than 5,500 microorganisms for hypothetical proteins that are located in the proximity of already known cellulases. We identified, synthesized and expressed a total of 17 putative cellulase genes with insufficient sequence similarity to currently known cellulases to be identified as such using traditional sequence annotation techniques that rely on significant sequence similarity. The recombinant proteins of the newly identified putative cellulases were subjected to enzymatic activity assays to verify their hydrolytic activity towards cellulose and lignocellulosic biomass. Eleven (65%) of the tested enzymes had significant activity towards at least one of the substrates. This high success rate highlights that a gene context-based approach can be used to assign function to genes that are otherwise categorized as "genomic dark matter" and to identify biomass-degrading enzymes that have little sequence similarity to already known cellulases. The ability to assign function to genes that have no related sequence representatives with functional annotation will be important to enhance our understanding of microbial processes and to identify microbial proteins for a wide range of applications. © 2014 Wiley Periodicals, Inc.

  4. Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

    Science.gov (United States)

    Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

    2015-01-01

    The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

  5. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999

    Energy Technology Data Exchange (ETDEWEB)

    Harger, Carol A.

    1999-10-28

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence. [The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  6. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

    Science.gov (United States)

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.

  7. Comparative genomic analysis of translation initiation mechanisms for genes lacking the Shine–Dalgarno sequence in prokaryotes

    KAUST Repository

    Nakagawa, So

    2017-02-15

    In prokaryotes, translation initiation is believed to occur through an interaction between the 3\\' tail of a 16S rRNA and a corresponding Shine-Dalgarno (SD) sequence in the 5\\' untranslated region (UTR) of an mRNA. However, some genes lack SD sequences (non-SD genes), and the fraction of non-SD genes in a genome varies depending on the prokaryotic species. To elucidate non-SD translation initiation mechanisms in prokaryotes from an evolutionary perspective, we statistically examined the nucleotide frequencies around the initiation codons in non-SD genes from 260 prokaryotes (235 bacteria and 25 archaea). We identified distinct nucleotide frequency biases upstream of the initiation codon in bacteria and archaea, likely because of the presence of leaderless mRNAs lacking a 5\\' UTR. Moreover, we observed overall similarities in the nucleotide patterns between upstream and downstream regions of the initiation codon in all examined phyla. Symmetric nucleotide frequency biases might facilitate translation initiation by preventing the formation of secondary structures around the initiation codon. These features are more prominent in species\\' genomes that harbor large fractions of non-SD sequences, suggesting that a reduced stability around the initiation codon is important for efficient translation initiation in prokaryotes.

  8. Comparative genomic analysis of translation initiation mechanisms for genes lacking the Shine–Dalgarno sequence in prokaryotes

    KAUST Repository

    Nakagawa, So; Niimura, Yoshihito; Gojobori, Takashi

    2017-01-01

    In prokaryotes, translation initiation is believed to occur through an interaction between the 3' tail of a 16S rRNA and a corresponding Shine-Dalgarno (SD) sequence in the 5' untranslated region (UTR) of an mRNA. However, some genes lack SD sequences (non-SD genes), and the fraction of non-SD genes in a genome varies depending on the prokaryotic species. To elucidate non-SD translation initiation mechanisms in prokaryotes from an evolutionary perspective, we statistically examined the nucleotide frequencies around the initiation codons in non-SD genes from 260 prokaryotes (235 bacteria and 25 archaea). We identified distinct nucleotide frequency biases upstream of the initiation codon in bacteria and archaea, likely because of the presence of leaderless mRNAs lacking a 5' UTR. Moreover, we observed overall similarities in the nucleotide patterns between upstream and downstream regions of the initiation codon in all examined phyla. Symmetric nucleotide frequency biases might facilitate translation initiation by preventing the formation of secondary structures around the initiation codon. These features are more prominent in species' genomes that harbor large fractions of non-SD sequences, suggesting that a reduced stability around the initiation codon is important for efficient translation initiation in prokaryotes.

  9. A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

    Science.gov (United States)

    Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

    2012-01-01

    We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

  10. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus.

    Science.gov (United States)

    Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan

    2016-03-01

    Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000.

  11. Single-Cell Whole-Genome Amplification and Sequencing: Methodology and Applications.

    Science.gov (United States)

    Huang, Lei; Ma, Fei; Chapman, Alec; Lu, Sijia; Xie, Xiaoliang Sunney

    2015-01-01

    We present a survey of single-cell whole-genome amplification (WGA) methods, including degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycles (MALBAC). The key parameters to characterize the performance of these methods are defined, including genome coverage, uniformity, reproducibility, unmappable rates, chimera rates, allele dropout rates, false positive rates for calling single-nucleotide variations, and ability to call copy-number variations. Using these parameters, we compare five commercial WGA kits by performing deep sequencing of multiple single cells. We also discuss several major applications of single-cell genomics, including studies of whole-genome de novo mutation rates, the early evolution of cancer genomes, circulating tumor cells (CTCs), meiotic recombination of germ cells, preimplantation genetic diagnosis (PGD), and preimplantation genomic screening (PGS) for in vitro-fertilized embryos.

  12. Genome-wide single nucleotide polymorphisms (SNPs) for a model invasive ascidian Botryllus schlosseri.

    Science.gov (United States)

    Gao, Yangchun; Li, Shiguo; Zhan, Aibin

    2018-04-01

    Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.

  13. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  14. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  15. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    Science.gov (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  16. Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

    Science.gov (United States)

    Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

    2013-10-01

    The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

  17. Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

    Science.gov (United States)

    Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

    2016-05-01

    Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

  18. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  19. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius.

    Directory of Open Access Journals (Sweden)

    Ceiridwen J Edwards

    Full Text Available BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer. In total, 289.9 megabases (22.48% of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously

  20. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius).

    LENUS (Irish Health Repository)

    Edwards, Ceiridwen J

    2010-01-01

    BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius) has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs) from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+\\/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer). In total, 289.9 megabases (22.48%) of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously identified

  1. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  2. The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

    Directory of Open Access Journals (Sweden)

    Yandell Mark

    2010-07-01

    Full Text Available Abstract Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24. The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity elsewhere in the genome, but only 23% have identical copies (99% identity. The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is

  3. Genome Sequences of Ilzat and Eleri, Two Phages Isolated Using Microbacterium foliorum NRRL B-24224

    Science.gov (United States)

    Ali, Ilzat; Jones, Acacia Eleri; Mohamed, Aleem

    2018-01-01

    ABSTRACT Bacteriophages Ilzat and Eleri are newly isolated Siphoviridae infecting Microbacterium foliorum NRRL B-24224. The phage genomes are similar in length, G+C content, and architecture and share 62.9% nucleotide sequence identity. PMID:29650566

  4. Complete Genome Sequence of the Gamma-Aminobutyric Acid-Producing Strain Streptococcus thermophilus APC151.

    Science.gov (United States)

    Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine

    2017-04-27

    Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.

  5. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  6. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  7. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  8. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999; FINAL

    International Nuclear Information System (INIS)

    Harger, Carol A.

    1999-01-01

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence.[The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  9. Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks.

    Science.gov (United States)

    Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S K; Mammel, Mark K; Tarr, Phillip I; Eppinger, Mark

    2016-01-01

    Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and

  10. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  11. Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.

    Science.gov (United States)

    Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset

    2018-03-01

    The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.

  12. Properties and distribution of pure GA-sequences of mammalian genomes.

    Directory of Open Access Journals (Sweden)

    Guenter Albrecht-Buehler

    Full Text Available The article describes DNA sequences of mammalian genomes that are longer than 50 bases, but consist exclusively of G's and A's ('pure GA-sequences'. Although their frequency of incidence should be 10(-16 or smaller, the chromosomes of human, chimpanzee, dog, cat, rat, and mouse contained many tens of thousands of them ubiquitously located along the chromosomes with a species-dependent density, reaching sizes of up to 1300 [b]. With the exception of a small number of poly-A-, poly-G-, poly-GA-, and poly-GAAA-sequences (combined <0.5%, all pure GA-sequences of the mammals tested were unique individuals, contained several repeated short GA-containing motifs, and shared a common hexa-nucleotide spectrum. At most 2% of the human GA-sequences were transcribed into mRNAs; all others were not coding for proteins. Although this could have made them less subject to natural selection, they contained many [corrected] times fewer point mutations than one should expect from the genome at large. As to the presence of other sequences with similarly restricted base contents, there were approximately as many pure TC-sequences as pure GA-sequences, but many fewer pure AC-, TA, and TG-sequences. There were practically no pure GC-sequences. The functions of pure GA-sequences are not known. Supported by a number of observations related to heat shock phenomena, the article speculates that they serve as genomic sign posts which may help guide polymerases and transcription factors to their proper targets, and/or as spatial linkers that help generate the 3-dimensional organization of chromatin.

  13. The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.; Kuehl,Jennifer V.; Arumuganathan, K.; Ellis, Mark W.; Mishler, Brent D.; Kelch,Dean G.; Olmstead, Richard G.; Boore, Jeffrey L.

    2005-02-01

    We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similar to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.

  14. The Solanum commersonii Genome Sequence Provides Insights into Adaptation to Stress Conditions and Genome Evolution of Wild Potato Relatives

    Science.gov (United States)

    Aversano, Riccardo; Contaldi, Felice; Ercolano, Maria Raffaella; Grosso, Valentina; Iorizzo, Massimo; Tatino, Filippo; Xumerle, Luciano; Dal Molin, Alessandra; Avanzato, Carla; Ferrarini, Alberto; Delledonne, Massimo; Sanseverino, Walter; Cigliano, Riccardo Aiese; Capella-Gutierrez, Salvador; Gabaldón, Toni; Frusciante, Luigi; Bradeen, James M.; Carputo, Domenico

    2015-01-01

    Here, we report the draft genome sequence of Solanum commersonii, which consists of ∼830 megabases with an N50 of 44,303 bp anchored to 12 chromosomes, using the potato (Solanum tuberosum) genome sequence as a reference. Compared with potato, S. commersonii shows a striking reduction in heterozygosity (1.5% versus 53 to 59%), and differences in genome sizes were mainly due to variations in intergenic sequence length. Gene annotation by ab initio prediction supported by RNA-seq data produced a catalog of 1703 predicted microRNAs, 18,882 long noncoding RNAs of which 20% are shown to target cold-responsive genes, and 39,290 protein-coding genes with a significant repertoire of nonredundant nucleotide binding site-encoding genes and 126 cold-related genes that are lacking in S. tuberosum. Phylogenetic analyses indicate that domesticated potato and S. commersonii lineages diverged ∼2.3 million years ago. Three duplication periods corresponding to genome enrichment for particular gene families related to response to salt stress, water transport, growth, and defense response were discovered. The draft genome sequence of S. commersonii substantially increases our understanding of the domesticated germplasm, facilitating translation of acquired knowledge into advances in crop stability in light of global climate and environmental changes. PMID:25873387

  15. The complete sequence of the mitochondrial genome of the African Penguin (Spheniscus demersus).

    Science.gov (United States)

    Labuschagne, Christiaan; Kotzé, Antoinette; Grobler, J Paul; Dalton, Desiré L

    2014-01-15

    The complete mitochondrial genome of the African Penguin (Spheniscus demersus) was sequenced. The molecule was sequenced via next generation sequencing and primer walking. The size of the genome is 17,346 bp in length. Comparison with the mitochondrial DNA of two other penguin genomes that have so far been reported was conducted namely; Little blue penguin (Eudyptula minor) and the Rockhopper penguin (Eudyptes chrysocome). This analysis made it possible to identify common penguin mitochondrial DNA characteristics. The S. demersus mtDNA genome is very similar, both in composition and length to both the E. chrysocome and E. minor genomes. The gene content of the African penguin mitochondrial genome is typical of vertebrates and all three penguin species have the standard gene order originally identified in the chicken. The control region for S. demersus is located between tRNA-Glu and tRNA-Phe and all three species of penguins contain two sets of similar repeats with varying copy numbers towards the 3' end of the control region, accounting for the size variance. This is the first report of the complete nucleotide sequence for the mitochondrial genome of the African penguin, S. demersus. These results can be subsequently used to provide information for penguin phylogenetic studies and insights into the evolution of genomes. © 2013 Elsevier B.V. All rights reserved.

  16. De novo Genome Assembly and Single Nucleotide Variations for Soybean Mosaic Virus Using Soybean Seed Transcriptome Data

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2017-10-01

    Full Text Available Soybean is the most important legume crop in the world. Several diseases in soybean lead to serious yield losses in major soybean-producing countries. Moreover, soybean can be infected by diverse viruses. Recently, we carried out a large-scale screening to identify viruses infecting soybean using available soybean transcriptome data. Of the screened transcriptomes, a soybean transcriptome for soybean seed development analysis contains several virus-associated sequences. In this study, we identified five viruses, including soybean mosaic virus (SMV, infecting soybean by de novo transcriptome assembly followed by blast search. We assembled a nearly complete consensus genome sequence of SMV China using transcriptome data. Based on phylogenetic analysis, the consensus genome sequence of SMV China was closely related to SMV isolates from South Korea. We examined single nucleotide variations (SNVs for SMVs in the soybean seed transcriptome revealing 780 SNVs, which were evenly distributed on the SMV genome. Four SNVs, C-U, U-C, A-G, and G-A, were frequently identified. This result demonstrated the quasispecies variation of the SMV genome. Taken together, this study carried out bioinformatics analyses to identify viruses using soybean transcriptome data. In addition, we demonstrated the application of soybean transcriptome data for virus genome assembly and SNV analysis.

  17. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  18. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  19. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  20. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  1. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  2. Equid herpesvirus 8: Complete genome sequence and association with abortion in mares

    Science.gov (United States)

    Garvey, Marie; Suárez, Nicolás M.; Kerr, Karen; Hector, Ralph; Moloney-Quinn, Laura; Arkins, Sean; Davison, Andrew J.

    2018-01-01

    Equid herpesvirus 8 (EHV-8), formerly known as asinine herpesvirus 3, is an alphaherpesvirus that is closely related to equid herpesviruses 1 and 9 (EHV-1 and EHV-9). The pathogenesis of EHV-8 is relatively little studied and to date has only been associated with respiratory disease in donkeys in Australia and horses in China. A single EHV-8 genome sequence has been generated for strain Wh in China, but is apparently incomplete and contains frameshifts in two genes. In this study, the complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 were determined by Illumina sequencing. Two of these strains were isolated from cases of abortion in horses, and were misdiagnosed initially as EHV-1, and two were isolated from donkeys, one with neurological disease. The four genome sequences are very similar to each other, exhibiting greater than 98.4% nucleotide identity, and their phylogenetic clustering together demonstrated that genomic diversity is not dependent on the host. Comparative genomic analysis revealed 24 of the 76 predicted protein sequences are completely conserved among the Irish EHV-8 strains. Evolutionary comparisons indicate that EHV-8 is phylogenetically closer to EHV-9 than it is to EHV-1. In summary, the first complete genome sequences of EHV-8 isolates from two host species over a twelve year period are reported. The current study suggests that EHV-8 can cause abortion in horses. The potential threat of EHV-8 to the horse industry and the possibility that donkeys may act as reservoirs of infection warrant further investigation. PMID:29414990

  3. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  4. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  5. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  6. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  7. Multi-platform next-generation sequencing of the domestic turkey (Meleagris gallopavo: genome assembly and analysis.

    Directory of Open Access Journals (Sweden)

    Rami A Dalloul

    2010-09-01

    Full Text Available A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo. Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest.

  8. Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).

    Science.gov (United States)

    Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi

    2011-02-01

    The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.

  9. Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.

    Science.gov (United States)

    Sun, Genlou; Komatsuda, Takao

    2010-08-01

    It is well known that Elymus arose through hybridization between representatives of different genera. Cytogenetic analyses show that all its members include the St genome in combination with one or more of four other genomes, the H, Y, P, and W genomes. The origins of the H, P, and W genomes are known, but not for the Y genome. We analyzed the single copy nuclear gene coding for elongation factor G (EF-G) from 28 accessions of polyploid Elymus species and 45 accessions of diploid Triticeae species in order to investigate origin of the Y genome and its relationship to other genomes in the tribe Triticeae. Sequence comparisons among the St, H, Y, P, W, and E genomes detected genome-specific polymorphisms at 66 nucleotide positions. The St and Y genomes are relatively dissimilar. The phylogeny of the Y genome sequences was investigated for the first time. They were most similar to the W genome sequences. The Y genome sequences were placed in two different groups. These two groups were included in an unresolved clade that included the W and E sequences as well as sequences from many annual species. The H genomes sequences were in a clade with the F, P, and Ns genome sequences as sister groups. These two clades were more closely related to each other and to the L and Xp genomes than they were to the St genome sequences. These data support the hypothesis that the Y genome evolved in a diploid species and has a different origin from the St genome. Copyright 2010 Elsevier Inc. All rights reserved.

  10. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  11. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    OpenAIRE

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.

  12. Ion torrent personal genome machine sequencing for genomic typing of Neisseria meningitidis for rapid determination of multiple layers of typing information.

    Science.gov (United States)

    Vogel, Ulrich; Szczepanowski, Rafael; Claus, Heike; Jünemann, Sebastian; Prior, Karola; Harmsen, Dag

    2012-06-01

    Neisseria meningitidis causes invasive meningococcal disease in infants, toddlers, and adolescents worldwide. DNA sequence-based typing, including multilocus sequence typing, analysis of genetic determinants of antibiotic resistance, and sequence typing of vaccine antigens, has become the standard for molecular epidemiology of the organism. However, PCR of multiple targets and consecutive Sanger sequencing provide logistic constraints to reference laboratories. Taking advantage of the recent development of benchtop next-generation sequencers (NGSs) and of BIGSdb, a database accommodating and analyzing genome sequence data, we therefore explored the feasibility and accuracy of Ion Torrent Personal Genome Machine (PGM) sequencing for genomic typing of meningococci. Three strains from a previous meningococcus serogroup B community outbreak were selected to compare conventional typing results with data generated by semiconductor chip-based sequencing. In addition, sequencing of the meningococcal type strain MC58 provided information about the general performance of the technology. The PGM technology generated sequence information for all target genes addressed. The results were 100% concordant with conventional typing results, with no further editing being necessary. In addition, the amount of typing information, i.e., nucleotides and target genes analyzed, could be substantially increased by the combined use of genome sequencing and BIGSdb compared to conventional methods. In the near future, affordable and fast benchtop NGS machines like the PGM might enable reference laboratories to switch to genomic typing on a routine basis. This will reduce workloads and rapidly provide information for laboratory surveillance, outbreak investigation, assessment of vaccine preventability, and antibiotic resistance gene monitoring.

  13. Combined evidence annotation of transposable elements in genome sequences.

    Directory of Open Access Journals (Sweden)

    Hadi Quesneville

    2005-07-01

    Full Text Available Transposable elements (TEs are mobile, repetitive sequences that make up significant fractions of metazoan genomes. Despite their near ubiquity and importance in genome and chromosome biology, most efforts to annotate TEs in genome sequences rely on the results of a single computational program, RepeatMasker. In contrast, recent advances in gene annotation indicate that high-quality gene models can be produced from combining multiple independent sources of computational evidence. To elevate the quality of TE annotations to a level comparable to that of gene models, we have developed a combined evidence-model TE annotation pipeline, analogous to systems used for gene annotation, by integrating results from multiple homology-based and de novo TE identification methods. As proof of principle, we have annotated "TE models" in Drosophila melanogaster Release 4 genomic sequences using the combined computational evidence derived from RepeatMasker, BLASTER, TBLASTX, all-by-all BLASTN, RECON, TE-HMM and the previous Release 3.1 annotation. Our system is designed for use with the Apollo genome annotation tool, allowing automatic results to be curated manually to produce reliable annotations. The euchromatic TE fraction of D. melanogaster is now estimated at 5.3% (cf. 3.86% in Release 3.1, and we found a substantially higher number of TEs (n = 6,013 than previously identified (n = 1,572. Most of the new TEs derive from small fragments of a few hundred nucleotides long and highly abundant families not previously annotated (e.g., INE-1. We also estimated that 518 TE copies (8.6% are inserted into at least one other TE, forming a nest of elements. The pipeline allows rapid and thorough annotation of even the most complex TE models, including highly deleted and/or nested elements such as those often found in heterochromatic sequences. Our pipeline can be easily adapted to other genome sequences, such as those of the D. melanogaster heterochromatin or other

  14. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing

    Directory of Open Access Journals (Sweden)

    Guangtu Gao

    2018-04-01

    Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and

  15. A map of human genome variation from population-scale sequencing.

    Science.gov (United States)

    Abecasis, Gonçalo R; Altshuler, David; Auton, Adam; Brooks, Lisa D; Durbin, Richard M; Gibbs, Richard A; Hurles, Matt E; McVean, Gil A

    2010-10-28

    The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot phase of the project, designed to develop and compare different strategies for genome-wide sequencing with high-throughput platforms. We undertook three projects: low-coverage whole-genome sequencing of 179 individuals from four populations; high-coverage sequencing of two mother-father-child trios; and exon-targeted sequencing of 697 individuals from seven populations. We describe the location, allele frequency and local haplotype structure of approximately 15 million single nucleotide polymorphisms, 1 million short insertions and deletions, and 20,000 structural variants, most of which were previously undescribed. We show that, because we have catalogued the vast majority of common variation, over 95% of the currently accessible variants found in any individual are present in this data set. On average, each person is found to carry approximately 250 to 300 loss-of-function variants in annotated genes and 50 to 100 variants previously implicated in inherited disorders. We demonstrate how these results can be used to inform association and functional studies. From the two trios, we directly estimate the rate of de novo germline base substitution mutations to be approximately 10(-8) per base pair per generation. We explore the data with regard to signatures of natural selection, and identify a marked reduction of genetic variation in the neighbourhood of genes, due to selection at linked sites. These methods and public data will support the next phase of human genetic research.

  16. Microbial species delineation using whole genome sequences.

    Science.gov (United States)

    Varghese, Neha J; Mukherjee, Supratim; Ivanova, Natalia; Konstantinidis, Konstantinos T; Mavrommatis, Kostas; Kyrpides, Nikos C; Pati, Amrita

    2015-08-18

    Increased sequencing of microbial genomes has revealed that prevailing prokaryotic species assignments can be inconsistent with whole genome information for a significant number of species. The long-standing need for a systematic and scalable species assignment technique can be met by the genome-wide Average Nucleotide Identity (gANI) metric, which is widely acknowledged as a robust measure of genomic relatedness. In this work, we demonstrate that the combination of gANI and the alignment fraction (AF) between two genomes accurately reflects their genomic relatedness. We introduce an efficient implementation of AF,gANI and discuss its successful application to 86.5M genome pairs between 13,151 prokaryotic genomes assigned to 3032 species. Subsequently, by comparing the genome clusters obtained from complete linkage clustering of these pairs to existing taxonomy, we observed that nearly 18% of all prokaryotic species suffer from anomalies in species definition. Our results can be used to explore central questions such as whether microorganisms form a continuum of genetic diversity or distinct species represented by distinct genetic signatures. We propose that this precise and objective AF,gANI-based species definition: the MiSI (Microbial Species Identifier) method, be used to address previous inconsistencies in species classification and as the primary guide for new taxonomic species assignment, supplemented by the traditional polyphasic approach, as required. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  18. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  19. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  20. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  1. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    Science.gov (United States)

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332

  2. Sequence imputation of HPV16 genomes for genetic association studies.

    Directory of Open Access Journals (Sweden)

    Benjamin Smith

    Full Text Available Human Papillomavirus type 16 (HPV16 causes over half of all cervical cancer and some HPV16 variants are more oncogenic than others. The genetic basis for the extraordinary oncogenic properties of HPV16 compared to other HPVs is unknown. In addition, we neither know which nucleotides vary across and within HPV types and lineages, nor which of the single nucleotide polymorphisms (SNPs determine oncogenicity.A reference set of 62 HPV16 complete genome sequences was established and used to examine patterns of evolutionary relatedness amongst variants using a pairwise identity heatmap and HPV16 phylogeny. A BLAST-based algorithm was developed to impute complete genome data from partial sequence information using the reference database. To interrogate the oncogenic risk of determined and imputed HPV16 SNPs, odds-ratios for each SNP were calculated in a case-control viral genome-wide association study (VWAS using biopsy confirmed high-grade cervix neoplasia and self-limited HPV16 infections from Guanacaste, Costa Rica.HPV16 variants display evolutionarily stable lineages that contain conserved diagnostic SNPs. The imputation algorithm indicated that an average of 97.5±1.03% of SNPs could be accurately imputed. The VWAS revealed specific HPV16 viral SNPs associated with variant lineages and elevated odds ratios; however, individual causal SNPs could not be distinguished with certainty due to the nature of HPV evolution.Conserved and lineage-specific SNPs can be imputed with a high degree of accuracy from limited viral polymorphic data due to the lack of recombination and the stochastic mechanism of variation accumulation in the HPV genome. However, to determine the role of novel variants or non-lineage-specific SNPs by VWAS will require direct sequence analysis. The investigation of patterns of genetic variation and the identification of diagnostic SNPs for lineages of HPV16 variants provides a valuable resource for future studies of HPV16

  3. Complete chloroplast genome sequence of Elodea canadensis and comparative analyses with other monocot plastid genomes.

    Science.gov (United States)

    Huotari, Tea; Korpelainen, Helena

    2012-10-15

    Elodea canadensis is an aquatic angiosperm native to North America. It has attracted great attention due to its invasive nature when transported to new areas in its non-native range. We have determined the complete nucleotide sequence of the chloroplast (cp) genome of Elodea. Taxonomically Elodea is a basal monocot, and only few monocot cp genomes representing early lineages of monocots have been sequenced so far. The genome is a circular double-stranded DNA molecule 156,700 bp in length, and has a typical structure with large (LSC 86,194 bp) and small (SSC 17,810 bp) single-copy regions separated by a pair of inverted repeats (IRs 26,348 bp each). The Elodea cp genome contains 113 unique genes and 16 duplicated genes in the IR regions. A comparative analysis showed that the gene order and organization of the Elodea cp genome is almost identical to that of Amborella trichopoda, a basal angiosperm. The structure of IRs in Elodea is unique among monocot species with the whole cp genome sequenced. In Elodea and another monocot Lemna minor the borders between IRs and LSC are located upstream of rps 19 gene and downstream of trnH-GUG gene, while in most monocots, IR has extended to include both trnH and rps 19 genes. A phylogenetic analysis conducted using Bayesian method, based on the DNA sequences of 81 chloroplast genes from 17 monocot taxa provided support for the placement of Elodea together with Lemna as a basal monocot and the next diverging lineage of monocots after Acorales. In comparison with other monocots, the Elodea cp genome has gone through only few rearrangements or gene losses. IR of Elodea has a unique structure among the monocot species studied so far as its structure is similar to that of a basal angiosperm Amborella. This result together with phylogenetic analyses supports the placement of Elodea as a basal monocot to the next diverging lineage of monocots after Acorales. So far, only few cp genomes representing early lineages of monocots have been

  4. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis

    OpenAIRE

    Iwanowicz, Luke R.; Iwanowicz, Deborah D.; Adams, Cynthia R.; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S.

    2017-01-01

    ABSTRACT Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis, gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  5. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Adams, Cynthia R; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S

    2017-10-12

    Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis , gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  6. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  7. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  8. The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

    International Nuclear Information System (INIS)

    Nylund, Stian; Karlsen, Marius; Nylund, Are

    2008-01-01

    The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae

  9. Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa

    Directory of Open Access Journals (Sweden)

    Shahin Arwa

    2012-11-01

    Full Text Available Abstract Background Bulbous flowers such as lily and tulip (Liliaceae family are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups and among the three monocot species: lily, tulip, and rice (6,900 groups were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions

  10. Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

    Science.gov (United States)

    Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

    2012-11-20

    Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable

  11. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  12. Beyond Linear Sequence Comparisons: The use of genome-levelcharacters for phylogenetic reconstruction

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2004-11-27

    Although the phylogenetic relationships of many organisms have been convincingly resolved by the comparisons of nucleotide or amino acid sequences, others have remained equivocal despite great effort. Now that large-scale genome sequencing projects are sampling many lineages, it is becoming feasible to compare large data sets of genome-level features and to develop this as a tool for phylogenetic reconstruction that has advantages over conventional sequence comparisons. Although it is unlikely that these will address a large number of evolutionary branch points across the broad tree of life due to the infeasibility of such sampling, they have great potential for convincingly resolving many critical, contested relationships for which no other data seems promising. However, it is important that we recognize potential pitfalls, establish reasonable standards for acceptance, and employ rigorous methodology to guard against a return to earlier days of scenario-driven evolutionary reconstructions.

  13. Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

    Science.gov (United States)

    Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

    1997-01-01

    SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

  14. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    Science.gov (United States)

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  16. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    Science.gov (United States)

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  17. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  18. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  19. Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

    Science.gov (United States)

    Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

    2014-11-01

    Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

  20. Same-day genomic and epigenomic diagnosis of brain tumors using real-time nanopore sequencing.

    Science.gov (United States)

    Euskirchen, Philipp; Bielle, Franck; Labreche, Karim; Kloosterman, Wigard P; Rosenberg, Shai; Daniau, Mailys; Schmitt, Charlotte; Masliah-Planchon, Julien; Bourdeaut, Franck; Dehais, Caroline; Marie, Yannick; Delattre, Jean-Yves; Idbaih, Ahmed

    2017-11-01

    Molecular classification of cancer has entered clinical routine to inform diagnosis, prognosis, and treatment decisions. At the same time, new tumor entities have been identified that cannot be defined histologically. For central nervous system tumors, the current World Health Organization classification explicitly demands molecular testing, e.g., for 1p/19q-codeletion or IDH mutations, to make an integrated histomolecular diagnosis. However, a plethora of sophisticated technologies is currently needed to assess different genomic and epigenomic alterations and turnaround times are in the range of weeks, which makes standardized and widespread implementation difficult and hinders timely decision making. Here, we explored the potential of a pocket-size nanopore sequencing device for multimodal and rapid molecular diagnostics of cancer. Low-pass whole genome sequencing was used to simultaneously generate copy number (CN) and methylation profiles from native tumor DNA in the same sequencing run. Single nucleotide variants in IDH1, IDH2, TP53, H3F3A, and the TERT promoter region were identified using deep amplicon sequencing. Nanopore sequencing yielded ~0.1X genome coverage within 6 h and resulting CN and epigenetic profiles correlated well with matched microarray data. Diagnostically relevant alterations, such as 1p/19q codeletion, and focal amplifications could be recapitulated. Using ad hoc random forests, we could perform supervised pan-cancer classification to distinguish gliomas, medulloblastomas, and brain metastases of different primary sites. Single nucleotide variants in IDH1, IDH2, and H3F3A were identified using deep amplicon sequencing within minutes of sequencing. Detection of TP53 and TERT promoter mutations shows that sequencing of entire genes and GC-rich regions is feasible. Nanopore sequencing allows same-day detection of structural variants, point mutations, and methylation profiling using a single device with negligible capital cost. It

  1. Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

    2014-01-01

    , a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

  2. Detection of a divergent variant of grapevine virus F by next-generation sequencing.

    Science.gov (United States)

    Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

    2015-08-01

    The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

  3. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  4. Genome sequence of Ochrobactrum anthropi strain SUBG007, a plant pathogen and potential xenobiotic compounds degradation bacterium

    Directory of Open Access Journals (Sweden)

    Kiran S. Chudasama

    2017-03-01

    Full Text Available Ochrobactrum anthropi SUBG007 was isolated from the fruit of Prunus dulcis in Rajkot (22.30°N, 70.78°E, Gujarat, India. Here we present the 4.37 Mb genome sequence strain SUBG007, which may provide the genetic information for the application in environment pollution degradation and agriculture field. The strain also posses many genes cluster which involved in production of important secondary metabolites. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession LUAY00000000.

  5. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  6. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  7. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  8. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  9. Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

    Science.gov (United States)

    Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

    2010-04-27

    To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be

  10. Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

    Science.gov (United States)

    Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

    2017-09-01

    The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

  11. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    Directory of Open Access Journals (Sweden)

    Bannantine John P

    2012-03-01

    Full Text Available Abstract Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs. Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb. Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565 further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences.

  12. Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement.

    Science.gov (United States)

    Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis

    2017-02-01

    Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  13. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  14. Draft Genome Sequences of Two Extensively Drug-Resistant Strains of Mycobacterium tuberculosis Belonging to the Euro-American S Lineage

    NARCIS (Netherlands)

    Malinga, L.A.; Abeel, T.; Desjardins, C.A.; Dlamini, T.C.; Cassell, G.; Chapman, S.B.; Birren, B.W.; Earl, A.M.; Van der Walt, M.

    2016-01-01

    We report the whole-genome sequencing of two extensively drug-resistant tuberculosis strains belonging to the Euro-American S lineage. The RSA 114 strain showed single-nucleotide polymorphisms predicted to have drug efflux activity.

  15. Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes.

    Directory of Open Access Journals (Sweden)

    Tiffany Langewisch

    Full Text Available In this Genomics Era, vast amounts of next-generation sequencing data have become publicly available for multiple genomes across hundreds of species. Analyses of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset and among different datasets or organisms. To facilitate the exploration of allelic variation and diversity, we have developed and deployed an in-house computer software to categorize and visualize these haplotypes. The SNPViz software enables users to analyze region-specific haplotypes from single nucleotide polymorphism (SNP datasets for different sequenced genomes. The examination of allelic variation and diversity of important soybean [Glycine max (L. Merr.] flowering time and maturity genes may provide additional insight into flowering time regulation and enhance researchers' ability to target soybean breeding for particular environments. For this study, we utilized two available soybean genomic datasets for a total of 72 soybean genotypes encompassing cultivars, landraces, and the wild species Glycine soja. The major soybean maturity genes E1, E2, E3, and E4 along with the Dt1 gene for plant growth architecture were analyzed in an effort to determine the number of major haplotypes for each gene, to evaluate the consistency of the haplotypes with characterized variant alleles, and to identify evidence of artificial selection. The results indicated classification of a small number of predominant haplogroups for each gene and important insights into possible allelic diversity for each gene within the context of known causative mutations. The software has both a stand-alone and web-based version and can be used to analyze other genes, examine additional soybean datasets, and view similar genome sequence and SNP datasets from other species.

  16. A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization

    International Nuclear Information System (INIS)

    Valles, Steven M.; Strong, Charles A.; Dang, Phat M.; Hunter, Wayne B.; Pereira, Roberto M.; Oi, David H.; Shapiro, Alexandra M.; Williams, David F.

    2004-01-01

    We report the first discovery and genome sequence of a virus infecting the red imported fire ant, Solenopsis invicta. The 8026 nucleotide, polyadenylated, RNA genome encoded two large open reading frames (ORF1 and ORF2), flanked and separated by 27, 223, and 171 nucleotide untranslated regions, respectively. The predicted amino acid sequence of the 5' proximal ORF1 (nucleotides 28 to 4218) exhibited significant identity and possessed consensus sequences characteristic of the helicase, cysteine protease, and RNA-dependent RNA polymerase sequence motifs from picornaviruses, picorna-like viruses, comoviruses, caliciviruses, and sequiviruses. The predicted amino acid sequence of the 3' proximal ORF2 (nucleotides 4390-7803) showed similarity to structural proteins in picorna-like viruses, especially the acute bee paralysis virus. Electron microscopic examination of negatively stained samples from virus-infected fire ants revealed isometric particles with a diameter of 31 nm, consistent with Picornaviridae. A survey for the fire ant virus from areas around Florida revealed a pattern of fairly widespread distribution. Among 168 nests surveyed, 22.9% were infected. The virus was found to infect all fire ant caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates ( male and female ), and queens. The virus, tentatively named S. invicta virus (SINV-1), appears to belong to the picorna-like viruses. We did not observe any perceptible symptoms among infected nests in the field. However, in every case where an SINV-1-infected colony was excavated from the field with an inseminated queen and held in the laboratory, all of the brood in these colonies died within 3 months

  17. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  18. Genomic sequencing in clinical trials

    OpenAIRE

    Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

    2011-01-01

    Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

  19. Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Genome-Wide Typing of Clostridium difficile.

    Science.gov (United States)

    Bletz, Stefan; Janezic, Sandra; Harmsen, Dag; Rupnik, Maja; Mellmann, Alexander

    2018-06-01

    Clostridium difficile , recently renamed Clostridioides difficile , is the most common cause of antibiotic-associated nosocomial gastrointestinal infections worldwide. To differentiate endogenous infections and transmission events, highly discriminatory subtyping is necessary. Today, methods based on whole-genome sequencing data are increasingly used to subtype bacterial pathogens; however, frequently a standardized methodology and typing nomenclature are missing. Here we report a core genome multilocus sequence typing (cgMLST) approach developed for C. difficile Initially, we determined the breadth of the C. difficile population based on all available MLST sequence types with Bayesian inference (BAPS). The resulting BAPS partitions were used in combination with C. difficile clade information to select representative isolates that were subsequently used to define cgMLST target genes. Finally, we evaluated the novel cgMLST scheme with genomes from 3,025 isolates. BAPS grouping ( n = 6 groups) together with the clade information led to a total of 11 representative isolates that were included for cgMLST definition and resulted in 2,270 cgMLST genes that were present in all isolates. Overall, 2,184 to 2,268 cgMLST targets were detected in the genome sequences of 70 outbreak-associated and reference strains, and on average 99.3% cgMLST targets (1,116 to 2,270 targets) were present in 2,954 genomes downloaded from the NCBI database, underlining the representativeness of the cgMLST scheme. Moreover, reanalyzing different cluster scenarios with cgMLST were concordant to published single nucleotide variant analyses. In conclusion, the novel cgMLST is representative for the whole C. difficile population, is highly discriminatory in outbreak situations, and provides a unique nomenclature facilitating interlaboratory exchange. Copyright © 2018 American Society for Microbiology.

  20. PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

    Science.gov (United States)

    Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

    2011-01-01

    PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

  1. Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Rong Li

    Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.

  2. Segment-specific terminal sequences of Bunyamwera bunyavirus regulate genome replication

    International Nuclear Information System (INIS)

    Barr, John N.; Elliott, Richard M.; Dunn, Ewan F.; Wertz, Gail W.

    2003-01-01

    Bunyamwera virus (BUNV) is the prototype of both the Orthobunyavirus genus and the Bunyaviridae family of segmented negative sense RNA viruses. The tripartite BUNV genome consists of small (S), medium (M), and large (L) segments that are transcribed to give a single mRNA and replicated to generate an antigenome that is the template for synthesis of further genomic RNA strands. We modified an existing cDNA-derived RNA synthesis system to allow identification of BUNV RNA replication and transcription products by direct metabolic labeling. Direct RNA analysis allowed us to distinguish between template activities that affected either RNA replication or mRNA transcription, an ability that was not possible using previous reporter gene expression assays. We generated genome analogs containing the entire nontranslated terminal sequences of the S, M, and L BUNV segments surrounding a common sequence. Analysis of RNAs synthesized from these templates revealed that the relative abilities of BUNV segments to perform RNA replication was M > L > S. Exchange of segment-specific terminal nucleotides identified a 12-nt region located within both the 3' and 5' termini of the M segment that correlated with its high replication ability

  3. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    Science.gov (United States)

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  4. Draft genome sequence of an endophytic bacterium, Paenibacillus tyrfis strain SUK123, isolated from Santiria apiculata stem

    Directory of Open Access Journals (Sweden)

    Emmanuel Haruna

    2017-12-01

    Full Text Available Here we report the draft genome sequence of an endophytic Paenibacillus tyrfis strain isolated from the Universiti Kebangsaan Malaysia reserve forest, Malaysia. The genome size was approximately 8.04 Mb, and the assembly consisted of 107 scaffolds with 168 contigs, and had a G + C content of 53%. Phylogenetic analysis of strain SUK123 using the 16S rRNA gene revealed that it belonged to the family Paenibacillaceae with the highest similarity to Paenibacillus elgii SDT (99%. Whole genome comparison of SUK123 with related species using average nucleotide identity (ANI analysis revealed a similarity of 98% to Paenibacillus tyrfis Mst1T, 94% to Paenibacillus elgii B69T, 91% to Paenibacillus ehimensis A2T, 68% to Paenibacillus polymyxa SC2T and 69% to Paenibacillus alvei DMS29T. The draft genome was deposited at the European Nucleotide Archive (PRJEB21373.

  5. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  6. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  7. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  8. Single-nucleotide polymorphism discovery in Leptographium longiclavatum, a mountain pine beetle-associated symbiotic fungus, using whole-genome resequencing.

    Science.gov (United States)

    Ojeda, Dario I; Dhillon, Braham; Tsui, Clement K M; Hamelin, Richard C

    2014-03-01

    Single-nucleotide polymorphisms (SNPs) are rapidly becoming the standard markers in population genomics studies; however, their use in nonmodel organisms is limited due to the lack of cost-effective approaches to uncover genome-wide variation, and the large number of individuals needed in the screening process to reduce ascertainment bias. To discover SNPs for population genomics studies in the fungal symbionts of the mountain pine beetle (MPB), we developed a road map to discover SNPs and to produce a genotyping platform. We undertook a whole-genome sequencing approach of Leptographium longiclavatum in combination with available genomics resources of another MPB symbiont, Grosmannia clavigera. We sequenced 71 individuals pooled into four groups using the Illumina sequencing technology. We generated between 27 and 30 million reads of 75 bp that resulted in a total of 1, 181 contigs longer than 2 kb and an assembled genome size of 28.9 Mb (N50 = 48 kb, average depth = 125x). A total of 9052 proteins were annotated, and between 9531 and 17,266 SNPs were identified in the four pools. A subset of 206 genes (containing 574 SNPs, 11% false positives) was used to develop a genotyping platform for this species. Using this roadmap, we developed a genotyping assay with a total of 147 SNPs located in 121 genes using the Illumina(®) Sequenom iPLEX Gold. Our preliminary genotyping (success rate = 85%) of 304 individuals from 36 populations supports the utility of this approach for population genomics studies in other MPB fungal symbionts and other fungal nonmodel species. © 2013 John Wiley & Sons Ltd.

  9. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  10. Genomic Prediction from Whole Genome Sequence in Livestock: The 1000 Bull Genomes Project

    DEFF Research Database (Denmark)

    Hayes, Benjamin J; MacLeod, Iona M; Daetwyler, Hans D

    Advantages of using whole genome sequence data to predict genomic estimated breeding values (GEBV) include better persistence of accuracy of GEBV across generations and more accurate GEBV across breeds. The 1000 Bull Genomes Project provides a database of whole genome sequenced key ancestor bulls....... In a dairy data set, predictions using BayesRC and imputed sequence data from 1000 Bull Genomes were 2% more accurate than with 800k data. We could demonstrate the method identified causal mutations in some cases. Further improvements will come from more accurate imputation of sequence variant genotypes...

  11. Complete chloroplast genome sequence of a major allogamous forage species, perennial ryegrass (Lolium perenne L.).

    Science.gov (United States)

    Diekmann, Kerstin; Hodkinson, Trevor R; Wolfe, Kenneth H; van den Bekerom, Rob; Dix, Philip J; Barth, Susanne

    2009-06-01

    Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1-27 codons in comparison of L. perenne to other Poaceae and 1-68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT-PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.

  12. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  13. Complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from lettuce (Lactuca sativa) originating from a conventional field in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2016-12-01

    Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.

  14. Whole genome sequencing and analysis of Campylobacter coli YH502 from retail chicken reveals a plasmid-borne type VI secretion system

    Directory of Open Access Journals (Sweden)

    Sandeep Ghatak

    2017-03-01

    Full Text Available Campylobacter is a major cause of foodborne illnesses worldwide. Campylobacter infections, commonly caused by ingestion of undercooked poultry and meat products, can lead to gastroenteritis and chronic reactive arthritis in humans. Whole genome sequencing (WGS is a powerful technology that provides comprehensive genetic information about bacteria and is increasingly being applied to study foodborne pathogens: e.g., evolution, epidemiology/outbreak investigation, and detection. Herein we report the complete genome sequence of Campylobacter coli strain YH502 isolated from retail chicken in the United States. WGS, de novo assembly, and annotation of the genome revealed a chromosome of 1,718,974 bp and a mega-plasmid (pCOS502 of 125,964 bp. GC content of the genome was 31.2% with 1931 coding sequences and 53 non-coding RNAs. Multiple virulence factors including a plasmid-borne type VI secretion system and antimicrobial resistance genes (beta-lactams, fluoroquinolones, and aminoglycoside were found. The presence of T6SS in a mobile genetic element (plasmid suggests plausible horizontal transfer of these virulence genes to other organisms. The C. coli YH502 genome also harbors CRISPR sequences and associated proteins. Phylogenetic analysis based on average nucleotide identity and single nucleotide polymorphisms identified closely related C. coli genomes available in the NCBI database. Taken together, the analyzed genomic data of this potentially virulent strain of C. coli will facilitate further understanding of this important foodborne pathogen most likely leading to better control strategies. The chromosome and plasmid sequences of C. coli YH502 have been deposited in GenBank under the accession numbers CP018900.1 and CP018901.1, respectively.

  15. EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

    Directory of Open Access Journals (Sweden)

    Grover Atul

    2007-07-01

    Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

  16. Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

    Science.gov (United States)

    Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

    2014-08-01

    The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

  17. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    Science.gov (United States)

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  18. Whole-genome sequencing approaches for conservation biology: Advantages, limitations and practical recommendations.

    Science.gov (United States)

    Fuentes-Pardo, Angela P; Ruzzante, Daniel E

    2017-10-01

    Whole-genome resequencing (WGR) is a powerful method for addressing fundamental evolutionary biology questions that have not been fully resolved using traditional methods. WGR includes four approaches: the sequencing of individuals to a high depth of coverage with either unresolved or resolved haplotypes, the sequencing of population genomes to a high depth by mixing equimolar amounts of unlabelled-individual DNA (Pool-seq) and the sequencing of multiple individuals from a population to a low depth (lcWGR). These techniques require the availability of a reference genome. This, along with the still high cost of shotgun sequencing and the large demand for computing resources and storage, has limited their implementation in nonmodel species with scarce genomic resources and in fields such as conservation biology. Our goal here is to describe the various WGR methods, their pros and cons and potential applications in conservation biology. WGR offers an unprecedented marker density and surveys a wide diversity of genetic variations not limited to single nucleotide polymorphisms (e.g., structural variants and mutations in regulatory elements), increasing their power for the detection of signatures of selection and local adaptation as well as for the identification of the genetic basis of phenotypic traits and diseases. Currently, though, no single WGR approach fulfils all requirements of conservation genetics, and each method has its own limitations and sources of potential bias. We discuss proposed ways to minimize such biases. We envision a not distant future where the analysis of whole genomes becomes a routine task in many nonmodel species and fields including conservation biology. © 2017 John Wiley & Sons Ltd.

  19. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    Directory of Open Access Journals (Sweden)

    Shultz Jeffry

    2008-07-01

    Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

  20. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  1. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  2. Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger.

    Science.gov (United States)

    Li, Kangxin; Yang, Fang; Abdullahi, A Y; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

    2016-12-01

    Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina . This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts.

  3. Light whole genome sequence for SNP discovery across domestic cat breeds

    Directory of Open Access Journals (Sweden)

    Driscoll Carlos

    2010-06-01

    Full Text Available Abstract Background The domestic cat has offered enormous genomic potential in the veterinary description of over 250 hereditary disease models as well as the occurrence of several deadly feline viruses (feline leukemia virus -- FeLV, feline coronavirus -- FECV, feline immunodeficiency virus - FIV that are homologues to human scourges (cancer, SARS, and AIDS respectively. However, to realize this bio-medical potential, a high density single nucleotide polymorphism (SNP map is required in order to accomplish disease and phenotype association discovery. Description To remedy this, we generated 3,178,297 paired fosmid-end Sanger sequence reads from seven cats, and combined these data with the publicly available 2X cat whole genome sequence. All sequence reads were assembled together to form a 3X whole genome assembly allowing the discovery of over three million SNPs. To reduce potential false positive SNPs due to the low coverage assembly, a low upper-limit was placed on sequence coverage and a high lower-limit on the quality of the discrepant bases at a potential variant site. In all domestic cats of different breeds: female Abyssinian, female American shorthair, male Cornish Rex, female European Burmese, female Persian, female Siamese, a male Ragdoll and a female African wildcat were sequenced lightly. We report a total of 964 k common SNPs suitable for a domestic cat SNP genotyping array and an additional 900 k SNPs detected between African wildcat and domestic cats breeds. An empirical sampling of 94 discovered SNPs were tested in the sequenced cats resulting in a SNP validation rate of 99%. Conclusions These data provide a large collection of mapped feline SNPs across the cat genome that will allow for the development of SNP genotyping platforms for mapping feline diseases.

  4. Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

    Science.gov (United States)

    Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

    1997-10-01

    We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

  5. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  6. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  7. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  8. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  9. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

    Science.gov (United States)

    Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

    2015-04-01

    Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

  11. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu

    2010-12-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  12. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2010-01-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  13. Untangling nucleotide diversity and evolution of the H genome in polyploid Hordeum and Elymus species based on the single copy of nuclear gene DMC1.

    Directory of Open Access Journals (Sweden)

    Dongfa Sun

    Full Text Available Numerous hybrid and polypoid species are found within the Triticeae. It has been suggested that the H subgenome of allopolyploid Elymus (wheatgrass species originated from diploid Hordeum (barley species, but the role of hybridization between polyploid Elymus and Hordeum has not been studied. It is not clear whether gene flow across polyploid Hordeum and Elymus species has occurred following polyploid speciation. Answering these questions will provide new insights into the formation of these polyploid species, and the potential role of gene flow among polyploid species during polyploid evolution. In order to address these questions, disrupted meiotic cDNA1 (DMC1 data from the allopolyploid StH Elymus are analyzed together with diploid and polyploid Hordeum species. Phylogenetic analysis revealed that the H copies of DMC1 sequence in some Elymus are very close to the H copies of DMC1 sequence in some polyploid Hordeum species, indicating either that the H genome in theses Elymus and polyploid Hordeum species originated from same diploid donor or that gene flow has occurred among them. Our analysis also suggested that the H genomes in Elymus species originated from limited gene pool, while H genomes in Hordeum polyploids have originated from broad gene pools. Nucleotide diversity (π of the DMC1 sequences on H genome from polyploid species (π = 0.02083 in Elymus, π = 0.01680 in polyploid Hordeum is higher than that in diploid Hordeum (π = 0.01488. The estimates of Tajima's D were significantly departure from the equilibrium neutral model at this locus in diploid Hordeum species (P<0.05, suggesting an excess of rare variants in diploid species which may not contribute to the origination of polyploids. Nucleotide diversity (π of the DMC1 sequences in Elymus polyploid species (π = 0.02083 is higher than that in polyploid Hordeum (π = 0.01680, suggesting that the degree of relationships between two parents of a polyploid might be a factor

  14. A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

    Science.gov (United States)

    Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

    2008-08-01

    In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

  15. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  16. Genomic sequencing of Pleistocene cave bears

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Hofreiter, Michael; Smith, Doug; Priest, JamesR.; Rohland, Nadin; Rabeder, Gernot; Krause, Johannes; Detter, J. Chris; Paabo, Svante; Rubin, Edward M.

    2005-04-01

    Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome, the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.

  17. Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

    Science.gov (United States)

    Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

    2017-07-01

    The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

  18. Genome sequencing of idiopathic pulmonary fibrosis in conjunction with a medical school human anatomy course.

    Science.gov (United States)

    Kumar, Akash; Dougherty, Max; Findlay, Gregory M; Geisheker, Madeleine; Klein, Jason; Lazar, John; Machkovech, Heather; Resnick, Jesse; Resnick, Rebecca; Salter, Alexander I; Talebi-Liasi, Faezeh; Arakawa, Christopher; Baudin, Jacob; Bogaard, Andrew; Salesky, Rebecca; Zhou, Qian; Smith, Kelly; Clark, John I; Shendure, Jay; Horwitz, Marshall S

    2014-01-01

    Even in cases where there is no obvious family history of disease, genome sequencing may contribute to clinical diagnosis and management. Clinical application of the genome has not yet become routine, however, in part because physicians are still learning how best to utilize such information. As an educational research exercise performed in conjunction with our medical school human anatomy course, we explored the potential utility of determining the whole genome sequence of a patient who had died following a clinical diagnosis of idiopathic pulmonary fibrosis (IPF). Medical students performed dissection and whole genome sequencing of the cadaver. Gross and microscopic findings were more consistent with the fibrosing variant of nonspecific interstitial pneumonia (NSIP), as opposed to IPF per se. Variants in genes causing Mendelian disorders predisposing to IPF were not detected. However, whole genome sequencing identified several common variants associated with IPF, including a single nucleotide polymorphism (SNP), rs35705950, located in the promoter region of the gene encoding mucin glycoprotein MUC5B. The MUC5B promoter polymorphism was recently found to markedly elevate risk for IPF, though a particular association with NSIP has not been previously reported, nor has its contribution to disease risk previously been evaluated in the genome-wide context of all genetic variants. We did not identify additional predicted functional variants in a region of linkage disequilibrium (LD) adjacent to MUC5B, nor did we discover other likely risk-contributing variants elsewhere in the genome. Whole genome sequencing thus corroborates the association of rs35705950 with MUC5B dysregulation and interstitial lung disease. This novel exercise additionally served a unique mission in bridging clinical and basic science education.

  19. Genome sequencing of idiopathic pulmonary fibrosis in conjunction with a medical school human anatomy course.

    Directory of Open Access Journals (Sweden)

    Akash Kumar

    Full Text Available Even in cases where there is no obvious family history of disease, genome sequencing may contribute to clinical diagnosis and management. Clinical application of the genome has not yet become routine, however, in part because physicians are still learning how best to utilize such information. As an educational research exercise performed in conjunction with our medical school human anatomy course, we explored the potential utility of determining the whole genome sequence of a patient who had died following a clinical diagnosis of idiopathic pulmonary fibrosis (IPF. Medical students performed dissection and whole genome sequencing of the cadaver. Gross and microscopic findings were more consistent with the fibrosing variant of nonspecific interstitial pneumonia (NSIP, as opposed to IPF per se. Variants in genes causing Mendelian disorders predisposing to IPF were not detected. However, whole genome sequencing identified several common variants associated with IPF, including a single nucleotide polymorphism (SNP, rs35705950, located in the promoter region of the gene encoding mucin glycoprotein MUC5B. The MUC5B promoter polymorphism was recently found to markedly elevate risk for IPF, though a particular association with NSIP has not been previously reported, nor has its contribution to disease risk previously been evaluated in the genome-wide context of all genetic variants. We did not identify additional predicted functional variants in a region of linkage disequilibrium (LD adjacent to MUC5B, nor did we discover other likely risk-contributing variants elsewhere in the genome. Whole genome sequencing thus corroborates the association of rs35705950 with MUC5B dysregulation and interstitial lung disease. This novel exercise additionally served a unique mission in bridging clinical and basic science education.

  20. Complete genome sequence of a proposed new tymovirus, tomato blistering mosaic virus.

    Science.gov (United States)

    Nicolini, Cícero; Inoue-Nagata, Alice Kazuko; Nagata, Tatsuya

    2015-02-01

    In a previous work, a distinct tymovirus infecting tomato plants in Brazil was reported and tentatively named tomato blistering mosaic virus (ToBMV). In this study, the complete genome sequence of ToBMV was determined and shown to have a size of 6277 nucleotides and three ORFs: ORF 1 encodes the replication-complex polyprotein, ORF 2 the movement protein, and ORF 3 the coat protein. The cleavage sites of the replication-complex polyprotein (GS/LP and VAG/QSP) of ToBMV were predicted by alignment analysis of amino acid sequences of other tymoviruses. In the phylogenetic tree, ToBMV clustered with the tymoviruses that infect solanaceous hosts.

  1. An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

    Directory of Open Access Journals (Sweden)

    Herring Christopher D

    2007-08-01

    Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

  2. Genotyping-by-sequencing for Populus population genomics: an assessment of genome sampling patterns and filtering approaches.

    Directory of Open Access Journals (Sweden)

    Martin P Schilling

    Full Text Available Continuing advances in nucleotide sequencing technology are inspiring a suite of genomic approaches in studies of natural populations. Researchers are faced with data management and analytical scales that are increasing by orders of magnitude. With such dramatic advances comes a need to understand biases and error rates, which can be propagated and magnified in large-scale data acquisition and processing. Here we assess genomic sampling biases and the effects of various population-level data filtering strategies in a genotyping-by-sequencing (GBS protocol. We focus on data from two species of Populus, because this genus has a relatively small genome and is emerging as a target for population genomic studies. We estimate the proportions and patterns of genomic sampling by examining the Populus trichocarpa genome (Nisqually-1, and demonstrate a pronounced bias towards coding regions when using the methylation-sensitive ApeKI restriction enzyme in this species. Using population-level data from a closely related species (P. tremuloides, we also investigate various approaches for filtering GBS data to retain high-depth, informative SNPs that can be used for population genetic analyses. We find a data filter that includes the designation of ambiguous alleles resulted in metrics of population structure and Hardy-Weinberg equilibrium that were most consistent with previous studies of the same populations based on other genetic markers. Analyses of the filtered data (27,910 SNPs also resulted in patterns of heterozygosity and population structure similar to a previous study using microsatellites. Our application demonstrates that technically and analytically simple approaches can readily be developed for population genomics of natural populations.

  3. Second generation sequencing of the mesothelioma tumor genome.

    Directory of Open Access Journals (Sweden)

    Raphael Bueno

    2010-05-01

    Full Text Available The current paradigm for elucidating the molecular etiology of cancers relies on the interrogation of small numbers of genes, which limits the scope of investigation. Emerging second-generation massively parallel DNA sequencing technologies have enabled more precise definition of the cancer genome on a global scale. We examined the genome of a human primary malignant pleural mesothelioma (MPM tumor and matched normal tissue by using a combination of sequencing-by-synthesis and pyrosequencing methodologies to a 9.6X depth of coverage. Read density analysis uncovered significant aneuploidy and numerous rearrangements. Method-dependent informatics rules, which combined the results of different sequencing platforms, were developed to identify and validate candidate mutations of multiple types. Many more tumor-specific rearrangements than point mutations were uncovered at this depth of sequencing, resulting in novel, large-scale, inter- and intra-chromosomal deletions, inversions, and translocations. Nearly all candidate point mutations appeared to be previously unknown SNPs. Thirty tumor-specific fusions/translocations were independently validated with PCR and Sanger sequencing. Of these, 15 represented disrupted gene-encoding regions, including kinases, transcription factors, and growth factors. One large deletion in DPP10 resulted in altered transcription and expression of DPP10 transcripts in a set of 53 additional MPM tumors correlated with survival. Additionally, three point mutations were observed in the coding regions of NKX6-2, a transcription regulator, and NFRKB, a DNA-binding protein involved in modulating NFKB1. Several regions containing genes such as PCBD2 and DHFR, which are involved in growth factor signaling and nucleotide synthesis, respectively, were selectively amplified in the tumor. Second-generation sequencing uncovered all types of mutations in this MPM tumor, with DNA rearrangements representing the dominant type.

  4. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

    Science.gov (United States)

    Ali, Akhtar

    2017-01-12

    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  5. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959

  6. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.

  7. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’Haridon, Stéphane

    2018-01-17

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  8. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed

    2018-01-01

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  9. A new HCV genotype 6 subtype designated 6v was confirmed with three complete genome sequences.

    Science.gov (United States)

    Wang, Yizhong; Xia, Xueshan; Li, Chunhua; Maneekarn, Niwat; Xia, Wenjie; Zhao, Wenhua; Feng, Yue; Kung, Hsiang Fu; Fu, Yongshui; Lu, Ling

    2009-03-01

    Although hepatitis C virus (HCV) genotype 6 is classified into 21 subtypes, 6a-6u, new variants continue to be identified. To characterize the full-length genomes of three novel HCV genotype 6 variants: KMN02, KM046 and KM181. From sera of patients with HCV infection, the entire HCV genome was amplified by RT-PCR followed by direct DNA sequencing and phylogenetic analysis. The sera contained HCV genomes of 9461, 9429, and 9461nt in length, and each harboured a single ORF of 9051nt. The genomes showed 95.3-98.1% nucleotide similarity to each other and 72.2-75.4% similarity to 23 genotype 6 reference sequences, which represent subtypes 6a-6u and unassigned variants km41 and gz52557. Phylogenetic analyses demonstrated that they were genotype 6, but were subtypically distinct. Based on the current criteria of HCV classification, they were designed to represent a new subtype, 6v. Analysis of E1 and NS5B region partial sequences revealed two additional related variants, CMBD-14 and CMBD-86 that had been previously reported in northern Thailand and sequences dropped into Genbank. Three novel HCV genotype 6 variants were entirely sequenced and designated subtype 6v.

  10. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  11. Automated typing of red blood cell and platelet antigens: a whole-genome sequencing study.

    Science.gov (United States)

    Lane, William J; Westhoff, Connie M; Gleadall, Nicholas S; Aguad, Maria; Smeland-Wagman, Robin; Vege, Sunitha; Simmons, Daimon P; Mah, Helen H; Lebo, Matthew S; Walter, Klaudia; Soranzo, Nicole; Di Angelantonio, Emanuele; Danesh, John; Roberts, David J; Watkins, Nick A; Ouwehand, Willem H; Butterworth, Adam S; Kaufman, Richard M; Rehm, Heidi L; Silberstein, Leslie E; Green, Robert C

    2018-06-01

    There are more than 300 known red blood cell (RBC) antigens and 33 platelet antigens that differ between individuals. Sensitisation to antigens is a serious complication that can occur in prenatal medicine and after blood transfusion, particularly for patients who require multiple transfusions. Although pre-transfusion compatibility testing largely relies on serological methods, reagents are not available for many antigens. Methods based on single-nucleotide polymorphism (SNP) arrays have been used, but typing for ABO and Rh-the most important blood groups-cannot be done with SNP typing alone. We aimed to develop a novel method based on whole-genome sequencing to identify RBC and platelet antigens. This whole-genome sequencing study is a subanalysis of data from patients in the whole-genome sequencing arm of the MedSeq Project randomised controlled trial (NCT01736566) with no measured patient outcomes. We created a database of molecular changes in RBC and platelet antigens and developed an automated antigen-typing algorithm based on whole-genome sequencing (bloodTyper). This algorithm was iteratively improved to address cis-trans haplotype ambiguities and homologous gene alignments. Whole-genome sequencing data from 110 MedSeq participants (30 × depth) were used to initially validate bloodTyper through comparison with conventional serology and SNP methods for typing of 38 RBC antigens in 12 blood-group systems and 22 human platelet antigens. bloodTyper was further validated with whole-genome sequencing data from 200 INTERVAL trial participants (15 × depth) with serological comparisons. We iteratively improved bloodTyper by comparing its typing results with conventional serological and SNP typing in three rounds of testing. The initial whole-genome sequencing typing algorithm was 99·5% concordant across the first 20 MedSeq genomes. Addressing discordances led to development of an improved algorithm that was 99·8% concordant for the remaining 90 Med

  12. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  13. Snake Genome Sequencing: Results and Future Prospects.

    Science.gov (United States)

    Kerkkamp, Harald M I; Kini, R Manjunatha; Pospelov, Alexey S; Vonk, Freek J; Henkel, Christiaan V; Richardson, Michael K

    2016-12-01

    Snake genome sequencing is in its infancy-very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  14. Snake Genome Sequencing: Results and Future Prospects

    Directory of Open Access Journals (Sweden)

    Harald M. I. Kerkkamp

    2016-12-01

    Full Text Available Snake genome sequencing is in its infancy—very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  15. Plantagora: modeling whole genome sequencing and assembly of plant genomes.

    Directory of Open Access Journals (Sweden)

    Roger Barthelson

    Full Text Available BACKGROUND: Genomics studies are being revolutionized by the next generation sequencing technologies, which have made whole genome sequencing much more accessible to the average researcher. Whole genome sequencing with the new technologies is a developing art that, despite the large volumes of data that can be produced, may still fail to provide a clear and thorough map of a genome. The Plantagora project was conceived to address specifically the gap between having the technical tools for genome sequencing and knowing precisely the best way to use them. METHODOLOGY/PRINCIPAL FINDINGS: For Plantagora, a platform was created for generating simulated reads from several different plant genomes of different sizes. The resulting read files mimicked either 454 or Illumina reads, with varying paired end spacing. Thousands of datasets of reads were created, most derived from our primary model genome, rice chromosome one. All reads were assembled with different software assemblers, including Newbler, Abyss, and SOAPdenovo, and the resulting assemblies were evaluated by an extensive battery of metrics chosen for these studies. The metrics included both statistics of the assembly sequences and fidelity-related measures derived by alignment of the assemblies to the original genome source for the reads. The results were presented in a website, which includes a data graphing tool, all created to help the user compare rapidly the feasibility and effectiveness of different sequencing and assembly strategies prior to testing an approach in the lab. Some of our own conclusions regarding the different strategies were also recorded on the website. CONCLUSIONS/SIGNIFICANCE: Plantagora provides a substantial body of information for comparing different approaches to sequencing a plant genome, and some conclusions regarding some of the specific approaches. Plantagora also provides a platform of metrics and tools for studying the process of sequencing and assembly

  16. Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

    Science.gov (United States)

    Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

    2018-05-29

    Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

  17. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  18. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  19. Salmonella enterica Prophage Sequence Profiles Reflect Genome Diversity and Can Be Used for High Discrimination Subtyping

    Directory of Open Access Journals (Sweden)

    Walid Mottawea

    2018-05-01

    Full Text Available Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella. In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S. Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.

  20. Comparing whole-genome sequencing with Sanger sequencing for spa typing of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik

    2014-12-01

    spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  2. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  3. The Genome Sequence of the psychrophilic archaeon, Methanococcoides burtonii: the Role of Genome Evolution in Cold-adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Michelle A.; Lauro, Federico M.; Williams, Timothy J.; Burg, Dominic; Siddiqui, Khawar S.; De Francisci, David; Chong, Kevin W.Y.; Pilak, Oliver; Chew, Hwee H.; De Maere, Matthew Z.; Ting, Lily; Katrib, Marilyn; Ng, Charmaine; Sowers, Kevin R.; Galperin, Michael Y.; Anderson, Iain J.; Ivanova, Natalia; Dalin, Eileen; Martinez, Michelle; Lapidus, Alla; Hauser, Loren; Land, Miriam; Thomas, Torsten; Cavicchioli, Ricardo

    2009-04-01

    Psychrophilic archaea are abundant and perform critical roles throughout the Earth's expansive cold biosphere. Here we report the first complete genome sequence for a psychrophilic methanogenic archaeon, Methanococcoides burtonii. The genome sequence was manually annotated including the use of a five tiered Evidence Rating system that ranked annotations from Evidence Rating (ER) 1 (gene product experimentally characterized from the parent organism) to ER5 (hypothetical gene product) to provide a rapid means of assessing the certainty of gene function predictions. The genome is characterized by a higher level of aberrant sequence composition (51%) than any other archaeon. In comparison to hyper/thermophilic archaea which are subject to selection of synonymous codon usage, M. burtonii has evolved cold adaptation through a genomic capacity to accommodate highly skewed amino acid content, while retaining codon usage in common with its mesophilic Methanosarcina cousins. Polysaccharide biosynthesis genes comprise at least 3.3% of protein coding genes in the genome, and Cell wall/membrane/envelope biogenesis COG genes are over-represented. Likewise, signal transduction (COG category T) genes are over-represented and M. burtonii has a high 'IQ' (a measure of adaptive potential) compared to many methanogens. Numerous genes in these two over-represented COG categories appear to have been acquired from {var_epsilon}- and {delta}-proteobacteria, as do specific genes involved in central metabolism such as a novel B form of aconitase. Transposases also distinguish M. burtonii from other archaea, and their genomic characteristics indicate they play an important role in evolving the M. burtonii genome. Our study reveals a capacity for this model psychrophile to evolve through genome plasticity (including nucleotide skew, horizontal gene transfer and transposase activity) that enables adaptation to the cold, and to the biological and physical changes that have

  4. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  5. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Alexander C Outhred

    Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.

  6. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  7. Draft Genome Sequence of a Clostridium botulinum Isolate from Water Used for Cooling at a Plant Producing Low-Acid Canned Foods.

    Science.gov (United States)

    Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W; Zink, Donald; Sharma, Shashi K

    2013-01-01

    Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C. botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C. botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.

  8. Draft Genome Sequence of a Clostridium botulinum Isolate from Water Used for Cooling at a Plant Producing Low-Acid Canned Foods

    OpenAIRE

    Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W.; Zink, Donald; Sharma, Shashi K.

    2013-01-01

    Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C.?botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C.?botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.

  9. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

    Science.gov (United States)

    Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

  10. Alignment of whole genomes.

    Science.gov (United States)

    Delcher, A L; Kasif, S; Fleischmann, R D; Peterson, J; White, O; Salzberg, S L

    1999-01-01

    A new system for aligning whole genome sequences is described. Using an efficient data structure called a suffix tree, the system is able to rapidly align sequences containing millions of nucleotides. Its use is demonstrated on two strains of Mycoplasma tuberculosis, on two less similar species of Mycoplasma bacteria and on two syntenic sequences from human chromosome 12 and mouse chromosome 6. In each case it found an alignment of the input sequences, using between 30 s and 2 min of computation time. From the system output, information on single nucleotide changes, translocations and homologous genes can easily be extracted. Use of the algorithm should facilitate analysis of syntenic chromosomal regions, strain-to-strain comparisons, evolutionary comparisons and genomic duplications. PMID:10325427

  11. Complete mitochondrial genome sequences of three bats species and whole genome mitochondrial analyses reveal patterns of codon bias and lend support to a basal split in Chiroptera.

    Science.gov (United States)

    Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A

    2012-01-15

    Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  13. Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections.

    Science.gov (United States)

    Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J

    2016-05-12

    In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P 10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

  14. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  15. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  16. Development of Genome-Wide SSR Markers from Angelica gigas Nakai Using Next Generation Sequencing.

    Science.gov (United States)

    Gil, Jinsu; Um, Yurry; Kim, Serim; Kim, Ok Tae; Koo, Sung Cheol; Reddy, Chinreddy Subramanyam; Kim, Seong-Cheol; Hong, Chang Pyo; Park, Sin-Gi; Kim, Ho Bang; Lee, Dong Hoon; Jeong, Byung-Hoon; Chung, Jong-Wook; Lee, Yi

    2017-09-21

    Angelica gigas Nakai is an important medicinal herb, widely utilized in Asian countries especially in Korea, Japan, and China. Although it is a vital medicinal herb, the lack of sequencing data and efficient molecular markers has limited the application of a genetic approach for horticultural improvements. Simple sequence repeats (SSRs) are universally accepted molecular markers for population structure study. In this study, we found over 130,000 SSRs, ranging from di- to deca-nucleotide motifs, using the genome sequence of Manchu variety (MV) of A. gigas, derived from next generation sequencing (NGS). From the putative SSR regions identified, a total of 16,496 primer sets were successfully designed. Among them, we selected 848 SSR markers that showed polymorphism from in silico analysis and contained tri- to hexa-nucleotide motifs. We tested 36 SSR primer sets for polymorphism in 16 A. gigas accessions. The average polymorphism information content (PIC) was 0.69; the average observed heterozygosity ( H O ) values, and the expected heterozygosity ( H E ) values were 0.53 and 0.73, respectively. These newly developed SSR markers would be useful tools for molecular genetics, genotype identification, genetic mapping, molecular breeding, and studying species relationships of the Angelica genus.

  17. [Complete genome sequencing and sequence analysis of BCG Tice].

    Science.gov (United States)

    Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

    2012-10-04

    The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

  18. Whole-Genome Sequencing and Comparative Genome Analysis of Bacillus subtilis Strains Isolated from Non-Salted Fermented Soybean Foods.

    Directory of Open Access Journals (Sweden)

    Mayumi Kamada

    Full Text Available Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA, we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from "Tua Nao" of Thailand traces a different evolutionary process from other strains.

  19. Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

    Science.gov (United States)

    Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

    2013-01-01

    Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

  20. Rainbow: a tool for large-scale whole-genome sequencing data analysis using cloud computing.

    Science.gov (United States)

    Zhao, Shanrong; Prenger, Kurt; Smith, Lance; Messina, Thomas; Fan, Hongtao; Jaeger, Edward; Stephens, Susan

    2013-06-27

    Technical improvements have decreased sequencing costs and, as a result, the size and number of genomic datasets have increased rapidly. Because of the lower cost, large amounts of sequence data are now being produced by small to midsize research groups. Crossbow is a software tool that can detect single nucleotide polymorphisms (SNPs) in whole-genome sequencing (WGS) data from a single subject; however, Crossbow has a number of limitations when applied to multiple subjects from large-scale WGS projects. The data storage and CPU resources that are required for large-scale whole genome sequencing data analyses are too large for many core facilities and individual laboratories to provide. To help meet these challenges, we have developed Rainbow, a cloud-based software package that can assist in the automation of large-scale WGS data analyses. Here, we evaluated the performance of Rainbow by analyzing 44 different whole-genome-sequenced subjects. Rainbow has the capacity to process genomic data from more than 500 subjects in two weeks using cloud computing provided by the Amazon Web Service. The time includes the import and export of the data using Amazon Import/Export service. The average cost of processing a single sample in the cloud was less than 120 US dollars. Compared with Crossbow, the main improvements incorporated into Rainbow include the ability: (1) to handle BAM as well as FASTQ input files; (2) to split large sequence files for better load balance downstream; (3) to log the running metrics in data processing and monitoring multiple Amazon Elastic Compute Cloud (EC2) instances; and (4) to merge SOAPsnp outputs for multiple individuals into a single file to facilitate downstream genome-wide association studies. Rainbow is a scalable, cost-effective, and open-source tool for large-scale WGS data analysis. For human WGS data sequenced by either the Illumina HiSeq 2000 or HiSeq 2500 platforms, Rainbow can be used straight out of the box. Rainbow is available

  1. Genomic sequence, organization and characteristics of a new nucleopolyhedrovirus isolated from Clanis bilineata larva

    Directory of Open Access Journals (Sweden)

    Wang Yong

    2009-02-01

    Full Text Available Abstract Background Baculoviruses are well known for their potential as biological agents for controlling agricultural and forest pests. They are also widely used as expression vectors in molecular cloning studies. The genome sequences of 48 baculoviruses are currently available in NCBI databases. As the number of sequenced viral genomes increases, it is important for the authors to present sufficiently detailed analyses and annotations to advance understanding of them. In this study, the complete genome of Clanis bilineata nucleopolyhedrovirus (ClbiNPV has been sequenced and analyzed in order to understand this virus better. Results The genome of ClbiNPV contains 135,454 base pairs (bp with a G+C content of 37%, and 139 putative open reading frames (ORFs of at least 150 nucleotides. One hundred and twenty-six of these ORFs have homologues with other baculovirus genes while the other 13 are unique to ClbiNPV. The 30 baculovirus core genes are all present in ClbiNPV. Phylogenetic analysis based on the combined pif-2 and lef-8 sequences places ClbiNPV in the Group II Alphabaculoviruses. This result is consistent with the absence of gp64 from the ClbiNPV genome and the presence instead of a fusion protein gene, characteristic of Group II. Blast searches revealed that ClbiNPV encodes a photolyase-like gene sequence, which has a 1-bp deletion when compared with photolyases of other baculoviruses. This deletion disrupts the sequence into two small photolyase ORFs, designated Clbiphr-1 and Clbiphr-2, which correspond to the CPD-DNA photolyase and FAD-binding domains of photolyases, respectively. Conclusion ClbiNPV belongs to the Group II Alphabaculoviruses and is most closely related to OrleNPV, LdMNPV, TnSNPV, EcobNPV and ChchNPV. It contains a variant DNA photolyase gene, which only exists in ChchNPV, TnSNPV and SpltGV among the baculoviruses.

  2. Complete plastid genome sequence of Daucus carota: implications for biotechnology and phylogeny of angiosperms.

    Science.gov (United States)

    Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry

    2006-08-31

    Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These

  3. Complete plastid genome sequence of Daucus carota: Implications for biotechnology and phylogeny of angiosperms

    Directory of Open Access Journals (Sweden)

    Ruhlman Tracey

    2006-08-01

    Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of

  4. Construction of a virtual Mycobacterium tuberculosis consensus genome and its application to data from a next generation sequencer.

    Science.gov (United States)

    Okumura, Kayo; Kato, Masako; Kirikae, Teruo; Kayano, Mitsunori; Miyoshi-Akiyama, Tohru

    2015-03-20

    Although Mycobacterium tuberculosis isolates are consisted of several different lineages and the epidemiology analyses are usually assessed relative to a particular reference genome, M. tuberculosis H37Rv, which might introduce some biased results. Those analyses are essentially based genome sequence information of M. tuberculosis and could be performed in sillico in theory, with whole genome sequence (WGS) data available in the databases and obtained by next generation sequencers (NGSs). As an approach to establish higher resolution methods for such analyses, whole genome sequences of the M. tuberculosis complexes (MTBCs) strains available on databases were aligned to construct virtual reference genome sequences called the consensus sequence (CS), and evaluated its feasibility in in sillico epidemiological analyses. The consensus sequence (CS) was successfully constructed and utilized to perform phylogenetic analysis, evaluation of read mapping efficacy, which is crucial for detecting single nucleotide polymorphisms (SNPs), and various MTBC typing methods virtually including spoligotyping, VNTR, Long sequence polymorphism and Beijing typing. SNPs detected based on CS, in comparison with H37Rv, were utilized in concatemer-based phylogenetic analysis to determine their reliability relative to a phylogenetic tree based on whole genome alignment as the gold standard. Statistical comparison of phylogenic trees based on CS with that of H37Rv indicated the former showed always better results that that of later. SNP detection and concatenation with CS was advantageous because the frequency of crucial SNPs distinguishing among strain lineages was higher than those of H37Rv. The number of SNPs detected was lower with the consensus than with the H37Rv sequence, resulting in a significant reduction in computational time. Performance of each virtual typing was satisfactory and accorded with those published when those are available. These results indicated that virtual CS

  5. Genomic insight into the common carp (Cyprinus carpio genome by sequencing analysis of BAC-end sequences

    Directory of Open Access Journals (Sweden)

    Wang Jintu

    2011-04-01

    Full Text Available Abstract Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio, a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3

  6. Genomic insight into the common carp (Cyprinus carpio) genome by sequencing analysis of BAC-end sequences

    Science.gov (United States)

    2011-01-01

    Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio), a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3,100 microsyntenies, covering over 50% of

  7. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  8. Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nouri, Shahideh; Salem, Nid?; Falk, Bryce W.

    2016-01-01

    We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus.

  9. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  10. Complete genome sequence of the biofilm-forming Microbacterium sp. strain BH-3-3-3, isolated from conventional field-grown lettuce (Lactuca sativa) in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2017-03-01

    The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.

  11. Using whole-genome sequence data to predict quantitative trait phenotypes in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Ulrike Ober

    Full Text Available Predicting organismal phenotypes from genotype data is important for plant and animal breeding, medicine, and evolutionary biology. Genomic-based phenotype prediction has been applied for single-nucleotide polymorphism (SNP genotyping platforms, but not using complete genome sequences. Here, we report genomic prediction for starvation stress resistance and startle response in Drosophila melanogaster, using ∼2.5 million SNPs determined by sequencing the Drosophila Genetic Reference Panel population of inbred lines. We constructed a genomic relationship matrix from the SNP data and used it in a genomic best linear unbiased prediction (GBLUP model. We assessed predictive ability as the correlation between predicted genetic values and observed phenotypes by cross-validation, and found a predictive ability of 0.239±0.008 (0.230±0.012 for starvation resistance (startle response. The predictive ability of BayesB, a Bayesian method with internal SNP selection, was not greater than GBLUP. Selection of the 5% SNPs with either the highest absolute effect or variance explained did not improve predictive ability. Predictive ability decreased only when fewer than 150,000 SNPs were used to construct the genomic relationship matrix. We hypothesize that predictive power in this population stems from the SNP-based modeling of the subtle relationship structure caused by long-range linkage disequilibrium and not from population structure or SNPs in linkage disequilibrium with causal variants. We discuss the implications of these results for genomic prediction in other organisms.

  12. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  13. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis.

    Science.gov (United States)

    Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming

    2016-08-05

    Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis

  14. Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

    Directory of Open Access Journals (Sweden)

    Rodrigo Pessôa

    Full Text Available BACKGROUND: Here, we report on the partial and full-length genomic (FLG variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs, 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP and 7 adult T-cell leukemia/lymphoma (ATLL patients, using an Illumina paired-end protocol. METHODS: Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. RESULTS: A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14 and FLG (n = 76 data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5% individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA and that 4 individuals (4.5% were infected with the Japanese sub-subtypes (aB. A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. CONCLUSIONS: This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data

  15. Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

    Science.gov (United States)

    Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

    2014-01-01

    Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the

  16. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  17. Overlapping Genomic Sequences: A Treasure Trove of Single-Nucleotide Polymorphisms

    Science.gov (United States)

    Taillon-Miller, Patricia; Gu, Zhijie; Li, Qun; Hillier, LaDeana; Kwok, Pui-Yan

    1998-01-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21–7q22, and 13q12–13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations. [The sequence data described in this paper have been submitted to the GenBank data library under accession nos. AC003015 (for GS113423), AC002380 (GS330J10), AC000066 (RG293F11), AC003086 (RG104F04), AC002525 (257C22A), and U73331 (96A18A).] PMID:9685323

  18. The complete genome sequence of a south Indian isolate of Rice tungro spherical virus reveals evidence of genetic recombination between distinct isolates.

    Science.gov (United States)

    Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K

    2013-12-01

    In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.

  19. Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

    Science.gov (United States)

    Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

    2013-01-01

    Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal

  20. Insights from 20 years of bacterial genome sequencing

    DEFF Research Database (Denmark)

    Land, Miriam; Hauser, Loren; Jun, Se-Ran

    2015-01-01

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along...... the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative...... genomics has produced. To date, there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling...

  1. Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep

    Science.gov (United States)

    Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen

    1998-01-01

    The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID

  2. Genome-wide-analyses of Listeria monocytogenes from food-processing plants reveal clonal diversity and date the emergence of persisting sequence types.

    Science.gov (United States)

    Knudsen, Gitte M; Nielsen, Jesper Boye; Marvig, Rasmus L; Ng, Yin; Worning, Peder; Westh, Henrik; Gram, Lone

    2017-08-01

    Whole genome sequencing is increasing used in epidemiology, e.g. for tracing outbreaks of food-borne diseases. This requires in-depth understanding of pathogen emergence, persistence and genomic diversity along the food production chain including in food processing plants. We sequenced the genomes of 80 isolates of Listeria monocytogenes sampled from Danish food processing plants over a time-period of 20 years, and analysed the sequences together with 10 public available reference genomes to advance our understanding of interplant and intraplant genomic diversity of L. monocytogenes. Except for three persisting sequence types (ST) based on Multi Locus Sequence Typing being ST7, ST8 and ST121, long-term persistence of clonal groups was limited, and new clones were introduced continuously, potentially from raw materials. No particular gene could be linked to the persistence phenotype. Using time-based phylogenetic analyses of the persistent STs, we estimate the L. monocytogenes evolutionary rate to be 0.18-0.35 single nucleotide polymorphisms/year, suggesting that the persistent STs emerged approximately 100 years ago, which correlates with the onset of industrialization and globalization of the food market. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  4. Whole-genome sequences of DA and F344 rats with different susceptibilities to arthritis, autoimmunity, inflammation and cancer.

    Science.gov (United States)

    Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S

    2013-08-01

    DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease.

  5. Whole-Genome Sequences of DA and F344 Rats with Different Susceptibilities to Arthritis, Autoimmunity, Inflammation and Cancer

    Science.gov (United States)

    Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A.; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S.

    2013-01-01

    DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease. PMID:23695301

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Whole-genome sequencing of multiple myeloma from diagnosis to plasma cell leukemia reveals genomic initiating events, evolution, and clonal tides.

    Science.gov (United States)

    Egan, Jan B; Shi, Chang-Xin; Tembe, Waibhav; Christoforides, Alexis; Kurdoglu, Ahmet; Sinari, Shripad; Middha, Sumit; Asmann, Yan; Schmidt, Jessica; Braggio, Esteban; Keats, Jonathan J; Fonseca, Rafael; Bergsagel, P Leif; Craig, David W; Carpten, John D; Stewart, A Keith

    2012-08-02

    The longitudinal evolution of a myeloma genome from diagnosis to plasma cell leukemia has not previously been reported. We used whole-genome sequencing (WGS) on 4 purified tumor samples and patient germline DNA drawn over a 5-year period in a t(4;14) multiple myeloma patient. Tumor samples were acquired at diagnosis, first relapse, second relapse, and end-stage secondary plasma cell leukemia (sPCL). In addition to the t(4;14), all tumor time points also shared 10 common single-nucleotide variants (SNVs) on WGS comprising shared initiating events. Interestingly, we observed genomic sequence variants that waxed and waned with time in progressive tumors, suggesting the presence of multiple independent, yet related, clones at diagnosis that rose and fell in dominance. Five newly acquired SNVs, including truncating mutations of RB1 and ZKSCAN3, were observed only in the final sPCL sample suggesting leukemic transformation events. This longitudinal WGS characterization of the natural history of a high-risk myeloma patient demonstrated tumor heterogeneity at diagnosis with shifting dominance of tumor clones over time and has also identified potential mutations contributing to myelomagenesis as well as transformation from myeloma to overt extramedullary disease such as sPCL.

  8. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  9. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  10. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  11. Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nouri, Shahideh; Salem, Nidà; Falk, Bryce W

    2016-07-21

    We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.

  12. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  13. Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum and Comparative Analysis with Common Buckwheat (F. esculentum.

    Directory of Open Access Journals (Sweden)

    Kwang-Soo Cho

    Full Text Available We report the chloroplast (cp genome sequence of tartary buckwheat (Fagopyrum tataricum obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats and F. esculentum (one repeat, and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes--rpoC2, ycf3, accD, and clpP--have high synonymous (Ks value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum.

  14. Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis

    Directory of Open Access Journals (Sweden)

    Stougaard Magnus

    2007-11-01

    Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as

  15. Validation of rice genome sequence by optical mapping

    Directory of Open Access Journals (Sweden)

    Pape Louise

    2007-08-01

    Full Text Available Abstract Background Rice feeds much of the world, and possesses the simplest genome analyzed to date within the grass family, making it an economically relevant model system for other cereal crops. Although the rice genome is sequenced, validation and gap closing efforts require purely independent means for accurate finishing of sequence build data. Results To facilitate ongoing sequencing finishing and validation efforts, we have constructed a whole-genome SwaI optical restriction map of the rice genome. The physical map consists of 14 contigs, covering 12 chromosomes, with a total genome size of 382.17 Mb; this value is about 11% smaller than original estimates. 9 of the 14 optical map contigs are without gaps, covering chromosomes 1, 2, 3, 4, 5, 7, 8 10, and 12 in their entirety – including centromeres and telomeres. Alignments between optical and in silico restriction maps constructed from IRGSP (International Rice Genome Sequencing Project and TIGR (The Institute for Genomic Research genome sequence sources are comprehensive and informative, evidenced by map coverage across virtually all published gaps, discovery of new ones, and characterization of sequence misassemblies; all totalling ~14 Mb. Furthermore, since optical maps are ordered restriction maps, identified discordances are pinpointed on a reliable physical scaffold providing an independent resource for closure of gaps and rectification of misassemblies. Conclusion Analysis of sequence and optical mapping data effectively validates genome sequence assemblies constructed from large, repeat-rich genomes. Given this conclusion we envision new applications of such single molecule analysis that will merge advantages offered by high-resolution optical maps with inexpensive, but short sequence reads generated by emerging sequencing platforms. Lastly, map construction techniques presented here points the way to new types of comparative genome analysis that would focus on discernment of

  16. DNA sequence explains seemingly disordered methylation levels in partially methylated domains of Mammalian genomes.

    Directory of Open Access Journals (Sweden)

    Dimos Gaidatzis

    2014-02-01

    Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.

  17. Human Ro60 (SSA2) genomic organization and sequence alterations, examined in cutaneous lupus erythematosus.

    Science.gov (United States)

    Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A

    2002-02-01

    The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.

  18. Accurate estimation of short read mapping quality for next-generation genome sequencing

    Science.gov (United States)

    Ruffalo, Matthew; Koyutürk, Mehmet; Ray, Soumya; LaFramboise, Thomas

    2012-01-01

    Motivation: Several software tools specialize in the alignment of short next-generation sequencing reads to a reference sequence. Some of these tools report a mapping quality score for each alignment—in principle, this quality score tells researchers the likelihood that the alignment is correct. However, the reported mapping quality often correlates weakly with actual accuracy and the qualities of many mappings are underestimated, encouraging the researchers to discard correct mappings. Further, these low-quality mappings tend to correlate with variations in the genome (both single nucleotide and structural), and such mappings are important in accurately identifying genomic variants. Approach: We develop a machine learning tool, LoQuM (LOgistic regression tool for calibrating the Quality of short read mappings, to assign reliable mapping quality scores to mappings of Illumina reads returned by any alignment tool. LoQuM uses statistics on the read (base quality scores reported by the sequencer) and the alignment (number of matches, mismatches and deletions, mapping quality score returned by the alignment tool, if available, and number of mappings) as features for classification and uses simulated reads to learn a logistic regression model that relates these features to actual mapping quality. Results: We test the predictions of LoQuM on an independent dataset generated by the ART short read simulation software and observe that LoQuM can ‘resurrect’ many mappings that are assigned zero quality scores by the alignment tools and are therefore likely to be discarded by researchers. We also observe that the recalibration of mapping quality scores greatly enhances the precision of called single nucleotide polymorphisms. Availability: LoQuM is available as open source at http://compbio.case.edu/loqum/. Contact: matthew.ruffalo@case.edu. PMID:22962451

  19. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  20. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  1. Harnessing Whole Genome Sequencing in Medical Mycology.

    Science.gov (United States)

    Cuomo, Christina A

    2017-01-01

    Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

  2. Quantitative trait loci markers derived from whole genome sequence data increases the reliability of genomic prediction

    DEFF Research Database (Denmark)

    Brøndum, Rasmus Froberg; Su, Guosheng; Janss, Luc

    2015-01-01

    This study investigated the effect on the reliability of genomic prediction when a small number of significant variants from single marker analysis based on whole genome sequence data were added to the regular 54k single nucleotide polymorphism (SNP) array data. The extra markers were selected...... with the aim of augmenting the custom low-density Illumina BovineLD SNP chip (San Diego, CA) used in the Nordic countries. The single-marker analysis was done breed-wise on all 16 index traits included in the breeding goals for Nordic Holstein, Danish Jersey, and Nordic Red cattle plus the total merit index...... itself. Depending on the trait’s economic weight, 15, 10, or 5 quantitative trait loci (QTL) were selected per trait per breed and 3 to 5 markers were selected to tag each QTL. After removing duplicate markers (same marker selected for more than one trait or breed) and filtering for high pairwise linkage...

  3. Genomic Sequence Variation Markup Language (GSVML).

    Science.gov (United States)

    Nakaya, Jun; Kimura, Michio; Hiroi, Kaei; Ido, Keisuke; Yang, Woosung; Tanaka, Hiroshi

    2010-02-01

    With the aim of making good use of internationally accumulated genomic sequence variation data, which is increasing rapidly due to the explosive amount of genomic research at present, the development of an interoperable data exchange format and its international standardization are necessary. Genomic Sequence Variation Markup Language (GSVML) will focus on genomic sequence variation data and human health applications, such as gene based medicine or pharmacogenomics. We developed GSVML through eight steps, based on case analysis and domain investigations. By focusing on the design scope to human health applications and genomic sequence variation, we attempted to eliminate ambiguity and to ensure practicability. We intended to satisfy the requirements derived from the use case analysis of human-based clinical genomic applications. Based on database investigations, we attempted to minimize the redundancy of the data format, while maximizing the data covering range. We also attempted to ensure communication and interface ability with other Markup Languages, for exchange of omics data among various omics researchers or facilities. The interface ability with developing clinical standards, such as the Health Level Seven Genotype Information model, was analyzed. We developed the human health-oriented GSVML comprising variation data, direct annotation, and indirect annotation categories; the variation data category is required, while the direct and indirect annotation categories are optional. The annotation categories contain omics and clinical information, and have internal relationships. For designing, we examined 6 cases for three criteria as human health application and 15 data elements for three criteria as data formats for genomic sequence variation data exchange. The data format of five international SNP databases and six Markup Languages and the interface ability to the Health Level Seven Genotype Model in terms of 317 items were investigated. GSVML was developed as

  4. High-coverage sequencing and annotated assembly of the genome of the Australian dragon lizard Pogona vitticeps.

    Science.gov (United States)

    Georges, Arthur; Li, Qiye; Lian, Jinmin; O'Meally, Denis; Deakin, Janine; Wang, Zongji; Zhang, Pei; Fujita, Matthew; Patel, Hardip R; Holleley, Clare E; Zhou, Yang; Zhang, Xiuwen; Matsubara, Kazumi; Waters, Paul; Graves, Jennifer A Marshall; Sarre, Stephen D; Zhang, Guojie

    2015-01-01

    The lizards of the family Agamidae are one of the most prominent elements of the Australian reptile fauna. Here, we present a genomic resource built on the basis of a wild-caught male ZZ central bearded dragon Pogona vitticeps. The genomic sequence for P. vitticeps, generated on the Illumina HiSeq 2000 platform, comprised 317 Gbp (179X raw read depth) from 13 insert libraries ranging from 250 bp to 40 kbp. After filtering for low-quality and duplicated reads, 146 Gbp of data (83X) was available for assembly. Exceptionally high levels of heterozygosity (0.85 % of single nucleotide polymorphisms plus sequence insertions or deletions) complicated assembly; nevertheless, 96.4 % of reads mapped back to the assembled scaffolds, indicating that the assembly included most of the sequenced genome. Length of the assembly was 1.8 Gbp in 545,310 scaffolds (69,852 longer than 300 bp), the longest being 14.68 Mbp. N50 was 2.29 Mbp. Genes were annotated on the basis of de novo prediction, similarity to the green anole Anolis carolinensis, Gallus gallus and Homo sapiens proteins, and P. vitticeps transcriptome sequence assemblies, to yield 19,406 protein-coding genes in the assembly, 63 % of which had intact open reading frames. Our assembly captured 99 % (246 of 248) of core CEGMA genes, with 93 % (231) being complete. The quality of the P. vitticeps assembly is comparable or superior to that of other published squamate genomes, and the annotated P. vitticeps genome can be accessed through a genome browser available at https://genomics.canberra.edu.au.

  5. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  6. Approaches for in silico finishing of microbial genome sequences

    Directory of Open Access Journals (Sweden)

    Frederico Schmitt Kremer

    Full Text Available Abstract The introduction of next-generation sequencing (NGS had a significant effect on the availability of genomic information, leading to an increase in the number of sequenced genomes from a large spectrum of organisms. Unfortunately, due to the limitations implied by the short-read sequencing platforms, most of these newly sequenced genomes remained as “drafts”, incomplete representations of the whole genetic content. The previous genome sequencing studies indicated that finishing a genome sequenced by NGS, even bacteria, may require additional sequencing to fill the gaps, making the entire process very expensive. As such, several in silico approaches have been developed to optimize the genome assemblies and facilitate the finishing process. The present review aims to explore some free (open source, in many cases tools that are available to facilitate genome finishing.

  7. Approaches for in silico finishing of microbial genome sequences.

    Science.gov (United States)

    Kremer, Frederico Schmitt; McBride, Alan John Alexander; Pinto, Luciano da Silva

    The introduction of next-generation sequencing (NGS) had a significant effect on the availability of genomic information, leading to an increase in the number of sequenced genomes from a large spectrum of organisms. Unfortunately, due to the limitations implied by the short-read sequencing platforms, most of these newly sequenced genomes remained as "drafts", incomplete representations of the whole genetic content. The previous genome sequencing studies indicated that finishing a genome sequenced by NGS, even bacteria, may require additional sequencing to fill the gaps, making the entire process very expensive. As such, several in silico approaches have been developed to optimize the genome assemblies and facilitate the finishing process. The present review aims to explore some free (open source, in many cases) tools that are available to facilitate genome finishing.

  8. A plant pathology perspective of fungal genome sequencing.

    Science.gov (United States)

    Aylward, Janneke; Steenkamp, Emma T; Dreyer, Léanne L; Roets, Francois; Wingfield, Brenda D; Wingfield, Michael J

    2017-06-01

    The majority of plant pathogens are fungi and many of these adversely affect food security. This mini-review aims to provide an analysis of the plant pathogenic fungi for which genome sequences are publically available, to assess their general genome characteristics, and to consider how genomics has impacted plant pathology. A list of sequenced fungal species was assembled, the taxonomy of all species verified, and the potential reason for sequencing each of the species considered. The genomes of 1090 fungal species are currently (October 2016) in the public domain and this number is rapidly rising. Pathogenic species comprised the largest category (35.5 %) and, amongst these, plant pathogens are predominant. Of the 191 plant pathogenic fungal species with available genomes, 61.3 % cause diseases on food crops, more than half of which are staple crops. The genomes of plant pathogens are slightly larger than those of other fungal species sequenced to date and they contain fewer coding sequences in relation to their genome size. Both of these factors can be attributed to the expansion of repeat elements. Sequenced genomes of plant pathogens provide blueprints from which potential virulence factors were identified and from which genes associated with different pathogenic strategies could be predicted. Genome sequences have also made it possible to evaluate adaptability of pathogen genomes and genomic regions that experience selection pressures. Some genomic patterns, however, remain poorly understood and plant pathogen genomes alone are not sufficient to unravel complex pathogen-host interactions. Genomes, therefore, cannot replace experimental studies that can be complex and tedious. Ultimately, the most promising application lies in using fungal plant pathogen genomics to inform disease management and risk assessment strategies. This will ultimately minimize the risks of future disease outbreaks and assist in preparation for emerging pathogen outbreaks.

  9. Whole genome re-sequencing reveals genome-wide variations among parental lines of 16 mapping populations in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Thudi, Mahendar; Khan, Aamir W; Kumar, Vinay; Gaur, Pooran M; Katta, Krishnamohan; Garg, Vanika; Roorkiwal, Manish; Samineni, Srinivasan; Varshney, Rajeev K

    2016-01-27

    Chickpea (Cicer arietinum L.) is the second most important grain legume cultivated by resource poor farmers in South Asia and Sub-Saharan Africa. In order to harness the untapped genetic potential available for chickpea improvement, we re-sequenced 35 chickpea genotypes representing parental lines of 16 mapping populations segregating for abiotic (drought, heat, salinity), biotic stresses (Fusarium wilt, Ascochyta blight, Botrytis grey mould, Helicoverpa armigera) and nutritionally important (protein content) traits using whole genome re-sequencing approach. A total of 192.19 Gb data, generated on 35 genotypes of chickpea, comprising 973.13 million reads, with an average sequencing depth of ~10 X for each line. On an average 92.18 % reads from each genotype were aligned to the chickpea reference genome with 82.17 % coverage. A total of 2,058,566 unique single nucleotide polymorphisms (SNPs) and 292,588 Indels were detected while comparing with the reference chickpea genome. Highest number of SNPs were identified on the Ca4 pseudomolecule. In addition, copy number variations (CNVs) such as gene deletions and duplications were identified across the chickpea parental genotypes, which were minimum in PI 489777 (1 gene deletion) and maximum in JG 74 (1,497). A total of 164,856 line specific variations (144,888 SNPs and 19,968 Indels) with the highest percentage were identified in coding regions in ICC 1496 (21 %) followed by ICCV 97105 (12 %). Of 539 miscellaneous variations, 339, 138 and 62 were inter-chromosomal variations (CTX), intra-chromosomal variations (ITX) and inversions (INV) respectively. Genome-wide SNPs, Indels, CNVs, PAVs, and miscellaneous variations identified in different mapping populations are a valuable resource in genetic research and helpful in locating genes/genomic segments responsible for economically important traits. Further, the genome-wide variations identified in the present study can be used for developing high density SNP arrays for

  10. Using Whole Genome Analysis to Examine Recombination across Diverse Sequence Types of Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Driebe

    Full Text Available Staphylococcus aureus is an important clinical pathogen worldwide and understanding this organism's phylogeny and, in particular, the role of recombination, is important both to understand the overall spread of virulent lineages and to characterize outbreaks. To further elucidate the phylogeny of S. aureus, 35 diverse strains were sequenced using whole genome sequencing. In addition, 29 publicly available whole genome sequences were included to create a single nucleotide polymorphism (SNP-based phylogenetic tree encompassing 11 distinct lineages. All strains of a particular sequence type fell into the same clade with clear groupings of the major clonal complexes of CC8, CC5, CC30, CC45 and CC1. Using a novel analysis method, we plotted the homoplasy density and SNP density across the whole genome and found evidence of recombination throughout the entire chromosome, but when we examined individual clonal lineages we found very little recombination. However, when we analyzed three branches of multiple lineages, we saw intermediate and differing levels of recombination between them. These data demonstrate that in S. aureus, recombination occurs across major lineages that subsequently expand in a clonal manner. Estimated mutation rates for the CC8 and CC5 lineages were different from each other. While the CC8 lineage rate was similar to previous studies, the CC5 lineage was 100-fold greater. Fifty known virulence genes were screened in all genomes in silico to determine their distribution across major clades. Thirty-three genes were present variably across clades, most of which were not constrained by ancestry, indicating horizontal gene transfer or gene loss.

  11. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  12. Genome sequencing of bacteria: sequencing, de novo assembly and rapid analysis using open source tools.

    Science.gov (United States)

    Kisand, Veljo; Lettieri, Teresa

    2013-04-01

    De novo genome sequencing of previously uncharacterized microorganisms has the potential to open up new frontiers in microbial genomics by providing insight into both functional capabilities and biodiversity. Until recently, Roche 454 pyrosequencing was the NGS method of choice for de novo assembly because it generates hundreds of thousands of long reads (tools for processing NGS data are increasingly free and open source and are often adopted for both their high quality and role in promoting academic freedom. The error rate of pyrosequencing the Alcanivorax borkumensis genome was such that thousands of insertions and deletions were artificially introduced into the finished genome. Despite a high coverage (~30 fold), it did not allow the reference genome to be fully mapped. Reads from regions with errors had low quality, low coverage, or were missing. The main defect of the reference mapping was the introduction of artificial indels into contigs through lower than 100% consensus and distracting gene calling due to artificial stop codons. No assembler was able to perform de novo assembly comparable to reference mapping. Automated annotation tools performed similarly on reference mapped and de novo draft genomes, and annotated most CDSs in the de novo assembled draft genomes. Free and open source software (FOSS) tools for assembly and annotation of NGS data are being developed rapidly to provide accurate results with less computational effort. Usability is not high priority and these tools currently do not allow the data to be processed without manual intervention. Despite this, genome assemblers now readily assemble medium short reads into long contigs (>97-98% genome coverage). A notable gap in pyrosequencing technology is the quality of base pair calling and conflicting base pairs between single reads at the same nucleotide position. Regardless, using draft whole genomes that are not finished and remain fragmented into tens of contigs allows one to characterize

  13. Comparative analysis of full genomic sequences among different genotypes of dengue virus type 3

    Directory of Open Access Journals (Sweden)

    Lin Ting-Hsiang

    2008-05-01

    Full Text Available Abstract Background Although the previous study demonstrated the envelope protein of dengue viruses is under purifying selection pressure, little is known about the genetic differences of full-length viral genomes of DENV-3. In our study, complete genomic sequencing of DENV-3 strains collected from different geographical locations and isolation years were determined and the sequence diversity as well as selection pressure sites in the DENV genome other than within the E gene were also analyzed. Results Using maximum likelihood and Bayesian approaches, our phylogenetic analysis revealed that the Taiwan's indigenous DENV-3 isolated from 1994 and 1998 dengue/DHF epidemics and one 1999 sporadic case were of the three different genotypes – I, II, and III, each associated with DENV-3 circulating in Indonesia, Thailand and Sri Lanka, respectively. Sequence diversity and selection pressure of different genomic regions among DENV-3 different genotypes was further examined to understand the global DENV-3 evolution. The highest nucleotide sequence diversity among the fully sequenced DENV-3 strains was found in the nonstructural protein 2A (mean ± SD: 5.84 ± 0.54 and envelope protein gene regions (mean ± SD: 5.04 ± 0.32. Further analysis found that positive selection pressure of DENV-3 may occur in the non-structural protein 1 gene region and the positive selection site was detected at position 178 of the NS1 gene. Conclusion Our study confirmed that the envelope protein is under purifying selection pressure although it presented higher sequence diversity. The detection of positive selection pressure in the non-structural protein along genotype II indicated that DENV-3 originated from Southeast Asia needs to monitor the emergence of DENV strains with epidemic potential for better epidemic prevention and vaccine development.

  14. Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis

    Directory of Open Access Journals (Sweden)

    Zhao Patrick X

    2011-07-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common type of sequence variation among plants and are often functionally important. We describe the use of 454 technology and high resolution melting analysis (HRM for high throughput SNP discovery in tetraploid alfalfa (Medicago sativa L., a species with high economic value but limited genomic resources. Results The alfalfa genotypes selected from M. sativa subsp. sativa var. 'Chilean' and M. sativa subsp. falcata var. 'Wisfal', which differ in water stress sensitivity, were used to prepare cDNA from tissue of clonally-propagated plants grown under either well-watered or water-stressed conditions, and then pooled for 454 sequencing. Based on 125.2 Mb of raw sequence, a total of 54,216 unique sequences were obtained including 24,144 tentative consensus (TCs sequences and 30,072 singletons, ranging from 100 bp to 6,662 bp in length, with an average length of 541 bp. We identified 40,661 candidate SNPs distributed throughout the genome. A sample of candidate SNPs were evaluated and validated using high resolution melting (HRM analysis. A total of 3,491 TCs harboring 20,270 candidate SNPs were located on the M. truncatula (MT 3.5.1 chromosomes. Gene Ontology assignments indicate that sequences obtained cover a broad range of GO categories. Conclusions We describe an efficient method to identify thousands of SNPs distributed throughout the alfalfa genome covering a broad range of GO categories. Validated SNPs represent valuable molecular marker resources that can be used to enhance marker density in linkage maps, identify potential factors involved in heterosis and genetic variation, and as tools for association mapping and genomic selection in alfalfa.

  15. Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.

    Science.gov (United States)

    Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi

    2017-07-01

    PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.

  16. A Snapshot of the Emerging Tomato Genome Sequence

    Directory of Open Access Journals (Sweden)

    Lukas A. Mueller

    2009-03-01

    Full Text Available The genome of tomato ( L. is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, the Netherlands, France, Japan, Spain, Italy, and the United States as part of the larger “International Solanaceae Genome Project (SOL: Systems Approach to Diversity and Adaptation” initiative. The tomato genome sequencing project uses an ordered bacterial artificial chromosome (BAC approach to generate a high-quality tomato euchromatic genome sequence for use as a reference genome for the Solanaceae and euasterids. Sequence is deposited at GenBank and at the SOL Genomics Network (SGN. Currently, there are around 1000 BACs finished or in progress, representing more than a third of the projected euchromatic portion of the genome. An annotation effort is also underway by the International Tomato Annotation Group. The expected number of genes in the euchromatin is ∼40,000, based on an estimate from a preliminary annotation of 11% of finished sequence. Here, we present this first snapshot of the emerging tomato genome and its annotation, a short comparison with potato ( L. sequence data, and the tools available for the researchers to exploit this new resource are also presented. In the future, whole-genome shotgun techniques will be combined with the BAC-by-BAC approach to cover the entire tomato genome. The high-quality reference euchromatic tomato sequence is expected to be near completion by 2010.

  17. Whole-Genome Sequences of Two Carbapenem-Resistant Klebsiella quasipneumoniae Strains Isolated from a Tertiary Hospital in Johor, Malaysia.

    Science.gov (United States)

    Gan, Han Ming; Rajasekaram, Ganeswrie; Eng, Wilhelm Wei Han; Kaniappan, Priyatharisni; Dhanoa, Amreeta

    2017-08-10

    We report the whole-genome sequences of two carbapenem-resistant clinical isolates of Klebsiella quasipneumoniae subsp. similipneumoniae obtained from two different patients. Both strains contained three different extended-spectrum β-lactamase genes and showed strikingly high pairwise average nucleotide identity of 99.99% despite being isolated 3 years apart from the same hospital. Copyright © 2017 Gan et al.

  18. Scrutinizing virus genome termini by high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Shasha Li

    Full Text Available Analysis of genomic terminal sequences has been a major step in studies on viral DNA replication and packaging mechanisms. However, traditional methods to study genome termini are challenging due to the time-consuming protocols and their inefficiency where critical details are lost easily. Recent advances in next generation sequencing (NGS have enabled it to be a powerful tool to study genome termini. In this study, using NGS we sequenced one iridovirus genome and twenty phage genomes and confirmed for the first time that the high frequency sequences (HFSs found in the NGS reads are indeed the terminal sequences of viral genomes. Further, we established a criterion to distinguish the type of termini and the viral packaging mode. We also obtained additional terminal details such as terminal repeats, multi-termini, asymmetric termini. With this approach, we were able to simultaneously detect details of the genome termini as well as obtain the complete sequence of bacteriophage genomes. Theoretically, this application can be further extended to analyze larger and more complicated genomes of plant and animal viruses. This study proposed a novel and efficient method for research on viral replication, packaging, terminase activity, transcription regulation, and metabolism of the host cell.

  19. AGORA : Organellar genome annotation from the amino acid and nucleotide references.

    Science.gov (United States)

    Jung, Jaehee; Kim, Jong Im; Jeong, Young-Sik; Yi, Gangman

    2018-03-29

    Next-generation sequencing (NGS) technologies have led to the accumulation of highthroughput sequence data from various organisms in biology. To apply gene annotation of organellar genomes for various organisms, more optimized tools for functional gene annotation are required. Almost all gene annotation tools are mainly focused on the chloroplast genome of land plants or the mitochondrial genome of animals.We have developed a web application AGORA for the fast, user-friendly, and improved annotations of organellar genomes. AGORA annotates genes based on a BLAST-based homology search and clustering with selected reference sequences from the NCBI database or user-defined uploaded data. AGORA can annotate the functional genes in almost all mitochondrion and plastid genomes of eukaryotes. The gene annotation of a genome with an exon-intron structure within a gene or inverted repeat region is also available. It provides information of start and end positions of each gene, BLAST results compared with the reference sequence, and visualization of gene map by OGDRAW. Users can freely use the software, and the accessible URL is https://bigdata.dongguk.edu/gene_project/AGORA/.The main module of the tool is implemented by the python and php, and the web page is built by the HTML and CSS to support all browsers. gangman@dongguk.edu.

  20. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Matsumura, Emilyn E.; Nerva, Luca; Nigg, Jared C.; Falk, Bryce W.; Nouri, Shahideh

    2016-01-01

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date.

  1. The Complete Sequence of the Mitochondrial Genome of the Chamberednautilus (Mollusca: Cephalopoda)

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2005-12-01

    Background: Mitochondria contain small genomes that arephysically separate from those of nuclei. Their comparison serves as amodel system for understanding the processes of genome evolution.Although complete mitochondrial genome sequences have been reported formore than 600 animals, the taxonomic sampling is highly biased towardvertebrates and arthropods, leaving much of the diversity yetuncharacterized. Results: The mitochondrial genome of a cephalopodmollusk, the Chambered Nautilus, is 16,258 nts in length and 59.5 percentA+T, both values that are typical of animal mitochondrial genomes. Itcontains the 37 genes that are typical for animal mtDNAs, with 15 on oneDNA strand and 22 on the other. The arrangement of these genes can bederived from that of the distantly related Katharina tunicata (Mollusca:Polyplacophora) by a switch in position of two large blocks of genes andtranspositions of four tRNA genes. There is strong skew in thedistribution of nucleotides between the two strands. There are an unusualnumber of non-coding regions and their function, if any, is not known;however, several of these demark abrupt shifts in nucleotide skew,suggesting that they may play roles in transcription and/or replication.One of the non-coding regions contains multiple repeats of a tRNA-likesequence. Some of the tRNA genes appear to overlap on the same strand,but this could be resolved if the polycistron were cleaved at thebeginning of the downstream gene, followed by polyadenylation of theproduct of the upstream gene to form a fully paired structure.Conclusions: Nautilus sp. mtDNA contains an expected gene content thathas experienced few rearrangements since the evolutionary split betweencephalopods and polyplacophorans. It contains an unusual number ofnon-coding regions, especially considering that these otherwise often aregenerated by the same processes that produce gene rearrangements. Thisappears to be yet another case where polyadenylation of mitochondrialtRNAs restores

  2. RANDNA: a random DNA sequence generator.

    Science.gov (United States)

    Piva, Francesco; Principato, Giovanni

    2006-01-01

    Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

  3. Rhipicephalus (Boophilus) microplus strain Deutsch, whole genome shotgun sequencing project first submission of genome sequence

    Science.gov (United States)

    The size and repetitive nature of the Rhipicephalus microplus genome makes obtaining a full genome sequence difficult. Cot filtration/selection techniques were used to reduce the repetitive fraction of the tick genome and enrich for the fraction of DNA with gene-containing regions. The Cot-selected ...

  4. Genome Sequence of the Palaeopolyploid soybean

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.

    2009-08-03

    Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.

  5. A computational genomics pipeline for prokaryotic sequencing projects.

    Science.gov (United States)

    Kislyuk, Andrey O; Katz, Lee S; Agrawal, Sonia; Hagen, Matthew S; Conley, Andrew B; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C; Sammons, Scott A; Govil, Dhwani; Mair, Raydel D; Tatti, Kathleen M; Tondella, Maria L; Harcourt, Brian H; Mayer, Leonard W; Jordan, I King

    2010-08-01

    New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base (http://nbase.biology.gatech.edu/). The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems.

  6. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  7. Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

    Science.gov (United States)

    Tian, Wenlan; Paudel, Dev

    2017-01-01

    Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

  8. Draft genome sequencing of giardia intestinalis assemblage B isolate GS: is human giardiasis caused by two different species?

    Directory of Open Access Journals (Sweden)

    Oscar Franzén

    2009-08-01

    Full Text Available Giardia intestinalis is a major cause of diarrheal disease worldwide and two major Giardia genotypes, assemblages A and B, infect humans. The genome of assemblage A parasite WB was recently sequenced, and the structurally compact 11.7 Mbp genome contains simplified basic cellular machineries and metabolism. We here performed 454 sequencing to 16x coverage of the assemblage B isolate GS, the only Giardia isolate successfully used to experimentally infect animals and humans. The two genomes show 77% nucleotide and 78% amino-acid identity in protein coding regions. Comparative analysis identified 28 unique GS and 3 unique WB protein coding genes, and the variable surface protein (VSP repertoires of the two isolates are completely different. The promoters of several enzymes involved in the synthesis of the cyst-wall lack binding sites for encystation-specific transcription factors in GS. Several synteny-breaks were detected and verified. The tetraploid GS genome shows higher levels of overall allelic sequence polymorphism (0.5 versus <0.01% in WB. The genomic differences between WB and GS may explain some of the observed biological and clinical differences between the two isolates, and it suggests that assemblage A and B Giardia can be two different species.

  9. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  10. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  11. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

    Science.gov (United States)

    2012-01-01

    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  12. Complete Genome Sequence of Yersinis pestis Strains Antiqua and Nepa1516: Evidence of Gene Reduction in an Emerging Pathogen

    Energy Technology Data Exchange (ETDEWEB)

    Chain, Patrick S [ORNL; Hu, Ping [Lawrence Berkeley National Laboratory (LBNL); Malfatti, Stephanie [Lawrence Livermore National Laboratory (LLNL); Radnedge, Lyndsay [Lawrence Livermore National Laboratory (LLNL); Larimer, Frank W [ORNL; Vergez, Lisa [Lawrence Livermore National Laboratory (LLNL); Worsham, Patricia [U.S. Army Medical Research Institute of Infectious Diseases; Chu, May C [Centers for Disease Control and Prevention; Anderson, Gary L [Lawrence Berkeley National Laboratory (LBNL)

    2006-01-01

    Yersinia pestis, the causative agent of bubonic and pneumonic plagues, has undergone detailed study at the molecular level. To further investigate the genomic diversity among this group and to help characterize lineages of the plague organism that have no sequenced members, we present here the genomes of two isolates of the ''classical'' antiqua biovar, strains Antiqua and Nepal516. The genomes of Antiqua and Nepal516 are 4.7 Mb and 4.5 Mb and encode 4,138 and 3,956 open reading frames, respectively. Though both strains belong to one of the three classical biovars, they represent separate lineages defined by recent phylogenetic studies. We compare all five currently sequenced Y. pestis genomes and the corresponding features in Yersinia pseudotuberculosis. There are strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. We found 453 single nucleotide polymorphisms in protein-coding regions, which were used to assess the evolutionary relationships of these Y. pestis strains. Gene reduction analysis revealed that the gene deletion processes are under selective pressure, and many of the inactivations are probably related to the organism's interaction with its host environment. The results presented here clearly demonstrate the differences between the two biovar antiqua lineages and support the notion that grouping Y. pestis strains based strictly on the classical definition of biovars (predicated upon two biochemical assays) does not accurately reflect the phylogenetic relationships within this species. A comparison of four virulent Y. pestis strains with the human-avirulent strain 91001 provides further insight into the genetic basis of virulence to humans.

  13. Genome sequence variation in the constricta strain dramatically alters the protein interaction and localization map of Potato yellow dwarf virus

    Science.gov (United States)

    The genome sequence of the constricta strain of Potato yellow dwarf virus (CYDV) was determined to be 12,792 nucleotides long and organized into seven open reading frames with the gene order 3’-N-X-P-Y-M-G-L-5’, which encodes the nucleocapsid, phosphoprotein, movement, matrix, glycoprotein and RNA-d...

  14. Whole genome sequencing distinguishes between relapse and reinfection in recurrent leprosy cases.

    Directory of Open Access Journals (Sweden)

    Mariane M A Stefani

    2017-06-01

    Full Text Available Since leprosy is both treated and controlled by multidrug therapy (MDT it is important to monitor recurrent cases for drug resistance and to distinguish between relapse and reinfection as a means of assessing therapeutic efficacy. All three objectives can be reached with single nucleotide resolution using next generation sequencing and bioinformatics analysis of Mycobacterium leprae DNA present in human skin.DNA was isolated by means of optimized extraction and enrichment methods from samples from three recurrent cases in leprosy patients participating in an open-label, randomized, controlled clinical trial of uniform MDT in Brazil (U-MDT/CT-BR. Genome-wide sequencing of M. leprae was performed and the resultant sequence assemblies analyzed in silico.In all three cases, no mutations responsible for resistance to rifampicin, dapsone and ofloxacin were found, thus eliminating drug resistance as a possible cause of disease recurrence. However, sequence differences were detected between the strains from the first and second disease episodes in all three patients. In one case, clear evidence was obtained for reinfection with an unrelated strain whereas in the other two cases, relapse appeared more probable.This is the first report of using M. leprae whole genome sequencing to reveal that treated and cured leprosy patients who remain in endemic areas can be reinfected by another strain. Next generation sequencing can be applied reliably to M. leprae DNA extracted from biopsies to discriminate between cases of relapse and reinfection, thereby providing a powerful tool for evaluating different outcomes of therapeutic regimens and for following disease transmission.

  15. Whole genome sequencing distinguishes between relapse and reinfection in recurrent leprosy cases

    Science.gov (United States)

    Bührer-Sékula, Samira; Benjak, Andrej; Loiseau, Chloé; Singh, Pushpendra; Pontes, Maria A. A.; Gonçalves, Heitor S.; Hungria, Emerith M.; Busso, Philippe; Piton, Jérémie; Silveira, Maria I. S.; Cruz, Rossilene; Schetinni, Antônio; Costa, Maurício B.; Virmond, Marcos C. L.; Diorio, Suzana M.; Dias-Baptista, Ida M. F.; Rosa, Patricia S.; Matsuoka, Masanori; Penna, Maria L. F.; Cole, Stewart T.; Penna, Gerson O.

    2017-01-01

    Background Since leprosy is both treated and controlled by multidrug therapy (MDT) it is important to monitor recurrent cases for drug resistance and to distinguish between relapse and reinfection as a means of assessing therapeutic efficacy. All three objectives can be reached with single nucleotide resolution using next generation sequencing and bioinformatics analysis of Mycobacterium leprae DNA present in human skin. Methodology DNA was isolated by means of optimized extraction and enrichment methods from samples from three recurrent cases in leprosy patients participating in an open-label, randomized, controlled clinical trial of uniform MDT in Brazil (U-MDT/CT-BR). Genome-wide sequencing of M. leprae was performed and the resultant sequence assemblies analyzed in silico. Principal findings In all three cases, no mutations responsible for resistance to rifampicin, dapsone and ofloxacin were found, thus eliminating drug resistance as a possible cause of disease recurrence. However, sequence differences were detected between the strains from the first and second disease episodes in all three patients. In one case, clear evidence was obtained for reinfection with an unrelated strain whereas in the other two cases, relapse appeared more probable. Conclusions/Significance This is the first report of using M. leprae whole genome sequencing to reveal that treated and cured leprosy patients who remain in endemic areas can be reinfected by another strain. Next generation sequencing can be applied reliably to M. leprae DNA extracted from biopsies to discriminate between cases of relapse and reinfection, thereby providing a powerful tool for evaluating different outcomes of therapeutic regimens and for following disease transmission. PMID:28617800

  16. Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

    Science.gov (United States)

    Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

    2014-07-01

    Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak

    Directory of Open Access Journals (Sweden)

    Trout-Yakel Keri M

    2010-02-01

    Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.

  18. Diversity and Genome Analysis of Australian and Global Oilseed Brassica napus L. Germplasm Using Transcriptomics and Whole Genome Re-sequencing

    Directory of Open Access Journals (Sweden)

    M. Michelle Malmberg

    2018-04-01

    Full Text Available Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD. Complexity reduction genotyping-by-sequencing (GBS methods, including GBS-transcriptomics (GBS-t, enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs, and identify structural variants (SVs. Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.

  19. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  20. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  1. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki.

    Directory of Open Access Journals (Sweden)

    Dann Turner

    Full Text Available Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA under the accession number LN890663.

  2. Complete mitochondrial genome sequence from an endangered Indian snake, Python molurus molurus (Serpentes, Pythonidae).

    Science.gov (United States)

    Dubey, Bhawna; Meganathan, P R; Haque, Ikramul

    2012-07-01

    This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.

  3. Sequencing and comparing whole mitochondrial genomes ofanimals

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.; Macey, J. Robert; Medina, Monica

    2005-04-22

    Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, that can be especially powerful. We describe here the protocols commonly used for physically isolating mtDNA, for amplifying these by PCR or RCA, for cloning,sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based on our experiences to date with determining and comparing complete mtDNA sequences.

  4. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  5. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    Science.gov (United States)

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.

    Science.gov (United States)

    Hiscock, D; Upton, C

    2000-05-01

    The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .

  7. The complete genomic sequence of pepper yellow leaf curl virus (PYLCV and its implications for our understanding of evolution dynamics in the genus polerovirus.

    Directory of Open Access Journals (Sweden)

    Aviv Dombrovsky

    Full Text Available We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV. PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV (both poleroviruses. The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs, which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93% and to ORF5 of CABYV (87%. Both PYLCV and Pepper vein yellowing virus (PeVYV contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP, may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2 were identified between nucleotides 4,962 and 5,061 (ORF 5 and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3 with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s between poleroviruses co-infecting a common host(s, resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

  8. The complete genomic sequence of pepper yellow leaf curl virus (PYLCV) and its implications for our understanding of evolution dynamics in the genus polerovirus.

    Science.gov (United States)

    Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

    2013-01-01

    We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

  9. ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcelo

    2008-09-01

    Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties

  10. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  11. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis

    International Nuclear Information System (INIS)

    Kato, Nobuyuki; Hijikata, Makoto; Ootsuyama, Yuko; Nakagawa, Masanori; Ohkoshi, Showgo; Sugimura, Takashi; Shimotohno, Kunitada

    1990-01-01

    The nucleotide sequence of the Japanese type of hepatitis C virus (HCV-J) genome, consisting of 9413 nucleotides, was determined by analyses of cDNA clones from plasma specimens from Japanese patients with chronic hepatitis. HCV-J genome contains a long open reading frame that can encode a sequence of 3010 amino acid residues. Comparison of HCV-J with the American isolate of HCV showed 22.6% difference in nucleotide sequence and 15.1% difference in amino acid sequence. Thus HCV-J and the American isolate of HCV are probably different subtypes of HCV. The relationship of HCV-J with other animal RNA virus families and the putative organization of the HCV-J genome are discussed

  12. Genome Sequencing and Analysis Conference IV

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    J. Craig Venter and C. Thomas Caskey co-chaired Genome Sequencing and Analysis Conference IV held at Hilton Head, South Carolina from September 26--30, 1992. Venter opened the conference by noting that approximately 400 researchers from 16 nations were present four times as many participants as at Genome Sequencing Conference I in 1989. Venter also introduced the Data Fair, a new component of the conference allowing exchange and on-site computer analysis of unpublished sequence data.

  13. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  14. MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

    Science.gov (United States)

    Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

    2016-03-01

    Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

  15. Value of a newly sequenced bacterial genome

    DEFF Research Database (Denmark)

    Barbosa, Eudes; Aburjaile, Flavia F; Ramos, Rommel Tj

    2014-01-01

    and annotation will not be undertaken. It is important to know what is lost when we settle for a draft genome and to determine the "scientific value" of a newly sequenced genome. This review addresses the expected impact of newly sequenced genomes on antibacterial discovery and vaccinology. Also, it discusses...... heightened expectations that NGS would boost antibacterial discovery and vaccine development. Although many possible drug and vaccine targets have been discovered, the success rate of genome-based analysis has remained below expectations. Furthermore, NGS has had consequences for genome quality, resulting...

  16. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  17. Whole-Genome Sequencing and Variant Analysis of Human Papillomavirus 16 Infections.

    Science.gov (United States)

    van der Weele, Pascal; Meijer, Chris J L M; King, Audrey J

    2017-10-01

    Human papillomavirus (HPV) is a strongly conserved DNA virus, high-risk types of which can cause cervical cancer in persistent infections. The most common type found in HPV-attributable cancer is HPV16, which can be subdivided into four lineages (A to D) with different carcinogenic properties. Studies have shown HPV16 sequence diversity in different geographical areas, but only limited information is available regarding HPV16 diversity within a population, especially at the whole-genome level. We analyzed HPV16 major variant diversity and conservation in persistent infections and performed a single nucleotide polymorphism (SNP) comparison between persistent and clearing infections. Materials were obtained in the Netherlands from a cohort study with longitudinal follow-up for up to 3 years. Our analysis shows a remarkably large variant diversity in the population. Whole-genome sequences were obtained for 57 persistent and 59 clearing HPV16 infections, resulting in 109 unique variants. Interestingly, persistent infections were completely conserved through time. One reinfection event was identified where the initial and follow-up samples clustered differently. Non-A1/A2 variants seemed to clear preferentially ( P = 0.02). Our analysis shows that population-wide HPV16 sequence diversity is very large. In persistent infections, the HPV16 sequence was fully conserved. Sequencing can identify HPV16 reinfections, although occurrence is rare. SNP comparison identified no strongly acting effect of the viral genome affecting HPV16 infection clearance or persistence in up to 3 years of follow-up. These findings suggest the progression of an early HPV16 infection could be host related. IMPORTANCE Human papillomavirus 16 (HPV16) is the predominant type found in cervical cancer. Progression of initial infection to cervical cancer has been linked to sequence properties; however, knowledge of variants circulating in European populations, especially with longitudinal follow-up, is

  18. Whole Genome Sequence Analysis of Pig Respiratory Bacterial Pathogens with Elevated Minimum Inhibitory Concentrations for Macrolides.

    Science.gov (United States)

    Dayao, Denise Ann Estarez; Seddon, Jennifer M; Gibson, Justine S; Blackall, Patrick J; Turni, Conny

    2016-10-01

    Macrolides are often used to treat and control bacterial pathogens causing respiratory disease in pigs. This study analyzed the whole genome sequences of one clinical isolate of Actinobacillus pleuropneumoniae, Haemophilus parasuis, Pasteurella multocida, and Bordetella bronchiseptica, all isolated from Australian pigs to identify the mechanism underlying the elevated minimum inhibitory concentrations (MICs) for erythromycin, tilmicosin, or tulathromycin. The H. parasuis assembled genome had a nucleotide transition at position 2059 (A to G) in the six copies of the 23S rRNA gene. This mutation has previously been associated with macrolide resistance but this is the first reported mechanism associated with elevated macrolide MICs in H. parasuis. There was no known macrolide resistance mechanism identified in the other three bacterial genomes. However, strA and sul2, aminoglycoside and sulfonamide resistance genes, respectively, were detected in one contiguous sequence (contig 1) of A. pleuropneumoniae assembled genome. This contig was identical to plasmids previously identified in Pasteurellaceae. This study has provided one possible explanation of elevated MICs to macrolides in H. parasuis. Further studies are necessary to clarify the mechanism causing the unexplained macrolide resistance in other Australian pig respiratory pathogens including the role of efflux systems, which were detected in all analyzed genomes.

  19. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    Directory of Open Access Journals (Sweden)

    Maley Carlo C

    2008-10-01

    Full Text Available Abstract Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12 genomes. Virtually all possible (> 98% 12 bp oligomers appear in vertebrate genomes while 98% to D. melanogaster (12–17 bp, C. elegans (11–17 bp, A. thaliana (11–17 bp, S. cerevisiae (10–16 bp and E. coli (9–15 bp. Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect

  20. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    Science.gov (United States)

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-01-01

    Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to

  1. Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria

    DEFF Research Database (Denmark)

    Larsen, Mette Voldby; Cosentino, Salvatore; Rasmussen, Simon

    2012-01-01

    Accurate strain identification is essential for anyone working with bacteria. For many species, multilocus sequence typing (MLST) is considered the "gold standard" of typing, but it is traditionally performed in an expensive and time-consuming manner. As the costs of whole-genome sequencing (WGS...

  2. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    Science.gov (United States)

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Whole-Genome de novo Sequencing Of Quail And Grey Partridge

    DEFF Research Database (Denmark)

    Holm, Lars-Erik; Panitz, Frank; Burt, Dave

    2011-01-01

    The development in sequencing methods has made it possible to perform whole genome de novo sequencing of species without large commercial interests. Within the EU-financed QUANTOMICS project (KBBE-2A-222664), we have performed de novo sequencing of quail (Coturnix coturnix) and grey partridge...... (Perdix perdix) on a Genome Analyzer GAII (Illumina) using paired-end sequencing. The amount of generated sequences amounts to 8 to 9 Gb for each species. The analysis and assembly of the generated sequences is ongoing. Access to the whole genome sequence from these two species will enable enhanced...... comparative studies towards the chicken genome and will aid in identifying evolutionarily conserved sequences within the Galliformes. The obtained sequences from quail and partridge represent a beginning of generating the whole genome sequence for these species. The continuation of establishing the genome...

  4. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species

    Science.gov (United States)

    Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M

    2004-01-01

    Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803

  5. Exploring genetic variation in the tomato (Solanum section Lycopersicon) clade by whole-genome sequencing.

    Science.gov (United States)

    Aflitos, Saulo; Schijlen, Elio; de Jong, Hans; de Ridder, Dick; Smit, Sandra; Finkers, Richard; Wang, Jun; Zhang, Gengyun; Li, Ning; Mao, Likai; Bakker, Freek; Dirks, Rob; Breit, Timo; Gravendeel, Barbara; Huits, Henk; Struss, Darush; Swanson-Wagner, Ruth; van Leeuwen, Hans; van Ham, Roeland C H J; Fito, Laia; Guignier, Laëtitia; Sevilla, Myrna; Ellul, Philippe; Ganko, Eric; Kapur, Arvind; Reclus, Emannuel; de Geus, Bernard; van de Geest, Henri; Te Lintel Hekkert, Bas; van Haarst, Jan; Smits, Lars; Koops, Andries; Sanchez-Perez, Gabino; van Heusden, Adriaan W; Visser, Richard; Quan, Zhiwu; Min, Jiumeng; Liao, Li; Wang, Xiaoli; Wang, Guangbiao; Yue, Zhen; Yang, Xinhua; Xu, Na; Schranz, Eric; Smets, Erik; Vos, Rutger; Rauwerda, Johan; Ursem, Remco; Schuit, Cees; Kerns, Mike; van den Berg, Jan; Vriezen, Wim; Janssen, Antoine; Datema, Erwin; Jahrman, Torben; Moquet, Frederic; Bonnet, Julien; Peters, Sander

    2014-10-01

    We explored genetic variation by sequencing a selection of 84 tomato accessions and related wild species representative of the Lycopersicon, Arcanum, Eriopersicon and Neolycopersicon groups, which has yielded a huge amount of precious data on sequence diversity in the tomato clade. Three new reference genomes were reconstructed to support our comparative genome analyses. Comparative sequence alignment revealed group-, species- and accession-specific polymorphisms, explaining characteristic fruit traits and growth habits in the various cultivars. Using gene models from the annotated Heinz 1706 reference genome, we observed differences in the ratio between non-synonymous and synonymous SNPs (dN/dS) in fruit diversification and plant growth genes compared to a random set of genes, indicating positive selection and differences in selection pressure between crop accessions and wild species. In wild species, the number of single-nucleotide polymorphisms (SNPs) exceeds 10 million, i.e. 20-fold higher than found in most of the crop accessions, indicating dramatic genetic erosion of crop and heirloom tomatoes. In addition, the highest levels of heterozygosity were found for allogamous self-incompatible wild species, while facultative and autogamous self-compatible species display a lower heterozygosity level. Using whole-genome SNP information for maximum-likelihood analysis, we achieved complete tree resolution, whereas maximum-likelihood trees based on SNPs from ten fruit and growth genes show incomplete resolution for the crop accessions, partly due to the effect of heterozygous SNPs. Finally, results suggest that phylogenetic relationships are correlated with habitat, indicating the occurrence of geographical races within these groups, which is of practical importance for Solanum genome evolution studies. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  6. Fast and robust methods for full genome sequencing of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Type 1 and Type 2

    DEFF Research Database (Denmark)

    Kvisgaard, Lise Kirstine; Hjulsager, Charlotte Kristiane; Fahnøe, Ulrik

    . In the present study, fast and robust methods for long range RT-PCR amplification and subsequent next generation sequencing (NGS) of PRRSV Type 1 and Type 2 viruses were developed and validated on nine Type 1 and nine Type 2 PRRSV viruses. The methods were shown to generate robust and reliable sequences both...... on primary material and cell culture adapted viruses and the protocols were shown to perform well on all three NGS platforms tested (Roche 454 FLX, Illumina HiSeq 2000, and Ion Torrent PGM™ Sequencer). To complete the sequences at the 5’ end, 5’ Rapid Amplification of cDNA Ends (5’ RACE) was conducted...... followed by cycle sequencing of clones. The genome lengths were determined to be 14,876-15,098 and 15,342-15,408 nucleotides long for the Type 1 and Type 2 strains, respectively. These methods will greatly facilitate the generation of more complete genome PRRSV sequences globally which in turn may lead...

  7. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  8. Context based computational analysis and characterization of ARS consensus sequences (ACS of Saccharomyces cerevisiae genome

    Directory of Open Access Journals (Sweden)

    Vinod Kumar Singh

    2016-09-01

    Full Text Available Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS requires an essential consensus sequence (ACS for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC denoted as ORC-ACS and non-replicating ACS sequences (nrACS, that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

  9. Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.; Boore,Jeffrey L.

    2007-01-01

    The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae, respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.

  10. MIPS: a database for genomes and protein sequences.

    Science.gov (United States)

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  11. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  12. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Matsumura, Emilyn E; Nerva, Luca; Nigg, Jared C; Falk, Bryce W; Nouri, Shahideh

    2016-09-08

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date. Copyright © 2016 Matsumura et al.

  13. Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

    Directory of Open Access Journals (Sweden)

    Sathishkumar Natarajan

    Full Text Available Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L. and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs, 1.9 million InDels, and 182,398 putative structural variations (SVs. Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

  14. Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

    Science.gov (United States)

    Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup

    2016-01-01

    Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

  15. Automated whole-genome multiple alignment of rat, mouse, and human

    Energy Technology Data Exchange (ETDEWEB)

    Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna

    2004-07-04

    We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: <7% of the rat contigs are aligned to multiple places in human and 97% of all alignments with human sequence > 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

  16. The UCSC genome browser database: update 2007

    DEFF Research Database (Denmark)

    Kuhn, R M; Karolchik, D; Zweig, A S

    2006-01-01

    The University of California, Santa Cruz Genome Browser Database contains, as of September 2006, sequence and annotation data for the genomes of 13 vertebrate and 19 invertebrate species. The Genome Browser displays a wide variety of annotations at all scales from the single nucleotide level up t...

  17. Isolation, identification, and complete genome sequence of a bovine adenovirus type 3 from cattle in China

    Directory of Open Access Journals (Sweden)

    Zhu Yuan-Mao

    2011-12-01

    Full Text Available Abstract Background Bovine adenovirus type 3 (BAV-3 belongs to the Mastadenovirus genus of the family Adenoviridae and is involved in respiratory and enteric infections of calves. The isolation of BAV-3 has not been reported prior to this study in China. In 2009, there were many cases in cattle showing similar clinical signs to BAV-3 infection and a virus strain, showing cytopathic effect in Madin-Darby bovine kidney cells, was isolated from a bovine nasal swab collected from feedlot cattle in Heilongjiang Province, China. The isolate was confirmed as a bovine adenovirus type 3 by PCR and immunofluorescence assay, and named as HLJ0955. So far only the complete genome sequence of prototype of BAV-3 WBR-1 strain has been reported. In order to further characterize the Chinese isolate HLJ0955, the complete genome sequence of HLJ0955 was determined. Results The size of the genome of the Chinese isolate HLJ0955 is 34,132 nucleotides in length with a G+C content of 53.6%. The coding sequences for gene regions of HLJ0955 isolate were similar to the prototype of BAV-3 WBR-1 strain, with 80.0-98.6% nucleotide and 87.5-98.8% amino acid identities. The genome of HLJ0955 strain contains 16 regions and four deletions in inverted terminal repeats, E1B region and E4 region, respectively. The complete genome and DNA binding protein gene based phylogenetic analysis with other adenoviruses were performed and the results showed that HLJ0955 isolate belonged to BAV-3 and clustered within the Mastadenovirus genus of the family Adenoviridae. Conclusions This is the first study to report the isolation and molecular characterization of BAV-3 from cattle in China. The phylogenetic analysis performed in this study supported the use of the DNA binding protein gene of adenovirus as an appropriate subgenomic target for the classification of different genuses of the family Adenoviridae on the molecular basis. Meanwhile, a large-scale pathogen and serological epidemiological

  18. Analysis of the complete genome sequence of Nocardia seriolae UTF1, the causative agent of fish nocardiosis: The first reference genome sequence of the fish pathogenic Nocardia species.

    Science.gov (United States)

    Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Nakamura, Yoji; Fujiwara, Atushi; Shimahara, Yoshiko; Kamaishi, Takashi; Yoshida, Terutoyo; Nagai, Satoshi; Kobayashi, Takanori; Katoh, Masaya

    2017-01-01

    Nocardiosis caused by Nocardia seriolae is one of the major threats in the aquaculture of Seriola species (yellowtail; S. quinqueradiata, amberjack; S. dumerili and kingfish; S. lalandi) in Japan. Here, we report the complete nucleotide genome sequence of N. seriolae UTF1, isolated from a cultured yellowtail. The genome is a circular chromosome of 8,121,733 bp with a G+C content of 68.1% that encodes 7,697 predicted proteins. In the N. seriolae UTF1 predicted genes, we found orthologs of virulence factors of pathogenic mycobacteria and human clinical Nocardia isolates involved in host cell invasion, modulation of phagocyte function and survival inside the macrophages. The virulence factor candidates provide an essential basis for understanding their pathogenic mechanisms at the molecular level by the fish nocardiosis research community in future studies. We also found many potential antibiotic resistance genes on the N. seriolae UTF1 chromosome. Comparative analysis with the four existing complete genomes, N. farcinica IFM 10152, N. brasiliensis HUJEG-1 and N. cyriacigeorgica GUH-2 and N. nova SH22a, revealed that 2,745 orthologous genes were present in all five Nocardia genomes (core genes) and 1,982 genes were unique to N. seriolae UTF1. In particular, the N. seriolae UTF1 genome contains a greater number of mobile elements and genes of unknown function that comprise the differences in structure and gene content from the other Nocardia genomes. In addition, a lot of the N. seriolae UTF1-specific genes were assigned to the ABC transport system. Because of limited resources in ocean environments, these N. seriolae UTF1 specific ABC transporters might facilitate adaptation strategies essential for marine environment survival. Thus, the availability of the complete N. seriolae UTF1 genome sequence will provide a valuable resource for comparative genomic studies of N. seriolae isolates, as well as provide new insights into the ecological and functional diversity of

  19. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.

    2011-05-13

    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  20. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    Science.gov (United States)

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource