WorldWideScience

Sample records for genome northern blot

  1. Northern blotting analysis

    DEFF Research Database (Denmark)

    Josefsen, Knud; Nielsen, Henrik

    2011-01-01

    Northern blotting analysis is a classical method for analysis of the size and steady-state level of a specific RNA in a complex sample. In short, the RNA is size-fractionated by gel electrophoresis and transferred by blotting onto a membrane to which the RNA is covalently bound. Then, the membrane...... is analysed by hybridization to one or more specific probes that are labelled for subsequent detection. Northern blotting is relatively simple to perform, inexpensive, and not plagued by artefacts. Recent developments of hybridization membranes and buffers have resulted in increased sensitivity closing...

  2. Northern blotting analysis

    DEFF Research Database (Denmark)

    Josefsen, Knud; Nielsen, Henrik

    2011-01-01

    is analysed by hybridization to one or more specific probes that are labelled for subsequent detection. Northern blotting is relatively simple to perform, inexpensive, and not plagued by artefacts. Recent developments of hybridization membranes and buffers have resulted in increased sensitivity closing...

  3. An alternative method for processing northern blots after capillary transfer.

    Science.gov (United States)

    Nilsen, Timothy W

    2015-03-02

    Different laboratories use different methods for the prehybridization, hybridization, and washing steps of the northern blotting procedure. In this protocol, a northern blot is pretreated with Church and Gilbert hybridization buffer to block nonspecific probe-binding sites. The immobilized RNA is then hybridized to a DNA probe specific for the RNA of interest. Finally, the membrane is washed and subjected to autoradiography or phosphorimaging. The solutions and conditions described here may be ideal for those who prefer to use fewer ingredients in their solutions. This protocol is designed to achieve the same goals as other northern blotting approaches. It minimizes background (nonspecific adherence of probe to membrane and nonspecific hybridization) and maximizes specific hybridization to RNAs immobilized on a membrane. © 2015 Cold Spring Harbor Laboratory Press.

  4. Automated design of genomic Southern blot probes

    Directory of Open Access Journals (Sweden)

    Komiyama Noboru H

    2010-01-01

    Full Text Available Abstract Background Sothern blotting is a DNA analysis technique that has found widespread application in molecular biology. It has been used for gene discovery and mapping and has diagnostic and forensic applications, including mutation detection in patient samples and DNA fingerprinting in criminal investigations. Southern blotting has been employed as the definitive method for detecting transgene integration, and successful homologous recombination in gene targeting experiments. The technique employs a labeled DNA probe to detect a specific DNA sequence in a complex DNA sample that has been separated by restriction-digest and gel electrophoresis. Critically for the technique to succeed the probe must be unique to the target locus so as not to cross-hybridize to other endogenous DNA within the sample. Investigators routinely employ a manual approach to probe design. A genome browser is used to extract DNA sequence from the locus of interest, which is searched against the target genome using a BLAST-like tool. Ideally a single perfect match is obtained to the target, with little cross-reactivity caused by homologous DNA sequence present in the genome and/or repetitive and low-complexity elements in the candidate probe. This is a labor intensive process often requiring several attempts to find a suitable probe for laboratory testing. Results We have written an informatic pipeline to automatically design genomic Sothern blot probes that specifically attempts to optimize the resultant probe, employing a brute-force strategy of generating many candidate probes of acceptable length in the user-specified design window, searching all against the target genome, then scoring and ranking the candidates by uniqueness and repetitive DNA element content. Using these in silico measures we can automatically design probes that we predict to perform as well, or better, than our previous manual designs, while considerably reducing design time. We went on to

  5. Optimization of northern analysis by vacuum-blotting, RNA-transfer visualization, and ultraviolet fixation

    International Nuclear Information System (INIS)

    Kroczek, R.A.; Siebert, E.

    1990-01-01

    We have optimized Northern analysis at several steps. Overnight electrophoresis was replaced by short gel runs and overnight capillary transfer by rapid vacuum-blotting adapted to Northern analysis. Short uv irradiation was used as a substitute for the usual RNA fixation by baking. Direct staining of RNA before electrophoresis made it possible to check RNA integrity and to evaluate the quality of the size separation immediately after electrophoresis. In this system, RNA transfer onto the membrane support could also be quickly assessed after the blotting step. The net result of all modifications was a doubling of the autoradiography signal compared with that obtained by modern Northern protocols. At the same time, the duration of the procedure was shortened drastically, allowing an autoradiography signal to be obtained within 24 h

  6. Detection of alien genetic introgressions in bread wheat using dot-blot genomic hybridisation.

    Science.gov (United States)

    Rey, María-Dolores; Prieto, Pilar

    2017-01-01

    Simple, reliable methods for the identification of alien genetic introgressions are required in plant breeding programmes. The use of genomic dot-blot hybridisation allows the detection of small Hordeum chilense genomic introgressions in the descendants of genetic crosses between wheat and H. chilense addition or substitution lines in wheat when molecular markers are difficult to use. Based on genomic in situ hybridisation, DNA samples from wheat lines carrying putatively H. chilense introgressions were immobilised on a membrane, blocked with wheat genomic DNA and hybridised with biotin-labelled H. chilense genomic DNA as a probe. This dot-blot screening reduced the number of plants necessary to be analysed by molecular markers or in situ hybridisation, saving time and money. The technique was sensitive enough to detect a minimum of 5 ng of total genomic DNA immobilised on the membrane or about 1/420 dilution of H. chilense genomic DNA in the wheat background. The robustness of the technique was verified by in situ hybridisation. In addition, the detection of other wheat relative species such as Hordeum vulgare , Secale cereale and Agropyron cristatum in the wheat background was also reported .

  7. Inheritance of resistance to barley yellow dwarf virus detected by northern blot analysis

    International Nuclear Information System (INIS)

    Lorens, G.F.; Falk, B.W.; Qualset, C.O.

    1989-01-01

    Development of wheat (Triticum aestivum L.) cultivars tolerant to the barley yellow dwarf virus disease (BYD) has been limited by lack of precision in rating plants for response to infection, usually done by visual scoring of plant symptoms under field conditions. Other methodologies have been developed to study the host/pathogen relationship and to assess resistance or susceptibility. In this study northern dot blot analysis was used to determine barley yellow dwarf virus (BYDV) RNA concentrations of six wheat cultivars that differed in visual BYD symptom expression. Plants were infected with the NYPAV (PAV) isolate of BYDV in the greenhouse. At several dates after inoculation crude plant extracts were blotted on nitrocellulose and hybridized with a 32 P-labeled probe of the pPA8 cDNA clone of BYDV. The distribution of PRC for the F 2 population was compared to the distribution of BYD visual symptom scores for 403 F 2 plants of a similar F 2 population of NS 879/4 x Seri 82 under field conditions. The results were qualitatively similar, suggesting that northern dot blot analysis to measure PRC may be useful in understanding the genetics of resistance to BYD. This technique, when incorporated into breeding programs, could be important in the development of highly tolerant wheat cultivars with reduced losses to BYD

  8. The early days of blotting.

    Science.gov (United States)

    Southern, Edwin

    2015-01-01

    The history of the development of DNA blotting is described in this chapter. DNA blotting, involving the transfer of electrophoretically separated DNA fragments to a membrane support through capillary action, is also known as Southern blotting. This procedure enables the detection of a specific DNA sequence by hybridization with probes. The term Southern blotting led to a "geographic" naming tradition, with RNA blotting bearing the name Northern blotting and protein transfer to membranes becoming known as Western blotting.

  9. Protein blotting protocol for beginners.

    Science.gov (United States)

    Petrasovits, Lars A

    2014-01-01

    The transfer and immobilization of biological macromolecules onto solid nitrocellulose or nylon (polyvinylidene difluoride (PVDF)) membranes subsequently followed by specific detection is referred to as blotting. DNA blots are called Southerns after the inventor of the technique, Edwin Southern. By analogy, RNA blots are referred to as northerns and protein blots as westerns (Burnette, Anal Biochem 112:195-203, 1981). With few exceptions, western blotting involves five steps, namely, sample collection, preparation, separation, immobilization, and detection. In this chapter, protocols for the entire process from sample collection to detection are described.

  10. Genetic relatedness of orbiviruses by RNA-RNA blot hybridization

    International Nuclear Information System (INIS)

    Bodkin, D.K.

    1985-01-01

    RNA-RNA blot hybridization was developed in order to identify type-specific genes among double-stranded (ds) RNA viruses, to assess the genetic relatedness of dsRNA viruses and to classify new strains. Viral dsRNA segments were electrophoresed through 10% polyacrylamide gels, transferred to membranes, and hybridized to [5' 32 P]-pCp labeled genomic RNA from a related strain. Hybridization was performed at 52 0 C, 50% formamide, 5X SSC. Under these conditions heterologous RNA species must share ≥ 74% sequence homology in order to form stable dsRNA hybrids. Cognate genes of nine members of the Palyam serogroup of orbiviruses were identified and their sequence relatedness to the prototype. Palyam virus, was determined. Reciprocal blot hybridizations were performed using radiolabeled genomic RNA of all members of the Palyam serogroup. Unique and variant genes were identified by lack of cross-homology or by weak homology between segments. Since genes 2 and 6 exhibited the highest degree of sequence variability, response to the vertebrate immune system may be a major cause of sequence divergence among members of a single serogroup. Changuinola serogroup isolates were compared by dot-blot hybridization, while Colorado tick fever (CTF) serogroup isolates were compared by the RNA-RNA blot hybridization procedure described for reovirus and Palyam serogroup isolates. Preliminary blot hybridization data were also obtained on the relatedness of members of different Orbivirus serogroups

  11. Detection of Sleeping Beauty transposition in the genome of host cells by non-radioactive Southern blot analysis

    Energy Technology Data Exchange (ETDEWEB)

    Aravalli, Rajagopal N., E-mail: aravalli@umn.edu [Department of Radiology, University of Minnesota Medical School, MMC 292, 420 Delaware Street SE, Minneapolis, MN 55455 (United States); Park, Chang W. [Department of Medicine, University of Minnesota Medical School, MMC 36, 420 Delaware Street SE, Minneapolis, MN 55455 (United States); Steer, Clifford J., E-mail: steer001@umn.edu [Department of Medicine, University of Minnesota Medical School, MMC 36, 420 Delaware Street SE, Minneapolis, MN 55455 (United States); Department of Genetics, Cell Biology and Development, University of Minnesota, Minneapolis, MN 55455 (United States)

    2016-08-26

    The Sleeping Beauty transposon (SB-Tn) system is being used widely as a DNA vector for the delivery of therapeutic transgenes, as well as a tool for the insertional mutagenesis in animal models. In order to accurately assess the insertional potential and properties related to the integration of SB it is essential to determine the copy number of SB-Tn in the host genome. Recently developed SB100X transposase has demonstrated an integration rate that was much higher than the original SB10 and that of other versions of hyperactive SB transposases, such as HSB3 or HSB17. In this study, we have constructed a series of SB vectors carrying either a DsRed or a human β-globin transgene that was encompassed by cHS4 insulator elements, and containing the SB100X transposase gene outside the SB-Tn unit within the same vector in cis configuration. These SB-Tn constructs were introduced into the K-562 erythroid cell line, and their presence in the genomes of host cells was analyzed by Southern blot analysis using non-radioactive probes. Many copies of SB-Tn insertions were detected in host cells regardless of transgene sequences or the presence of cHS4 insulator elements. Interestingly, the size difference of 2.4 kb between insulated SB and non-insulated controls did not reflect the proportional difference in copy numbers of inserted SB-Tns. We then attempted methylation-sensitive Southern blots to assess the potential influence of cHS4 insulator elements on the epigenetic modification of SB-Tn. Our results indicated that SB100X was able to integrate at multiple sites with the number of SB-Tn copies larger than 6 kb in size. In addition, the non-radioactive Southern blot protocols developed here will be useful to detect integrated SB-Tn copies in any mammalian cell type.

  12. Detection of Sleeping Beauty transposition in the genome of host cells by non-radioactive Southern blot analysis

    International Nuclear Information System (INIS)

    Aravalli, Rajagopal N.; Park, Chang W.; Steer, Clifford J.

    2016-01-01

    The Sleeping Beauty transposon (SB-Tn) system is being used widely as a DNA vector for the delivery of therapeutic transgenes, as well as a tool for the insertional mutagenesis in animal models. In order to accurately assess the insertional potential and properties related to the integration of SB it is essential to determine the copy number of SB-Tn in the host genome. Recently developed SB100X transposase has demonstrated an integration rate that was much higher than the original SB10 and that of other versions of hyperactive SB transposases, such as HSB3 or HSB17. In this study, we have constructed a series of SB vectors carrying either a DsRed or a human β-globin transgene that was encompassed by cHS4 insulator elements, and containing the SB100X transposase gene outside the SB-Tn unit within the same vector in cis configuration. These SB-Tn constructs were introduced into the K-562 erythroid cell line, and their presence in the genomes of host cells was analyzed by Southern blot analysis using non-radioactive probes. Many copies of SB-Tn insertions were detected in host cells regardless of transgene sequences or the presence of cHS4 insulator elements. Interestingly, the size difference of 2.4 kb between insulated SB and non-insulated controls did not reflect the proportional difference in copy numbers of inserted SB-Tns. We then attempted methylation-sensitive Southern blots to assess the potential influence of cHS4 insulator elements on the epigenetic modification of SB-Tn. Our results indicated that SB100X was able to integrate at multiple sites with the number of SB-Tn copies larger than 6 kb in size. In addition, the non-radioactive Southern blot protocols developed here will be useful to detect integrated SB-Tn copies in any mammalian cell type.

  13. TLC blot (far-eastern blot) and its applications.

    Science.gov (United States)

    Taki, Takao; Gonzalez, Tania Valdes; Goto-Inoue, Naoko; Hayasaka, Takahiro; Setou, Mitsutoshi

    2009-01-01

    A simple method for transfer of lipids including phospholipids, glycolipids, and neutral lipids from a high-performance thin-layer chromatography (HPTLC) plate to a polyvinylidene difluoride (PVDF) membrane, called TLC blot (far-eastern blot), is presented. Lipids separated on a HPTLC plate are blotted quantitatively. This procedure made it possible to purify individual lipids from a blotted membrane in a short time. Binding study, immunodetection, and mass spectrometric analysis are available for PVDF membrane. Furthermore, the world of molecular species imaging is opened by a scanning analysis with a combination of TLC blot and matrix-assisted laser desorption/ionization quadrupole ion trap time-of-flight mass spectrometer (TLC-Blot/MALDI-TOF MS).

  14. Draft genome sequences of seven isolates of Phytophthora ramorum EU2 from Northern Ireland

    Directory of Open Access Journals (Sweden)

    Lourdes de la Mata Saez

    2015-12-01

    Full Text Available Here we present draft-quality genome sequence assemblies for the oomycete Phytophthora ramorum genetic lineage EU2. We sequenced genomes of seven isolates collected in Northern Ireland between 2010 and 2012. Multiple genome sequences from P. ramorum EU2 will be valuable for identifying genetic variation within the clonal lineage that can be useful for tracking its spread.

  15. Western blotting.

    Science.gov (United States)

    Kurien, Biji T; Scofield, R Hal

    2006-04-01

    Western blotting (protein blotting or immunoblotting) is a powerful and important procedure for the immunodetection of proteins post-electrophoresis, particularly proteins that are of low abundance. Since the inception of the protocol for protein transfer from an electrophoresed gel to a membrane in 1979, protein blotting has evolved greatly. The scientific community is now confronted with a variety of ways and means to carry out this transfer. This review describes the various procedures that have been used to transfer proteins from a gel to a membrane based on the principles of simple diffusion, vacuum-assisted solvent flow and electrophoretic elution. Finally, a brief description of methods generally used to detect antigens on blots is also described.

  16. Northern blot analysis to investigate the abundance of microorganisms

    International Nuclear Information System (INIS)

    Krause, D.O.

    2005-01-01

    areas known as hyper-variable regions which have a high degree of sequence variation. As a result of this structure, it is possible to design signature oligonucleotide probes varying in length from about 15 to 30 nucleotides that are diagnostic of microorganisms at the kingdom, domain, genus and even species level. These signature sequences can be used in a variety of applications such as PCR analysis, construction of clone libraries or direct probing of bulk rRNA. In this chapter, I provide detailed protocols for the analysis of extracted rRNA and give detailed procedures that must be followed to do northern blot analysis of bulk RNA extracted from the rumen

  17. TLC-Blot (Far-Eastern Blot) and Its Application to Functional Lipidomics.

    Science.gov (United States)

    Taki, Takao

    2015-01-01

    A simple method for transfer of lipids-including phospholipids, glycolipids, and neutral lipids-from a high performance thin layer chromatography (HPTLC) plate to a polyvinylidene difluoride (PVDF) membrane, TLC-Blot (Far-Eastern Blot), and its biochemical applications are presented. This chapter presents the conventional procedures for separating lipid from tissue samples, cultured cells, and serum and the subsequent development of TLC. Individual lipids separated on an HPTLC plate can be transferred to the PVDF membrane quantitatively and also isolated from the lipid-blotted membrane by a one-step purification procedure. Immunodetection with monoclonal antibodies and treatment with lipid-metabolizing enzymes on the lipid-blotted membrane are possible. The method for identification of individual lipids transferred on the PVDF membrane using matrix-assisted laser desorption/ionization quadrupole ion trap time-of-flight mass spectrometry (TLC-Blot/MALDI-TOF MS) is shown as a functional lipidomics application.

  18. Immuno-Northern Blotting: Detection of RNA Modifications by Using Antibodies against Modified Nucleosides.

    Directory of Open Access Journals (Sweden)

    Eikan Mishima

    Full Text Available The biological roles of RNA modifications are still largely not understood. Thus, developing a method for detecting RNA modifications is important for further clarification. We developed a method for detecting RNA modifications called immuno-northern blotting (INB analysis and herein introduce its various capabilities. This method involves the separation of RNAs using either polyacrylamide or agarose gel electrophoresis, followed by transfer onto a nylon membrane and subsequent immunoblotting using antibodies against modified nucleosides for the detection of specific modifications. We confirmed that INB with the antibodies for 1-methyladenosine (m1A, N6-methyladenosine (m6A, pseudouridine, and 5-methylcytidine (m5C showed different modifications in a variety of RNAs from various species and organelles. INB with the anti-m5C antibody revealed that the antibody cross-reacted with another modification on DNA, suggesting the application of this method for characterization of the antibody for modified nucleosides. Additionally, using INB with the antibody for m1A, which is a highly specific modification in eukaryotic tRNA, we detected tRNA-derived fragments known as tiRNAs under the cellular stress response, suggesting the application for tracking target RNA containing specific modifications. INB with the anti-m6A antibody confirmed the demethylation of m6A by the specific demethylases fat mass and obesity-associated protein (FTO and ALKBH5, suggesting its application for quantifying target modifications in separated RNAs. Furthermore, INB demonstrated that the knockdown of FTO and ALKBH5 increased the m6A modification in small RNAs as well as in mRNA. The INB method has high specificity, sensitivity, and quantitative capability, and it can be employed with conventional experimental apparatus. Therefore, this method would be useful for research on RNA modifications and metabolism.

  19. Immuno-Northern Blotting: Detection of RNA Modifications by Using Antibodies against Modified Nucleosides.

    Science.gov (United States)

    Mishima, Eikan; Jinno, Daisuke; Akiyama, Yasutoshi; Itoh, Kunihiko; Nankumo, Shinnosuke; Shima, Hisato; Kikuchi, Koichi; Takeuchi, Yoichi; Elkordy, Alaa; Suzuki, Takehiro; Niizuma, Kuniyasu; Ito, Sadayoshi; Tomioka, Yoshihisa; Abe, Takaaki

    2015-01-01

    The biological roles of RNA modifications are still largely not understood. Thus, developing a method for detecting RNA modifications is important for further clarification. We developed a method for detecting RNA modifications called immuno-northern blotting (INB) analysis and herein introduce its various capabilities. This method involves the separation of RNAs using either polyacrylamide or agarose gel electrophoresis, followed by transfer onto a nylon membrane and subsequent immunoblotting using antibodies against modified nucleosides for the detection of specific modifications. We confirmed that INB with the antibodies for 1-methyladenosine (m1A), N6-methyladenosine (m6A), pseudouridine, and 5-methylcytidine (m5C) showed different modifications in a variety of RNAs from various species and organelles. INB with the anti-m5C antibody revealed that the antibody cross-reacted with another modification on DNA, suggesting the application of this method for characterization of the antibody for modified nucleosides. Additionally, using INB with the antibody for m1A, which is a highly specific modification in eukaryotic tRNA, we detected tRNA-derived fragments known as tiRNAs under the cellular stress response, suggesting the application for tracking target RNA containing specific modifications. INB with the anti-m6A antibody confirmed the demethylation of m6A by the specific demethylases fat mass and obesity-associated protein (FTO) and ALKBH5, suggesting its application for quantifying target modifications in separated RNAs. Furthermore, INB demonstrated that the knockdown of FTO and ALKBH5 increased the m6A modification in small RNAs as well as in mRNA. The INB method has high specificity, sensitivity, and quantitative capability, and it can be employed with conventional experimental apparatus. Therefore, this method would be useful for research on RNA modifications and metabolism.

  20. Northern and Southern blot analysis of human RNA and DNA in autopsy material

    DEFF Research Database (Denmark)

    Larsen, S; Rygaard, K; Asnaes, S

    1992-01-01

    was obtained less than two days postmortem. Histological examination showing slight or no autolysis and the presence of ribosomal bands after gel electrophoresis were both indicative parameters of RNA preservation. DNA was appropriate for Southern blotting when the tissue was obtained less than three to five...

  1. Western blotting using capillary electrophoresis.

    Science.gov (United States)

    Anderson, Gwendolyn J; M Cipolla, Cynthia; Kennedy, Robert T

    2011-02-15

    A microscale Western blotting system based on separating sodium-dodecyl sulfate protein complexes by capillary gel electrophoresis followed by deposition onto a blotting membrane for immunoassay is described. In the system, the separation capillary is grounded through a sheath capillary to a mobile X-Y translation stage which moves a blotting membrane past the capillary outlet for protein deposition. The blotting membrane is moistened with a methanol and buffer mixture to facilitate protein adsorption. Although discrete protein zones could be detected, bands were broadened by ∼1.7-fold by transfer to membrane. A complete Western blot for lysozyme was completed in about one hour with 50 pg mass detection limit from low microgram per milliliter samples. These results demonstrate substantial reduction in time requirements and improvement in mass sensitivity compared to conventional Western blots. Western blotting using capillary electrophoresis shows promise to analyze low volume samples with reduced reagents and time, while retaining the information content of a typical Western blot.

  2. Western Blotting using Capillary Electrophoresis

    OpenAIRE

    Anderson, Gwendolyn J.; Cipolla, Cynthia; Kennedy, Robert T.

    2011-01-01

    A microscale Western blotting system based on separating sodium-dodecyl sulfate protein complexes by capillary gel electrophoresis followed by deposition onto a blotting membrane for immunoassay is described. In the system, the separation capillary is grounded through a sheath capillary to a mobile X-Y translation stage which moves a blotting membrane past the capillary outlet for protein deposition. The blotting membrane is moistened with a methanol and buffer mixture to facilitate protein a...

  3. Southern blotting.

    Science.gov (United States)

    Brown, T

    2001-05-01

    Southern blotting is the transfer of DNA fragments from an electrophoresis gel to a membrane support (the properties and advantages of the different types of membrane, transfer buffer, and transfer method are discussed in detail), resulting in immobilization of the DNA fragments, so the membrane carries a semipermanent reproduction of the banding pattern of the gel. After immobilization, the DNA can be subjected to hybridization analysis, enabling bands with sequence similarity to a labeled probe to be identified. This appendix describes Southern blotting via upward capillary transfer of DNA from an agarose gel onto a nylon or nitrocellulose membrane, using a high-salt transfer buffer to promote binding of DNA to the membrane. With the high-salt buffer, the DNA becomes bound to the membrane during transfer but not permanently immobilized. Immobilization is achieved by UV irradiation (for nylon) or baking (for nitrocellulose). A Support Protocol describes how to calibrate a UV transilluminator for optimal UV irradiation of a nylon membrane. An alternate protocol details transfer using nylon membranes and an alkaline buffer, and is primarily used with positively charged nylon membranes. The advantage of this combination is that no post-transfer immobilization step is required, as the positively charged membrane binds DNA irreversibly under alkaline transfer conditions. The method can also be used with neutral nylon membranes but less DNA will be retained. A second alternate protocol describes a transfer method based on a different transfer-stack setup. The traditional method of upward capillary transfer of DNA from gel to membrane described in the first basic and alternate protocols has certain disadvantages, notably the fact that the gel can become crushed by the weighted filter papers and paper towels that are laid on top of it. This slows down the blotting process and may reduce the amount of DNA that can be transferred. The downward capillary method described in

  4. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  5. Introduction to protein blotting.

    Science.gov (United States)

    Kurien, Biji T; Scofield, R Hal

    2009-01-01

    Protein blotting is a powerful and important procedure for the immunodetection of proteins following electrophoresis, particularly proteins that are of low abundance. Since the inception of the protocol for protein transfer from an electrophoresed gel to a membrane in 1979, protein blotting has evolved greatly. The scientific community is now confronted with a variety of ways and means to carry out this transfer.

  6. Aye-aye population genomic analyses highlight an important center of endemism in northern Madagascar.

    Science.gov (United States)

    Perry, George H; Louis, Edward E; Ratan, Aakrosh; Bedoya-Reina, Oscar C; Burhans, Richard C; Lei, Runhua; Johnson, Steig E; Schuster, Stephan C; Miller, Webb

    2013-04-09

    We performed a population genomics study of the aye-aye, a highly specialized nocturnal lemur from Madagascar. Aye-ayes have low population densities and extensive range requirements that could make this flagship species particularly susceptible to extinction. Therefore, knowledge of genetic diversity and differentiation among aye-aye populations is critical for conservation planning. Such information may also advance our general understanding of Malagasy biogeography, as aye-ayes have the largest species distribution of any lemur. We generated and analyzed whole-genome sequence data for 12 aye-ayes from three regions of Madagascar (North, West, and East). We found that the North population is genetically distinct, with strong differentiation from other aye-ayes over relatively short geographic distances. For comparison, the average FST value between the North and East aye-aye populations--separated by only 248 km--is over 2.1-times greater than that observed between human Africans and Europeans. This finding is consistent with prior watershed- and climate-based hypotheses of a center of endemism in northern Madagascar. Taken together, these results suggest a strong and long-term biogeographical barrier to gene flow. Thus, the specific attention that should be directed toward preserving large, contiguous aye-aye habitats in northern Madagascar may also benefit the conservation of other distinct taxonomic units. To help facilitate future ecological- and conservation-motivated population genomic analyses by noncomputational biologists, the analytical toolkit used in this study is available on the Galaxy Web site.

  7. Western blotting: an introduction.

    Science.gov (United States)

    Kurien, Biji T; Scofield, R Hal

    2015-01-01

    Western blotting is an important procedure for the immunodetection of proteins, particularly proteins that are of low abundance. This process involves the transfer of protein patterns from gel to microporous membrane. Electrophoretic as well as non-electrophoretic transfer of proteins to membranes was first described in 1979. Protein blotting has evolved greatly since the inception of this protocol, allowing protein transfer to be accomplished in a variety of ways.

  8. Detection of proteins on blot transfer membranes.

    Science.gov (United States)

    Sasse, Joachim; Gallagher, Sean R

    2003-11-01

    In the basic and alternate protocols of this unit, proteins are stained after electroblotting from polyacrylamide gels to blot transfer membranes. If the samples of interest are electrophoresed in duplicate and transferred to a blot transfer membrane, half of the membrane can be stained to determine the efficiency of transfer to the membrane and the other half can be used for immunoblotting (i.e., western blotting). Detection limits of each staining method are given along with a list of compatible blot transfer membranes and gels. A support protocol describes a method for alkali treatment that enhances subsequent staining of bound proteins.

  9. [Better performance of Western blotting: quick vs slow protein transfer, blotting membranes and the visualization methods].

    Science.gov (United States)

    Kong, Ling-Quan; Pu, Ying-Hui; Ma, Shi-Kun

    2008-01-01

    To study how the choices of the quick vs slow protein transfer, the blotting membranes and the visualization methods influence the performance of Western blotting. The cellular proteins were abstracted from human breast cell line MDA-MB-231 for analysis with Western blotting using quick (2 h) and slow (overnight) protein transfer, different blotting membranes (nitrocellulose, PVDF and nylon membranes) and different visualization methods (ECL and DAB). In Western blotting with slow and quick protein transfer, the prestained marker presented more distinct bands on nitrocellulose membrane than on the nylon and PVDF membranes, and the latter also showed clear bands on the back of the membrane to very likely cause confusion, which did not occur with nitrocellulose membrane. PVDF membrane allowed slightly clearer visualization of the proteins with DAB method as compared with nitrocellulose and nylon membranes, and on the latter two membranes, quick protein transfer was likely to result in somehow irregular bands in comparison with slow protein transfer. With slow protein transfer and chemiluminescence for visualization, all the 3 membranes showed clear background, while with quick protein transfer, nylon membrane gave rise to obvious background noise but the other two membranes did not. Different membranes should be selected for immunoblotting according to the actual needs of the experiment. Slow transfer of the proteins onto the membranes often has better effect than quick transfer, and enhanced chemiluminescence is superior to DAB for protein visualization and allows highly specific and sensitive analysis of the protein expressions.

  10. The Design of a Quantitative Western Blot Experiment

    Directory of Open Access Journals (Sweden)

    Sean C. Taylor

    2014-01-01

    Full Text Available Western blotting is a technique that has been in practice for more than three decades that began as a means of detecting a protein target in a complex sample. Although there have been significant advances in both the imaging and reagent technologies to improve sensitivity, dynamic range of detection, and the applicability of multiplexed target detection, the basic technique has remained essentially unchanged. In the past, western blotting was used simply to detect a specific target protein in a complex mixture, but now journal editors and reviewers are requesting the quantitative interpretation of western blot data in terms of fold changes in protein expression between samples. The calculations are based on the differential densitometry of the associated chemiluminescent and/or fluorescent signals from the blots and this now requires a fundamental shift in the experimental methodology, acquisition, and interpretation of the data. We have recently published an updated approach to produce quantitative densitometric data from western blots (Taylor et al., 2013 and here we summarize the complete western blot workflow with a focus on sample preparation and data analysis for quantitative western blotting.

  11. Western Blotting of the Endocannabinoid System.

    Science.gov (United States)

    Wager-Miller, Jim; Mackie, Ken

    2016-01-01

    Measuring expression levels of G protein-coupled receptors (GPCRs) is an important step for understanding the distribution, function, and regulation of these receptors. A common approach for detecting proteins from complex biological systems is Western blotting. In this chapter, we describe a general approach to Western blotting protein components of the endocannabinoid system using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and nitrocellulose membranes, with a focus on detecting type 1 cannabinoid (CB1) receptors. When this technique is carefully used, specifically with validation of the primary antibodies, it can provide quantitative information on protein expression levels. Additional information can also be inferred from Western blotting such as potential posttranslational modifications that can be further evaluated by specific analytical techniques.

  12. Comparative Genomics and Transcriptional Analysis of Prophages Identified in the Genomes of Lactobacillus gasseri, Lactobacillus salivarius, and Lactobacillus casei†

    Science.gov (United States)

    Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Altermann, Eric; Barrangou, Rodolphe; McGrath, Stephen; Claesson, Marcus J.; Li, Yin; Leahy, Sinead; Walker, Carey D.; Zink, Ralf; Neviani, Erasmo; Steele, Jim; Broadbent, Jeff; Klaenhammer, Todd R.; Fitzgerald, Gerald F.; O'Toole, Paul W.; van Sinderen, Douwe

    2006-01-01

    Lactobacillus gasseri ATCC 33323, Lactobacillus salivarius subsp. salivarius UCC 118, and Lactobacillus casei ATCC 334 contain one (LgaI), four (Sal1, Sal2, Sal3, Sal4), and one (Lca1) distinguishable prophage sequences, respectively. Sequence analysis revealed that LgaI, Lca1, Sal1, and Sal2 prophages belong to the group of Sfi11-like pac site and cos site Siphoviridae, respectively. Phylogenetic investigation of these newly described prophage sequences revealed that they have not followed an evolutionary development similar to that of their bacterial hosts and that they show a high degree of diversity, even within a species. The attachment sites were determined for all these prophage elements; LgaI as well as Sal1 integrates in tRNA genes, while prophage Sal2 integrates in a predicted arginino-succinate lyase-encoding gene. In contrast, Lca1 and the Sal3 and Sal4 prophage remnants are integrated in noncoding regions in the L. casei ATCC 334 and L. salivarius UCC 118 genomes. Northern analysis showed that large parts of the prophage genomes are transcriptionally silent and that transcription is limited to genome segments located near the attachment site. Finally, pulsed-field gel electrophoresis followed by Southern blot hybridization with specific prophage probes indicates that these prophage sequences are narrowly distributed within lactobacilli. PMID:16672450

  13. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  14. Draft genome sequence of chloride-tolerant Leptospirillum ferriphilum Sp-Cl from industrial bioleaching operations in northern Chile.

    Science.gov (United States)

    Issotta, Francisco; Galleguillos, Pedro A; Moya-Beltrán, Ana; Davis-Belmar, Carol S; Rautenbach, George; Covarrubias, Paulo C; Acosta, Mauricio; Ossandon, Francisco J; Contador, Yasna; Holmes, David S; Marín-Eliantonio, Sabrina; Quatrini, Raquel; Demergasso, Cecilia

    2016-01-01

    Leptospirillum ferriphilum Sp-Cl is a Gram negative, thermotolerant, curved, rod-shaped bacterium, isolated from an industrial bioleaching operation in northern Chile, where chalcocite is the major copper mineral and copper hydroxychloride atacamite is present in variable proportions in the ore. This strain has unique features as compared to the other members of the species, namely resistance to elevated concentrations of chloride, sulfate and metals. Basic microbiological features and genomic properties of this biotechnologically relevant strain are described in this work. The 2,475,669 bp draft genome is arranged into 74 scaffolds of 74 contigs. A total of 48 RNA genes and 2,834 protein coding genes were predicted from its annotation; 55 % of these were assigned a putative function. Release of the genome sequence of this strain will provide further understanding of the mechanisms used by acidophilic bacteria to endure high osmotic stress and high chloride levels and of the role of chloride-tolerant iron-oxidizers in industrial bioleaching operations.

  15. Virtual Northern analysis of the human genome.

    Directory of Open Access Journals (Sweden)

    Evan H Hurowitz

    2007-05-01

    Full Text Available We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale.We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90% confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs tend to be longer or shorter than average; these functional classes were similar in both human and yeast.Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

  16. Virtual Northern analysis of the human genome.

    Science.gov (United States)

    Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

    2007-05-23

    We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

  17. Multiplexed Western Blotting Using Microchip Electrophoresis.

    Science.gov (United States)

    Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T

    2016-07-05

    Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.

  18. A novel rat genomic simple repeat DNA with RNA-homology shows triplex (H-DNA)-like structure and tissue-specific RNA expression

    International Nuclear Information System (INIS)

    Dey, Indranil; Rath, Pramod C.

    2005-01-01

    Mammalian genome contains a wide variety of repetitive DNA sequences of relatively unknown function. We report a novel 227 bp simple repeat DNA (3.3 DNA) with a d {(GA) 7 A (AG) 7 } dinucleotide mirror repeat from the rat (Rattus norvegicus) genome. 3.3 DNA showed 75-85% homology with several eukaryotic mRNAs due to (GA/CU) n dinucleotide repeats by nBlast search and a dispersed distribution in the rat genome by Southern blot hybridization with [ 32 P]3.3 DNA. The d {(GA) 7 A (AG) 7 } mirror repeat formed a triplex (H-DNA)-like structure in vitro. Two large RNAs of 9.1 and 7.5 kb were detected by [ 32 P]3.3 DNA in rat brain by Northern blot hybridization indicating expression of such simple sequence repeats at RNA level in vivo. Further, several cDNAs were isolated from a rat cDNA library by [ 32 P]3.3 DNA probe. Three such cDNAs showed tissue-specific RNA expression in rat. pRT 4.1 cDNA showed strong expression of a 2.39 kb RNA in brain and spleen, pRT 5.5 cDNA showed strong expression of a 2.8 kb RNA in brain and a 3.9 kb RNA in lungs, and pRT 11.4 cDNA showed weak expression of a 2.4 kb RNA in lungs. Thus, genomic simple sequence repeats containing d (GA/CT) n dinucleotides are transcriptionally expressed and regulated in rat tissues. Such d (GA/CT) n dinucleotide repeats may form structural elements (e.g., triplex) which may be sites for functional regulation of genomic coding sequences as well as RNAs. This may be a general function of such transcriptionally active simple sequence repeats widely dispersed in mammalian genome

  19. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida).

    Science.gov (United States)

    Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M

    1996-07-01

    Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.

  20. Multistrip western blotting to increase quantitative data output.

    Science.gov (United States)

    Kiyatkin, Anatoly; Aksamitiene, Edita

    2009-01-01

    The qualitative and quantitative measurements of protein abundance and modification states are essential in understanding their functions in diverse cellular processes. Typical western blotting, though sensitive, is prone to produce substantial errors and is not readily adapted to high-throughput technologies. Multistrip western blotting is a modified immunoblotting procedure based on simultaneous electrophoretic transfer of proteins from multiple strips of polyacrylamide gels to a single membrane sheet. In comparison with the conventional technique, Multistrip western blotting increases the data output per single blotting cycle up to tenfold, allows concurrent monitoring of up to nine different proteins from the same loading of the sample, and substantially improves the data accuracy by reducing immunoblotting-derived signal errors. This approach enables statistically reliable comparison of different or repeated sets of data, and therefore is beneficial to apply in biomedical diagnostics, systems biology, and cell signaling research.

  1. Northern Spotted Owl (Strix occidentalis caurina) Genome: Divergence with the Barred Owl (Strix varia) and Characterization of Light-Associated Genes.

    Science.gov (United States)

    Hanna, Zachary R; Henderson, James B; Wall, Jeffrey D; Emerling, Christopher A; Fuchs, Jérôme; Runckel, Charles; Mindell, David P; Bowie, Rauri C K; DeRisi, Joseph L; Dumbacher, John P

    2017-10-01

    We report here the assembly of a northern spotted owl (Strix occidentalis caurina) genome. We generated Illumina paired-end sequence data at 90× coverage using nine libraries with insert lengths ranging from ∼250 to 9,600 nt and read lengths from 100 to 375 nt. The genome assembly is comprised of 8,108 scaffolds totaling 1.26 × 109 nt in length with an N50 length of 3.98 × 106 nt. We calculated the genome-wide fixation index (FST) of S. o. caurina with the closely related barred owl (Strix varia) as 0.819. We examined 19 genes that encode proteins with light-dependent functions in our genome assembly as well as in that of the barn owl (Tyto alba). We present genomic evidence for loss of three of these in S. o. caurina and four in T. alba. We suggest that most light-associated gene functions have been maintained in owls and their loss has not proceeded to the same extent as in other dim-light-adapted vertebrates. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. The (in)complete organelle genome: exploring the use and nonuse of available technologies for characterizing mitochondrial and plastid chromosomes.

    Science.gov (United States)

    Sanitá Lima, Matheus; Woods, Laura C; Cartwright, Matthew W; Smith, David Roy

    2016-11-01

    Not long ago, scientists paid dearly in time, money and skill for every nucleotide that they sequenced. Today, DNA sequencing technologies epitomize the slogan 'faster, easier, cheaper and more', and in many ways, sequencing an entire genome has become routine, even for the smallest laboratory groups. This is especially true for mitochondrial and plastid genomes. Given their relatively small sizes and high copy numbers per cell, organelle DNAs are currently among the most highly sequenced kind of chromosome. But accurately characterizing an organelle genome and the information it encodes can require much more than DNA sequencing and bioinformatics analyses. Organelle genomes can be surprisingly complex and can exhibit convoluted and unconventional modes of gene expression. Unravelling this complexity can demand a wide assortment of experiments, from pulsed-field gel electrophoresis to Southern and Northern blots to RNA analyses. Here, we show that it is exactly these types of 'complementary' analyses that are often lacking from contemporary organelle genome papers, particularly short 'genome announcement' articles. Consequently, crucial and interesting features of organelle chromosomes are going undescribed, which could ultimately lead to a poor understanding and even a misrepresentation of these genomes and the genes they express. High-throughput sequencing and bioinformatics have made it easy to sequence and assemble entire chromosomes, but they should not be used as a substitute for or at the expense of other types of genomic characterization methods. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  3. Other notable protein blotting methods: a brief review.

    Science.gov (United States)

    Kurien, Biji T; Scofield, R Hal

    2015-01-01

    Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

  4. Western blotting using chemiluminescent substrates.

    Science.gov (United States)

    Alegria-Schaffer, Alice

    2014-01-01

    Western blotting is a powerful and commonly used tool to identify and quantify a specific protein in a complex mixture (Towbin et al., 1979). The technique enables indirect detection of protein samples immobilized on a nitrocellulose or polyvinylidene fluoride (PVDF) membrane. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Multistrip Western blotting to increase quantitative data output

    OpenAIRE

    Kiyatkin, Anatoly; Aksamitiene, Edita

    2009-01-01

    The qualitative and quantitative measurements of protein abundance and modification states are essential in understanding their functions in diverse cellular processes. Typical Western blotting, though sensitive, is prone to produce substantial errors and is not readily adapted to high-throughput technologies. Multistrip Western blotting is a modified immunoblotting procedure based on simultaneous electrophoretic transfer of proteins from multiple strips of polyacrylamide gels to a single mem...

  6. Annotated Draft Genome Assemblies for the Northern Bobwhite (Colinus virginianus) and the Scaled Quail (Callipepla squamata) Reveal Disparate Estimates of Modern Genome Diversity and Historic Effective Population Size.

    Science.gov (United States)

    Oldeschulte, David L; Halley, Yvette A; Wilson, Miranda L; Bhattarai, Eric K; Brashear, Wesley; Hill, Joshua; Metz, Richard P; Johnson, Charles D; Rollins, Dale; Peterson, Markus J; Bickhart, Derek M; Decker, Jared E; Sewell, John F; Seabury, Christopher M

    2017-09-07

    Northern bobwhite ( Colinus virginianus ; hereafter bobwhite) and scaled quail ( Callipepla squamata ) populations have suffered precipitous declines across most of their US ranges. Illumina-based first- (v1.0) and second- (v2.0) generation draft genome assemblies for the scaled quail and the bobwhite produced N50 scaffold sizes of 1.035 and 2.042 Mb, thereby producing a 45-fold improvement in contiguity over the existing bobwhite assembly, and ≥90% of the assembled genomes were captured within 1313 and 8990 scaffolds, respectively. The scaled quail assembly (v1.0 = 1.045 Gb) was ∼20% smaller than the bobwhite (v2.0 = 1.254 Gb), which was supported by kmer-based estimates of genome size. Nevertheless, estimates of GC content (41.72%; 42.66%), genome-wide repetitive content (10.40%; 10.43%), and MAKER-predicted protein coding genes (17,131; 17,165) were similar for the scaled quail (v1.0) and bobwhite (v2.0) assemblies, respectively. BUSCO analyses utilizing 3023 single-copy orthologs revealed a high level of assembly completeness for the scaled quail (v1.0; 84.8%) and the bobwhite (v2.0; 82.5%), as verified by comparison with well-established avian genomes. We also detected 273 putative segmental duplications in the scaled quail genome (v1.0), and 711 in the bobwhite genome (v2.0), including some that were shared among both species. Autosomal variant prediction revealed ∼2.48 and 4.17 heterozygous variants per kilobase within the scaled quail (v1.0) and bobwhite (v2.0) genomes, respectively, and estimates of historic effective population size were uniformly higher for the bobwhite across all time points in a coalescent model. However, large-scale declines were predicted for both species beginning ∼15-20 KYA. Copyright © 2017 Oldeschulte et al.

  7. Annotated Draft Genome Assemblies for the Northern Bobwhite (Colinus virginianus and the Scaled Quail (Callipepla squamata Reveal Disparate Estimates of Modern Genome Diversity and Historic Effective Population Size

    Directory of Open Access Journals (Sweden)

    David L. Oldeschulte

    2017-09-01

    Full Text Available Northern bobwhite (Colinus virginianus; hereafter bobwhite and scaled quail (Callipepla squamata populations have suffered precipitous declines across most of their US ranges. Illumina-based first- (v1.0 and second- (v2.0 generation draft genome assemblies for the scaled quail and the bobwhite produced N50 scaffold sizes of 1.035 and 2.042 Mb, thereby producing a 45-fold improvement in contiguity over the existing bobwhite assembly, and ≥90% of the assembled genomes were captured within 1313 and 8990 scaffolds, respectively. The scaled quail assembly (v1.0 = 1.045 Gb was ∼20% smaller than the bobwhite (v2.0 = 1.254 Gb, which was supported by kmer-based estimates of genome size. Nevertheless, estimates of GC content (41.72%; 42.66%, genome-wide repetitive content (10.40%; 10.43%, and MAKER-predicted protein coding genes (17,131; 17,165 were similar for the scaled quail (v1.0 and bobwhite (v2.0 assemblies, respectively. BUSCO analyses utilizing 3023 single-copy orthologs revealed a high level of assembly completeness for the scaled quail (v1.0; 84.8% and the bobwhite (v2.0; 82.5%, as verified by comparison with well-established avian genomes. We also detected 273 putative segmental duplications in the scaled quail genome (v1.0, and 711 in the bobwhite genome (v2.0, including some that were shared among both species. Autosomal variant prediction revealed ∼2.48 and 4.17 heterozygous variants per kilobase within the scaled quail (v1.0 and bobwhite (v2.0 genomes, respectively, and estimates of historic effective population size were uniformly higher for the bobwhite across all time points in a coalescent model. However, large-scale declines were predicted for both species beginning ∼15–20 KYA.

  8. Western Blot of Stained Proteins from Dried Polyacrylamide Gels

    Science.gov (United States)

    Gruber, Claudia; Stan-Lotter, Helga

    1996-01-01

    Western blotting of proteins is customarily performed following their separation on polyacrylamide gels, either prior to staining (1) or, as recently reported, following staining (2). We describe here Western blotting with stained gels, which had been dried and some of which had been stored for years. This procedure permits immunological analysis of proteins, to which antisera may have become available only later, or where the application of newly developed sensitive detection methods is desired. Once rehydration of the gels is achieved, proteins can be-transferred to blotting membranes by any appropriate protocol. Proteins stained with Coomassie Blue have to be detected with a non-chromogenic method, such as the film-based enhanced chemiluminescence (ECL)2) procedure (3). Silver stained proteins, which transfer in the colorless form, may be visualized by any detection method, although, because of the usually very low amounts of proteins, detection by ECL is preferable. Blotting of stained proteins from rehydrated gels is as rapid and as quantitative as from freshly prepared gels, in contrast to blotting from wet stained gels, which requires extensive washing and results in low transfer efficiency (2). Together with a photographic record of the gel pattern, unambiguous identification of immunoreactive proteins from complex mixtures is possible. Some further applications of this work are discussed.

  9. Post-staining electroblotting for efficient and reliable peptide blotting.

    Science.gov (United States)

    Lee, Der-Yen; Chang, Geen-Dong

    2015-01-01

    Post-staining electroblotting has been previously described to transfer Coomassie blue-stained proteins from polyacrylamide gel onto polyvinylidene difluoride (PVDF) membranes. Actually, stained peptides can also be efficiently and reliably transferred. Because of selective staining procedures for peptides and increased retention of stained peptides on the membrane, even peptides with molecular masses less than 2 kDa such as bacitracin and granuliberin R are transferred with satisfactory results. For comparison, post-staining electroblotting is about 16-fold more sensitive than the conventional electroblotting for visualization of insulin on the membrane. Therefore, the peptide blots become practicable and more accessible to further applications, e.g., blot overlay detection or immunoblotting analysis. In addition, the efficiency of peptide transfer is favorable for N-terminal sequence analysis. With this method, peptide blotting can be normalized for further analysis such as blot overlay assay, immunoblotting, and N-terminal sequencing for identification of peptide in crude or partially purified samples.

  10. A simple, rapid and efficient method for the extraction of genomic ...

    African Journals Online (AJOL)

    The isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including long range PCR, endonuclease restriction digestion, southern blot analysis, and genomic library construction. Many protocols are available for the extraction of DNA from plant material, but obtain it is ...

  11. Ultrasensitive Detection of Proteins on Western Blots with Semiconducting Polymer Dots

    OpenAIRE

    Ye, Fangmao; Smith, Polina B.; Wu, Changfeng; Chiu, Daniel T.

    2013-01-01

    We demonstrate ultrasensitive fluorescence imaging of proteins on Western blots using a bright, compact, and orange-emitting semiconducting polymer dot (CN-PPV). We achieved a detection limit at the single-picogram level in dot blots; with conventional Western blotting, we detected 50 pg of transferrin and trypsin inhibitor after SDS-PAGE and transfer onto a PVDF membrane. Our method does not require any additional equipment or time compared to the conventional procedure with traditional fluo...

  12. Plastid genome structure and loss of photosynthetic ability in the parasitic genus Cuscuta.

    Science.gov (United States)

    Revill, Meredith J W; Stanley, Susan; Hibberd, Julian M

    2005-09-01

    The genus Cuscuta (dodder) is composed of parasitic plants, some species of which appear to be losing the ability to photosynthesize. A molecular phylogeny was constructed using 15 species of Cuscuta in order to assess whether changes in photosynthetic ability and alterations in structure of the plastid genome relate to phylogenetic position within the genus. The molecular phylogeny provides evidence for four major clades within Cuscuta. Although DNA blot analysis showed that Cuscuta species have smaller plastid genomes than tobacco, and that plastome size varied significantly even within one Cuscuta clade, dot blot analysis indicated that the dodders possess homologous sequence to 101 genes from the tobacco plastome. Evidence is provided for significant rates of DNA transfer from plastid to nucleus in Cuscuta. Size and structure of Cuscuta plastid genomes, as well as photosynthetic ability, appear to vary independently of position within the phylogeny, thus supporting the hypothesis that within Cuscuta photosynthetic ability and organization of the plastid genome are changing in an unco-ordinated manner.

  13. A brief review of other notable protein blotting methods.

    Science.gov (United States)

    Kurien, Biji T; Scofield, R Hal

    2009-01-01

    A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

  14. Characterization of genomic sequence of a drought-resistant gene ...

    Indian Academy of Sciences (India)

    to study the genomics of polyploid plants, as most pro- genitors have been ... had been shown to constitute significant stress in pilot exper- iments. Untreated ... Southern blotting, real-time quantitative PCR and total soluble sugar analysis.

  15. In Situ Blotting : A Novel Method for Direct Transfer of Native Proteins from Sectioned Tissue to Blotting Membrane

    NARCIS (Netherlands)

    Okabe, Masashi; Nyakas, Csaba; Buwalda, Bauke; Luiten, Paul G.M.

    1993-01-01

    We describe a novel technique for direct transfer of native proteins from unfixed frozen tissue sections to an immobilizing matrix, e.g., nitrocellulose, polyvinyliden difluoride, or positively charged nylon membranes. Proteins are directly blotted onto the membrane, providing optimal accessibility

  16. St2-80: a new FISH marker for St genome and genome analysis in Triticeae.

    Science.gov (United States)

    Wang, Long; Shi, Qinghua; Su, Handong; Wang, Yi; Sha, Lina; Fan, Xing; Kang, Houyang; Zhang, Haiqin; Zhou, Yonghong

    2017-07-01

    The St genome is one of the most fundamental genomes in Triticeae. Repetitive sequences are widely used to distinguish different genomes or species. The primary objectives of this study were to (i) screen a new sequence that could easily distinguish the chromosome of the St genome from those of other genomes by fluorescence in situ hybridization (FISH) and (ii) investigate the genome constitution of some species that remain uncertain and controversial. We used degenerated oligonucleotide primer PCR (Dop-PCR), Dot-blot, and FISH to screen for a new marker of the St genome and to test the efficiency of this marker in the detection of the St chromosome at different ploidy levels. Signals produced by a new FISH marker (denoted St 2 -80) were present on the entire arm of chromosomes of the St genome, except in the centromeric region. On the contrary, St 2 -80 signals were present in the terminal region of chromosomes of the E, H, P, and Y genomes. No signal was detected in the A and B genomes, and only weak signals were detected in the terminal region of chromosomes of the D genome. St 2 -80 signals were obvious and stable in chromosomes of different genomes, whether diploid or polyploid. Therefore, St 2 -80 is a potential and useful FISH marker that can be used to distinguish the St genome from those of other genomes in Triticeae.

  17. Seroprevalence of bovine theileriosis in northern China

    Directory of Open Access Journals (Sweden)

    Yaqiong Li

    2016-11-01

    Full Text Available Abstract Background Bovine theileriosis is a common disease transmitted by ticks, and can cause loss of beef and dairy cattle worldwide. Here, an indirect enzyme-linked immunosorbent assay (iELISA based on Theileria luwenshuni surface protein (TlSP was developed and used to carry out a seroepidemiological survey of bovine theileriosis in northern China. Methods We used the BugBuster Ni-NTA His•Bind Purification Kit to purify recombinant TlSP (rTlSP, which was subsequently analyzed by Western Blotting to evaluate cross-reactivity with other pathogen-positive sera. The iELISA method based on rTlSP was successfully developed. Sera from 2005 blood samples were tested with the rTlSP-iELISA method, and blood smears from these samples were observed by microscopy. Results The specificity of iELISA was 98.9%, the sensitivity was 98.5%, and the cut-off was selected as 24.6%. Western Blot analysis of rTlSP confirmed that there were cross-reactions with Theileria luwenshuni, Theileria uilenbergi, Theileria ovis, Theileria annulata, Theileria orientalis and Theileria sinensis. The epidemiological survey showed that the highest positive rate of bovine theileriosis was 98.3%, the lowest rate was 84.1%, and the average positive rate was 95.4% by iELISA. With microscopy, the highest positive rate was 38.9%, the lowest rate was 5.1%, and the relative average positive rate was 13.7%. Conclusions An rTlSP-iELISA was developed to detect circulating antibodies against bovine Theileria in northern China. This is the first report on the seroprevalence of bovine theileriosis in northern China, and it also provides seroepidemiological data on bovine theileriosis in China.

  18. Fluorescence-based Western blotting for quantitation of protein biomarkers in clinical samples.

    Science.gov (United States)

    Zellner, Maria; Babeluk, Rita; Diestinger, Michael; Pirchegger, Petra; Skeledzic, Senada; Oehler, Rudolf

    2008-09-01

    Since most high throughput techniques used in biomarker discovery are very time and cost intensive, highly specific and quantitative analytical alternative application methods are needed for the routine analysis. Conventional Western blotting allows detection of specific proteins to the level of single isotypes while its quantitative accuracy is rather limited. We report a novel and improved quantitative Western blotting method. The use of fluorescently labelled secondary antibodies strongly extends the dynamic range of the quantitation and improves the correlation with the protein amount (r=0.997). By an additional fluorescent staining of all proteins immediately after their transfer to the blot membrane, it is possible to visualise simultaneously the antibody binding and the total protein profile. This allows for an accurate correction for protein load. Applying this normalisation it could be demonstrated that fluorescence-based Western blotting is able to reproduce a quantitative analysis of two specific proteins in blood platelet samples from 44 subjects with different diseases as initially conducted by 2D-DIGE. These results show that the proposed fluorescence-based Western blotting is an adequate application technique for biomarker quantitation and suggest possibilities of employment that go far beyond.

  19. SDS-Polyacrylamide Electrophoresis and Western Blotting Applied to the Study of Asthma.

    Science.gov (United States)

    García-Solaesa, Virginia; Abad, Sara Ciria

    2016-01-01

    Western blotting is used to analyze proteins after being separated by electrophoresis and subsequently electro-transferred to a membrane. Once immobilized, a specific protein can be identified through its reaction with a labeled antibody or antigen. It is a methodology commonly used in biomedical research such as asthma studies, to assess the pathways of inflammatory mediators involved in the disease.Here, we describe an example of western blotting to determine the factors involved in asthma. In this chapter, the methodology of western blotting is reviewed, paying attention on potential problems and giving interesting recommendations.

  20. Multistrip Western blotting: a tool for comparative quantitative analysis of multiple proteins.

    Science.gov (United States)

    Aksamitiene, Edita; Hoek, Jan B; Kiyatkin, Anatoly

    2015-01-01

    The qualitative and quantitative measurements of protein abundance and modification states are essential in understanding their functions in diverse cellular processes. Typical Western blotting, though sensitive, is prone to produce substantial errors and is not readily adapted to high-throughput technologies. Multistrip Western blotting is a modified immunoblotting procedure based on simultaneous electrophoretic transfer of proteins from multiple strips of polyacrylamide gels to a single membrane sheet. In comparison with the conventional technique, Multistrip Western blotting increases data output per single blotting cycle up to tenfold; allows concurrent measurement of up to nine different total and/or posttranslationally modified protein expression obtained from the same loading of the sample; and substantially improves the data accuracy by reducing immunoblotting-derived signal errors. This approach enables statistically reliable comparison of different or repeated sets of data and therefore is advantageous to apply in biomedical diagnostics, systems biology, and cell signaling research.

  1. TMEPAI genome editing in triple negative breast cancer cells

    Directory of Open Access Journals (Sweden)

    Bantari W.K. Wardhani

    2017-05-01

    Full Text Available Background: Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9 is a powerful genome editing technique. It consists of RNA-guided DNA endonuclease Cas9 and single guide RNA (gRNA. By combining their expressions, high efficiency cleavage of the target gene can be achieved, leading to the formation of DNA double-strand break (DSB at the genomic locus of interest which will be repaired via NHEJ (non-homologous end joining or HDR (homology-directed repair and mediate DNA alteration. We aimed to apply the CRISPR/Cas9 technique to knock-out the transmembrane prostate androgen-induced protein (TMEPAI gene in the triple negative breast cancer cell line.Methods: Designed gRNA which targets the TMEPAI gene was synthesized, annealed, and cloned into gRNA expression vector. It was co-transfected into the TNBC cell line using polyethylenimine (PEI together with Cas9-GFP and puromycin resistant gene vector. At 24-hours post-transfection, cells were selected by puromycin for 3 days before they were cloned. Selected knock-out clones were subsequently checked on their protein levels by western blotting.Results: CRISPR/Cas9, a genome engineering technique successfully knocked-out TMEPAI in the Hs578T TNBC cell line. Sequencing shows a frameshift mutation in TMEPAI. Western blot shows the absence of TMEPAI band on Hs578T KO cells.Conclusion: TMEPAI gene was deleted in the TNBC cell line using the genomic editing technique CRISPR/Cas9. The deletion was confirmed by genome and protein analysis.

  2. Genomic characterisation of Almpiwar virus, Harrison Dam virus and Walkabout Creek virus; three novel rhabdoviruses from northern Australia

    Directory of Open Access Journals (Sweden)

    Jane McAllister

    2014-09-01

    Full Text Available Rhabdoviridae represent a diverse group of viruses with the potential to cause disease in humans, animals and plants. Currently there are nine genera in the family; however a large number of rhabdoviruses remain unassigned. Here we characterise three novel rhabdoviruses genomes. Almpiwar virus (ALMV, isolated from skinks in northern Queensland, is the first completely sequenced rhabdovirus from squamates, with serological studies indicating multiple animal host species. Harrison Dam virus (HARDV and Walkabout Creek virus (WACV were isolated from mosquitoes in the Northern Territory and biting midges in southern Queensland respectively and their vertebrate hosts remain unknown. Serological cross-neutralisation tests with other Australian rhabdoviruses indicate that ALMV, WACV and HARDV are distinct viruses with little antigenic cross-reactivity. Next-generation sequencing revealed that all viruses encode the core proteins common to rhabdoviruses (N, P, M, G and L, plus additional ORFs between the M and G genes. HARDV also contains a small ORF between the G and L genes. Phylogenetic analysis of N and L proteins suggests that HARDV and WACV share a common lineage with the tupaviruses and Sandjimba group, whereas ALMV is a distinct and divergent virus showing no clear relationship to any rhabdovirus except the recently characterised Niahka virus (NIAV.

  3. A Laboratory Exercise Illustrating the Sensitivity and Specificity of Western Blot Analysis

    Science.gov (United States)

    Chang, Ming-Mei; Lovett, Janice

    2011-01-01

    Western blot analysis, commonly known as "Western blotting," is a standard tool in every laboratory where proteins are analyzed. It involves the separation of polypeptides in polyacrylamide gels followed by the electrophoretic transfer of the separated polypeptides onto a nitrocellulose or polyvinylidene fluoride membrane. A replica of the…

  4. Zinc blotting assay for detection of zinc binding prolamin in barley (Hordeum vulgare) grain

    DEFF Research Database (Denmark)

    Uddin, Mohammad Nasir; Nielsen, Ane Langkilde-Lauesen; Vincze, Eva

    2014-01-01

    In plants, zinc is commonly found bound to proteins. In barley (Hordeum vulgare), major storage proteins are alcohol-soluble prolamins known as hordeins, and some of them have the potential to bind or store zinc. 65Zn overlay and blotting techniques have been widely used for detecting zinc......-binding protein. However, to our knowledge so far this zinc blotting assay has never been applied to detect a prolamin fraction in barley grains. A radioactive zinc (65ZnCl2) blotting technique was optimized to detect zinc-binding prolamins, followed by development of an easy-to-follow nonradioactive colorimetric...... zinc blotting method with a zinc-sensing dye, dithizone. Hordeins were extracted from mature barley grain, separated by SDS-PAGE, blotted on a membrane, renatured, overlaid, and probed with zinc; subsequently, zinc-binding specificity of certain proteins was detected either by autoradiography or color...

  5. Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

    Science.gov (United States)

    Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

    2015-08-01

    The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

  6. INSITU BLOTTING - A NOVEL METHOD FOR DIRECT TRANSFER OF NATIVE PROTEINS FROM SECTIONED TISSUE TO BLOTTING MEMBRANE - PROCEDURE AND SOME APPLICATIONS

    NARCIS (Netherlands)

    OKABE, M; NYAKAS, C; BUWALDA, B; LUITEN, PGM

    We describe a novel technique for direct transfer of native proteins from unfixed frozen tissue sections to an immobilizing matrix, e.g., nitrocellulose, polyvinyliden difluoride, or positively charged nylon membranes. Proteins are directly blotted onto the membrane, providing optimal accessibility

  7. Effects of Reusing Gel Electrophoresis and Electrotransfer Buffers on Western Blotting.

    Science.gov (United States)

    Heda, Ghanshyam D; Omotola, Oluwabukola B; Heda, Rajiv P; Avery, Jamie

    2016-09-01

    SDS-PAGE and Western blotting are 2 of the most commonly used biochemical methods for protein analysis. Proteins are electrophoretically separated based on their MWs by SDS-PAGE and then electrotransferred to a solid membrane surface for subsequent protein-specific analysis by immunoblotting, a procedure commonly known as Western blotting. Both of these procedures use a salt-based buffer, with the latter procedure consisting of methanol as an additive known for its toxicity. Previous reports present a contradictory view in favor or against reusing electrotransfer buffer, also known as Towbin's transfer buffer (TTB), with an aim to reduce the toxic waste. In this report, we present a detailed analysis of not only reusing TTB but also gel electrophoresis buffer (EB) on proteins of low to high MW range. Our results suggest that EB can be reused for at least 5 times without compromising the electrophoretic separation of mixture of proteins in an MW standard, BSA, and crude cell lysates. Additionally, reuse of EB did not affect the quality of subsequent Western blots. Successive reuse of TTB, on the other hand, diminished the signal of proteins of different MWs in a protein standard and a high MW membrane protein cystic fibrosis transmembrane-conductance regulator (CFTR) in Western blotting.

  8. Diversity and endemism in deglaciated areas: ploidy, relative genome size and niche differentiation in the Galium pusillum complex (Rubiaceae) in Northern and Central Europe

    Science.gov (United States)

    Kolář, Filip; Lučanová, Magdalena; Vít, Petr; Urfus, Tomáš; Chrtek, Jindřich; Fér, Tomáš; Ehrendorfer, Friedrich; Suda, Jan

    2013-01-01

    Background and Aims Plants endemic to areas covered by ice sheets during the last glaciation represent paradigmatic examples of rapid speciation in changing environments, yet very few systems outside the harsh arctic zone have been comprehensively investigated so far. The Galium pusillum aggregate (Rubiaceae) is a challenging species complex that exhibits a marked differentiation in boreal parts of Northern Europe. As a first step towards understanding its evolutionary history in deglaciated regions, this study assesses cytological variation and ecological preferences of the northern endemics and compares the results with corresponding data for species occurring in neighbouring unglaciated parts of Central and Western Europe. Methods DNA flow cytometry was used together with confirmatory chromosome counts to determine ploidy levels and relative genome sizes in 1158 individuals from 181 populations. A formalized analysis of habitat preferences was applied to explore niche differentiation among species and ploidy levels. Key Results The G. pusillum complex evolved at diploid and tetraploid levels in Northern Europe, in contrast to the high-polyploid evolution of most other northern endemics. A high level of eco-geographic segregation was observed between different species (particularly along gradients of soil pH and competition) which is unusual for plants in deglaciated areas and most probably contributes to maintaining species integrity. Relative monoploid DNA contents of the species from previously glaciated regions were significantly lower than those of their counterparts from mostly unglaciated Central Europe, suggesting independent evolutionary histories. Conclusions The aggregate of G. pusillum in Northern Europe represents an exceptional case with a geographically vicariant and ecologically distinct diploid/tetraploid species endemic to formerly glaciated areas. The high level of interspecific differentiation substantially widens our perception of the

  9. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis

    OpenAIRE

    Silva, Jillian M.; McMahon, Martin

    2014-01-01

    The Western blot techniques that were originally established in the late 1970s are still actively utilized today. However, this traditional method of Western blotting has several drawbacks that include low quality resolution, spurious bands, decreased sensitivity, and poor protein integrity. Recent advances have drastically improved numerous aspects of the standard Western blot protocol to produce higher qualitative and quantitative data. The Bis-Tris gel system, an alternative to the convent...

  10. A draft de novo genome assembly for the northern bobwhite (Colinus virginianus reveals evidence for a rapid decline in effective population size beginning in the Late Pleistocene.

    Directory of Open Access Journals (Sweden)

    Yvette A Halley

    Full Text Available Wild populations of northern bobwhites (Colinus virginianus; hereafter bobwhite have declined across nearly all of their U.S. range, and despite their importance as an experimental wildlife model for ecotoxicology studies, no bobwhite draft genome assembly currently exists. Herein, we present a bobwhite draft de novo genome assembly with annotation, comparative analyses including genome-wide analyses of divergence with the chicken (Gallus gallus and zebra finch (Taeniopygia guttata genomes, and coalescent modeling to reconstruct the demographic history of the bobwhite for comparison to other birds currently in decline (i.e., scarlet macaw; Ara macao. More than 90% of the assembled bobwhite genome was captured within 14,000 unique genes and proteins. Bobwhite analyses of divergence with the chicken and zebra finch genomes revealed many extremely conserved gene sequences, and evidence for lineage-specific divergence of noncoding regions. Coalescent models for reconstructing the demographic history of the bobwhite and the scarlet macaw provided evidence for population bottlenecks which were temporally coincident with human colonization of the New World, the late Pleistocene collapse of the megafauna, and the last glacial maximum. Demographic trends predicted for the bobwhite and the scarlet macaw also were concordant with how opposing natural selection strategies (i.e., skewness in the r-/K-selection continuum would be expected to shape genome diversity and the effective population sizes in these species, which is directly relevant to future conservation efforts.

  11. HIV‑2 antibody detection after indeterminate or negative HIV‑1 Western blot in Cuba, 2005-2008.

    Science.gov (United States)

    Díaz, Dervel F; Ortiz, Eva; Martín, Dayamí; Nibot, Carmen; Rizo, Adis; Silva, Eladio

    2012-01-01

    INTRODUCTION Differentiating between HIV-1 and HIV-2 infection is the first step to understanding HIV transmission, epidemiology and pathogenesis in geographical areas where both viruses circulate. In Cuba, positive results in mixed HIV-1/2 screening assays are confirmed by HIV-1 Western blot. Indeterminate results constitute the main limitation of this test and HIV-2 infection is among their possible causes; hence the importance of second-stage screening and confirmatory tests for HIV-2 infection. OBJECTIVE Investigate the contribution of HIV-2 antibodies to negative or indeterminate HIV-1 Western blot results in serum samples from 2005 through 2008 in Cuba. METHODS HIV-2 reactivity was studied using the ELISA DAVIH-VIH-2 diagnostic kit (Cuba) in 1723 serum samples with negative or indeterminate results for HIV-1 Western blot from January 2005 through December 2008. Duplicate sera reactive by ELISA were confirmed by HIV-2 Western blot, results interpreted according to WHO criteria. The epidemiological interview established by Cuba's National Program for Prevention and Control Sexually-Transmitted Diseases and HIV/AIDS was applied to HIV-2 Western blot-positive patients. RESULTS Among all sera studied, HIV-2 ELISA identified 12 reactive serum samples (0.70%) and 1711 non-reactive (99.30%). Western blot analysis of the 12 ELISA-reactive samples confirmed two positive samples (16.67%), 4 negative (33.33%) and 6 indeterminate (50%). Positive samples reacted against the p16, p26, gp36, p53, p56, p68 and gp105 proteins. All 12 ELISA-reactive samples belonged to the HIV-1 Western blot indeterminate group. The two HIV-2-positive samples showed well defined reactivity to gp160, p53, p55 and p34 of HIV-1. HIV-1 seroconversion was observed in all 10 remaining samples during serological followup. CONCLUSIONS Two new HIV-2 seropositive cases were diagnosed using DAVIH-VIH-2 and HIV-2 Western blot in indeterminate HIV-1 Western blot samples. Results support the recommendation

  12. Lectin-Array Blotting.

    Science.gov (United States)

    Pazos, Raquel; Echevarria, Juan; Hernandez, Alvaro; Reichardt, Niels-Christian

    2017-09-01

    Aberrant protein glycosylation is a hallmark of cancer, infectious diseases, and autoimmune or neurodegenerative disorders. Unlocking the potential of glycans as disease markers will require rapid and unbiased glycoproteomics methods for glycan biomarker discovery. The present method is a facile and rapid protocol for qualitative analysis of protein glycosylation in complex biological mixtures. While traditional lectin arrays only provide an average signal for the glycans in the mixture, which is usually dominated by the most abundant proteins, our method provides individual lectin binding profiles for all proteins separated in the gel electrophoresis step. Proteins do not have to be excised from the gel for subsequent analysis via the lectin array but are transferred by contact diffusion from the gel to a glass slide presenting multiple copies of printed lectin arrays. Fluorescently marked glycoproteins are trapped by the printed lectins via specific carbohydrate-lectin interactions and after a washing step their binding profile with up to 20 lectin probes is analyzed with a fluorescent scanner. The method produces the equivalent of 20 lectin blots in a single experiment, giving detailed insight into the binding epitopes present in the fractionated proteins. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  13. Application of FTA sample collection and DNA purification system on the determination of CTG trinucleotide repeat size by PCR-based Southern blotting.

    Science.gov (United States)

    Hsiao, K M; Lin, H M; Pan, H; Li, T C; Chen, S S; Jou, S B; Chiu, Y L; Wu, M F; Lin, C C; Li, S Y

    1999-01-01

    Myotonic dystrophy (DM) is caused by a CTG trinucleotide expansion mutation at exon 15 of the myotonic dystrophy protein kinase gene. The clinical severity of this disease correlates with the length of the CTG trinucleotide repeats. Determination of the CTG repeat length has been primarily relied on by Southern blot analysis of restriction enzyme-digested genomic DNA. The development of PCR-based Southern blotting methodology provides a much more sensitive and simpler protocol for DM diagnosis. However, the quality of the template and the high (G+C) ratio of the amplified region hamper the use of PCR on the diagnosis of DM. A modified PCR protocol to amplify different lengths of CTG repeat region using various concentrations of 7deaza-dGTP has been reported (1). Here we describe a procedure including sample collection, DNA purification, and PCR analysis of CTG repeat length without using 7-deaza-dGTP. This protocol is very sensitive and convenient because only a small number of nucleate cells are needed for detection of CTG expansion. Therefore, it could be very useful in clinical and prenatal diagnosis as well as in prevalence study of DM.

  14. Newly discovered young CORE-SINEs in marsupial genomes.

    Science.gov (United States)

    Munemasa, Maruo; Nikaido, Masato; Nishihara, Hidenori; Donnellan, Stephen; Austin, Christopher C; Okada, Norihiro

    2008-01-15

    Although recent mammalian genome projects have uncovered a large part of genomic component of various groups, several repetitive sequences still remain to be characterized and classified for particular groups. The short interspersed repetitive elements (SINEs) distributed among marsupial genomes are one example. We have identified and characterized two new SINEs from marsupial genomes that belong to the CORE-SINE family, characterized by a highly conserved "CORE" domain. PCR and genomic dot blot analyses revealed that the distribution of each SINE shows distinct patterns among the marsupial genomes, implying different timing of their retroposition during the evolution of marsupials. The members of Mar3 (Marsupialia 3) SINE are distributed throughout the genomes of all marsupials, whereas the Mac1 (Macropodoidea 1) SINE is distributed specifically in the genomes of kangaroos. Sequence alignment of the Mar3 SINEs revealed that they can be further divided into four subgroups, each of which has diagnostic nucleotides. The insertion patterns of each SINE at particular genomic loci, together with the distribution patterns of each SINE, suggest that the Mar3 SINEs have intensively amplified after the radiation of diprotodontians, whereas the Mac1 SINE has amplified only slightly after the divergence of hypsiprimnodons from other macropods. By compiling the information of CORE-SINEs characterized to date, we propose a comprehensive picture of how SINE evolution occurred in the genomes of marsupials.

  15. Human papillomavirus genomes in squamous cell carcinomas of the uterine cervix

    International Nuclear Information System (INIS)

    Matsukura, Toshihiko; Sugase, Motoyasu

    2004-01-01

    The association between invasive cervical carcinoma and human papillomavirus (HPV) has now been established beyond doubt, but this is not necessarily a direct-and-effect association. To assess the causality of HPV, we analyzed HPV genomes in squamous cell carcinomas (SCCS) of the uterine cervix by both blot hybridization and PCR. Genital HPV sequences were found in 231 (79%) of 294 SCCs by blot hybridization with more than five copies of entire HPV genomes identified in some cases including HPV 16 (92 cases), HPV 58 (32 cases), and HPV 52 (24 cases). By PCR-direct sequence analysis in 250 of 294 SCCs, genital HPV sequences were found in 240 samples (96%). The partial L1 sequences of HPV 16 were identified in 123 cases, and those of HPVs 18 and 31 were found in 24 and 20 cases, respectively. In addition, multiple HPV types were identified in 29 (12%) of 250 SCCs, and the HPV copy number, detected by PCR only, was less than 0.05. Marked discrepancies were therefore evident between the two analytical techniques. In this report, we discuss the causality of HPV for SCC with regard to the length of the viral genome, the amount of viral DNA, and multiple HPVs in single SCCs

  16. Positive IgG Western Blot for Borrelia burgdorferi in Colombia

    Directory of Open Access Journals (Sweden)

    Palacios Ricardo

    1999-01-01

    Full Text Available In order to evaluate the presence of specific IgG antibodies to Borrelia burgdorferi in patients with clinical manifestations associated with Lyme borreliosis in Cali, Colombia, 20 serum samples from patients with dermatologic signs, one cerebrospinal fluid (CSF sample from a patient with chronic neurologic and arthritic manifestations, and twelve serum samples from individuals without clinical signs associated with Lyme borreliosis were analyzed by IgG Western blot. The results were interpreted following the recommendations of the Centers for Diseases Control and Prevention (CDC for IgG Western blots. Four samples fulfilled the CDC criteria: two serum specimens from patients with morphea (localized scleroderma, the CSF from the patient with neurologic and arthritic manifestations, and one of the controls. Interpretation of positive serology for Lyme disease in non-endemic countries must be cautious. However these results suggest that the putative "Lyme-like" disease may correlate with positivity on Western blots, thus raising the possibility that a spirochete genospecies distinct from B. burgdorferi sensu stricto, or a Borrelia species other than B. burgdorferi sensu lato is the causative agent. Future work will focus on a survey of the local tick and rodent population for evidence of spirochete species that could be incriminated as the etiologic agent.

  17. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  18. RTA, a candidate G protein-coupled receptor: Cloning, sequencing, and tissue distribution

    International Nuclear Information System (INIS)

    Ross, P.C.; Figler, R.A.; Corjay, M.H.; Barber, C.M.; Adam, N.; Harcus, D.R.; Lynch, K.R.

    1990-01-01

    Genomic and cDNA clones, encoding a protein that is a member of the guanine nucleotide-binding regulatory protein (G protein)-coupled receptor superfamily, were isolated by screening rat genomic and thoracic aorta cDNA libraries with an oligonucleotide encoding a highly conserved region of the M 1 muscarinic acetylcholine receptor. Sequence analyses of these clones showed that they encode a 343-amino acid protein (named RTA). The RTA gene is single copy, as demonstrated by restriction mapping and Southern blotting of genomic clones and rat genomic DNA. RTA RNA sequences are relatively abundant throughout the gut, vas deferens, uterus, and aorta but are only barely detectable (on Northern blots) in liver, kidney, lung, and salivary gland. In the rat brain, RTA sequences are markedly abundant in the cerebellum. TRA is most closely related to the mas oncogene (34% identity), which has been suggested to be a forebrain angiotensin receptor. They conclude that RTA is not an angiotensin receptor; to date, they have been unable to identify its ligand

  19. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  20. BLOTS AND ALL: A HISTORY OF THE RORSCHACH INK BLOT TEST IN BRITAIN.

    Science.gov (United States)

    Hubbard, Katherine; Hegarty, Peter

    2016-01-01

    Despite the easily recognizable nature of the Rorschach ink blot test very little is known about the history of the test in Britain. We attend to the oft-ignored history of the Rorschach test in Britain and compare it to its history in the US. Prior to the Second World War, Rorschach testing in Britain had attracted advocates and critiques. Afterward, the British Rorschach Forum, a network with a high proportion of women, developed around the Tavistock Institute in London and The Rorschach Newsletter. In 1968, the International Rorschach Congress was held in London but soon after the group became less exclusive, and fell into decline. A comparative account of the Rorschach in Britain demonstrates how different national institutions invested in the 'projective hypothesis' according to the influence of psychoanalysis, the adoption of a nationalized health system, and the social positioning of 'others' throughout the twentieth century. In comparing and contrasting the history of the Rorschach in Britain and the US, we decentralize and particularize the history of North American Psychology. © 2016 Wiley Periodicals, Inc.

  1. Genomic signals of migration and continuity in Britain before the Anglo-Saxons

    NARCIS (Netherlands)

    Martiniano, Rui; Caffell, Anwen; Holst, Malin; Hunter-Mann, Kurt; Montgomery, Janet; Müldner, Gundula; McLaughlin, Russell L; Teasdale, Matthew D; van Rheenen, Wouter; Veldink, Jan H; van den Berg, Leonard H; Hardiman, Orla; Carroll, Maureen; Roskams, Steve; Oxley, John; Morgan, Colleen; Thomas, Mark G; Barnes, Ian; McDonnell, Christine; Collins, Matthew J; Bradley, Daniel G

    2016-01-01

    The purported migrations that have formed the peoples of Britain have been the focus of generations of scholarly controversy. However, this has not benefited from direct analyses of ancient genomes. Here we report nine ancient genomes (∼1 ×) of individuals from northern Britain: seven from a Roman

  2. Androgen receptor-mediated non-genomic effects of vinclozolin on porcine ovarian follicles and isolated granulosa cells: Vinclozolin and non-genomic effects in porcine ovarian follicles.

    Science.gov (United States)

    Wartalski, Kamil; Knet-Seweryn, Malgorzata; Hoja-Lukowicz, Dorota; Tabarowski, Zbigniew; Duda, Malgorzata

    2016-05-01

    The present study investigated the influence of the androgen receptor (AR) agonists testosterone (T) and dihydrotestosterone (DHT), and vinclozolin (Vnz), a fungicide with antiandrogenic activity, on non-genomic signal transduction within ovarian follicles. Porcine granulosa cells (GCs) isolated from mature follicles were cultured for 48h. For the last 24h of culture, they were exposed to T (10(-7)M), DHT (10(-7)M), Vnz (1.4×10(-5)M), T and Vnz (T+Vnz), or DHT and Vnz (DHT+Vnz) at the same concentrations. To better imitate in vivo conditions, whole follicles (4-6mm in diameter) were incubated (24h) in an organ culture system with the same factors. Expression of AR mRNA and protein was determined by real-time PCR and western blot analyses. To demonstrate AR localization in cultured GCs and whole follicles, immunocytochemistry and immunohistochemistry were performed, respectively. To elucidate the possible non-genomic action of Vnz in GCs, protein expression and the activity of ERK1/2 and Akt kinases were determined by western blot and ELISA analyses. The immunocytochemistry and immunohistochemistry results showed that exposure of GCs and follicles to Vnz resulted in cytoplasmic and perinuclear AR localization. Real-time PCR and western blot analysis showed that AR mRNA and protein expression increased (P≤0.001) in GC cultures after combined treatment with an androgen and Vnz. In whole follicles, such treatment also increased AR mRNA with a decrease in the respective protein expression (P≤0.001). Moreover, addition of T or DHT with Vnz increased the activity of ERK1/2 and Akt kinases in cultured GCs (P≤0.001). The results suggest a novel mechanism for Vnz action in porcine ovarian follicles on both AR mRNA and protein levels. Thus, this environmental antiandrogen activates non-genomic signaling pathways, as indicated by the increased activity of both investigated kinases observed within minutes of Vnz addition. Given the widespread presence of Vnz in the

  3. Structure and transcription of the Helicoverpa armigera densovirus (HaDV2) genome and its expression strategy in LD652 cells.

    Science.gov (United States)

    Xu, Pengjun; Graham, Robert I; Wilson, Kenneth; Wu, Kongming

    2017-02-07

    Densoviruses (DVs) are highly pathogenic to their hosts. However, we previously reported a mutualistic DV (HaDV2). Very little was known about the characteristics of this virus, so herein we undertook a series of experiments to explore the molecular biology of HaDV2 further. Phylogenetic analysis showed that HaDV2 was similar to members of the genus Iteradensovirus. However, compared to current members of the genus Iteradensovirus, the sequence identity of HaDV2 is less than 44% at the nucleotide-level, and lower than 36, 28 and 19% at the amino-acid-level of VP, NS1 and NS2 proteins, respectively. Moreover, NS1 and NS2 proteins from HaDV2 were smaller than those from other iteradensoviruses due to their shorter N-terminal sequences. Two transcripts of about 2.2 kb coding for the NS proteins and the VP proteins were identified by Northern Blot and RACE analysis. Using specific anti-NS1 and anti-NS2 antibodies, Western Blot analysis revealed a 78 kDa and a 48 kDa protein, respectively. Finally, the localization of both NS1 and NS2 proteins within the cell nucleus was determined by using Green Fluorescent Protein (GFP) labelling. The genome organization, terminal hairpin structure, transcription and expression strategies as well as the mutualistic relationship with its host, suggested that HaDV2 was a novel member of the genus Iteradensovirus within the subfamily Densovirinae.

  4. Blotting from PhastGel to Membranes by Ultrasound.

    Science.gov (United States)

    Kost, Joseph; Azagury, Aharon

    2015-01-01

    Ultrasound based approach for enhanced protein blotting is proposed. Three minutes of ultrasound exposure (1 MHz, 2.5 W/cm(2)) was sufficient for a clear transfer of proteins from a polyacrylamide gel (PhastGel) to nitrocellulose or Nylon 66 Biotrans membrane. The proteins evaluated were prestained sodium dodecyl sulfate-polyacrylamide standards (18,500-106,000 Da) and 14C-labeled Rainbow protein molecular weight markers (14,300-200,000 Da).

  5. Mammalian α-polymerase: cloning of partial complementary DNA and immunobinding of catalytic subunit in crude homogenate protein blots

    International Nuclear Information System (INIS)

    SenGupta, D.N.; Kumar, P.; Zmudzka, B.Z.; Coughlin, S.; Vishwanatha, J.K.; Robey, F.A.; Parrott, C.; Wilson, S.H.

    1987-01-01

    A new polyclonal antibody against the α-polymerase catalytic polypeptide was prepared by using homogeneous HeLa cellα-polymerase. The antibody neutralized α-polymerase activity and was strong and specific for the α-polymerase catalytic polypeptide (M/sub r/ 183,000) in Western blot analysis of crude extracts of HeLa cells. The antibody was used to screen a cDNA library of newborn rat brain poly(A+) RNA in λgt11. A positive phage was identified and plaque purified. This phage, designated λpolα1.2, also was found to be positive with an antibody against Drosophila α-polymerase. The insert in λpolα1.2 (1183 base pairs) contained a poly(A) sequence at the 3' terminus and a short in-phase open reading frame at the 5' terminus. A synthetic oligopeptide (eight amino acids) corresponding to the open reading frame was used to raise antiserum in rabbits. Antibody affinity purified from this serum was found to be immunoreactive against purified α-polymerase by enzyme-linked immunosorbent assay and was capable of immunoprecipitating α-polymerase. This indicated the λpolα1.2 insert encoded an α-polymerase epitope and suggested that the cDNA corresponded to an α-polymerase mRNA. This was confirmed in hybrid selection experiments using pUC9 containing the cDNA insert and poly(A+) RNA from newborn rat brain; the insert hybridized to mRNA capable of encoding α-polymerase catalytic polypeptides. Northern blot analysis of rat brain poly(A+) RNA revealed that this mRNA is ∼5.4 kilobases

  6. Improvement of western blot test specificity for detecting equine serum antibodies to Sarcocystis neurona.

    Science.gov (United States)

    Rossano, M G; Mansfield, L S; Kaneene, J B; Murphy, A J; Brown, C M; Schott, H C; Fox, J C

    2000-01-01

    Equine protozoal myeloencephalitis (EPM) is a neurological disease of horses and ponies caused by the apicomplexan protozoan parasite Sarcocystis neurona. The purposes of this study were to develop the most stringent criteria possible for a positive test result, to estimate the sensitivity and specificity of the EPM Western blot antibody test, and to assess the ability of bovine antibodies to Sarcocystis cruzi to act as a blocking agent to minimize false-positive results in the western blot test for S. neurona. Sarcocystis neurona merozoites harvested from equine dermal cell culture were heat denatured, and the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis in a 12-20% linear gradient gel. Separated proteins were electrophoretically transferred to polyvinylidene fluoride membranes and blocked in 1% bovine serum albumin and 0.5% Tween-Tris-buffered saline. Serum samples from 6 horses with S. neurona infections (confirmed by culture from neural tissue) and 57 horses without infections (horses from the Eastern Hemisphere, where S. neurona does not exist) were tested by Western blot. Horses from both groups had reactivity to the 62-, 30-, 16-, 13-, 11-, 10.5-, and 10-kD bands. Testing was repeated with another step. Blots were treated with bovine S. cruzi antibodies prior to loading the equine samples. After this modification of the Western blot test, positive infection status was significantly associated with reactivity to the 30- and 16-kD bands (Pblot had a sample sensitivity of 100% and sample specificity of 98%. It is concluded that the specificity of the Western blot test is improved by blocking proteins not specific to S. neurona and using reactivity to the 30- and 16-kD bands as the criterion for a positive test.

  7. Label-free DNA quantification via a 'pipette, aggregate and blot' (PAB) approach with magnetic silica particles on filter paper.

    Science.gov (United States)

    Li, Jingyi; Liu, Qian; Alsamarri, Hussein; Lounsbury, Jenny A; Haversitick, Doris M; Landers, James P

    2013-03-07

    Reliable measurement of DNA concentration is essential for a broad range of applications in biology and molecular biology, and for many of these, quantifying the nucleic acid content is inextricably linked to obtaining optimal results. In its most simplistic form, quantitative analysis of nucleic acids can be accomplished by UV-Vis absorbance and, in more sophisticated format, by fluorimetry. A recently reported new concept, the 'pinwheel assay', involves a label-free approach for quantifying DNA through aggregation of paramagnetic beads in a rotating magnetic field. Here, we describe a simplified version of that assay adapted for execution using only a pipet and filter paper. The 'pipette, aggregate, and blot' (PAB) approach allows DNA to induce bead aggregation in a pipette tip through exposure to a magnetic field, followed by dispensing (blotting) onto filter paper. The filter paper immortalises the extent of aggregation, and digital images of the immortalized bead conformation, acquired with either a document scanner or a cell phone camera, allows for DNA quantification using a noncomplex algorithm. Human genomic DNA samples extracted from blood are quantified with the PAB approach and the results utilized to define the volume of sample used in a PCR reaction that is sensitive to input mass of template DNA. Integrating the PAB assay with paper-based DNA extraction and detection modalities has the potential to yield 'DNA quant-on-paper' devices that may be useful for point-of-care testing.

  8. Novel rod-shaped viruses isolated from garlic, Allium sativum, possessing a unique genome organization.

    Science.gov (United States)

    Sumi, S; Tsuneyoshi, T; Furutani, H

    1993-09-01

    Rod-shaped flexuous viruses were partially purified from garlic plants (Allium sativum) showing typical mosaic symptoms. The genome was shown to be composed of RNA with a poly(A) tail of an estimated size of 10 kb as shown by denaturing agarose gel electrophoresis. We constructed cDNA libraries and screened four independent clones, which were designated GV-A, GV-B, GV-C and GV-D, using Northern and Southern blot hybridization. Nucleotide sequence determination of the cDNAs, two of which correspond to nearly one-third of the virus genomic RNA, shows that all of these viruses possess an identical genomic structure and that also at least four proteins are encoded in the viral cDNA, their M(r)s being estimated to be 15K, 27K, 40K and 11K. The 15K open reading frame (ORF) encodes the core-like sequence of a zinc finger protein preceded by a cluster of basic amino acid residues. The 27K ORF probably encodes the viral coat protein (CP), based on both the existence of some conserved sequences observed in many other rod-shaped or flexuous virus CPs and an overall amino acid sequence similarity to potexvirus and carlavirus CPs. The 11K ORF shows significant amino acid sequence similarities to the corresponding 12K proteins of the potexviruses and carlaviruses. On the other hand, the 40K ORF product does not resemble any other plant virus gene products reported so far. The genomic organization in the 3' region of the garlic viruses resembles, but clearly differs from, that of carlaviruses. Phylogenetic analysis based upon the amino acid sequence of the viral capsid protein also indicates that the garlic viruses have a unique and distinct domain different from those of the potexvirus and carlavirus groups. The results suggest that the garlic viruses described here belong to an unclassified and new virus group closely related to the carlaviruses.

  9. Use of a Western blot technique for the serodiagnosis of glanders

    Directory of Open Access Journals (Sweden)

    de Souza Marcilia MA

    2011-01-01

    Full Text Available Abstract Background The in vivo diagnosis of glanders relies on the highly sensitive complement fixation test (CFT. Frequently observed false positive results are troublesome for veterinary authorities and cause financial losses to animal owners. Consequently, there is an urgent need to develop a test with high specificity. Hence, a Western blot assay making use of a partly purified lipopolysaccaride (LPS containing antigen of three Burkholderia mallei strains was developed. The test was validated investigating a comprehensive set of positive and negative sera obtained from horses and mules from endemic and non endemic areas. Results The developed Western blot assay showed a markedly higher diagnostic specificity when compared to the prescribed CFT and therefore can be used as a confirmatory test. However, the CFT remains the test of choice for routine testing of glanders due to its high sensitivity, its feasibility using standard laboratory equipment and its worldwide distribution in diagnostic laboratories. Conclusions The CFT should be amended by the newly validated Western blot to increase the positive likelihood ratio of glanders serodiagnosis in non endemic areas or areas with low glanders prevalence. Its use for international trade of horses and mules should be implemented by the OIE.

  10. Matrix-assisted laser desorption-ionization mass spectrometry peptide mass fingerprinting for proteome analysis: identification efficiency after on-blot or in-gel digestion with and without desalting procedures.

    Science.gov (United States)

    Lamer, S; Jungblut, P R

    2001-03-10

    In theory, peptide mass fingerprinting by matrix assisted laser desorption-ionization mass spectrometry (MALDI-MS) has the potential to identify all of the proteins detected by silver staining on gels. In practice, if the genome of the organism investigated is completely sequenced, using current techniques, all proteins stained by Coomassie Brilliant Blue can be identified. This loss of identification sensitivity of ten to hundred-fold is caused by loss of peptides by surface contacts. Therefore, we performed digestion and transfer of peptides in the lower microl range and reduced the number of steps. The peptide mix obtained from in-gel or on-blot digestion was analyzed directly after digestion or after concentration on POROS R2 beads. Eight protein spots of a 2-DE gel from Mycobacterium bovis BCG were identified using these four preparation procedures for MALDI-MS. Overall, on-blot digestion was as effective as in-gel digestion. Whereas higher signal intensities resulted after concentration, hydrophilic peptides are better detected by direct measurement of the peptide mix without POROS R2 concentration.

  11. Conditions that allow for effective transfer of membrane proteins onto nitrocellulose membrane in Western blots.

    Science.gov (United States)

    Abeyrathne, Priyanka D; Lam, Joseph S

    2007-04-01

    A major hurdle in characterizing bacterial membrane proteins by Western blotting is the ineffectiveness of transferring these proteins from sodium dodecyl sulfate -- polyacrylamide gel electrophoresis (SDS-PAGE) gel onto nitrocellulose membrane, using standard Western blot buffers and electrophoretic conditions. In this study, we compared a number of modified Western blotting buffers and arrived at a composition designated as the SDS-PAGE-Urea Lysis buffer. The use of this buffer and specific conditions allowed the reproducible transfer of highly hydrophobic bacterial membrane proteins with 2-12 transmembrane-spanning segments as well as soluble proteins onto nitrocellulose membranes. This method should be broadly applicable for immunochemical studies of other membrane proteins.

  12. Banding pattern indicative of echinococcosis in a commercial cysticercosis western blot

    Directory of Open Access Journals (Sweden)

    Tappe D

    2009-09-01

    Full Text Available Abstract Objective A commercial cysticercosis Western blot was evaluated for serological cross-reactivity of sera from patients with alveolar (AE and cystic echinococcosis (CE. Methods A total of 161 sera were examined, including 31 sera from AE-patients, 11 sera from CE-patients, 9 sera from patients with other parasitic diseases and 109 sera from patients with unrelated medical conditions. All AE-and CE-sera were also examined by the echinococcosis Western blot. Results More sera from patients with AE than with CE showed cross-reactivity in the form of ladder-like patterns ("Mikado aspect" and untypical bands at 6-8 kDa (71% and 77.4% versus 27.3% and 45.5%, respectively. In contrast, triplets of bands in the area above 50 kDa and between 24 and 39-42 kDa were more frequent in CE than in AE sera. The fuzzy band at 50-55 kDa typical for cysticercosis was absent in all AE and CE sera. Conclusions Atypical banding patterns in the cysticercosis Western blot should raise the suspicion of a metacestode infection different from Taenia solium, i.e. Echinococcus multilocularis or E. granulosus, especially when the Mikado aspect and an altered 6-8 kDa band is visible in the absence of a fuzzy 50-55 kDa band.

  13. Characterization of the structure of the erythropoietin receptor by ligand blotting

    International Nuclear Information System (INIS)

    Atkins, H.L.; Broudy, V.C.; Papayannopoulou, T.

    1991-01-01

    Erythropoietin (Epo) regulates the growth and differentiation of erythroid cells by binding to a specific receptor. We characterized the native Epo receptor on erythroleukemia cell lines by ligand blotting. Solubilized cell membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred onto nitrocellulose, and probed with 125I-Epo. Specificity was demonstrated by inhibition of 125I-Epo binding by unlabeled excess Epo but not other peptide growth factors and by the cellular distribution of the Epo binding protein. A single membrane protein of 61 Kd ± 4 Kd was sufficient to bind 125I Epo in both human (OCIM2, K562) and murine (GM979, Rauscher, DA-1) cell lines. This finding is consistent with the predicted size of the Epo receptor from the murine cDNA clone. However, chemical crosslinking of 125I-Epo to its receptor has identified two Epo binding proteins of 105 Kd and 85 Kd. This difference may occur because the receptor is size fractionated before Epo binding in the ligand blot, but after Epo binding in crosslinking studies. Ligand blotting demonstrates that the native Epo receptor is composed of a single 61-Kd Epo binding protein, and suggests the presence of additional proteins of 20 to 25 Kd that associate with the receptor after Epo binding

  14. Standardization of Licorice and TCM Formulations Using Eastern Blot Fingerprinting Analysis

    Directory of Open Access Journals (Sweden)

    Yukihiro Shoyama

    2013-01-01

    Full Text Available To prepare the antiglycyrrhizin (GC monoclonal antibody (MAb, GC was treated with NaIO4 resulting in aldehyde which can be combined with carrier protein. An antigen conjugate was performed by a matrix-assisted laser desorption/ionization TOF mass spectrometry to determine the hapten numbers in the conjugate. Anti-GC MAb was prepared from a hybridoma which was fixed from the spleen cells producing anti-GC MAb and the myeloma cells after immunization. The TCM and licorice extract were developed by TLC and blotted to a polyvinylidene difluoride (PVDF membrane. The membrane was treated by NaIO4 and protein, enzyme labeled secondary MAb, and finally substrate was added. Clear spot appeared on PVDF membrane identifying GC against a background containing large amount of impurities. In eastern blotting, the GC molecule was divided into two functions. The aglycone part is recognized as an epitope and the sugar moiety can be combined to membrane. The specific reactivity of sugar moiety in the GC molecule against anti-GC MAb might be modified by the NaIO4 treatment on the membrane because glycyrrhetic acid 3-O-glucuronide can be stained although the cross-reactivity is only 4.3%. Eastern blotting for GC can not only apply for the standardization of licorice and TCM, but also it can open for the other bioactive products.

  15. Application of Whole Genome Expression Analysis to Assess Bacterial Responses to Environmental Conditions

    Science.gov (United States)

    Vukanti, R. V.; Mintz, E. M.; Leff, L. G.

    2005-05-01

    Bacterial responses to environmental signals are multifactorial and are coupled to changes in gene expression. An understanding of bacterial responses to environmental conditions is possible using microarray expression analysis. In this study, the utility of microarrays for examining changes in gene expression in Escherichia coli under different environmental conditions was assessed. RNA was isolated, hybridized to Affymetrix E. coli Genome 2.0 chips and analyzed using Affymetrix GCOS and Genespring software. Major limiting factors were obtaining enough quality RNA (107-108 cells to get 10μg RNA)and accounting for differences in growth rates under different conditions. Stabilization of RNA prior to isolation and taking extreme precautions while handling RNA were crucial. In addition, use of this method in ecological studies is limited by availability and cost of commercial arrays; choice of primers for cDNA synthesis, reproducibility, complexity of results generated and need to validate findings. This method may be more widely applicable with the development of better approaches for RNA recovery from environmental samples and increased number of available strain-specific arrays. Diligent experimental design and verification of results with real-time PCR or northern blots is needed. Overall, there is a great potential for use of this technology to discover mechanisms underlying organisms' responses to environmental conditions.

  16. Routine Western blot to check autophagic flux : Cautions and recommendations

    NARCIS (Netherlands)

    Gomez-Sanchez, Ruben; Pizarro-Estrella, Elisa; Yakhine-Diop, Sokhna M. S.; Rodriguez-Arribas, Mario; Bravo-San Pedro, Jose M.; Fuentes, Jose M.; Gonzalez-Polo, Rosa A.

    2015-01-01

    At present, the analysis of autophagic flux by Western blotting (WB), which measures two of the most important markers of autophagy, i.e., microtubule-associated protein 1 light chain 3 (LC3) and p62, is widely accepted in the scientific community. In this study, we addressed the possible

  17. Southern blot analysis of skin biopsies for human papillomavirus DNA: renal allograft recipients in south-eastern Queensland.

    Science.gov (United States)

    Trenfield, K; Salmond, C A; Pope, J H; Hardie, I R

    1993-01-01

    The 104 skin biopsies from 34 patients who attended a Renal Transplant Unit in Brisbane over 12 months included 40 squamous cell carcinoma (SCC), 22 solar keratoses, 4 hyperkeratoses, 18 warts and 11 basal cell carcinoma (BCC). Human papillomavirus (HPV) DNA was identified by Southern blot hybridisation using, as individual probes, purified insert DNA from recombinant HPV 1, 2, 3 or 3/10, 4, 5 or 5/8, 7, 11, 16, 18 and 41 under relaxed conditions and characterised by restriction enzyme analysis and Southern blot hybridisation under more stringent conditions. Genomic HPV DNA was characterised in 7 skin biopsies from 4 renal allograft recipients (RARs): HPV 1A in a SCC (20 copies/cell) and a BCC (10 copies/cell) from the one patient, HPV 36 (20 copies/cell) in a SCC, HPV 1A [symbol: see text] 1000 copies/cell) in a wart and HPV 2B (200-800 copies/cell) in 3 warts from the one patient. Only HPV 1A in the SCC exhibited a significant degree of subtype variation. HPV DNA was identified in another 5 skin biopsies from another 4 RARs: HPV 3A in a wart and a hyperkeratosis, HPV 3/10-related DNA in 2 solar keratoses and HPV 5/8-related DNA in another (20-50 copies/cell). The incidence of HPV 5 (or 5-related HPVs) in RAR SCC was very low and that of HPV DNA in RAR warts was lower than that recorded elsewhere but this was not due to insensitivity of the assays. There was no evidence for a role for HPV in the aetiology of skin cancer in RARs in south-eastern Queensland but the possibility remains that as yet unidentified HPV types are involved.

  18. Modification of T-cell antigenic properties of tetanus toxoid by SDS-PAGE separation. Implications for T-cell blotting

    DEFF Research Database (Denmark)

    Christensen, C B; Theander, T G

    1997-01-01

    Using Tetanus Toxoid (TT) as a model antigen the T-cell Blotting method was evaluated. Peripheral blood mononuclear cell (PBMC) cultures were stimulated by blotted nitrocellulose-bound TT or soluble TT. SDS-Poly-Acrylamide-Gel-Electrophoresis separated TT only induced proliferation in 20% of the ......Using Tetanus Toxoid (TT) as a model antigen the T-cell Blotting method was evaluated. Peripheral blood mononuclear cell (PBMC) cultures were stimulated by blotted nitrocellulose-bound TT or soluble TT. SDS-Poly-Acrylamide-Gel-Electrophoresis separated TT only induced proliferation in 20......% of the PBMC cultures whereas proliferation was induced in 79% of the same cultures offered similar treated TT (except for the PAGE separation). When T-cell blotting was performed with TT separated in a SDS-agarose matrix, proliferation was induced in 80% of donors responding to soluble TT. The results show...... that SDS-PAGE alters the ability of TT to induce T-cell proliferation, possibly due to unpolymerized acrylamide binding to proteins during SDS-PAGE. The use of SDS-PAGE T-cell blotting in the screening for T-cell antigens must therefore be reconsidered. We suggest the use of SDS-Agarose Gel Electrophoresis...

  19. Multi-strip Western blotting to increase quantitative data output

    OpenAIRE

    Aksamitiene, Edita; Hoek, Jan B.; Kholodenko, Boris; Kiyatkin, Anatoly

    2007-01-01

    The qualitative and quantitative measurement of protein abundance and protein modification states are essential in understanding their role in diverse cellular processes. Traditional Western blotting technique, though sensitive, is prone to produce substantial errors and is not readily adapted to high-throughput technologies. We propose a modified immunoblotting procedure, which is based on simultaneous transfer of proteins from multiple gel-strips onto the same membrane, and is compatible wi...

  20. [Clinical manifestation of Lyme borreliosis in children with positive and negatiwe western blot results].

    Science.gov (United States)

    Ołdak, Elzbieta; Rozkiewicz, Doroto; Sulik, Artur

    2008-01-01

    In the afforested area of North-Eastern Poland the risk of Borrelia burgdorferi infection seems to be higher compared to the other regions. Because of unspecific clinical manifestation of Lyme borreliosis in children the positive ELISA IgM results should be confirmed with Western blot IgM tests. Retrospective analysis of clinical signs and symptoms of Lyme borreliosis in children with positive ELISA IgM and positive Western blot IgM results and in children with positive ELISA IgM and negative Western blot IgM results. The study included 20 children reactive with ELISA IgM (Bellco Biomedica, Austria), hospitalized in Pediatric Infectious Diseases Clinic in 2007 due to probable diagnosis of Lyme disease. All children were tested with B. burgdorferi Western blot IgM and/or IgG assay (DRG, Diagnostics, Germany) as a second-step diagnosis. In 10 (50% females, 50% males) out of 20 children the results were positive (borreliosis) and in other 10 (80% females, 20% males) the results were negative (controls). In both groups of patients the retrospective analysis of signs and symptoms was done. The most often clinical manifestation of Lyme borreliosis in children was neuroborreliosis. Children presented Lyme meningitis (30%), facial nerve palsy (10%) and chronic or recurrent headaches (40%), associated with vertigo (20%), weakness (30%), fever (40%), and fatigue syndrome (30%). One patient presented Lyme arthritis. Children of control group presented with unspecific symptoms like isolated headaches (40%), arthralgias (70%), myalgias (10%) and abdomen pain (20%) (1) The most frequent clinical presentation of Lyme borreliosis in analyzed children was neuroborreliosis; (2) Isolated arthralgias in children reactive with B. burgdorferi ELISA IgM need to be confirmed with Western blot assay before implementing the antibiotic therapy.

  1. Evaluation of two commercial systems for automated processing, reading, and interpretation of Lyme borreliosis Western blots.

    Science.gov (United States)

    Binnicker, M J; Jespersen, D J; Harring, J A; Rollins, L O; Bryant, S C; Beito, E M

    2008-07-01

    The diagnosis of Lyme borreliosis (LB) is commonly made by serologic testing with Western blot (WB) analysis serving as an important supplemental assay. Although specific, the interpretation of WBs for diagnosis of LB (i.e., Lyme WBs) is subjective, with considerable variability in results. In addition, the processing, reading, and interpretation of Lyme WBs are laborious and time-consuming procedures. With the need for rapid processing and more objective interpretation of Lyme WBs, we evaluated the performances of two automated interpretive systems, TrinBlot/BLOTrix (Trinity Biotech, Carlsbad, CA) and BeeBlot/ViraScan (Viramed Biotech AG, Munich, Germany), using 518 serum specimens submitted to our laboratory for Lyme WB analysis. The results of routine testing with visual interpretation were compared to those obtained by BLOTrix analysis of MarBlot immunoglobulin M (IgM) and IgG and by ViraScan analysis of ViraBlot and ViraStripe IgM and IgG assays. BLOTrix analysis demonstrated an agreement of 84.7% for IgM and 87.3% for IgG compared to visual reading and interpretation. ViraScan analysis of the ViraBlot assays demonstrated agreements of 85.7% for IgM and 94.2% for IgG, while ViraScan analysis of the ViraStripe IgM and IgG assays showed agreements of 87.1 and 93.1%, respectively. Testing by the automated systems yielded an average time savings of 64 min/run compared to processing, reading, and interpretation by our current procedure. Our findings demonstrated that automated processing and interpretive systems yield results comparable to those of visual interpretation, while reducing the subjectivity and time required for Lyme WB analysis.

  2. Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

    2017-11-01

    Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

  3. Construction of a genomic library of the human cytomegalovirus genome and analysis of late transcription of its inverted internal repeat region

    International Nuclear Information System (INIS)

    Silva, K.F.S.T.

    1989-01-01

    The investigations described in this dissertation were designed to determine the transcriptionally active DNA sequences of IIR region and to identify the viral mRNA transcribed from the transcriptionally most active DNA sequences of that region during late phase of HCMV Towne infection. Preliminary transcriptional studies which included the hybridization of a southern blot of XbaI digested entire HCMV genome to 32 P-labelled late phase infected cell A + RNA, indicated that late viral transcripts homologous to XbaI Q fragment of IIR region were very highly abundant while XbaI Q fragment showed a very low transcriptional activity. To facilitate further analysis of late transcription of IIR region, the entire DNA sequences of IIR region were molecularly cloned as U, S, and H BamHI fragments in pACYC-184 plasmid vector. In addition, to be used in future studies on other regions of the genome, except for y and c' smaller fragments the entire 240 kb HCMV genome was cloned as BamHI fragments in the same vector. Furthermore, the U, S, and H BamHI fragments were mapped with six other restriction enzymes in order to use that mapping data in subsequent transcriptional analysis of the IIR region. Further localization of transcriptionally active DNA sequences within IIR region was achieved by hybridization of southern blots of restricted U, S, and H BamHI fragments with 3' 32 P-labelled infected cell late A + RNA. The 1.5 kb EcooRI subfragments of S BamHI fragment and the adjoining 0.72 kb XhoI subfragment of H BamHI fragment revealed the highest level of transcription, although the remainder of the S fragment was also transcribed at a substantial level. The U fragment and the remainder of the H fragment was transcribed at a very low level

  4. Characterisation and expression of the mitochondrial genome of a new type of cytoplasmic male-sterile sunflower

    NARCIS (Netherlands)

    Spassova, Mariana; Moneger, Françoise; Leaver, Christopher J.; Petrov, Peter; Atanassov, Atanas; Nijkamp, H. John J.; Hille, Jacques

    1994-01-01

    A new cytoplasmic male sterile sunflower, CMS3, was characterised in relation to the Petiolaris (PET1) cytoplasmic male-sterile sunflower, CMS89. Southern blot analysis showed that the mitochondrial genome of CMS3 contains unique rearrangements in at least five loci (atp6, atp9, atpA, nad1 + 5 and

  5. Molecular cloning of human T-cell lymphotrophic virus type I-like proviral genome from the peripheral lymphocyte DNA of a patient with chronic neurologic disorders

    International Nuclear Information System (INIS)

    Reddy, E.P.; Mettus, R.V.; DeFreitas, E.; Wroblewska, Z.; Cisco, M.; Koprowski, H.

    1988-01-01

    Human T-cell lymphotropic virus type 1 (HTLV-I), the etiologic agent of human T-cell leukemia, has recently been shown to be associated with neurologic disorders such as tropical spastic paraparesis, HTLV-associated myelopathy, and possibly with multiple sclerosis. In this communication, the authors have examined one specific case of neurologic disorder that can be classified as multiple sclerosis or tropical spastic paraparesis. The patient suffering from chronic neurologic disorder was found to contain antibodies to HTLV-I envelope and gag proteins in his serum and cerebrospinal fluid. Lymphocytes from peripheral blood and cerebrospinal fluid of the patient were shown to express viral RNA sequences by in situ hybridization. Southern blot analysis of the patient lymphocyte DNA revealed the presence of HTLV-I-related sequences. Blot-hybridization analysis of the RNA from fresh peripheral lymphocytes stimulated with interleukin 2 revealed the presence of abundant amounts of genomic viral RNA with little or no subgenomic RNA. They have clones the proviral genome from the DNA of the peripheral lymphocytes and determined its restriction map. This analysis shows that this proviral genome is very similar if not identical to that of the prototype HTLV-I genome

  6. Paleo-eskimo mtDNA genome reveals matrilineal discontinuity in Greenland

    DEFF Research Database (Denmark)

    Gilbert, Marcus Thomas Pius; Kivisild, Toomas; Grønnow, Bjarne

    2008-01-01

    a mitochondrial genome from a Paleo-Eskimo human by using 3400-to 4500-year-old frozen hair excavated from an early Greenlandic Saqqaq settlement. The sample is distinct from modern Native Americans and Neo-Eskimos, falling within haplogroup D2a1, a group previously observed among modern Aleuts and Siberian......The Paleo-Eskimo Saqqaq and Independence I cultures, documented from archaeological remains in Northern Canada and Greenland, represent the earliest human expansion into the New World's northern extremes. However, their origin and genetic relationship to later cultures are unknown. We sequenced...

  7. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  8. Solid-phase assay for the phosphorylation of proteins blotted on nitrocellulose membrane filters

    International Nuclear Information System (INIS)

    Valtorta, F.; Schiebler, W.; Jahn, R.; Ceccarelli, B.; Greengard, P.

    1986-01-01

    A new procedure for the phosphorylation and assay of phosphoproteins is described. Proteins are solubilized from tissue samples, separated by polyacrylamide gel electrophoresis, transferred onto nitrocellulose membrane filters, and the blotted polypeptides are phyosphorylated with the catalytic subunit of cyclic AMP (adenosine 3':5'-monophosphate)-dependent protein kinase. The method was developed for the assay of dephosphosynapsin I, but it has also proven suitable for the phosphorylation of other proteins. The patterns of phosphorylation of tissue samples phosphorylated using the new method are similar to those obtained using the conventional test tube assay. Once phosphorylated, the adsorbed proteins can be digested with proteases and subjected to phosphopeptide mapping. The phosphorylated blotted proteins can also be analyzed by overlay techniques for the immunological detection of polypeptides

  9. COMPARISONS OF ELISA AND WESTERN BLOT ASSAYS FOR DETECTION OF CRYPTOSPORIDIUM ANTIBODY

    Science.gov (United States)

    A seroprevalence survey was conducted using ELISA and Western blot (WB) assays for antibody to three Cryptosporidium antigens on 380 blood donors in Jackson County, Oregon. The purpose was to determine if either assay could detect serological evidence of an outbreak which occurre...

  10. A streamlined Western blot exercise: An efficient and greener approach in the laboratory classroom.

    Science.gov (United States)

    Ness, Traci L; Robinson, Rebekah L; Mojadedi, Wais; Peavy, Lydia; Weiland, Mitch H

    2015-01-01

    SDS-PAGE and western blotting are two commonly taught protein detection techniques in biochemistry and molecular biology laboratory classrooms. A pitfall associated with incorporating these techniques into the laboratory is the significant wait times that do not allow students to obtain timely results. The waiting associated with SDS-PAGE comes from staining and destaining, whereas with western blotting it is the times required for antibody incubations and the numerous wash steps. This laboratory exercise incorporates 2,2,2-trichloroethanol (TCE) into the SDS-PAGE gel allowing for visualization of migrated proteins in a matter of minutes, saving both the time and chemical waste associated with traditional Coomassie staining. Additionally, TCE staining does not affect protein transfer eliminating the requirement for duplicated gels for total protein and western analyses. Protein transfer can be confirmed immediately without the use of Ponceau S staining. Lastly, this western blot procedure has been further shortened by using an HRP-conjugated primary antibody, which eliminates the secondary antibody incubation and washes, and uses a colorimetric detection to allow for visualization by students without the need for specialized equipment. © 2015 The International Union of Biochemistry and Molecular Biology.

  11. Records of Chrysomya albiceps in Northern Italy: an ecological and forensic perspective

    Directory of Open Access Journals (Sweden)

    S Vanin

    2009-07-01

    Full Text Available Knowledge of the carrion-breeding insects present at a local level is important and necessary for defining the post-mortem interval. Climate changes and globalisation are affecting species ranges and population dynamics. In this note, we report the incidence of Chrysomya albiceps (Diptera: Calliphoridae on dead human bodies and carrion in Northern Italy. These data confirm the spread of this species in the Northern regions. The partial sequencing of a 583-bp region of the cytochrome oxidase subunit 1 gene of an Adriatic population did not reveal any difference compared to the same genomic region in the African and South American populations of this species.

  12. Identification and characteristics of microRNAs from Bombyx mori

    Directory of Open Access Journals (Sweden)

    Gao Xiaolian

    2008-05-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small RNA molecules that regulate gene expression by targeting messenger RNAs (mRNAs and causing mRNA cleavage or translation blockage. Of the 355 Arthropod miRNAs that have been identified, only 21 are B. mori miRNAs that were predicted computationally; of these, only let-7 has been confirmed by Northern blotting. Results Combining a computational method based on sequence homology searches with experimental identification based on microarray assays and Northern blotting, we identified 46 miRNAs, an additional 21 plausible miRNAs, and a novel small RNA in B. mori. The latter, bmo-miR-100-like, was identified using the known miRNA aga-miR-100 as a probe; bmo-miR-100-like was detected by microarray assay and Northern blotting, but its precursor sequences did not fold into a hairpin structure. Among these identified miRNAs, we found 12 pairs of miRNAs and miRNA*s. Northern blotting revealed that some B. mori miRNA genes were expressed only during specific stages, indicating that B. mori miRNA genes (e.g., bmo-miR-277 have developmentally regulated patterns of expression. We identified two miRNA gene clusters in the B. mori genome. bmo-miR-2b, which is found in the gene cluster bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b, encodes a newly identified member of the mir-2 family. Moreover, we found that methylation can increase the sensitivity of a DNA probe used to detect a miRNA by Northern blotting. Functional analysis revealed that 11 miRNAs may regulate 13 B. mori orthologs of the 25 known Drosophila miRNA-targeted genes according to the functional conservation. We predicted the binding sites on the 1671 3'UTR of B. mori genes; 547 targeted genes, including 986 target sites, were predicted. Of these target sites, 338 had perfect base pairing to the seed region of 43 miRNAs. From the predicted genes, 61 genes, each of them with multiple predicted target sites, should be

  13. PCR artifact in testing for homologous recombination in genomic editing in zebrafish.

    Directory of Open Access Journals (Sweden)

    Minho Won

    Full Text Available We report a PCR-induced artifact in testing for homologous recombination in zebrafish. We attempted to replace the lnx2a gene with a donor cassette, mediated by a TALEN induced double stranded cut. The donor construct was flanked with homology arms of about 1 kb at the 5' and 3' ends. Injected embryos (G0 were raised and outcrossed to wild type fish. A fraction of the progeny appeared to have undergone the desired homologous recombination, as tested by PCR using primer pairs extending from genomic DNA outside the homology region to a site within the donor cassette. However, Southern blots revealed that no recombination had taken place. We conclude that recombination happened during PCR in vitro between the donor integrated elsewhere in the genome and the lnx2a locus. We conclude that PCR alone may be insufficient to verify homologous recombination in genome editing experiments in zebrafish.

  14. Genomic organization, expression, and chromosome localization of a third aurora-related kinase gene, Aie1.

    Science.gov (United States)

    Hu, H M; Chuang, C K; Lee, M J; Tseng, T C; Tang, T K

    2000-11-01

    We previously reported two novel testis-specific serine/threonine kinases, Aie1 (mouse) and AIE2 (human), that share high amino acid identities with the kinase domains of fly aurora and yeast Ipl1. Here, we report the entire intron-exon organization of the Aie1 gene and analyze the expression patterns of Aie1 mRNA during testis development. The mouse Aie1 gene spans approximately 14 kb and contains seven exons. The sequences of the exon-intron boundaries of the Aie1 gene conform to the consensus sequences (GT/AG) of the splicing donor and acceptor sites of most eukaryotic genes. Comparative genomic sequencing revealed that the gene structure is highly conserved between mouse Aie1 and human AIE2. However, much less homology was found in the sequence outside the kinase-coding domains. The Aie1 locus was mapped to mouse chromosome 7A2-A3 by fluorescent in situ hybridization. Northern blot analysis indicates that Aie1 mRNA likely is expressed at a low level on day 14 and reaches its plateau on day 21 in the developing postnatal testis. RNA in situ hybridization indicated that the expression of the Aie1 transcript was restricted to meiotically active germ cells, with the highest levels detected in spermatocytes at the late pachytene stage. These findings suggest that Aie1 plays a role in spermatogenesis.

  15. Determination of Diagnostic Antigens in Cattle Amphistomiasis Using Western Blotting

    Directory of Open Access Journals (Sweden)

    A Halajian

    2009-05-01

    Full Text Available "nBackground: Mixed infection with amphistomes seems common in native cattle of Iran. The aim of this study was to determine diagnostic antigens in cattle mixed amphistomiasis."nMethods: Specific antigens of Cotylophoron cotylophorum, Gastrothylax crumenifer and Paramphisto­mum cervi (mixed infection, the most common species, were collected from cattle was deter­mined. Adult trematodes were collected from the rumen of naturally infected cattle at meat inspec­tion. After their homogenization and centrifugation, somatic antigens were prepared and ana­lyzed by SDS-PAGE. Specific antigens were determinated by western blot with homologous and heterolo­gous sera. SDS-PAGE of whole worms extract was performed at different concentrations and subse­quent gels staining. Immunoblotting analysis using sera from cattle naturally infected with am­phistomes, Dicrocoelium dendriticum, Fasciola spp. and hydatid cyst was performed."nResults: Electrophorese analysis of somatic antigens revealed the presence of 10 and 21 protein bands at 4 µgr/ml and 8 µgr/ml with molecular weights ranging from 25-120 and 25-150 kDa, respectively. The best result was taken at 8 mg/ml concentration. Although western blot of these proteins demon­strate 5 major antigenic polypeptides ranging from 50 to 100 kDa which were recognized by serum of cat­tle naturally infected with mixed amphistomes.

  16. Interspecies transmission and limited persistence of low pathogenic avian influenza genomes among Alaska dabbling ducks

    Science.gov (United States)

    Reeves, Andrew B.; Pearce, John M.; Ramey, Andy M.; Meixell, Brandt; Runstadler, Jonathan A.

    2011-01-01

    The reassortment and geographic distribution of low pathogenic avian influenza (LPAI) virus genes are well documented, but little is known about the persistence of intact LPAI genomes among species and locations. To examine persistence of entire LPAI genome constellations in Alaska, we calculated the genetic identities among 161 full-genome LPAI viruses isolated across 4 years from five species of duck: northern pintail (Anas acuta), mallard (Anas platyrhynchos), American green-winged teal (Anas crecca), northern shoveler (Anas clypeata) and American wigeon (Anas americana). Based on pairwise genetic distance, highly similar LPAI genomes (>99% identity) were observed within and between species and across a range of geographic distances (up to and >1000 km), but most often between isolates collected 0–10 km apart. Highly similar viruses were detected between years, suggesting inter-annual persistence, but these were rare in our data set with the majority occurring within 0–9 days of sampling. These results identify LPAI transmission pathways in the context of species, space and time, an initial perspective into the extent of regional virus distribution and persistence, and insight into why no completely Eurasian genomes have ever been detected in Alaska. Such information will be useful in forecasting the movement of foreign-origin avian influenza strains should they be introduced to North America.

  17. Genomic signals of migration and continuity in Britain before the Anglo-Saxons.

    Science.gov (United States)

    Martiniano, Rui; Caffell, Anwen; Holst, Malin; Hunter-Mann, Kurt; Montgomery, Janet; Müldner, Gundula; McLaughlin, Russell L; Teasdale, Matthew D; van Rheenen, Wouter; Veldink, Jan H; van den Berg, Leonard H; Hardiman, Orla; Carroll, Maureen; Roskams, Steve; Oxley, John; Morgan, Colleen; Thomas, Mark G; Barnes, Ian; McDonnell, Christine; Collins, Matthew J; Bradley, Daniel G

    2016-01-19

    The purported migrations that have formed the peoples of Britain have been the focus of generations of scholarly controversy. However, this has not benefited from direct analyses of ancient genomes. Here we report nine ancient genomes (∼ 1 ×) of individuals from northern Britain: seven from a Roman era York cemetery, bookended by earlier Iron-Age and later Anglo-Saxon burials. Six of the Roman genomes show affinity with modern British Celtic populations, particularly Welsh, but significantly diverge from populations from Yorkshire and other eastern English samples. They also show similarity with the earlier Iron-Age genome, suggesting population continuity, but differ from the later Anglo-Saxon genome. This pattern concords with profound impact of migrations in the Anglo-Saxon period. Strikingly, one Roman skeleton shows a clear signal of exogenous origin, with affinities pointing towards the Middle East, confirming the cosmopolitan character of the Empire, even at its northernmost fringes.

  18. Differential proteomic analysis of noncardia gastric cancer from individuals of northern Brazil.

    Science.gov (United States)

    Leal, Mariana Ferreira; Chung, Janete; Calcagno, Danielle Queiroz; Assumpção, Paulo Pimentel; Demachki, Samia; da Silva, Ismael Dale Cotrim Guerreiro; Chammas, Roger; Burbano, Rommel Rodríguez; de Arruda Cardoso Smith, Marília

    2012-01-01

    Gastric cancer is the second leading cause of cancer-related death worldwide. The identification of new cancer biomarkers is necessary to reduce the mortality rates through the development of new screening assays and early diagnosis, as well as new target therapies. In this study, we performed a proteomic analysis of noncardia gastric neoplasias of individuals from Northern Brazil. The proteins were analyzed by two-dimensional electrophoresis and mass spectrometry. For the identification of differentially expressed proteins, we used statistical tests with bootstrapping resampling to control the type I error in the multiple comparison analyses. We identified 111 proteins involved in gastric carcinogenesis. The computational analysis revealed several proteins involved in the energy production processes and reinforced the Warburg effect in gastric cancer. ENO1 and HSPB1 expression were further evaluated. ENO1 was selected due to its role in aerobic glycolysis that may contribute to the Warburg effect. Although we observed two up-regulated spots of ENO1 in the proteomic analysis, the mean expression of ENO1 was reduced in gastric tumors by western blot. However, mean ENO1 expression seems to increase in more invasive tumors. This lack of correlation between proteomic and western blot analyses may be due to the presence of other ENO1 spots that present a slightly reduced expression, but with a high impact in the mean protein expression. In neoplasias, HSPB1 is induced by cellular stress to protect cells against apoptosis. In the present study, HSPB1 presented an elevated protein and mRNA expression in a subset of gastric cancer samples. However, no association was observed between HSPB1 expression and clinicopathological characteristics. Here, we identified several possible biomarkers of gastric cancer in individuals from Northern Brazil. These biomarkers may be useful for the assessment of prognosis and stratification for therapy if validated in larger clinical study

  19. Differential proteomic analysis of noncardia gastric cancer from individuals of northern Brazil.

    Directory of Open Access Journals (Sweden)

    Mariana Ferreira Leal

    Full Text Available Gastric cancer is the second leading cause of cancer-related death worldwide. The identification of new cancer biomarkers is necessary to reduce the mortality rates through the development of new screening assays and early diagnosis, as well as new target therapies. In this study, we performed a proteomic analysis of noncardia gastric neoplasias of individuals from Northern Brazil. The proteins were analyzed by two-dimensional electrophoresis and mass spectrometry. For the identification of differentially expressed proteins, we used statistical tests with bootstrapping resampling to control the type I error in the multiple comparison analyses. We identified 111 proteins involved in gastric carcinogenesis. The computational analysis revealed several proteins involved in the energy production processes and reinforced the Warburg effect in gastric cancer. ENO1 and HSPB1 expression were further evaluated. ENO1 was selected due to its role in aerobic glycolysis that may contribute to the Warburg effect. Although we observed two up-regulated spots of ENO1 in the proteomic analysis, the mean expression of ENO1 was reduced in gastric tumors by western blot. However, mean ENO1 expression seems to increase in more invasive tumors. This lack of correlation between proteomic and western blot analyses may be due to the presence of other ENO1 spots that present a slightly reduced expression, but with a high impact in the mean protein expression. In neoplasias, HSPB1 is induced by cellular stress to protect cells against apoptosis. In the present study, HSPB1 presented an elevated protein and mRNA expression in a subset of gastric cancer samples. However, no association was observed between HSPB1 expression and clinicopathological characteristics. Here, we identified several possible biomarkers of gastric cancer in individuals from Northern Brazil. These biomarkers may be useful for the assessment of prognosis and stratification for therapy if validated in

  20. Peatmoss (Sphagnum) diversification associated with Miocene Northern Hemisphere climatic cooling?

    Science.gov (United States)

    Shaw, A Jonathan; Devos, Nicolas; Cox, Cymon J; Boles, Sandra B; Shaw, Blanka; Buchanan, Alex M; Cave, Lynette; Seppelt, Rodney

    2010-06-01

    Global climate changes sometimes spark biological radiations that can feed back to effect significant ecological impacts. Northern Hemisphere peatlands dominated by living and dead peatmosses (Sphagnum) harbor almost 30% of the global soil carbon pool and have functioned as a net carbon sink throughout the Holocene, and probably since the late Tertiary. Before that time, northern latitudes were dominated by tropical and temperate plant groups and ecosystems. Phylogenetic analyses of mosses (phylum Bryophyta) based on nucleotide sequences from the plastid, mitochondrial, and nuclear genomes indicate that most species of Sphagnum are of recent origin (ca. Sphagnum species are not only well-adapted to boreal peatlands, they create the conditions that promote development of peatlands. The recent radiation that gave rise to extant diversity of peatmosses is temporally associated with Miocene climatic cooling in the Northern Hemisphere. The evolution of Sphagnum has had profound influences on global biogeochemistry because of the unique biochemical, physiological, and morphological features of these plants, both while alive and after death. 2010 Elsevier Inc. All rights reserved.

  1. Silver and gold nanoparticle coated membranes applied to protein dot blots

    International Nuclear Information System (INIS)

    Xie, F.; Drozdowicz-Tomsia, K.; Shtoyko, T.; Goldys, E. M.

    2011-01-01

    Detection and identification of low abundance biomarker proteins is frequently based on various types of membrane-based devices. Lowering of the protein detection limits is vital in commercial applications such as lateral flow assays and in Western blots widely used in proteomics. These currently suffer from insufficient detection sensitivity and low retention for small 2–5 kDa proteins. In this study, we report the deposition of two types of metal nanoparticles: gold colloids (50–95 nm diameter) and silver fractals onto a range of commonly used types of membranes including polyvinylidene fluoride (PVDF). Due to strong affinity of proteins to noble metals, such modified membranes have the potential to effectively capture trace proteins preventing their loss. The membranes modified by metal particles were characterized optically and by SEM. The membrane performance in protein dot blots was evaluated using the protein—fluorophore conjugates Deep Purple-bovine serum albumin and fluorescein—human serum albumin. We found that the metal nanoparticles increase light extinction by metals, which is balanced by increased fluorescence, so that the effective fluorescence signal is unchanged. This feature combined with the capture of proteins by the nanoparticles embedded in the membrane increases the detection limit of membrane assays.

  2. Expression of chloroperoxidase from Pseudomonas pyrrocinia in tobacco plastids for fungal resistance.

    Science.gov (United States)

    Ruhlman, Tracey A; Rajasekaran, Kanniah; Cary, Jeffrey W

    2014-11-01

    The chloroperoxidase (cpo) gene from Pseudomonas pyrrocinia was transformed into the plastid genome (plastome) of Nicotiana tabacum var. Petit Havana and transplastomic lines were compared with a nuclear transformant for the same gene. Southern analysis confirmed integration in the plastome and western blotting confirmed the presence of the chloroperoxidase protein (CPO) in higher abundance in transplastomic plants than in cpo nuclear transformants. Northern analysis of primary plastome transformants for cpo showed 15-fold higher transcript abundance than in the nuclear transformant, yet this extent of enhancement was not observed in western blot, enzyme or bioassay, indicating a bottleneck at the post-transcriptional level. Representative plants from the two transplastomic lines showed resistance to fungal pathogens in vitro (Aspergillus flavus, Fusarium verticillioides, and Verticillium dahliae) and in planta (Alternaria alternata). Published by Elsevier Ireland Ltd.

  3. Checking transfer efficiency and equal loading via qualitative optical way in western blotting.

    Science.gov (United States)

    Gong, Jun-Hua; Gong, Jian-Ping; Zheng, Kai-Wen

    2017-11-01

    The ability to determine that successful transfer and equal loading occur prior to using primary antibodies is important. And total protein staining is commonly used to check transfer efficiency and normalization, which play a crucial role in western blotting. Ponceau S and coomassie blue are commonly used, but there are disadvantages reported in recent years. Therefore, we are interested in finding another method, which is cheap, easy and fast. As we know, protein binding region of PVDF membrane is still hydrophilic when carbinol volatilizes, however, the non-protein binding region of PVDF membrane became hydrophobic again. And this different wettability between non-protein binding region and protein binding region of Polyvinylidene difluoride membrane may be used to check transfer efficiency and equal loading in western blotting. Based on the principle above, we describe an optical approach where an experimenter can observe that the proteins have been transferred to the membrane without any staining within minutes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Conservation of the fourth gene among rotaviruses recovered from asymptomatic newborn infants and its possible role in attenuation

    International Nuclear Information System (INIS)

    Flores, J.; Midthun, K.; Hoshino, Y.; Green, K.; Gorziglia, M.; Kapikian, A.Z.; Chanock, R.M.

    1986-01-01

    RNA-RNA hybridization was performed to assess the extent of genetic relatedness among human rotaviruses isolated from children with gastroenteritis and from asymptomatic newborn infants. 32 P-labeled single-stranded RNAs produced by in vitro transcription from viral cores of the different strains tested were used as probes in two different hybridization assays: (1) undenatured genomic RNAs were resolved by polyacrylamide gel electrophoresis, denatured in situ, electrophoretically transferred to diazobenzyloxymethyl-paper (Northern blots), and then hybridized to the probes under two different conditions of stringency; and (ii) denatured genomic double-stranded RNAs were hybridized to the probes in solution and the hybrids which formed were identified by polyacrylamide gel electrophoresis. When analyzed by Northern blot hybridization at a low level of stringency, all genes from the strains tested cross-hybridized, providing evidence for some sequence homology in each of the corresponding genes. However, when hybridization stringency was increased, a difference in gene 4 sequence was detected between strains recovered from asymptomatic newborn infants (nursery strains) and strains recovered from infants and young children with diarrhea. Although the nursery strains exhibited serotypic diversity, the fourth gene appeared to be highly conversed. These results were confirmed and extended during experiments in which the RNA-RNA hybridization was carried out in solution and the resulting hybrids were analyzed by polyacrylamide gel electrophoresis. Full-length hybrids did not form between the fourth genes from the nursery strains and the corresponding genes from the strains recovered from symptomatic infants and young children

  5. Spread of CTX-M-type ESßLs in isolates of E. coli from long-term care and rehabilitation facilities in Northern Italy

    Directory of Open Access Journals (Sweden)

    Elisabetta Nucleo

    2008-09-01

    Full Text Available During the period March 2003 – May 2004 at the Laboratory of Clinical Microbiology “Redaelli” LTCRF in Milan, Italy, a total of 529 E. coli, obtained from inpatients of 3 different Long Term Care Rehabilitation Facilities (LTCRFs in Northern Italy, were processed and 77 ESßLs producers (14.5% were identified by Vitek System. The results were confirmed by double-disk synergy test with tazobactam (TZP. 61/77 isolates were characterized by higher levels of resistance to cefotaxime (CTX than to ceftazidime (CAZ. (ß-lactamase production was investigated by analytical isoelectric focusing (IEF coupled with a bioassay and showed multiple (ß-lactamase bands including one enzyme with pI 8.4 that, in a bioassay, was more active on CTX,ATM than on CAZ. The presence of (ß-lactamase genes was investigated by colony blot hybridization and by PCR amplification of blaTEM, blaSHV and blaCTX-M alleles. 43/61 isolates produced both TEM-1 and CTX-M-type enzymes, 14/61 expressed only CTX-M-type while in 4 cases were found blaCTX-M, blaTEM and blaSHV genes.The remainders (16/77, characterized by high levels of resistance to both CTX and CAZ, produced TEM-1 and SHV-5 enzymes (1/16 and TEM type ESßLs (15/16. Conjugation experiments, performed in liquid medium, confermed that the ESßLs determinants were transferable. Pulsed-field gel electrophoresis profiles of genomic DNA, digested with NotI, were analysed and revealed clonal heterogeneity. Our work confirms the emergence of CTX-M-type enzymes and their spread in Northern Italy also in longterm care and rehabilitation facilities that may be an important reservoir of ES?L producing E. coli.

  6. Partial digestion with restriction enzymes of ultraviolet-irradiated human genomic DNA: a method for identifying restriction site polymorphisms

    International Nuclear Information System (INIS)

    Nobile, C.; Romeo, G.

    1988-01-01

    A method for partial digestion of total human DNA with restriction enzymes has been developed on the basis of a principle already utilized by P.A. Whittaker and E. Southern for the analysis of phage lambda recombinants. Total human DNA irradiated with uv light of 254 nm is partially digested by restriction enzymes that recognize sequences containing adjacent thymidines because of TT dimer formation. The products resulting from partial digestion of specific genomic regions are detected in Southern blots by genomic-unique DNA probes with high reproducibility. This procedure is rapid and simple to perform because the same conditions of uv irradiation are used for different enzymes and probes. It is shown that restriction site polymorphisms occurring in the genomic regions analyzed are recognized by the allelic partial digest patterns they determine

  7. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  8. Comparative genomic mapping of the bovine Fragile Histidine Triad (FHIT tumour suppressor gene: characterization of a 2 Mb BAC contig covering the locus, complete annotation of the gene, analysis of cDNA and of physiological expression profiles

    Directory of Open Access Journals (Sweden)

    Boussaha Mekki

    2006-05-01

    Full Text Available Abstract Background The Fragile Histidine Triad gene (FHIT is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. Results The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. Conclusion A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis

  9. Comparative genomic mapping of the bovine Fragile Histidine Triad (FHIT) tumour suppressor gene: characterization of a 2 Mb BAC contig covering the locus, complete annotation of the gene, analysis of cDNA and of physiological expression profiles.

    Science.gov (United States)

    Uboldi, Cristina; Guidi, Elena; Roperto, Sante; Russo, Valeria; Roperto, Franco; Di Meo, Giulia Pia; Iannuzzi, Leopoldo; Floriot, Sandrine; Boussaha, Mekki; Eggen, André; Ferretti, Luca

    2006-05-23

    The Fragile Histidine Triad gene (FHIT) is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis, especially of vesical papillomavirus-associated cancers of

  10. Recombinant antigen-based immuno-slot blot method for serodiagnosis of syphilis

    Directory of Open Access Journals (Sweden)

    N.S. Sato

    2004-07-01

    Full Text Available Three recombinant antigens of Treponema pallidum Nichols strain were fused with GST, cloned and expressed in Escherichia coli, resulting in high levels of GST-rTp47 and GST-rTp17 expression, and supplementation with arginine tRNA for the AGR codon was needed to obtain GST-rTp15 overexpression. Purified fusion protein yields were 1.9, 1.7 and 5.3 mg/l of cell culture for GST-rTp47, GST-rTp17 and GST-rTp15, respectively. The identities of the antigens obtained were confirmed by automated DNA sequencing using ABI Prism 310 and peptide mapping by Finningan LC/MS. These recombinant antigens were evaluated by immuno-slot blot techniques applied to 137 serum samples from patients with a clinical and laboratory diagnosis of syphilis (61 samples, from healthy blood donors (50 samples, individuals with sexually transmitted disease other than syphilis (3 samples, and from individuals with other spirochetal diseases such as Lyme disease (20 samples and leptospirosis (3 samples. The assay had sensitivity of 95.1% (95% CI, 86.1 to 98.7% and a specificity of 94.7% (95% CI, 87.0 to 98.7%; a stronger reactivity was observed with fraction rTp17. The immunoreactivity results showed that fusion recombinant antigens based-immuno-slot blot techniques are suitable for use in diagnostic assays for syphilis.

  11. Acid-Urea Gel Electrophoresis and Western Blotting of Histones.

    Science.gov (United States)

    Hazzalin, Catherine A; Mahadevan, Louis C

    2017-01-01

    Acid-urea gel electrophoresis offers significant advantages over SDS-PAGE for analysis of post-translational protein modifications, being capable of resolving proteins of similar size but varying in charge. Hence, it can be used to separate protein variants with small charge-altering differences in primary sequence, and is particularly useful in the analysis of histones whose charge variation arises from post-translational modification, such as phosphorylation or acetylation. On acid-urea gels, histones that carry multiple modifications, each with a characteristic charge, are resolved into distinct bands, the so-called "histone ladder." Thus, the extent and distribution of different modification states of histones can be visualized. Here, we describe the analysis of histone H3 by acid-urea gel electrophoresis and western blotting.

  12. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  13. Glycosaminoglycan blotting on nitrocellulose membranes treated with cetylpyridinium chloride after agarose-gel electrophoretic separation.

    Science.gov (United States)

    Maccari, Francesca; Volpi, Nicola

    2002-09-01

    We describe a method for blotting and immobilizing several nonsulfated and sulfated complex polysaccharides on membranes made hydrophilic and positively charged by a cationic detergent after their separation by conventional agarose gel electrophoresis. Nitrocellulose membranes were derivatized with the cationic detergent cetylpyridinium chloride (CPC) and mixtures of glycosaminoglycans (GAGs) were capillary-blotted after their separation in agarose gel electrophoresis in barium acetate/1,2-diaminopropane. Single purified species of variously sulfated polysaccharides were transferred onto the derivatized membranes after electrophoresis with an efficiency of 100% and stained with alcian blue (irreversible staining) and toluidine blue (reversible staining) permitting about 0.1 nug threshold of detection. Nonsulfated polyanions, hyaluronic acid, a fructose-containing polysaccharide with a chondroitin backbone purified from Escherichia coli U1-41, and its defructosylated product, were also electrophoretically separated and transferred onto membranes. The limit of detection for desulfated GAGs was about 0.1-0.5 nug after irreversible or reversible staining. GAG extracts from bovine, lung and aorta, and human aorta and urine were separated by agarose gel electrophoresis and blotted on CPC-treated nitrocellulose membranes. The polysaccharide composition of these extracts was determined. The membrane stained with toluidine blue (reversible staining) was destained and the same lanes used for immunological detection or other applications. Reversible staining was also applied to recover single species of polysaccharides after electrophoretic separation of mixtures of GAGs and their transfer onto membranes. Single bands were released from the membrane with an efficiency of 70-100% for further biochemical characterization.

  14. A novel stroke locus identified in a northern Sweden pedigree

    DEFF Research Database (Denmark)

    Janunger, T.; Nilsson-Ardnor, S.; Wiklund, P.-G.

    2009-01-01

    OBJECTIVES: The population of northern Sweden is characterized by reduced genetic diversity and a high incidence of stroke. We sought to reduce genetic variation further, using genealogic analysis in a set of nuclear families affected by stroke, and we subsequently performed a genome-wide scan...... to identify novel stroke susceptibility loci. METHODS: Through genealogy, 7 nuclear families with a common ancestor, connected over 8 generations, were identified. A genome-wide scan using 449 microsatellite markers was performed with subsequent haplotype analyses. RESULTS: A maximum allele-sharing lod score...... of 4.81 on chromosome 9q31-q33 was detected. Haplotype analysis identified a common 2.2-megabase interval in the chromosomal region in 4 of the nuclear families, where an overrepresentation of intracerebral hemorrhage was observed. CONCLUSIONS: We have identified a novel susceptibility locus for stroke...

  15. microRNA analysis of Taenia crassiceps cysticerci under praziquantel treatment and genome-wide identification of Taenia solium miRNAs.

    Science.gov (United States)

    Pérez, Matías Gastón; Macchiaroli, Natalia; Lichtenstein, Gabriel; Conti, Gabriela; Asurmendi, Sebastián; Milone, Diego Humberto; Stegmayer, Georgina; Kamenetzky, Laura; Cucher, Marcela; Rosenzvit, Mara Cecilia

    2017-09-01

    MicroRNAs (miRNAs) are small non-coding RNAs that have emerged as important regulators of gene expression and perform critical functions in development and disease. In spite of the increased interest in miRNAs from helminth parasites, no information is available on miRNAs from Taenia solium, the causative agent of cysticercosis, a neglected disease affecting millions of people worldwide. Here we performed a comprehensive analysis of miRNAs from Taenia crassiceps, a laboratory model for T. solium studies, and identified miRNAs in the T. solium genome. Moreover, we analysed the effect of praziquantel, one of the two main drugs used for cysticercosis treatment, on the miRNA expression profile of T. crassiceps cysticerci. Using small RNA-seq and two independent algorithms for miRNA prediction, as well as northern blot validation, we found transcriptional evidence of 39 miRNA loci in T. crassiceps. Since miRNAs were mapped to the T. solium genome, these miRNAs are considered common to both parasites. The miRNA expression profile of T. crassiceps was biased to the same set of highly expressed miRNAs reported in other cestodes. We found a significant altered expression of miR-7b under praziquantel treatment. In addition, we searched for miRNAs predicted to target genes related to drug response. We performed a detailed target prediction for miR-7b and found genes related to drug action. We report an initial approach to study the effect of sub-lethal drug treatment on miRNA expression in a cestode parasite, which provides a platform for further studies of miRNA involvement in drug effects. The results of our work could be applied to drug development and provide basic knowledge of cysticercosis and other neglected helminth infections. Copyright © 2017 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

  16. Accelerating the Switchgrass (Panicum virgatum L.) Breeding Cycle Using Genomic Selection Approaches

    Science.gov (United States)

    Lipka, Alexander E.; Lu, Fei; Cherney, Jerome H.; Buckler, Edward S.; Casler, Michael D.; Costich, Denise E.

    2014-01-01

    Switchgrass (Panicum virgatum L.) is a perennial grass undergoing development as a biofuel feedstock. One of the most important factors hindering breeding efforts in this species is the need for accurate measurement of biomass yield on a per-hectare basis. Genomic selection on simple-to-measure traits that approximate biomass yield has the potential to significantly speed up the breeding cycle. Recent advances in switchgrass genomic and phenotypic resources are now making it possible to evaluate the potential of genomic selection of such traits. We leveraged these resources to study the ability of three widely-used genomic selection models to predict phenotypic values of morphological and biomass quality traits in an association panel consisting of predominantly northern adapted upland germplasm. High prediction accuracies were obtained for most of the traits, with standability having the highest ten-fold cross validation prediction accuracy (0.52). Moreover, the morphological traits generally had higher prediction accuracies than the biomass quality traits. Nevertheless, our results suggest that the quality of current genomic and phenotypic resources available for switchgrass is sufficiently high for genomic selection to significantly impact breeding efforts for biomass yield. PMID:25390940

  17. Western Blotting Using the Invitrogen NuPage Novex Bis Tris MiniGels

    OpenAIRE

    Penna, Aubin; Cahalan, Michael

    2007-01-01

    Western Blotting (or immunoblotting) is a standard laboratory procedure allowing investigators to verify the expression of a protein, determine the relative amount of the protein present in different samples, and analyze the results of co-immunoprecipitation experiments. In this method, a target protein is detected with a specific primary antibody in a given sample of tissue homogenate or extract. Protein separation according to molecular weight is achieved using denaturing SDS-PAGE. After tr...

  18. DISKRIMINASI KELAMIN PADA IKAN TUNA SIRIP KUNING, Yellowfin tuna MENGGUNAKAN ANALISIS DOT BLOT DAN ELISA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2014-08-01

    Full Text Available Pemahaman tentang penentuan jenis kelamin dalam populasi induk merupakan hal yang sangat penting bagi keberhasilan program pembenihan. Pengukuran reaksi antibodi dan aktivitas hormon testosterone, serta estradiol adalah metode dengan potensi yang secara akurat dapat menentukan jenis kelamin ikan tanpa mematikan ikan. Tujuan penelitian ini adalah untuk mengetahui akurasi metode dot blot dan ELISA dengan 11-ketotestorsterone (11-KT yang tersedia secara komersial EIA-kit untuk membedakan jenis kelamin ikan tuna sirip kuning. Hasil analisis menunjukkan bahwa metode dot blot menghasilkan ekspresi vitelogenin tampak jelas pada individu betina dan efek plasma terlihat transparan, jika dibandingkan dengan individu jantan. Interpretasi dari metode ini memerlukan pengalaman dan keahlian dalam akurasi pembacaan hasil. Aktivitas hormon 11-KT dengan sampel klip sirip dan plasma memberikan hasil yang baik dengan aktivitas hormon terlihat jelas.

  19. Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

    Science.gov (United States)

    Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

    2015-01-01

    The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

  20. Product-selective blot: a technique for measuring enzyme activities in large numbers of samples and in native electrophoresis gels

    International Nuclear Information System (INIS)

    Thompson, G.A.; Davies, H.M.; McDonald, N.

    1985-01-01

    A method termed product-selective blotting has been developed for screening large numbers of samples for enzyme activity. The technique is particularly well suited to detection of enzymes in native electrophoresis gels. The principle of the method was demonstrated by blotting samples from glutaminase or glutamate synthase reactions into an agarose gel embedded with ion-exchange resin under conditions favoring binding of product (glutamate) over substrates and other substances in the reaction mixture. After washes to remove these unbound substances, the product was measured using either fluorometric staining or radiometric techniques. Glutaminase activity in native electrophoresis gels was visualized by a related procedure in which substrates and products from reactions run in the electrophoresis gel were blotted directly into a resin-containing image gel. Considering the selective-binding materials available for use in the image gel, along with the possible detection systems, this method has potentially broad application

  1. Characterization of apparently balanced chromosomal rearrangements from the developmental genome anatomy project.

    Science.gov (United States)

    Higgins, Anne W; Alkuraya, Fowzan S; Bosco, Amy F; Brown, Kerry K; Bruns, Gail A P; Donovan, Diana J; Eisenman, Robert; Fan, Yanli; Farra, Chantal G; Ferguson, Heather L; Gusella, James F; Harris, David J; Herrick, Steven R; Kelly, Chantal; Kim, Hyung-Goo; Kishikawa, Shotaro; Korf, Bruce R; Kulkarni, Shashikant; Lally, Eric; Leach, Natalia T; Lemyre, Emma; Lewis, Janine; Ligon, Azra H; Lu, Weining; Maas, Richard L; MacDonald, Marcy E; Moore, Steven D P; Peters, Roxanna E; Quade, Bradley J; Quintero-Rivera, Fabiola; Saadi, Irfan; Shen, Yiping; Shendure, Jay; Williamson, Robin E; Morton, Cynthia C

    2008-03-01

    Apparently balanced chromosomal rearrangements in individuals with major congenital anomalies represent natural experiments of gene disruption and dysregulation. These individuals can be studied to identify novel genes critical in human development and to annotate further the function of known genes. Identification and characterization of these genes is the goal of the Developmental Genome Anatomy Project (DGAP). DGAP is a multidisciplinary effort that leverages the recent advances resulting from the Human Genome Project to increase our understanding of birth defects and the process of human development. Clinically significant phenotypes of individuals enrolled in DGAP are varied and, in most cases, involve multiple organ systems. Study of these individuals' chromosomal rearrangements has resulted in the mapping of 77 breakpoints from 40 chromosomal rearrangements by FISH with BACs and fosmids, array CGH, Southern-blot hybridization, MLPA, RT-PCR, and suppression PCR. Eighteen chromosomal breakpoints have been cloned and sequenced. Unsuspected genomic imbalances and cryptic rearrangements were detected, but less frequently than has been reported previously. Chromosomal rearrangements, both balanced and unbalanced, in individuals with multiple congenital anomalies continue to be a valuable resource for gene discovery and annotation.

  2. Small genomes and large seeds: chromosome numbers, genome size and seed mass in diploid Aesculus species (Sapindaceae).

    Science.gov (United States)

    Krahulcová, Anna; Trávnícek, Pavel; Krahulec, František; Rejmánek, Marcel

    2017-04-01

    Aesculus L. (horse chestnut, buckeye) is a genus of 12-19 extant woody species native to the temperate Northern Hemisphere. This genus is known for unusually large seeds among angiosperms. While chromosome counts are available for many Aesculus species, only one has had its genome size measured. The aim of this study is to provide more genome size data and analyse the relationship between genome size and seed mass in this genus. Chromosome numbers in root tip cuttings were confirmed for four species and reported for the first time for three additional species. Flow cytometric measurements of 2C nuclear DNA values were conducted on eight species, and mean seed mass values were estimated for the same taxa. The same chromosome number, 2 n = 40, was determined in all investigated taxa. Original measurements of 2C values for seven Aesculus species (eight taxa), added to just one reliable datum for A. hippocastanum , confirmed the notion that the genome size in this genus with relatively large seeds is surprisingly low, ranging from 0·955 pg 2C -1 in A. parviflora to 1·275 pg 2C -1 in A. glabra var. glabra. The chromosome number of 2 n = 40 seems to be conclusively the universal 2 n number for non-hybrid species in this genus. Aesculus genome sizes are relatively small, not only within its own family, Sapindaceae, but also within woody angiosperms. The genome sizes seem to be distinct and non-overlapping among the four major Aesculus clades. These results provide an extra support for the most recent reconstruction of Aesculus phylogeny. The correlation between the 2C values and seed masses in examined Aesculus species is slightly negative and not significant. However, when the four major clades are treated separately, there is consistent positive association between larger genome size and larger seed mass within individual lineages. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For

  3. Dot-blot immunoassay of Fasciola gigantica infection using 27 kDa and adult worm regurge antigens in Egyptian patients.

    Science.gov (United States)

    Kamel, Hanan H; Saad, Ghada A; Sarhan, Rania M

    2013-04-01

    The purpose of the present study was to evaluate the potential role of the 27-Kilodalton (KDa) antigen versus Fasciola gigantica adult worm regurge antigens in a DOT-Blot assay and to assess this assay as a practical tool for diagnosis fascioliasis in Egyptian patients. Fasciola gigantica antigen of an approximate molecular mass 27-(KDa) was obtained from adult worms by a simple elution SDS-PAGE. A Dot-Blot was developed comparatively to adult worm regurge antigens for the detection of specific antibodies from patients infected with F. gigantica in Egypt. Control sera were obtained from patients with other parasitic infections and healthy volunteers to assess the test and compare between the antigens. The sensitivity, specificity, positive and negative predictive values of Dot-Blot using the adult worm regurge were 80%, 90%, 94.1%, and 69.2% respectively, while those using 27-KDa were 100% which confirms the diagnostic potential of this antigen. All patients infected with Fasciola were positive, with cross reactivity reported with Schistosoma mansoni serum samples. This 27-KDa Dot-Blot assay showed to be a promising test which can be used for serodiagnosis of fascioliasis in Egyptian patients especially, those presenting with hepatic disease. It is specific, sensitive and easy to perform method for the rapid diagnosis particularly when more complex laboratory tests are unavailable.

  4. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  5. Assembling large genomes: analysis of the stick insect (Clitarchus hookeri) genome reveals a high repeat content and sex-biased genes associated with reproduction.

    Science.gov (United States)

    Wu, Chen; Twort, Victoria G; Crowhurst, Ross N; Newcomb, Richard D; Buckley, Thomas R

    2017-11-16

    Stick insects (Phasmatodea) have a high incidence of parthenogenesis and other alternative reproductive strategies, yet the genetic basis of reproduction is poorly understood. Phasmatodea includes nearly 3000 species, yet only the genome of Timema cristinae has been published to date. Clitarchus hookeri is a geographical parthenogenetic stick insect distributed across New Zealand. Sexual reproduction dominates in northern habitats but is replaced by parthenogenesis in the south. Here, we present a de novo genome assembly of a female C. hookeri and use it to detect candidate genes associated with gamete production and development in females and males. We also explore the factors underlying large genome size in stick insects. The C. hookeri genome assembly was 4.2 Gb, similar to the flow cytometry estimate, making it the second largest insect genome sequenced and assembled to date. Like the large genome of Locusta migratoria, the genome of C. hookeri is also highly repetitive and the predicted gene models are much longer than those from most other sequenced insect genomes, largely due to longer introns. Miniature inverted repeat transposable elements (MITEs), absent in the much smaller T. cristinae genome, is the most abundant repeat type in the C. hookeri genome assembly. Mapping RNA-Seq reads from female and male gonadal transcriptomes onto the genome assembly resulted in the identification of 39,940 gene loci, 15.8% and 37.6% of which showed female-biased and male-biased expression, respectively. The genes that were over-expressed in females were mostly associated with molecular transportation, developmental process, oocyte growth and reproductive process; whereas, the male-biased genes were enriched in rhythmic process, molecular transducer activity and synapse. Several genes involved in the juvenile hormone synthesis pathway were also identified. The evolution of large insect genomes such as L. migratoria and C. hookeri genomes is most likely due to the

  6. The genomic history of southeastern Europe.

    Science.gov (United States)

    Mathieson, Iain; Alpaslan-Roodenberg, Songül; Posth, Cosimo; Szécsényi-Nagy, Anna; Rohland, Nadin; Mallick, Swapan; Olalde, Iñigo; Broomandkhoshbacht, Nasreen; Candilio, Francesca; Cheronet, Olivia; Fernandes, Daniel; Ferry, Matthew; Gamarra, Beatriz; Fortes, Gloria González; Haak, Wolfgang; Harney, Eadaoin; Jones, Eppie; Keating, Denise; Krause-Kyora, Ben; Kucukkalipci, Isil; Michel, Megan; Mittnik, Alissa; Nägele, Kathrin; Novak, Mario; Oppenheimer, Jonas; Patterson, Nick; Pfrengle, Saskia; Sirak, Kendra; Stewardson, Kristin; Vai, Stefania; Alexandrov, Stefan; Alt, Kurt W; Andreescu, Radian; Antonović, Dragana; Ash, Abigail; Atanassova, Nadezhda; Bacvarov, Krum; Gusztáv, Mende Balázs; Bocherens, Hervé; Bolus, Michael; Boroneanţ, Adina; Boyadzhiev, Yavor; Budnik, Alicja; Burmaz, Josip; Chohadzhiev, Stefan; Conard, Nicholas J; Cottiaux, Richard; Čuka, Maja; Cupillard, Christophe; Drucker, Dorothée G; Elenski, Nedko; Francken, Michael; Galabova, Borislava; Ganetsovski, Georgi; Gély, Bernard; Hajdu, Tamás; Handzhyiska, Veneta; Harvati, Katerina; Higham, Thomas; Iliev, Stanislav; Janković, Ivor; Karavanić, Ivor; Kennett, Douglas J; Komšo, Darko; Kozak, Alexandra; Labuda, Damian; Lari, Martina; Lazar, Catalin; Leppek, Maleen; Leshtakov, Krassimir; Vetro, Domenico Lo; Los, Dženi; Lozanov, Ivaylo; Malina, Maria; Martini, Fabio; McSweeney, Kath; Meller, Harald; Menđušić, Marko; Mirea, Pavel; Moiseyev, Vyacheslav; Petrova, Vanya; Price, T Douglas; Simalcsik, Angela; Sineo, Luca; Šlaus, Mario; Slavchev, Vladimir; Stanev, Petar; Starović, Andrej; Szeniczey, Tamás; Talamo, Sahra; Teschler-Nicola, Maria; Thevenet, Corinne; Valchev, Ivan; Valentin, Frédérique; Vasilyev, Sergey; Veljanovska, Fanica; Venelinova, Svetlana; Veselovskaya, Elizaveta; Viola, Bence; Virag, Cristian; Zaninović, Joško; Zäuner, Steve; Stockhammer, Philipp W; Catalano, Giulio; Krauß, Raiko; Caramelli, David; Zariņa, Gunita; Gaydarska, Bisserka; Lillie, Malcolm; Nikitin, Alexey G; Potekhina, Inna; Papathanasiou, Anastasia; Borić, Dušan; Bonsall, Clive; Krause, Johannes; Pinhasi, Ron; Reich, David

    2018-03-08

    Farming was first introduced to Europe in the mid-seventh millennium bc, and was associated with migrants from Anatolia who settled in the southeast before spreading throughout Europe. Here, to understand the dynamics of this process, we analysed genome-wide ancient DNA data from 225 individuals who lived in southeastern Europe and surrounding regions between 12000 and 500 bc. We document a west-east cline of ancestry in indigenous hunter-gatherers and, in eastern Europe, the early stages in the formation of Bronze Age steppe ancestry. We show that the first farmers of northern and western Europe dispersed through southeastern Europe with limited hunter-gatherer admixture, but that some early groups in the southeast mixed extensively with hunter-gatherers without the sex-biased admixture that prevailed later in the north and west. We also show that southeastern Europe continued to be a nexus between east and west after the arrival of farmers, with intermittent genetic contact with steppe populations occurring up to 2,000 years earlier than the migrations from the steppe that ultimately replaced much of the population of northern Europe.

  7. Proteínas inmunodominantes de Brucella Melitensis evaluadas por Western Blot

    Directory of Open Access Journals (Sweden)

    Elizabeth Anaya

    1997-01-01

    Full Text Available Se separaron extractos de proteínas totales de Brucella melitensis en gel 15% SDS-PAGE. Su seroreactividad fue analizada por Western Blot con resultados satisfactorios. Para éste propósito sueros controles negativos (n=03, sueros de pacientes con brucelosis (n=34, cólera (n=12, tifoidea (n=02 y tuberculosis (n=02 fueron usados. Esta prueba inmunodiagnóstica detectó bandas seroreactivas altamente específicas (100% correspondientes a 8,14,18, un complejo de 25-48 y 58kDa. La sensibilidad del test fue del 90% usando los sueros antes mencionados.

  8. FANCD2 Western blot as a diagnostic tool for Brazilian patients with Fanconi anemia

    Directory of Open Access Journals (Sweden)

    D.V. Pilonetto

    2009-03-01

    Full Text Available Fanconi anemia is a rare hereditary disease showing genetic heterogeneity due to a variety of mutations in genes involved in DNA repair pathways, which may lead to different clinical manifestations. Phenotypic variability makes diagnosis difficult based only on clinical manifestations, therefore laboratory tests are necessary. New advances in molecular pathogenesis of this disease led researchers to develop a diagnostic test based on Western blot for FANCD2. The objective of the present study was to determine the efficacy of this method for the diagnosis of 84 Brazilian patients with Fanconi anemia, all of whom tested positive for the diepoxybutane test, and 98 healthy controls. The FANCD2 monoubiquitinated isoform (FANCDS+/FANCD2L- was not detected in 77 patients (91.7%. In 2 patients (2.4%, there was an absence of both the monoubiquitinated and the non-ubiquitinated proteins (FANCD2S-/FANCD2L- and 5 patients (5.9% had both isoforms (FANCD2S+/FANCD2L+. This last phenotype suggests downstream subtypes or mosaicism. All controls were diepoxybutane negative and were also negative on the FANCD2 Western blot. The Western blot for FANCD2 presented a sensitivity of 94% (79/84 and specificity of 100% (98/98. This method was confirmed as an efficient approach to screen Brazilian patients with deleterious mutations on FANCD2 (FANCD2S-/FANCD2L- or other upstream genes of the FA/BRCA pathway (FANCDS+/FANCD2L-, to confirm the chromosome breakage test and to classify patients according to the level of FA/BRCA pathway defects. However, patients showing both FANCD2 isoforms (FANCD2S+/FANCD2L+ require additional studies to confirm mutations on downstream Fanconi anemia genes or the presence of mosaicism.

  9. Modified protocol for genomic DNA extraction from newly plucked feathers of lophura leucomelana hamiltoni (Galliformes) for genetic studies and its endo-restriction analysis

    International Nuclear Information System (INIS)

    Andleeb, S.; Shamim, S.; Minhas, R.A.

    2012-01-01

    A rapid and accurate protocol was used first time to isolate the high-quality genomic DNA from newly plucked feathers of Lophura leucomelana. Two different lysis protocols were used depending on the feather size and it was observed that 55 deg. C for 3 to 4 days showed better results of feathers lysis as compared with the 37 deg. C for overnight with gentle shaking. Purification of genomic DNA was also performed with phenol: chloroform: isoamyl alcohol and 100% absolute ethanol precipitation methods. By using this protocol, a significant amount of high-quality genomic DNA was obtained and the purity of DNA was analyzed through endo-restriction analysis. Genomic DNA isolated with this modified method will be used for Southern blotting and also in several polymerase chain reaction systems devoted to sex determination and paternity testing and the evolutionary relationships among the other pheasants. (author)

  10. Engineering the Chloroplast Genome of Oleaginous Marine Microalga Nannochloropsis oceanica

    Directory of Open Access Journals (Sweden)

    Qinhua Gan

    2018-04-01

    Full Text Available Plastid engineering offers an important tool to fill the gap between the technical and the enormous potential of microalgal photosynthetic cell factory. However, to date, few reports on plastid engineering in industrial microalgae have been documented. This is largely due to the small cell sizes and complex cell-wall structures which make these species intractable to current plastid transformation methods (i.e., biolistic transformation and polyethylene glycol-mediated transformation. Here, employing the industrial oleaginous microalga Nannochloropsis oceanica as a model, an electroporation-mediated chloroplast transformation approach was established. Fluorescent microscopy and laser confocal scanning microscopy confirmed the expression of the green fluorescence protein, driven by the endogenous plastid promoter and terminator. Zeocin-resistance selection led to an acquisition of homoplasmic strains of which a stable and site-specific recombination within the chloroplast genome was revealed by sequencing and DNA gel blotting. This demonstration of electroporation-mediated chloroplast transformation opens many doors for plastid genome editing in industrial microalgae, particularly species of which the chloroplasts are recalcitrant to chemical and microparticle bombardment transformation.

  11. From genomes to vaccines via the proteome

    Directory of Open Access Journals (Sweden)

    R Alan Wilson

    2004-08-01

    Full Text Available An effective vaccine against schistosomiasis mansoni would be a valuable control tool and the high levels of protection elicited in rodents and primates by radiation-attenuated cercariae provide proof of principle. A major obstacle to vaccine development is the difficulty of identifying the antigens that mediate protection, not least because of the size of the genome at 280Mb DNA encoding 14,000 to 20,000 genes. The technologies collectively called proteomics, including 2D electrophoresis, liquid chromatography and mass spectrometry, now permit any protein to be identified provided there is extensive DNA data, and preferably a genome sequence. Applied to soluble (cytosolic proteins from schistosomes, proteomics reveals the great similarity in composition between life cycle stages, with several WHO vaccine candidates amongst the most abundant constituents. The proteomic approach has been successfully applied to identify the secretions used by cercaria to penetrate host skin, the gut secretions of adult worms and the proteins exposed on the tegument surface. Soluble proteins can also be separated by 2D electrophoresis before western blotting to identify the full range of antigenic targets present in a parasite preparation. The next step is to discover which target proteins represent the weak points in the worm's defences.

  12. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  13. Genetic relatedness of indigenous ethnic groups in northern Borneo to neighboring populations from Southeast Asia, as inferred from genome-wide SNP data.

    Science.gov (United States)

    Yew, Chee Wei; Hoque, Mohd Zahirul; Pugh-Kitingan, Jacqueline; Minsong, Alexander; Voo, Christopher Lok Yung; Ransangan, Julian; Lau, Sophia Tiek Ying; Wang, Xu; Saw, Woei Yuh; Ong, Rick Twee-Hee; Teo, Yik-Ying; Xu, Shuhua; Hoh, Boon-Peng; Phipps, Maude E; Kumar, S Vijay

    2018-07-01

    The region of northern Borneo is home to the current state of Sabah, Malaysia. It is located closest to the southern Philippine islands and may have served as a viaduct for ancient human migration onto or off of Borneo Island. In this study, five indigenous ethnic groups from Sabah were subjected to genome-wide SNP genotyping. These individuals represent the "North Borneo"-speaking group of the great Austronesian family. They have traditionally resided in the inland region of Sabah. The dataset was merged with public datasets, and the genetic relatedness of these groups to neighboring populations from the islands of Southeast Asia, mainland Southeast Asia and southern China was inferred. Genetic structure analysis revealed that these groups formed a genetic cluster that was independent of the clusters of neighboring populations. Additionally, these groups exhibited near-absolute proportions of a genetic component that is also common among Austronesians from Taiwan and the Philippines. They showed no genetic admixture with Austro-Melanesian populations. Furthermore, phylogenetic analysis showed that they are closely related to non-Austro-Melansian Filipinos as well as to Taiwan natives but are distantly related to populations from mainland Southeast Asia. Relatively lower heterozygosity and higher pairwise genetic differentiation index (F ST ) values than those of nearby populations indicate that these groups might have experienced genetic drift in the past, resulting in their differentiation from other Austronesians. Subsequent formal testing suggested that these populations have received no gene flow from neighboring populations. Taken together, these results imply that the indigenous ethnic groups of northern Borneo shared a common ancestor with Taiwan natives and non-Austro-Melanesian Filipinos and then isolated themselves on the inland of Sabah. This isolation presumably led to no admixture with other populations, and these individuals therefore underwent

  14. Mapping and expression studies of the mir17-92 cluster on pig chromosome 11

    DEFF Research Database (Denmark)

    Sawera, Milena; Gorodkin, Jan; Cirera, Susanna

    2005-01-01

    We have identified the first porcine microRNA (miRNA) cluster (the mir17-92 cluster) and localized it to the q-arm of pig Chromosome 11. The miRNA cluster was found by sequence similarity search with human miRNA sequences against the pig genomic data generated within the Sino-Danish pig genome...... from the human data. The expression profiles of seven studied miRNAs were analyzed by hybridization to Northern blots containing five porcine tissues: cerebellum, cortex, hippocampus, kidney, and liver. In order to determine the localization of the mir17-92 cluster in the pig genome, we mapped...... project. The resulting data contained three complete and two incomplete miRNA precursors of seven miRNAs from the human mir17-92 cluster. Because there is a 100% sequence identity between the four pig miRNAs and the corresponding human miRNAs, the sequences of three unavailable pig miRNAs were derived...

  15. Analysis of complete genome sequences of G9P[19] rotavirus strains from human and piglet with diarrhea provides evidence for whole-genome interspecies transmission of nonreassorted porcine rotavirus.

    Science.gov (United States)

    Yodmeeklin, Arpaporn; Khamrin, Pattara; Chuchaona, Watchaporn; Kumthip, Kattareeya; Kongkaew, Aphisek; Vachirachewin, Ratchaya; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2017-01-01

    Whole genomes of G9P[19] human (RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19]) and porcine (RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19]) rotaviruses concurrently detected in the same geographical area in northern Thailand were sequenced and analyzed for their genetic relationships using bioinformatic tools. The complete genome sequence of human rotavirus RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] was most closely related to those of porcine rotavirus RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19] and to those of porcine-like human and porcine rotaviruses reference strains than to those of human rotavirus reference strains. The genotype constellation of G9P[19] detected in human and piglet were identical and displayed as the G9-P[19]-I5-R1-C1-M1-A8-N1-T1-E1-H1 genotypes with the nucleotide sequence identities of VP7, VP4, VP6, VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4, and NSP5 at 99.0%, 99.5%, 93.2%, 97.7%, 97.7%, 85.6%, 89.5%, 93.2%, 92.9%, 94.0%, and 98.1%, respectively. The findings indicate that human rotavirus strain RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] containing the genome segments of porcine genetic backbone is most likely a human rotavirus of porcine origin. Our data provide an evidence of interspecies transmission and whole-genome transmission of nonreassorted G9P[19] porcine RVA to human occurring in nature in northern Thailand. Copyright © 2016. Published by Elsevier B.V.

  16. The first complete organellar genomes of an Antarctic red alga, Pyropia endiviifolia: insights into its genome architecture and phylogenetic position within genus Pyropia (Bangiales, Rhodophyta)

    Science.gov (United States)

    Xu, Kuipeng; Tang, Xianghai; Bi, Guiqi; Cao, Min; Wang, Lu; Mao, Yunxiang

    2017-08-01

    Pyropia species grow in the intertidal zone and are cold-water adapted. To date, most of the information about the whole plastid and mitochondrial genomes (ptDNA and mtDNA) of this genus is limited to Northern Hemisphere species. Here, we report the sequencing of the ptDNA and mtDNA of the Antarctic red alga Pyropia endiviifolia using the Illumina platform. The plastid genome (195 784 bp, 33.28% GC content) contains 210 protein-coding genes, 37 tRNA genes and 6 rRNA genes. The mitochondrial genome (34 603 bp, 30.5% GC content) contains 26 protein-coding genes, 25 tRNA genes and 2 rRNA genes. Our results suggest that the organellar genomes of Py. endiviifolia have a compact organization. Although the collinearity of these genomes is conserved compared with other Pyropia species, the genome sizes show significant differences, mainly because of the different copy numbers of rDNA operons in the ptDNA and group II introns in the mtDNA. The other Pyropia species have 2u20133 distinct intronic ORFs in their cox 1 genes, but Py. endiviifolia has no introns in its cox 1 gene. This has led to a smaller mtDNA than in other Pyropia species. The phylogenetic relationships within Pyropia were examined using concatenated gene sets from most of the available organellar genomes with both the maximum likelihood and Bayesian methods. The analysis revealed a sister taxa affiliation between the Antarctic species Py. endiviifolia and the North American species Py. kanakaensis.

  17. Antibody responses to Borrelia burgdorferi detected by western blot vary geographically in Canada

    OpenAIRE

    Ogden, Nicholas H.; Arsenault, Julie; Hatchette, Todd F.; Mechai, Samir; Lindsay, L. Robbin

    2017-01-01

    Lyme disease is emerging in eastern and central Canada, and most cases are diagnosed using the two-tier serological test (Enzyme Immuno Assay [EIA] followed by Western blot [WB]). Simplification of this algorithm would be advantageous unless it impacts test performance. In this study, accuracy of individual proteins of the IgG WB algorithm in predicting the overall test result in samples from Canadians was assessed. Because Borrelia burgdorferi strains vary geographically in Canada, geographi...

  18. Blotting Assisted by Heating and Solvent Extraction for DESI-MS Imaging

    Science.gov (United States)

    Cabral, Elaine C.; Mirabelli, Mario F.; Perez, Consuelo J.; Ifa, Demian R.

    2013-06-01

    Imprints of potato sprout ( Solanum tuberosum L.), gingko leaves (Gingko biloba L. ) and strawberries (Fragaria x ananassa Duch. ) were successfully imaged by desorption electrospray ionization mass spectrometry (DESI-MS) on TLC plates through blotting assisted by heating and/or solvent extraction. Ion images showing the distribution of significant compounds such as glycoalkaloid toxins in potato sprout, ginkgolic acids and flavonoids in ginkgo leaves, and sugars and anthocyanidin in strawberry were obtained. Practical implications of this work include analysis of a wide range of irregular or soft materials by different imprinting conditions without requiring the addition of matrices or use of specific kinds of surfaces.

  19. Sequencing of Australian wild rice genomes reveals ancestral relationships with domesticated rice.

    Science.gov (United States)

    Brozynska, Marta; Copetti, Dario; Furtado, Agnelo; Wing, Rod A; Crayn, Darren; Fox, Glen; Ishikawa, Ryuji; Henry, Robert J

    2017-06-01

    The related A genome species of the Oryza genus are the effective gene pool for rice. Here, we report draft genomes for two Australian wild A genome taxa: O. rufipogon-like population, referred to as Taxon A, and O. meridionalis-like population, referred to as Taxon B. These two taxa were sequenced and assembled by integration of short- and long-read next-generation sequencing (NGS) data to create a genomic platform for a wider rice gene pool. Here, we report that, despite the distinct chloroplast genome, the nuclear genome of the Australian Taxon A has a sequence that is much closer to that of domesticated rice (O. sativa) than to the other Australian wild populations. Analysis of 4643 genes in the A genome clade showed that the Australian annual, O. meridionalis, and related perennial taxa have the most divergent (around 3 million years) genome sequences relative to domesticated rice. A test for admixture showed possible introgression into the Australian Taxon A (diverged around 1.6 million years ago) especially from the wild indica/O. nivara clade in Asia. These results demonstrate that northern Australia may be the centre of diversity of the A genome Oryza and suggest the possibility that this might also be the centre of origin of this group and represent an important resource for rice improvement. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Detection of mutations related to drug resistance in M. tuberculosis by dot blot hybridization and spoligotyping using specific radiolabelled probes

    International Nuclear Information System (INIS)

    El-Maghraby, T.K.; Abdelazeim, O.

    2002-01-01

    The present work has been conducted to determine the mutations related to drug resistance in M. tuberculosis in 63 Egyptian isolates using dot blot hybridization and spoligotyping. The PCR was done for amplification rpoB and katG genes in isolates. Dot blot hybridization were done to PCR products by using specific radiolabelled probes. Moreover, spoligotyping was done to know about the different strains found in Egypt. The results revealed that 58% from isolates had drug resistance to one or more of antituberculosis drugs. The results of spoligotyping have revealed that some Egyptian isolates are identical with the international code while the rest has not been identified yet. DNA sequencing was done to identify the mutation that not clear in dot blot hybridization. Early diagnosis of geno typing resistance to antituberculosis drugs is important as well as allow appropriate early patients management with few days of TB diagnosis. Using such strategy for early diagnosis of TB drug resistance allow and fast and potent patient's management

  1. Genome-wide study of the defective sucrose fermenter strain of Vibrio cholerae from the Latin American cholera epidemic.

    NARCIS (Netherlands)

    Garza, D.R.; Thompson, C.C.; Loureiro, E.C.; Dutilh, B.E.; Inada, D.T.; Junior, E.C.; Cardoso, J.F.; Nunes, M.R.; Lima, C.P. de; Silvestre, R.V.; Nunes, K.N.; Santos, E.C.; Edwards, R.A.; Vicente, A.C.; Sa Morais, L.L. de

    2012-01-01

    The 7th cholera pandemic reached Latin America in 1991, spreading from Peru to virtually all Latin American countries. During the late epidemic period, a strain that failed to ferment sucrose dominated cholera outbreaks in the Northern Brazilian Amazon region. In order to understand the genomic

  2. Analysis of sperm antigens by sodium dodecyl sulfate gel/protein blot radioimmunobinding method

    International Nuclear Information System (INIS)

    Lee, C.Y.G.; Huang, Y.S.; Hu, P.C.; Gomel, V.; Menge, A.C.

    1982-01-01

    A radioimmunobinding method based on the blotting of renatured proteins from sodium dodecyl sulfate gels on to nitrocellulose filter papers was developed to analyze the sperm antigens that elicit serum anti-sperm antibodies. In rabbits, serum anti-sperm antibodies were raised by immunization with homologous epididymal spermatozoa mixed with complete Freund's adjuvant. The raised antisera from either male or female rabbits were shown to react with three major sperm protein bands on sodium dodecyl sulfate gels with the corresponding molecular weights of about 70,000 +/- 5000, 14,000, and 13,000, respectively. In humans, the monoclonal antibodies against human sperm were raised by a hybridoma technique. Out of six independent hybrid cell lines that were generated, three of them were shown to secrete immunoglobulins that react with the same two protein bands on sodium dodecyl sulfate gels, which have the approximate molecular weight of 10,000. The same procedure was also used to analyze human serum samples that were shown to contain anti-sperm antibodies by the known techniques. Unique sperm antigens that elicit anti-sperm antibodies in humans were identified and correlated. The results of this study suggest that sodium dodecyl sulfate gel/protein blot radioimmunobinding method may be a sensitive and useful tool for the study of sperm antigens that elicit autoimmune responses and their association with human infertility

  3. Northern employment

    International Nuclear Information System (INIS)

    Zavitz, J.

    1997-01-01

    Hiring practices and policies and employment opportunities that were available in the Beaufort Sea and MacKenzie Delta project for local residents and for people from southern Canada were dealt with in this chapter. Depending on the source, Northern hiring was a mere token, or a genuine and successful effort on the part of the companies to involve the native population and to share with them the benefits of the project. The fact remains that opening up job opportunities for Northerners was not easily attained, and would never have been realized without the involvement of government and community organizations. Government also played a major role in developing policies and training regimes. By the end of exploration operations, the hiring of Northern residents in the oil and gas industry had become a requirement of drilling applications. Training programs were also created to ensure that Northern residents received the means necessary to take advantage of Northern employment opportunities

  4. La técnica de Western Blot como criterio de identidad para la vacuna antimeningocócica Men B Western Blot technique as an identity criterion for Men B antimeningococcal vaccine

    Directory of Open Access Journals (Sweden)

    R. Rosario Diéguez Castro

    2009-12-01

    Full Text Available Se desarrolló y validó la técnica de Western Blot aplicada a la vacuna antimeningocócica Men B producida en el Instituto Finlay con el objetivo de demostrar un criterio de identidad. En el estudio de las proteínas antigénicas de la vacuna, P1.15 y P1.4 en vesícula de membrana externa,monograneles y producto final se emplearon en la identificación anticuerpos monoclonales específicos para estas proteínas. Los parámetros desarrollados en la validación de la técnica fueron: especificidad, límite de detección, repetibilidad, precisión intermedia, reproducibilidad y robustez. El método cumplió con los parámetros señalados, por lo que se consideró validado.Western Blot technique was developed and validated, applied to Men B meningococcal vaccine produced in "Carlos J, Finlay" Institute to demonstrate an identity criterion. In study of antigenic proteins of the vaccine, we used P1.15 y P1.4 in vesicle of external membrane, monogranels, and end product to identify the monoclonal antibodies specific of these proteins. Parameters developed in technique validation included: specificity, detection limit, repetition, average accuracy, reproduction, and strength. Method fulfilled with specified parameters, thus considering its validation.

  5. Genome-wide discovery of novel and conserved microRNAs in white shrimp (Litopenaeus vannamei).

    Science.gov (United States)

    Xi, Qian-Yun; Xiong, Yuan-Yan; Wang, Yuan-Mei; Cheng, Xiao; Qi, Qi-En; Shu, Gang; Wang, Song-Bo; Wang, Li-Na; Gao, Ping; Zhu, Xiao-Tong; Jiang, Qing-Yan; Zhang, Yong-Liang; Liu, Li

    2015-01-01

    Of late years, a large amount of conserved and species-specific microRNAs (miRNAs) have been performed on identification from species which are economically important but lack a full genome sequence. In this study, Solexa deep sequencing and cross-species miRNA microarray were used to detect miRNAs in white shrimp. We identified 239 conserved miRNAs, 14 miRNA* sequences and 20 novel miRNAs by bioinformatics analysis from 7,561,406 high-quality reads representing 325,370 distinct sequences. The all 20 novel miRNAs were species-specific in white shrimp and not homologous in other species. Using the conserved miRNAs from the miRBase database as a query set to search for homologs from shrimp expressed sequence tags (ESTs), 32 conserved computationally predicted miRNAs were discovered in shrimp. In addition, using microarray analysis in the shrimp fed with Panax ginseng polysaccharide complex, 151 conserved miRNAs were identified, 18 of which were significant up-expression, while 49 miRNAs were significant down-expression. In particular, qRT-PCR analysis was also performed for nine miRNAs in three shrimp tissues such as muscle, gill and hepatopancreas. Results showed that these miRNAs expression are tissue specific. Combining results of the three methods, we detected 20 novel and 394 conserved miRNAs. Verification with quantitative reverse transcription (qRT-PCR) and Northern blot showed a high confidentiality of data. The study provides the first comprehensive specific miRNA profile of white shrimp, which includes useful information for future investigations into the function of miRNAs in regulation of shrimp development and immunology.

  6. Evaluation of the radioimmunoassay, indirect enzyme linked immunosorbent assay, and dot blot assay for the identification of Xanthomonas campestris pv. phaseoli

    Energy Technology Data Exchange (ETDEWEB)

    Malin, E; Belden, E L; Roth, D

    1985-09-01

    A radioimmunoassay (RIA), an indirect competitive enzyme-linked immunosorbent assay (ELISA), and a dot-blot modification of the ELISA were evaluated for detection and identification of Xanthomonas campestris pv. phaseoli (X. c. pv. phaseoli). RIA and the dot blot tests were specific for X. c. pv. phaseoli; however, significant cross reactions occurred in the indirect competitive ELISA when using anti-X. c. pv. phaseoli antiserum against other closely related bacteria. The sensitivity level of all procedures for X. c. pv. phaseoli was approximately l0/sup 5/ colony forming unitsmL. All procedures were unsatisfactory in reliably detecting low levels of X. c. pv. phaseoli directly from extracts of bean seed. However when used in conjunction with ilution plating the dot blot assay and the RIA would be useful in specifically identifying X. c. pv. phaseoli. The relative merits of these tests for identification of X. c. pv. phaseoli are discussed.

  7. Whole-genome analysis of herbicide-tolerant mutant rice generated by Agrobacterium-mediated gene targeting.

    Science.gov (United States)

    Endo, Masaki; Kumagai, Masahiko; Motoyama, Ritsuko; Sasaki-Yamagata, Harumi; Mori-Hosokawa, Satomi; Hamada, Masao; Kanamori, Hiroyuki; Nagamura, Yoshiaki; Katayose, Yuichi; Itoh, Takeshi; Toki, Seiichi

    2015-01-01

    Gene targeting (GT) is a technique used to modify endogenous genes in target genomes precisely via homologous recombination (HR). Although GT plants are produced using genetic transformation techniques, if the difference between the endogenous and the modified gene is limited to point mutations, GT crops can be considered equivalent to non-genetically modified mutant crops generated by conventional mutagenesis techniques. However, it is difficult to guarantee the non-incorporation of DNA fragments from Agrobacterium in GT plants created by Agrobacterium-mediated GT despite screening with conventional Southern blot and/or PCR techniques. Here, we report a comprehensive analysis of herbicide-tolerant rice plants generated by inducing point mutations in the rice ALS gene via Agrobacterium-mediated GT. We performed genome comparative genomic hybridization (CGH) array analysis and whole-genome sequencing to evaluate the molecular composition of GT rice plants. Thus far, no integration of Agrobacterium-derived DNA fragments has been detected in GT rice plants. However, >1,000 single nucleotide polymorphisms (SNPs) and insertion/deletion (InDels) were found in GT plants. Among these mutations, 20-100 variants might have some effect on expression levels and/or protein function. Information about additive mutations should be useful in clearing out unwanted mutations by backcrossing. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  8. Genome sequence and genetic diversity of European ash trees.

    Science.gov (United States)

    Sollars, Elizabeth S A; Harper, Andrea L; Kelly, Laura J; Sambles, Christine M; Ramirez-Gonzalez, Ricardo H; Swarbreck, David; Kaithakottil, Gemy; Cooper, Endymion D; Uauy, Cristobal; Havlickova, Lenka; Worswick, Gemma; Studholme, David J; Zohren, Jasmin; Salmon, Deborah L; Clavijo, Bernardo J; Li, Yi; He, Zhesi; Fellgett, Alison; McKinney, Lea Vig; Nielsen, Lene Rostgaard; Douglas, Gerry C; Kjær, Erik Dahl; Downie, J Allan; Boshier, David; Lee, Steve; Clark, Jo; Grant, Murray; Bancroft, Ian; Caccamo, Mario; Buggs, Richard J A

    2017-01-12

    Ash trees (genus Fraxinus, family Oleaceae) are widespread throughout the Northern Hemisphere, but are being devastated in Europe by the fungus Hymenoscyphus fraxineus, causing ash dieback, and in North America by the herbivorous beetle Agrilus planipennis. Here we sequence the genome of a low-heterozygosity Fraxinus excelsior tree from Gloucestershire, UK, annotating 38,852 protein-coding genes of which 25% appear ash specific when compared with the genomes of ten other plant species. Analyses of paralogous genes suggest a whole-genome duplication shared with olive (Olea europaea, Oleaceae). We also re-sequence 37 F. excelsior trees from Europe, finding evidence for apparent long-term decline in effective population size. Using our reference sequence, we re-analyse association transcriptomic data, yielding improved markers for reduced susceptibility to ash dieback. Surveys of these markers in British populations suggest that reduced susceptibility to ash dieback may be more widespread in Great Britain than in Denmark. We also present evidence that susceptibility of trees to H. fraxineus is associated with their iridoid glycoside levels. This rapid, integrated, multidisciplinary research response to an emerging health threat in a non-model organism opens the way for mitigation of the epidemic.

  9. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  10. Quantum dot bio-conjugate: as a western blot probe for highly sensitive detection of cellular proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kale, Sonia [Agharkar Research Institute (India); Kale, Anup [University of Alabama, Center for Materials for Information Technology (United States); Gholap, Haribhau; Rana, Abhimanyu [National Chemical Laboratory, Physical and Materials Chemistry Division (India); Desai, Rama [National Centre for Cell Science (India); Banpurkar, Arun [University of Pune, Department of Physics (India); Ogale, Satishchandra, E-mail: sb.ogale@ncl.res.in [National Chemical Laboratory, Physical and Materials Chemistry Division (India); Shastry, Padma, E-mail: padma@nccs.res.in [National Centre for Cell Science (India)

    2012-03-15

    In the present study, we report a quantum dot (QD)-tailored western blot analysis for a sensitive, rapid and flexible detection of the nuclear and cytoplasmic proteins. Highly luminescent CdTe and (CdTe)ZnS QDs are synthesized by aqueous method. High resolution transmission electron microscopy, Raman spectroscopy, fourier transform infrared spectroscopy, fluorescence spectroscopy and X-ray diffraction are used to characterize the properties of the quantum dots. The QDs are functionalized with antibodies of prostate apoptosis response-4 (Par-4), poly(ADP-ribose) polymerases and {beta} actin to specifically bind with the proteins localized in the nucleus and cytoplasm of the cells, respectively. The QD-conjugated antibodies are used to overcome the limitations of conventional western blot technique. The sensitivity and rapidity of protein detection in QD-based approach is very high, with detection limits up to 10 pg of protein. In addition, these labels provide the capability of enhanced identification and localization of marker proteins in intact cells by confocal laser scanning microscopy.

  11. Avian metapneumovirus SH gene end and G protein mutations influence the level of protection of live-vaccine candidates.

    Science.gov (United States)

    Naylor, Clive J; Ling, Roger; Edworthy, Nicole; Savage, Carol E; Easton, Andrew J

    2007-06-01

    A prototype avian metapneumovirus (AMPV) vaccine (P20) was previously shown to give variable outcomes in experimental trials. Following plaque purification, three of 12 viruses obtained from P20 failed to induce protection against virulent challenge, whilst the remainder retained their protective capacity. The genome sequences of two protective viruses were identical to the P20 consensus, whereas two non-protective viruses differed only in the SH gene transcription termination signal. Northern blotting showed that the alterations in the SH gene-end region of the non-protective viruses led to enhanced levels of dicistronic mRNA produced by transcriptional readthrough. A synthetic minigenome was used to demonstrate that the altered SH gene-end region reduced the level of protein expression from a downstream gene. The genomes of the remaining eight plaque-purified viruses were sequenced in the region where the P20 consensus sequence differed from the virulent progenitor. The seven protective clones were identical, whereas the non-protective virus retained the virulent progenitor sequence at two positions and contained extensive alterations in its attachment (G) protein sequence associated with a reduced or altered expression pattern of G protein on Western blots. The data indicate that the efficacy of a putative protective vaccine strain is affected by mutations altering the balance of G protein expression.

  12. A simple and inexpensive method for genomic restriction mapping analysis

    International Nuclear Information System (INIS)

    Huang, C.H.; Lam, V.M.S.; Tam, J.W.O.

    1988-01-01

    The Southern blotting procedure for the transfer of DNA fragments from agarose gels to nitrocellulose membranes has revolutionized nucleic acid detection methods, and it forms the cornerstone of research in molecular biology. Basically, the method involves the denaturation of DNA fragments that have been separated on an agarose gel, the immobilization of the fragments by transfer to a nitrocellulose membrane, and the identification of the fragments of interest through hybridization to /sup 32/P-labeled probes and autoradiography. While the method is sensitive and applicable to both genomic and cloned DNA, it suffers from the disadvantages of being time consuming and expensive, and fragments of greater than 15 kb are difficult to transfer. Moreover, although theoretically the nitrocellulose membrane can be washed and hybridized repeatedly using different probes, in practice, the membrane becomes brittle and difficult to handle after a few cycles. A direct hybridization method for pure DNA clones was developed in 1975 but has not been widely exploited. The authors report here a modification of their procedure as applied to genomic DNA. The method is simple, rapid, and inexpensive, and it does not involve transfer to nitrocellulose membranes

  13. Transformation of triploid bermudagrass (Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic bombardment.

    Science.gov (United States)

    Zhang, G; Lu, S; Chen, T A; Funk, C R; Meyer, W A

    2003-06-01

    A transformation system for triploid bermudagrass ( Cynodon dactylon x C. transvaalensis cv. TifEagle) was established with a biolistic bombardment delivery system. Embryogenic callus was induced from stolons and maintained on Murashige and Skoog's medium supplemented with 30 microM dicamba, 20 microM benzylaminopurine, and 100 mg/l myo-inositol. Using the hygromycin phosphotransferase ( hpt) gene as the selectable marker gene, we obtained 75 transgenic lines from 18 petri dishes bombarded. Integration of the hpt gene into genomic DNA and transcription of hpt was confirmed by Southern and Northern blot analyses, respectively. Through suspension culture screening, we obtained homogeneously transformed plants showing stable transcription of the hpt gene.

  14. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  15. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  16. Whole-genome resequencing of honeybee drones to detect genomic selection in a population managed for royal jelly.

    Science.gov (United States)

    Wragg, David; Marti-Marimon, Maria; Basso, Benjamin; Bidanel, Jean-Pierre; Labarthe, Emmanuelle; Bouchez, Olivier; Le Conte, Yves; Vignal, Alain

    2016-06-03

    Four main evolutionary lineages of A. mellifera have been described including eastern Europe (C) and western and northern Europe (M). Many apiculturists prefer bees from the C lineage due to their docility and high productivity. In France, the routine importation of bees from the C lineage has resulted in the widespread admixture of bees from the M lineage. The haplodiploid nature of the honeybee Apis mellifera, and its small genome size, permits affordable and extensive genomics studies. As a pilot study of a larger project to characterise French honeybee populations, we sequenced 60 drones sampled from two commercial populations managed for the production of honey and royal jelly. Results indicate a C lineage origin, whilst mitochondrial analysis suggests two drones originated from the O lineage. Analysis of heterozygous SNPs identified potential copy number variants near to genes encoding odorant binding proteins and several cytochrome P450 genes. Signatures of selection were detected using the hapFLK haplotype-based method, revealing several regions under putative selection for royal jelly production. The framework developed during this study will be applied to a broader sampling regime, allowing the genetic diversity of French honeybees to be characterised in detail.

  17. Establishment and application of a modified membrane-blot assay for Rhizomucor miehei lipases aimed at improving their methanol tolerance and thermostability.

    Science.gov (United States)

    He, Dong; Luo, Wen; Wang, Zhiyuan; Lv, Pengmei; Yuan, Zhenhong; Huang, Shaowei; Xv, Jingliang

    2017-07-01

    Directed evolution has been proved an effective way to improve the stability of proteins, but high throughput screening assays for directed evolution with simultaneous improvement of two or more properties are still rare. In this study, we aimed to establish a membrane-blot assay for use in the high-throughput screening of Rhizomucor miehei lipases (RMLs). With the assistance of the membrane-blot screening assay, a mutant E47K named G10 that showed improved thermal stability was detected in the first round of error-prone PCR. Using G10 as the parent, two variants G10-11 and G10-20 that showed improved thermal stability and methanol tolerance without loss of activity compared to the wild type RML were obtained. The T 50 60 -value of G10-11 and G10-20 increased by 12°C and 6.5°C, respectively. After incubation for 1h, the remaining residual activity of G10-11 and G10-20 was 63.45% and 74.33%, respectively, in 50% methanol, and 15.98% and 30.22%, respectively, in 80% methanol. Thus, we successfully developed a membrane-blot assay that could be used for the high-throughput screening of RMLs with improved thermostability and methanol tolerance. Based on our findings, we believe that our newly developed membrane-blot assay will have potential applications in directed evolution in the future. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Patterns and risks of trichinella infection in humans and pigs in northern Laos.

    Directory of Open Access Journals (Sweden)

    James V Conlan

    Full Text Available Several outbreaks of trichinellosis associated with the consumption of raw pork have occurred in Laos since 2004. This cross-sectional study was conducted in four provinces of northern Laos to investigate the seroepidemiology of trichinellosis in the human population and determine the prevalence and species of Trichinella infection in the domestic pig population. Serum samples and questionnaire data were obtained from 1419 individuals. Serum samples were tested for Trichinella antibodies by ELISA using larval excretory-secretory (ES antigens and a subset of 68 positive samples were tested by western blot. The seroprevalence of Trichinella antibodies was 19.1% (95% confidence interval (CI = 17.1-21.1%. The risk of having antibodies detected by ELISA using ES antigens increased with age, being of Lao-Tai ethnicity, living in Oudomxay province and being male. Tongue and diaphragm muscle samples were collected from 728 pigs and tested for Trichinella larvae by the artificial digestion method. Trichinella larvae were isolated from 15 pigs (2.1% of which 13 were identified as T. spiralis by molecular typing; the species of the two remaining isolates could not be determined due to DNA degradation. Trichinella spp. are endemic in the domestic environment of northern Laos and targeted preventative health measures should be initiated to reduce the risk of further outbreaks occurring.

  19. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells

    International Nuclear Information System (INIS)

    Liu, H.S.; Lin, Y.L.; Chen, C.C.

    1997-01-01

    In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)

  20. Genetics of Obesity Traits: A Bivariate Genome-Wide Association Analysis

    DEFF Research Database (Denmark)

    Wu, Yili; Duan, Haiping; Tian, Xiaocao

    2018-01-01

    Previous genome-wide association studies on anthropometric measurements have identified more than 100 related loci, but only a small portion of heritability in obesity was explained. Here we present a bivariate twin study to look for the genetic variants associated with body mass index and waist......-hip ratio, and to explore the obesity-related pathways in Northern Han Chinese. Cholesky decompositionmodel for 242monozygotic and 140 dizygotic twin pairs indicated a moderate genetic correlation (r = 0.53, 95%CI: 0.42–0.64) between body mass index and waist-hip ratio. Bivariate genome-wide association.......05. Expression quantitative trait loci analysis identified rs2242044 as a significant cis-eQTL in both the normal adipose-subcutaneous (P = 1.7 × 10−9) and adipose-visceral (P = 4.4 × 10−15) tissue. These findings may provide an important entry point to unravel genetic pleiotropy in obesity traits....

  1. The genome-wide expression profile of Curcuma longa-treated cisplatin-stimulated HEK293 cells

    Science.gov (United States)

    Sohn, Sung-Hwa; Ko, Eunjung; Chung, Hwan-Suck; Lee, Eun-Young; Kim, Sung-Hoon; Shin, Minkyu; Hong, Moochang; Bae, Hyunsu

    2010-01-01

    AIM The rhizome of turmeric, Curcuma longa (CL), is a herbal medicine used in many traditional prescriptions. It has previously been shown that CL treatment showed greater than 47% recovery from cisplatin-induced cell damage in human kidney HEK 293 cells. This study was conducted to evaluate the recovery mechanisms of CL that occur during cisplatin induced nephrotoxicity by examining the genome wide mRNA expression profiles of HEK 293 -cells. METHOD Recovery mechanisms of CL that occur during cisplatin-induced nephrotoxicity were determined by microarray, real-time PCR, immunofluorescent confocal microscopy and Western blot analysis. RESULTS The results of microarray analysis and real-time PCR revealed that NFκB pathway-related genes and apoptosis-related genes were down-regulated in CL-treated HEK 293 cells. In addition, immunofluorescent confocal microscopy and Western blot analysis revealed that NFκB p65 nuclear translocation was inhibited in CL-treated HEK 293 cells. Therefore, the mechanism responsible for the effects of CL on HEK 293 cells is closely associated with regulation of the NFκB pathway. CONCLUSION CL possesses novel therapeutic agents that can be used for the prevention or treatment of cisplatin-induced renal disorders. PMID:20840446

  2. Genital Sensory Stimulation Shifts Estradiol Intraoviductal Signaling from Nongenomic to Genomic Pathways, Independently from Prolactin Surges

    Directory of Open Access Journals (Sweden)

    C PEÑARROJA-MATUTAN0

    2007-01-01

    Full Text Available Estradiol (E2 accelerates oviductal egg transport through nongenomic pathways involving oviductal protein phosphorylation in non-mated rats, and through genomic pathways in mated rats. Here we investigated the ability of cervico-vaginal stimulation (CVS to switch the mode of action of E2 in the absence of other male-associated components. Pro-estrous rats were subjected to CVS with a glass rod and 12 hours later were injected subcutaneously with E2 and intrabursally with the RNA synthesis inhibitor Actinomycin D or the protein phosphorylation inhibitor H-89. The number of eggs in the oviduct, assessed 24 h later, showed that Actinomycin D, but not H-89 blocked the E2-induced egg transport acceleration. This clearly indicates that CVS alone, without other mating-associated signals, is able to shift E2 signaling from nongenomic to genomic pathways. Since mating and CVS activate a neuroendocrine reflex that causes iterative prolactin (PRL surges, the involvement of PRL pathway in this phenomenon was evaluated. Prolactin receptor mRNA and protein expression in the rat oviduct was demonstrated by RT-PCR and Western blot, but their levels were not different on day 2 of the cycle (C2 or pregnancy (P2. Activated ST AT 5a/b (phosphorylated was detected by Western blot on P2 in the ovary, but not in the oviduct, showing that mating does not stimulate this PRL signalling pathway in the oviduct. Other rats subjected to CVS in the evening of pro-estrus were treated with bromoergocriptine to suppress PRL surges. In these rats, H-89 did not block the E2-induced acceleration of egg transport suggesting that PRL surges are not essential to shift E2 signaling pathways in the oviduct. We conclude that CVS is one of the components of mating that shifts E2 signaling in the oviduct from nongenomic to genomic pathways, and this effect is independent of PRL surges elicited by mating

  3. Western blot banding pattern in early Lyme borreliosis among patients from an endemic region of north-eastern Poland.

    Science.gov (United States)

    Flisiak, R; Wierzbicka, I; Prokopowicz, D

    1998-01-01

    Aim of this study was evaluation of Western blot banding patterns in different clinical forms of early Lyme borreliosis diagnosed in patients from north-eastern Poland, recognized as endemic for tick-borne diseases. Study was performed on serum samples of 48 patients with Lyme borreliosis and 26 healthy volunteers, as controls. Samples tested routinely for total antibody with enzyme immunoassay were subsequently analysed for specific antibodies with Western blot based on antigen extract of European strain of Borrelia burgdorferi. In patients, IgM antibodies were the most frequently directed against 41 kDa and 58 kDa antigens, whereas in control group only antibodies against 45 kDa and 58 kDa were present. Similar response was observed in respect to IgG antibodies. Evaluation of banding pattern in respect to clinical form of the disease revealed the highest prevalence of IgM and IgG anti-41 kDa antibodies in patients with erythema migrans and Lyme arthritis, and anti-58 kDa in neuroborreliosis patients, who had no anti-21 kDa antibodies. Relatively high frequency of IgG antibodies against 21, 30 and 93 kDa antigens was typical for neuroborreliosis. Bands count was significantly higher in different clinical forms of the disease than in controls, and it was the highest in neuroborreliosis. Combined analysis of Western blot results (IgM/IgG) enabled to achieve higher sensitivity (84%) and specificity (100%) than available with the most recommended EIA kits.

  4. Genome Size Diversity in Lilium (Liliaceae Is Correlated with Karyotype and Environmental Traits

    Directory of Open Access Journals (Sweden)

    Yun-peng Du

    2017-07-01

    Full Text Available Genome size (GS diversity is of fundamental biological importance. The occurrence of giant genomes in angiosperms is restricted to just a few lineages in the analyzed genome size of plant species so far. It is still an open question whether GS diversity is shaped by neutral or natural selection. The genus Lilium, with giant genomes, is phylogenetically and horticulturally important and is distributed throughout the northern hemisphere. GS diversity in Lilium and the underlying evolutionary mechanisms are poorly understood. We performed a comprehensive study involving phylogenetically independent analysis on 71 species to explore the diversity and evolution of GS and its correlation with karyological and environmental traits within Lilium (including Nomocharis. The strong phylogenetic signal detected for GS in the genus provides evidence consistent with that the repetitive DNA may be the primary contributors to the GS diversity, while the significant positive relationships detected between GS and the haploid chromosome length (HCL provide insights into patterns of genome evolution. The relationships between GS and karyotypes indicate that ancestral karyotypes of Lilium are likely to have exhibited small genomes, low diversity in centromeric index (CVCI values and relatively high relative variation in chromosome length (CVCL values. Significant relationships identified between GS and annual temperature and between GS and annual precipitation suggest that adaptation to habitat strongly influences GS diversity. We conclude that GS in Lilium is shaped by both neutral (genetic drift and adaptive evolution. These findings will have important consequences for understanding the evolution of giant plant genomes, and exploring the role of repetitive DNA fraction and chromosome changes in a plant group with large genomes and conservation of chromosome number.

  5. Immunodiagnosis of Echinococcus Infections: Confirmatory Testing and Species Differentiation by a New Commercial Western Blot

    Science.gov (United States)

    Liance, Martine; Janin, Veronique; Bresson-Hadni, Solange; Vuitton, Dominique-Angele; Houin, Rene; Piarroux, Renaud

    2000-01-01

    The Echinococcus Western Blot IgG (LDBIO Diagnostics, Lyon, France), using a whole larval antigen from Echinococcus multilocularis, was evaluated for serodiagnosis and differentiation between two human parasitic infections of worldwide importance: cystic echinococcosis, due to Echinococcus granulosus, and alveolar echinococcosis, due to E. multilocularis. Fifty and 61 serum samples from patients with cystic and alveolar echinococcosis, respectively, were used for assessing diagnostic sensitivity. The sensitivity of the assay was compared with those of screening tests used for these applications. Sera used for assessing cross-reactivities were from 154 patients with other diseases, either parasitic or not. The assay allowed the detection of serum immunoglobulin G antibodies in 97% of Echinococcus-infected patients. It had a higher sensitivity than screening assays for the detection for each echinococcosis. The assay allowed us to correctly distinguish between E. granulosus- and E. multilocularis-infected patients in 76% of cases. It did not allow us to distinguish active from inactive forms of both echinococcoses. The occurrence of cross-reactivities with neurocysticercosis indicates the necessity for retesting sera with species-specific antigens, for rare patients with neurologic disorders. This study shows the usefulness of the commercially available Echinococcus Western Blot IgG for the serological confirmation of human echinococcosis. PMID:11015390

  6. Should we ignore western blots when selecting antibodies for other applications?

    DEFF Research Database (Denmark)

    Uhlén, Mathias

    2017-01-01

    .In the Human Protein Atlas (HPA) program, we have validated more than 24,000 in-house-generated antibodies directed to 17,000 human target proteins2. Although there is often a correlation between performance in different applications, we have observed many examples of antibodies that show strong support...... applications and that this influences the epitopes exposed on the target protein, which might have profound consequences for the ability of a given antibody to bind specifically to its target. As an example, proteins that are analyzed by immunohistochemistry (IHC) are normally first cross-linked with formalin.......In conclusion, western blot and protein array analyses can indeed be useful tools when selecting specific antibodies for other applications. The use of these methods is encouraged both for antibody providers and users, and antibodies with signs of cross-reactivity in these applications should be treated...

  7. Analysis of transposons and repeat composition of the sunflower (Helianthus annuus L.) genome.

    Science.gov (United States)

    Cavallini, Andrea; Natali, Lucia; Zuccolo, Andrea; Giordani, Tommaso; Jurman, Irena; Ferrillo, Veronica; Vitacolonna, Nicola; Sarri, Vania; Cattonaro, Federica; Ceccarelli, Marilena; Cionini, Pier Giorgio; Morgante, Michele

    2010-02-01

    A sample-sequencing strategy combined with slot-blot hybridization and FISH was used to study the composition of the repetitive component of the sunflower genome. One thousand six hundred thirty-eight sequences for a total of 954,517 bp were analyzed. The fraction of sequences that can be classified as repetitive using computational and hybridization approaches amounts to 62% in total. Almost two thirds remain as yet uncharacterized in nature. Of those characterized, most belong to the gypsy superfamily of LTR-retrotransposons. Unlike in other species, where single families can account for large fractions of the genome, it appears that no transposon family has been amplified to very high levels in sunflower. All other known classes of transposable elements were also found. One family of unknown nature (contig 61) was the most repeated in the sunflower genome. The evolution of the repetitive component in the Helianthus genus and in other Asteraceae was studied by comparative analysis of the hybridization of total genomic DNAs from these species to the sunflower small-insert library and compared to gene-based phylogeny. Very little similarity is observed between Helianthus species and two related Asteraceae species outside of the genus. Most repetitive elements are similar in annual and perennial Helianthus species indicating that sequence amplification largely predates such divergence. Gypsy-like elements are more represented in the annuals than in the perennials, while copia-like elements are similarly represented, attesting a different amplification history of the two superfamilies of LTR-retrotransposons in the Helianthus genus.

  8. Mere end blot en bid af hverdagen- Måltidet i et leve- og bomiljø

    DEFF Research Database (Denmark)

    Bundgaard, Karen Marie

    2005-01-01

    . Datamaterialet bygger på deltagerobservationer og interviews. Undersøgelsen viste, at den måde måltiderne var organiseret på gav tid og rum til en hjemlig atmosfære, til et levende fællesskab, til det at være noget og at være sig selv og til at have værdifulde gøremål. Måltiderne var ikke blot en bid – men en...

  9. Demographic history and biologically relevant genetic variation of Native Mexicans inferred from whole-genome sequencing

    OpenAIRE

    Romero-Hidalgo, Sandra; Ochoa-Leyva, Adrián; Garcíarrubio, Alejandro; Acuña-Alonzo, Victor; Antúnez-Argüelles, Erika; Balcazar-Quintero, Martha; Barquera-Lozano, Rodrigo; Carnevale, Alessandra; Cornejo-Granados, Fernanda; Fernández-López, Juan Carlos; García-Herrera, Rodrigo; García-Ortíz, Humberto; Granados-Silvestre, Ángeles; Granados, Julio; Guerrero-Romero, Fernando

    2017-01-01

    Understanding the genetic structure of Native American populations is important to clarify their diversity, demographic history, and to identify genetic factors relevant for biomedical traits. Here, we show a demographic history reconstruction from 12 Native American whole genomes belonging to six distinct ethnic groups representing the three main described genetic clusters of Mexico (Northern, Southern, and Maya). Effective population size estimates of all Native American groups remained bel...

  10. Genomic characterisation of Wongabel virus reveals novel genes within the Rhabdoviridae.

    Science.gov (United States)

    Gubala, Aneta J; Proll, David F; Barnard, Ross T; Cowled, Chris J; Crameri, Sandra G; Hyatt, Alex D; Boyle, David B

    2008-06-20

    Viruses belonging to the family Rhabdoviridae infect a variety of different hosts, including insects, vertebrates and plants. Currently, there are approximately 200 ICTV-recognised rhabdoviruses isolated around the world. However, the majority remain poorly characterised and only a fraction have been definitively assigned to genera. The genomic and transcriptional complexity displayed by several of the characterised rhabdoviruses indicates large diversity and complexity within this family. To enable an improved taxonomic understanding of this family, it is necessary to gain further information about the poorly characterised members of this family. Here we present the complete genome sequence and predicted transcription strategy of Wongabel virus (WONV), a previously uncharacterised rhabdovirus isolated from biting midges (Culicoides austropalpalis) collected in northern Queensland, Australia. The 13,196 nucleotide genome of WONV encodes five typical rhabdovirus genes N, P, M, G and L. In addition, the WONV genome contains three genes located between the P and M genes (U1, U2, U3) and two open reading frames overlapping with the N and G genes (U4, U5). These five additional genes and their putative protein products appear to be novel, and their functions are unknown. Predictive analysis of the U5 gene product revealed characteristics typical of viroporins, and indicated structural similarities with the alpha-1 protein (putative viroporin) of viruses in the genus Ephemerovirus. Phylogenetic analyses of the N and G proteins of WONV indicated closest similarity with the avian-associated Flanders virus; however, the genomes of these two viruses are significantly diverged. WONV displays a novel and unique genome structure that has not previously been described for any animal rhabdovirus.

  11. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR.

    Science.gov (United States)

    Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M

    2014-04-01

    Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution

  12. A single-step simultaneous protein staining procedure for polyacrylamide gels and nitrocellulose membranes by Alta during western blot analysis.

    Science.gov (United States)

    Pal, Jayanta K; Berwal, Sunil K; Soni, Rupali N

    2012-01-01

    A simple method for staining of proteins simultaneously on sodium dodecyl sulfate (SDS) polyacrylamide gels and nitrocellulose membranes by Alta during western blot analysis is described. A 5% solution of Alta, a commercially available cosmetic preparation, is added in the upper tank buffer during electrophoresis. On completion of electrophoresis, the gel is washed in distilled water and viewed on a white light plate and a transilluminator to photograph the protein profiles. The gel is processed for western blot transfer of proteins onto a nitrocellulose membrane, and upon completion, the protein profiles on the membrane are viewed and photographed as stated above. The membrane can then be processed for immunostaining as per the standard procedure. Thus, the staining procedure using Alta is simple, rapid (without any need of destaining), and cost-effective.

  13. A mitochondrial genome sequence of a hominin from Sima de los Huesos.

    Science.gov (United States)

    Meyer, Matthias; Fu, Qiaomei; Aximu-Petri, Ayinuer; Glocke, Isabelle; Nickel, Birgit; Arsuaga, Juan-Luis; Martínez, Ignacio; Gracia, Ana; de Castro, José María Bermúdez; Carbonell, Eudald; Pääbo, Svante

    2014-01-16

    Excavations of a complex of caves in the Sierra de Atapuerca in northern Spain have unearthed hominin fossils that range in age from the early Pleistocene to the Holocene. One of these sites, the 'Sima de los Huesos' ('pit of bones'), has yielded the world's largest assemblage of Middle Pleistocene hominin fossils, consisting of at least 28 individuals dated to over 300,000 years ago. The skeletal remains share a number of morphological features with fossils classified as Homo heidelbergensis and also display distinct Neanderthal-derived traits. Here we determine an almost complete mitochondrial genome sequence of a hominin from Sima de los Huesos and show that it is closely related to the lineage leading to mitochondrial genomes of Denisovans, an eastern Eurasian sister group to Neanderthals. Our results pave the way for DNA research on hominins from the Middle Pleistocene.

  14. Occurrence of concurrent infections with multiple serotypes of dengue viruses during 2013–2015 in northern Kerala, India

    Directory of Open Access Journals (Sweden)

    Manchala Nageswar Reddy

    2017-03-01

    Full Text Available Background Dengue is a global human public health threat, causing severe morbidity and mortality. The occurrence of sequential infection by more than one serotype of dengue virus (DENV is a major contributing factor for the induction of Dengue Hemorrhagic Fever (DHF and Dengue Shock Syndrome (DSS, two major medical conditions caused by DENV infection. However, there is no specific drug or vaccine available against dengue infection. There are reports indicating the increased incidence of concurrent infection of dengue in several tropical and subtropical regions. Recently, increasing number of DHF and DSS cases were reported in India indicating potential enhancement of concurrent DENV infections. Therefore, accurate determination of the occurrence of DENV serotype co-infections needs to be conducted in various DENV prone parts of India. In this context, the present study was conducted to analyse the magnitude of concurrent infection in northern Kerala, a southwest state of India, during three consecutive years from 2013 to 2015. Methods A total of 120 serum samples were collected from the suspected dengue patients. The serum samples were diagnosed for the presence of dengue NS1 antigen followed by the isolation of dengue genome from NS1 positive samples. The isolated dengue genome was further subjected to RTPCR based molecular serotyping. The phylogenetic tree was constructed based on the sequence of PCR amplified products. Results Out of the total number of samples collected, 100 samples were positive for dengue specific antigen (NS1 and 26 of them contained the dengue genome. The RTPCR based molecular serotyping of the dengue genome revealed the presence of all four serotypes with different combinations. However, serotypes 1 and 3 were predominant combinations of concurrent infection. Interestingly, there were two samples with all four serotypes concurrently infected in 2013. Discussion All samples containing dengue genome showed the presence of

  15. Ensembl Genomes 2016: more genomes, more complexity.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Armean, Irina; Boddu, Sanjay; Bolt, Bruce J; Carvalho-Silva, Denise; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Aranganathan, Naveen K; Langridge, Nicholas; Lowy, Ernesto; McDowall, Mark D; Maheswari, Uma; Nuhn, Michael; Ong, Chuang Kee; Overduin, Bert; Paulini, Michael; Pedro, Helder; Perry, Emily; Spudich, Giulietta; Tapanari, Electra; Walts, Brandon; Williams, Gareth; Tello-Ruiz, Marcela; Stein, Joshua; Wei, Sharon; Ware, Doreen; Bolser, Daniel M; Howe, Kevin L; Kulesha, Eugene; Lawson, Daniel; Maslen, Gareth; Staines, Daniel M

    2016-01-04

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species, complementing the resources for vertebrate genomics developed in the context of the Ensembl project (http://www.ensembl.org). Together, the two resources provide a consistent set of programmatic and interactive interfaces to a rich range of data including reference sequence, gene models, transcriptional data, genetic variation and comparative analysis. This paper provides an update to the previous publications about the resource, with a focus on recent developments. These include the development of new analyses and views to represent polyploid genomes (of which bread wheat is the primary exemplar); and the continued up-scaling of the resource, which now includes over 23 000 bacterial genomes, 400 fungal genomes and 100 protist genomes, in addition to 55 genomes from invertebrate metazoa and 39 genomes from plants. This dramatic increase in the number of included genomes is one part of a broader effort to automate the integration of archival data (genome sequence, but also associated RNA sequence data and variant calls) within the context of reference genomes and make it available through the Ensembl user interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Different domains of Bacillus thuringiensis delta-endotoxins can bind to insect midgut membrane proteins on ligand blots

    NARCIS (Netherlands)

    Maagd, de R.A.; Klei, van der H.; Bakker, P.L.; Stiekema, W.J.; Bosch, D.

    1996-01-01

    We investigated the role of the constituent domains of the CryIA(b) and CryIA(c) δ-endotoxins in binding to midgut epithelial cell membrane proteins of Spodoptera exigua and Manduca sexta on ligand blots. A collection of wild- type and CryIC-CryIA hybrid toxins was used for this purpose. As

  17. Molecular evidence of sorbitol dehydrogenase in tomato, a non-Rosaceae plant.

    Science.gov (United States)

    Ohta, Kazuhiro; Moriguchi, Ryo; Kanahama, Koki; Yamaki, Shohei; Kanayama, Yoshinori

    2005-12-01

    The enzyme NAD-dependent sorbitol dehydrogenase (SDH) is well characterized in the Rosaceae family of fruit trees, which synthesizes sorbitol as a translocatable photosynthate. Expressed sequence tags of SDH-like sequences have also been generated from various non-Rosaceae species that do not synthesize sorbitol as a primary photosynthetic product, but the physiological roles of the encoded proteins in non-Rosaceae plants are unknown. Therefore, we isolated an SDH-like cDNA (SDL) from tomato (Lycopersicon esculentum Mill.). Genomic Southern blot analysis suggested that SDL exists in the tomato genome as a single-copy gene. Northern blot analysis showed that SDL is ubiquitously expressed in tomato plants. Recombinant SDL protein was produced and purified for enzymatic characterization. SDL catalyzed the interconversion of sorbitol and fructose with NAD (H). SDL showed highest activity for sorbitol among the several substrates tested. SDL showed no activity with NADP+. Thus, SDL was identified as a SDH, although the Km values and substrate specificity of SDL were significantly different from those of SDH purified from the Japanese pear (Pyrus pyrifolia), a Rosaceae fruit tree. In addition, tomato was transformed with antisense SDL to evaluate the contribution of SDL to SDH activity in tomato. The transformation decreased SDH activity to approximately 50% on average. Taken together, these results provide molecular evidence of SDH in tomato, and SDL was renamed LeSDH.

  18. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    Science.gov (United States)

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  19. Evaluación de las pruebas dot blot y aglutinación de látex para el diagnóstico de cisticercosis en Perú

    Directory of Open Access Journals (Sweden)

    Eduardo Miranda-Ulloa

    Full Text Available Con el objetivo de evaluar las pruebas dot blot y aglutinación de látex para la detección de cisticercosis humana con antígeno de líquido de cisticerco de Taenia solium, se usaron 125 sueros humanos, de los cuales 60 procedían de personas con cisticercosis confirmada por Western Blot, 45 de personas con otras enfermedades parasitarias y 20 de personas aparentemente sanas. La concentración óptima del antígeno para impregnar las tiras dot blot fue de 0,01 ug/uL, y para impregnar las partículas de látex fue de 0,092 ug/uL. Para la prueba dot blot se encontró una sensibilidad del 100% y especificidad del 87,7%; para la aglutinación de látex una sensibilidad del 93,3% y especificidad del 89,2%. Ambas pruebas podrían ser de utilidad y factibles de implementar como alternativas de diagnóstico serológico en laboratorios de áreas endémicas del Perú

  20. phiGENOME: an integrative navigation throughout bacteriophage genomes.

    Science.gov (United States)

    Stano, Matej; Klucar, Lubos

    2011-11-01

    phiGENOME is a web-based genome browser generating dynamic and interactive graphical representation of phage genomes stored in the phiSITE, database of gene regulation in bacteriophages. phiGENOME is an integral part of the phiSITE web portal (http://www.phisite.org/phigenome) and it was optimised for visualisation of phage genomes with the emphasis on the gene regulatory elements. phiGENOME consists of three components: (i) genome map viewer built using Adobe Flash technology, providing dynamic and interactive graphical display of phage genomes; (ii) sequence browser based on precisely formatted HTML tags, providing detailed exploration of genome features on the sequence level and (iii) regulation illustrator, based on Scalable Vector Graphics (SVG) and designed for graphical representation of gene regulations. Bringing 542 complete genome sequences accompanied with their rich annotations and references, makes phiGENOME a unique information resource in the field of phage genomics. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. High prevalence of human papillomavirus infection in American Indian women of the Northern Plains

    Science.gov (United States)

    Bell, Maria C.; Schmidt-Grimminger, Delf; Patrick, Sarah; Ryschon, Tim; Linz, Laurie; Chauhan, Subhash C.

    2008-01-01

    Objectives Cervical cancer is the leading gynecological malignancy worldwide, and the incidence of this disease is very high in American Indian women. Infection with the Human Papillomavirus (HPV) is responsible for more than 95% of cervical squamous carcinomas. Therefore, the main objective of this study was to analyze oncogenic HPV infections in American Indian women residing in the Northern Plains. Methods Cervical samples were collected from 287 women attending a Northern Plains American Indian reservation outpatient clinic. DNA was extracted from the cervical samples and HPV specific DNA were amplified by polymerase chain reaction (PCR) using the L1 consensus primer sets. The PCR products were hybridized with the Roche HPV Line Blot assay for HPV genotyping to detect 27 different low and high-risk HPV genotypes. The chi-square test was performed for statistical analysis of the HPV infection and cytology diagnosis data. Results Of the total 287 patients, 61 women (21.25%) tested positive for HPV infection. Among all HPV-positive women, 41 (67.2%) were infected with high-risk HPV types. Of the HPV infected women, 41% presented with multiple HPV genotypes. Additionally, of the women infected with oncogenic HPV types, 20 (48.7%) were infected with HPV 16 and 18 and the remaining 21 (51.3%) were infected with other oncogenic types (i.e., HPV59, 39, 73). Women infected with oncogenic HPV types had significantly higher (p=0.001) abnormal Papanicolaou smear tests (Pap test) compared to women who were either HPV negative or positive for non-oncogenic HPV types. The incidence of HPV infection was inversely correlated (pIndian women residing on Northern Plains Reservations. In addition, a significant proportion of the oncogenic HPV infections were other than HPV16 and 18. PMID:17659767

  2. Genome Maps, a new generation genome browser.

    Science.gov (United States)

    Medina, Ignacio; Salavert, Francisco; Sanchez, Rubén; de Maria, Alejandro; Alonso, Roberto; Escobar, Pablo; Bleda, Marta; Dopazo, Joaquín

    2013-07-01

    Genome browsers have gained importance as more genomes and related genomic information become available. However, the increase of information brought about by new generation sequencing technologies is, at the same time, causing a subtle but continuous decrease in the efficiency of conventional genome browsers. Here, we present Genome Maps, a genome browser that implements an innovative model of data transfer and management. The program uses highly efficient technologies from the new HTML5 standard, such as scalable vector graphics, that optimize workloads at both server and client sides and ensure future scalability. Thus, data management and representation are entirely carried out by the browser, without the need of any Java Applet, Flash or other plug-in technology installation. Relevant biological data on genes, transcripts, exons, regulatory features, single-nucleotide polymorphisms, karyotype and so forth, are imported from web services and are available as tracks. In addition, several DAS servers are already included in Genome Maps. As a novelty, this web-based genome browser allows the local upload of huge genomic data files (e.g. VCF or BAM) that can be dynamically visualized in real time at the client side, thus facilitating the management of medical data affected by privacy restrictions. Finally, Genome Maps can easily be integrated in any web application by including only a few lines of code. Genome Maps is an open source collaborative initiative available in the GitHub repository (https://github.com/compbio-bigdata-viz/genome-maps). Genome Maps is available at: http://www.genomemaps.org.

  3. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus , family

    Directory of Open Access Journals (Sweden)

    Aneta Gubala

    2017-07-01

    Full Text Available Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector.

  4. Network analysis of epidermal growth factor signaling using integrated genomic, proteomic and phosphorylation data.

    Directory of Open Access Journals (Sweden)

    Katrina M Waters

    Full Text Available To understand how integration of multiple data types can help decipher cellular responses at the systems level, we analyzed the mitogenic response of human mammary epithelial cells to epidermal growth factor (EGF using whole genome microarrays, mass spectrometry-based proteomics and large-scale western blots with over 1000 antibodies. A time course analysis revealed significant differences in the expression of 3172 genes and 596 proteins, including protein phosphorylation changes measured by western blot. Integration of these disparate data types showed that each contributed qualitatively different components to the observed cell response to EGF and that varying degrees of concordance in gene expression and protein abundance measurements could be linked to specific biological processes. Networks inferred from individual data types were relatively limited, whereas networks derived from the integrated data recapitulated the known major cellular responses to EGF and exhibited more highly connected signaling nodes than networks derived from any individual dataset. While cell cycle regulatory pathways were altered as anticipated, we found the most robust response to mitogenic concentrations of EGF was induction of matrix metalloprotease cascades, highlighting the importance of the EGFR system as a regulator of the extracellular environment. These results demonstrate the value of integrating multiple levels of biological information to more accurately reconstruct networks of cellular response.

  5. Network Analysis of Epidermal Growth Factor Signaling using Integrated Genomic, Proteomic and Phosphorylation Data

    Energy Technology Data Exchange (ETDEWEB)

    Waters, Katrina M.; Liu, Tao; Quesenberry, Ryan D.; Willse, Alan R.; Bandyopadhyay, Somnath; Kathmann, Loel E.; Weber, Thomas J.; Smith, Richard D.; Wiley, H. S.; Thrall, Brian D.

    2012-03-29

    To understand how integration of multiple data types can help decipher cellular responses at the systems level, we analyzed the mitogenic response of human mammary epithelial cells to epidermal growth factor (EGF) using whole genome microarrays, mass spectrometry-based proteomics and large-scale western blots with over 1000 antibodies. A time course analysis revealed significant differences in the expression of 3172 genes and 596 proteins, including protein phosphorylation changes measured by western blot. Integration of these disparate data types showed that each contributed qualitatively different components to the observed cell response to EGF and that varying degrees of concordance in gene expression and protein abundance measurements could be linked to specific biological processes. Networks inferred from individual data types were relatively limited, whereas networks derived from the integrated data recapitulated the known major cellular responses to EGF and exhibited more highly connected signaling nodes than networks derived from any individual dataset. While cell cycle regulatory pathways were altered as anticipated, we found the most robust response to mitogenic concentrations of EGF was induction of matrix metalloprotease cascades, highlighting the importance of the EGFR system as a regulator of the extracellular environment. These results demonstrate the value of integrating multiple levels of biological information to more accurately reconstruct networks of cellular response.

  6. Total protein analysis as a reliable loading control for quantitative fluorescent Western blotting.

    Directory of Open Access Journals (Sweden)

    Samantha L Eaton

    Full Text Available Western blotting has been a key technique for determining the relative expression of proteins within complex biological samples since the first publications in 1979. Recent developments in sensitive fluorescent labels, with truly quantifiable linear ranges and greater limits of detection, have allowed biologists to probe tissue specific pathways and processes with higher resolution than ever before. However, the application of quantitative Western blotting (QWB to a range of healthy tissues and those from degenerative models has highlighted a problem with significant consequences for quantitative protein analysis: how can researchers conduct comparative expression analyses when many of the commonly used reference proteins (e.g. loading controls are differentially expressed? Here we demonstrate that common controls, including actin and tubulin, are differentially expressed in tissues from a wide range of animal models of neurodegeneration. We highlight the prevalence of such alterations through examination of published "-omics" data, and demonstrate similar responses in sensitive QWB experiments. For example, QWB analysis of spinal cord from a murine model of Spinal Muscular Atrophy using an Odyssey scanner revealed that beta-actin expression was decreased by 19.3±2% compared to healthy littermate controls. Thus, normalising QWB data to β-actin in these circumstances could result in 'skewing' of all data by ∼20%. We further demonstrate that differential expression of commonly used loading controls was not restricted to the nervous system, but was also detectable across multiple tissues, including bone, fat and internal organs. Moreover, expression of these "control" proteins was not consistent between different portions of the same tissue, highlighting the importance of careful and consistent tissue sampling for QWB experiments. Finally, having illustrated the problem of selecting appropriate single protein loading controls, we demonstrate

  7. Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species

    Directory of Open Access Journals (Sweden)

    Jing Meng

    2018-04-01

    Full Text Available Aconitum (Ranunculaceae consists of approximately 400 species distributed in the temperate regions of the northern hemisphere. Many species are well-known herbs, mainly used for analgesia and anti-inflammatory purposes. This genus is well represented in China and has gained widespread attention for its toxicity and detoxification properties. In southwestern China, several Aconitum species, called ‘Dula’ in the Yi Nationality, were often used to control the poisonous effects of other Aconitum plants. In this study, the complete chloroplast (cp genomes of these species were determined for the first time through Illumina paired-end sequencing. Our results indicate that their cp genomes ranged from 151,214 bp (A. episcopale to 155,769 bp (A. delavayi in length. A total of 111–112 unique genes were identified, including 85 protein-coding genes, 36–37 tRNA genes and eight ribosomal RNA genes (rRNA. We also analyzed codon usage, IR expansion or contraction and simple sequence repeats in the cp genomes. Eight variable regions were identified and these may potentially be useful as specific DNA barcodes for species identification of Aconitum. Phylogenetic analysis revealed that all five studied species formed a new clade and were resolved with 100% bootstrap support. This study will provide genomic resources and potential plastid markers for DNA barcoding, further taxonomy and germplasm exploration of Aconitum.

  8. Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species.

    Science.gov (United States)

    Meng, Jing; Li, Xuepei; Li, Hongtao; Yang, Junbo; Wang, Hong; He, Jun

    2018-04-26

    Aconitum (Ranunculaceae) consists of approximately 400 species distributed in the temperate regions of the northern hemisphere. Many species are well-known herbs, mainly used for analgesia and anti-inflammatory purposes. This genus is well represented in China and has gained widespread attention for its toxicity and detoxification properties. In southwestern China, several Aconitum species, called ‘Dula’ in the Yi Nationality, were often used to control the poisonous effects of other Aconitum plants. In this study, the complete chloroplast (cp) genomes of these species were determined for the first time through Illumina paired-end sequencing. Our results indicate that their cp genomes ranged from 151,214 bp ( A. episcopale ) to 155,769 bp ( A. delavayi ) in length. A total of 111⁻112 unique genes were identified, including 85 protein-coding genes, 36⁻37 tRNA genes and eight ribosomal RNA genes (rRNA). We also analyzed codon usage, IR expansion or contraction and simple sequence repeats in the cp genomes. Eight variable regions were identified and these may potentially be useful as specific DNA barcodes for species identification of Aconitum . Phylogenetic analysis revealed that all five studied species formed a new clade and were resolved with 100% bootstrap support. This study will provide genomic resources and potential plastid markers for DNA barcoding, further taxonomy and germplasm exploration of Aconitum .

  9. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus Hapavirus, family Rhabdoviridae.

    Science.gov (United States)

    Gubala, Aneta; Walsh, Susan; McAllister, Jane; Weir, Richard; Davis, Steven; Melville, Lorna; Mitchell, Ian; Bulach, Dieter; Gauci, Penny; Skvortsov, Alex; Boyle, David

    2017-01-01

    Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs) in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector.

  10. Identification of very small open reading frames in the genomes of Holmes Jungle virus, Ord River virus, and Wongabel virus of the genus Hapavirus, family Rhabdoviridae

    Science.gov (United States)

    Gubala, Aneta; Walsh, Susan; McAllister, Jane; Weir, Richard; Davis, Steven; Melville, Lorna; Mitchell, Ian; Bulach, Dieter; Gauci, Penny; Skvortsov, Alex; Boyle, David

    2017-01-01

    Viruses of the family Rhabdoviridae infect a broad range of hosts from a variety of ecological and geographical niches, including vertebrates, arthropods, and plants. The arthropod-transmitted members of this family display considerable genetic diversity and remarkable genomic flexibility that enable coding for various accessory proteins in different locations of the genome. Here, we describe the genome of Holmes Jungle virus, isolated from Culex annulirostris mosquitoes collected in northern Australia, and make detailed comparisons with the closely related Ord River and Wongabel viruses, with a focus on identifying very small open reading frames (smORFs) in their genomes. This is the first systematic prediction of smORFs in rhabdoviruses, emphasising the intricacy of the rhabdovirus genome and the knowledge gaps. We speculate that these smORFs may be of importance to the life cycle of the virus in the arthropod vector. PMID:28747815

  11. Development of antibiotic marker-free creeping bentgrass resistance against herbicides.

    Science.gov (United States)

    Lee, Ki-Won; Kim, Ki-Yong; Kim, Kyung-Hee; Lee, Byung-Hyun; Kim, Jin-Seog; Lee, Sang-Hoon

    2011-01-01

    Herbicide-resistant creeping bentgrass plants (Agrostis stolonifera L.) without antibiotic-resistant markers were produced by Agrobacterium-mediated transformation. Embryogenic callus tissues were infected with Agrobacterium tumefaciens EHA105, harboring the bar and the CP4-EPSPS genes for bialaphos and glyphosate resistance. Phosphinothricin-resistant calli and plants were selected. Soil-grown plants were obtained at 14-16 weeks after transformation. Genetic transformation of the selected, regenerated plants was validated by PCR. Southern blot analysis revealed that at least one copy of the transgene was integrated into the genome of the transgenic plants. Transgene expression was confirmed by Northern blot. CP4-EPSPS protein was detected by ELISA. Transgenic plants remained green and healthy when sprayed with Basta, containing 0.5% glufosinate ammonium or glyphosate. The optimized Agrobacterium-mediated transformation method resulted in an average of 9.4% transgenic plants. The results of the present study suggest that the optimized marker-free technique could be used as an effective and reliable method for routine transformation, which may facilitate the development of varieties of new antibiotic-free grass species.

  12. Phylogenomic relationship of feijoa (Acca sellowiana (O.Berg) Burret) with other Myrtaceae based on complete chloroplast genome sequences.

    Science.gov (United States)

    Machado, Lilian de Oliveira; Vieira, Leila do Nascimento; Stefenon, Valdir Marcos; Oliveira Pedrosa, Fábio de; Souza, Emanuel Maltempi de; Guerra, Miguel Pedro; Nodari, Rubens Onofre

    2017-04-01

    Given their distribution, importance, and richness, Myrtaceae species comprise a model system for studying the evolution of tropical plant diversity. In addition, chloroplast (cp) genome sequencing is an efficient tool for phylogenetic relationship studies. Feijoa [Acca sellowiana (O. Berg) Burret; CN: pineapple-guava] is a Myrtaceae species that occurs naturally in southern Brazil and northern Uruguay. Feijoa is known for its exquisite perfume and flavorful fruits, pharmacological properties, ornamental value and increasing economic relevance. In the present work, we reported the complete cp genome of feijoa. The feijoa cp genome is a circular molecule of 159,370 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC 88,028 bp) and a Small Single Copy region (SSC 18,598 bp) separated by Inverted Repeat regions (IRs 26,372 bp). The genome structure, gene order, GC content and codon usage are similar to those of typical angiosperm cp genomes. When compared to other cp genome sequences of Myrtaceae, feijoa showed closest relationship with pitanga (Eugenia uniflora L.). Furthermore, a comparison of pitanga synonymous (Ks) and nonsynonymous (Ka) substitution rates revealed extremely low values. Maximum Likelihood and Bayesian Inference analyses produced phylogenomic trees identical in topology. These trees supported monophyly of three Myrtoideae clades.

  13. ANCA-GBM dot-blot : Evaluation of an assay in the differential diagnosis of patients presenting with rapidly progressive glomerulonephritis

    NARCIS (Netherlands)

    Rutgers, Abraham; Damoiseaux, Jan; Roozendaal, Caroline; Limburg, Pieter C; Stegeman, Coen A; Tervaert, Jan Willem Cohen

    Rapidly progressive glomerulonephritis (RPGN) is characterized by rapid and progressive loss of renal function and the presence of crescentic glomerulonephritis (CGN). Early diagnosis and appropriate treatment is mandatory to prevent death and/or renal failure. We have evaluated an ANCA-GBM dot-blot

  14. Characterization of Sm14 related components in different helminths by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting analysis

    Directory of Open Access Journals (Sweden)

    Nilton Thaumaturgo

    2002-10-01

    Full Text Available Sm14 was the first fatty acid-binding protein homologue identified in helminths. Thereafter, members of the same family were identified in several helminth species, with high aminoacid sequence homology between them. In addition, immune crossprotection was also reported against Fasciola hepatica infection, in animals previously immunized with the Schistosoma mansoni vaccine candidate, r-Sm14. In the present study, data on preliminary sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting analysis of nine different helminth extracts focusing the identification of Sm14 related proteins, is reported. Out of these, three extracts - Ascaris suum (males and females, Echinostoma paraensei, and Taenia saginata - presented components that comigrated with Sm14 in SDS-PAGE, and that were recognized by anti-rSm14 policlonal serum, in Western blotting tests.

  15. Genomics using the Assembly of the Mink Genome

    DEFF Research Database (Denmark)

    Guldbrandtsen, Bernt; Cai, Zexi; Sahana, Goutam

    2018-01-01

    The American Mink’s (Neovison vison) genome has recently been sequenced. This opens numerous avenues of research both for studying the basic genetics and physiology of the mink as well as genetic improvement in mink. Using genotyping-by-sequencing (GBS) generated marker data for 2,352 Danish farm...... mink runs of homozygosity (ROH) were detect in mink genomes. Detectable ROH made up on average 1.7% of the genome indicating the presence of at most a moderate level of genomic inbreeding. The fraction of genome regions found in ROH varied. Ten percent of the included regions were never found in ROH....... The ability to detect ROH in the mink genome also demonstrates the general reliability of the new mink genome assembly. Keywords: american mink, run of homozygosity, genome, selection, genomic inbreeding...

  16. Nature: a colour comparison between Northern South Africa and Northern Australia

    CSIR Research Space (South Africa)

    Baumbach, J

    2009-10-01

    Full Text Available During 1983 DSTO in Australia measured the reflectances of grass, trees and soil in northern Australia, using a custom-build spectroradiometer. During 2002 CSIR in South Africa performed similar measurements in northern South Africa, using a...

  17. Visualization for genomics: the Microbial Genome Viewer.

    NARCIS (Netherlands)

    Kerkhoven, R.; Enckevort, F.H.J. van; Boekhorst, J.; Molenaar, D; Siezen, R.J.

    2004-01-01

    SUMMARY: A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a

  18. Development of EMab-51, a Sensitive and Specific Anti-Epidermal Growth Factor Receptor Monoclonal Antibody in Flow Cytometry, Western Blot, and Immunohistochemistry.

    Science.gov (United States)

    Itai, Shunsuke; Kaneko, Mika K; Fujii, Yuki; Yamada, Shinji; Nakamura, Takuro; Yanaka, Miyuki; Saidoh, Noriko; Handa, Saori; Chang, Yao-Wen; Suzuki, Hiroyoshi; Harada, Hiroyuki; Kato, Yukinari

    2017-10-01

    The epidermal growth factor receptor (EGFR) is a member of the human epidermal growth factor receptor (HER) family of receptor tyrosine kinases and is involved in cell growth and differentiation. EGFR homodimers or heterodimers with other HER members, such as HER2 and HER3, activate downstream signaling cascades in many cancers. In this study, we developed novel anti-EGFR monoclonal antibodies (mAbs) and characterized their efficacy in flow cytometry, Western blot, and immunohistochemical analyses. First, we expressed the full-length or ectodomain of EGFR in LN229 glioblastoma cells and then immunized mice with LN229/EGFR or ectodomain of EGFR, and performed the first screening using enzyme-linked immunosorbent assays. Subsequently, we selected mAbs according to their efficacy in flow cytometry (second screening), Western blot (third screening), and immunohistochemical (fourth screening) analyses. Among 100 mAbs, only one clone EMab-51 (IgG 1 , kappa) reacted with EGFR in Western blot analysis. Finally, immunohistochemical analyses with EMab-51 showed sensitive and specific reactions against oral cancer cells, warranting the use of EMab-51 to detect EGFR in pathological analyses of EGFR-expressing cancers.

  19. The complete chloroplast genome sequence of the relict woody plant Metasequoia glyptostroboides Hu et Cheng

    Directory of Open Access Journals (Sweden)

    Jinhui eChen

    2015-06-01

    Full Text Available Metasequoia glyptostroboides Hu et Cheng is the only species in the genus Metasequoia Miki ex Hu et Cheng, which belongs to the Cupressaceae family. There were around ten species in the Metasequoia genus, which were widely spread across the Northern Hemisphere during the Cretaceous of the Mesozoic and in the Cenozoic. M. glyptostroboides is the only remaining representative of this genus. Here, we report the complete chloroplast (cp genome sequence and the cp genomic features of M. glyptostroboides. The M. glyptostroboides cp genome is 131,887 bp in length, with a total of 117 genes comprised of 82 protein-coding genes, 31 tRNA genes and four rRNA genes. In this genome, 11 forward repeats, nine palindromic repeats and 15 tandem repeats were detected. A total of 188 perfect microsatellites were detected through simple sequence repeat (SSR analysis and these were distributed unevenly within the cp genome. Comparison of the cp genome structure and gene order to those of several other land plants indicated that a copy of the inverted repeat (IR region, which was found to be IR region A (IRA, was lost in the M. glyptostroboides cp ge-nome. The five most divergent and five most conserved genes were determined and further phylogenetic analysis was performed among plant species, especially for relat-ed species in conifers. Finally, phylogenetic analysis demonstrated that M. glyptostro-boides is a sister species to Cryptomeria japonica (L. F. D. Don and to Taiwania cryptomerioides Hayata. The complete cp genome sequence information of M. glyp-tostroboides will be great helpful for further investigations of this endemic relict woody plant and for in-depth understanding of the evolutionary history of the conif-erous cp genomes, especially for the position of M. glyptostroboides in plant systemat-ics and evolution.

  20. The complete chloroplast genome sequence of the relict woody plant Metasequoia glyptostroboides Hu et Cheng.

    Science.gov (United States)

    Chen, Jinhui; Hao, Zhaodong; Xu, Haibin; Yang, Liming; Liu, Guangxin; Sheng, Yu; Zheng, Chen; Zheng, Weiwei; Cheng, Tielong; Shi, Jisen

    2015-01-01

    Metasequoia glyptostroboides Hu et Cheng is the only species in the genus Metasequoia Miki ex Hu et Cheng, which belongs to the Cupressaceae family. There were around 10 species in the Metasequoia genus, which were widely spread across the Northern Hemisphere during the Cretaceous of the Mesozoic and in the Cenozoic. M. glyptostroboides is the only remaining representative of this genus. Here, we report the complete chloroplast (cp) genome sequence and the cp genomic features of M. glyptostroboides. The M. glyptostroboides cp genome is 131,887 bp in length, with a total of 117 genes comprised of 82 protein-coding genes, 31 tRNA genes and four rRNA genes. In this genome, 11 forward repeats, nine palindromic repeats, and 15 tandem repeats were detected. A total of 188 perfect microsatellites were detected through simple sequence repeat (SSR) analysis and these were distributed unevenly within the cp genome. Comparison of the cp genome structure and gene order to those of several other land plants indicated that a copy of the inverted repeat (IR) region, which was found to be IR region A (IRA), was lost in the M. glyptostroboides cp genome. The five most divergent and five most conserved genes were determined and further phylogenetic analysis was performed among plant species, especially for related species in conifers. Finally, phylogenetic analysis demonstrated that M. glyptostroboides is a sister species to Cryptomeria japonica (L. F.) D. Don and to Taiwania cryptomerioides Hayata. The complete cp genome sequence information of M. glyptostroboides will be great helpful for further investigations of this endemic relict woody plant and for in-depth understanding of the evolutionary history of the coniferous cp genomes, especially for the position of M. glyptostroboides in plant systematics and evolution.

  1. Cy5 total protein normalization in Western blot analysis.

    Science.gov (United States)

    Hagner-McWhirter, Åsa; Laurin, Ylva; Larsson, Anita; Bjerneld, Erik J; Rönn, Ola

    2015-10-01

    Western blotting is a widely used method for analyzing specific target proteins in complex protein samples. Housekeeping proteins are often used for normalization to correct for uneven sample loads, but these require careful validation since expression levels may vary with cell type and treatment. We present a new, more reliable method for normalization using Cy5-prelabeled total protein as a loading control. We used a prelabeling protocol based on Cy5 N-hydroxysuccinimide ester labeling that produces a linear signal response. We obtained a low coefficient of variation (CV) of 7% between the ratio of extracellular signal-regulated kinase (ERK1/2) target to Cy5 total protein control signals over the whole loading range from 2.5 to 20.0μg of Chinese hamster ovary cell lysate protein. Corresponding experiments using actin or tubulin as controls for normalization resulted in CVs of 13 and 18%, respectively. Glyceraldehyde-3-phosphate dehydrogenase did not produce a proportional signal and was not suitable for normalization in these cells. A comparison of ERK1/2 signals from labeled and unlabeled samples showed that Cy5 prelabeling did not affect antibody binding. By using total protein normalization we analyzed PP2A and Smad2/3 levels with high confidence. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa.

    Science.gov (United States)

    Shinkuma, Satoru; Guo, Zongyou; Christiano, Angela M

    2016-05-17

    Genome editing with engineered site-specific endonucleases involves nonhomologous end-joining, leading to reading frame disruption. The approach is applicable to dominant negative disorders, which can be treated simply by knocking out the mutant allele, while leaving the normal allele intact. We applied this strategy to dominant dystrophic epidermolysis bullosa (DDEB), which is caused by a dominant negative mutation in the COL7A1 gene encoding type VII collagen (COL7). We performed genome editing with TALENs and CRISPR/Cas9 targeting the mutation, c.8068_8084delinsGA. We then cotransfected Cas9 and guide RNA expression vectors expressed with GFP and DsRed, respectively, into induced pluripotent stem cells (iPSCs) generated from DDEB fibroblasts. After sorting, 90% of the iPSCs were edited, and we selected four gene-edited iPSC lines for further study. These iPSCs were differentiated into keratinocytes and fibroblasts secreting COL7. RT-PCR and Western blot analyses revealed gene-edited COL7 with frameshift mutations degraded at the protein level. In addition, we confirmed that the gene-edited truncated COL7 could neither associate with normal COL7 nor undergo triple helix formation. Our data establish the feasibility of mutation site-specific genome editing in dominant negative disorders.

  3. Near Full-Length Identification of a Novel HIV-1 CRF01_AE/B/C Recombinant in Northern Myanmar.

    Science.gov (United States)

    Zhou, Yan-Heng; Chen, Xin; Liang, Yue-Bo; Pang, Wei; Qin, Wei-Hong; Zhang, Chiyu; Zheng, Yong-Tang

    2015-08-01

    The Myanmar-China border appears to be the "hot spot" region for the occurrence of HIV-1 recombination. The majority of the previous analyses of HIV-1 recombination were based on partial genomic sequences, which obviously cannot reflect the reality of the genetic diversity of HIV-1 in this area well. Here, we present a near full-length characterization of a novel HIV-1 CRF01_AE/B/C recombinant isolated from a long-distance truck driver in Northern Myanmar. It is the first description of a near full-length genomic sequence in Myanmar since 2003, and might be one of the most complicated HIV-1 chimeras ever detected in Myanmar, containing four CRF01_AE, six B segments, and five C segments separated by 14 breakpoints throughout its genome. The discovery and characterization of this new CRF01_AE/B/C recombinant indicate that intersubtype recombination is ongoing in Myanmar, continuously generating new forms of HIV-1. More work based on near full-length sequence analyses is urgently needed to better understand the genetic diversity of HIV-1 in these regions.

  4. The perennial ryegrass GenomeZipper: targeted use of genome resources for comparative grass genomics.

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F X; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-02-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species.

  5. Titan's Stratospheric Condensibles at High Northern Latitudes During Northern Winter

    Science.gov (United States)

    Anderson, Carrie; Samuelson, R.; Achterberg, R.

    2012-01-01

    The Infrared Interferometer Spectrometer (IRIS) instrument on board Voyager 1 caught the first glimpse of an unidentified particulate feature in Titan's stratosphere that spectrally peaks at 221 per centimeter. Until recently, this feature that we have termed 'the haystack,' has been seen persistently at high northern latitudes with the Composite Infrared Spectrometer (CIRS) instrument onboard Cassini, The strength of the haystack emission feature diminishes rapidly with season, becoming drastically reduced at high northern latitudes, as Titan transitions from northern winter into spring, In contrast to IRIS whose shortest wavenumber was 200 per centimeter, CIRS extends down to 10 per centimeter, thus revealing an entirely unexplored spectral region in which nitrile ices have numerous broad lattice vibration features, Unlike the haystack, which is only found at high northern latitudes during northern winter/early northern spring, this geometrically thin nitrile cloud pervades Titan's lower stratosphere, spectrally peaking at 160 per centimeter, and is almost global in extent spanning latitudes 85 N to 600 S, The inference of nitrile ices are consistent with the highly restricted altitude ranges over which these features are observed, and appear to be dominated by a mixture of HCN and HC3N, The narrow range in altitude over which the nitrile ices extend is unlike the haystack, whose vertical distribution is significantly broader, spanning roughly 70 kilometers in altitude in Titan's lower stratosphere, The nitrile clouds that CIRS observes are located in a dynamically stable region of Titan's atmosphere, whereas CH4 clouds, which ordinarily form in the troposphere, form in a more dynamically unstable region, where convective cloud systems tend to occur. In the unusual situation where Titan's tropopause cools significantly from the HASI 70.5K temperature minimum, CH4 should condense in Titan's lower stratosphere, just like the aforementioned nitrile clouds, although

  6. Genomics Assisted Ancestry Deconvolution in Grape

    Science.gov (United States)

    Sawler, Jason; Reisch, Bruce; Aradhya, Mallikarjuna K.; Prins, Bernard; Zhong, Gan-Yuan; Schwaninger, Heidi; Simon, Charles; Buckler, Edward; Myles, Sean

    2013-01-01

    The genus Vitis (the grapevine) is a group of highly diverse, diploid woody perennial vines consisting of approximately 60 species from across the northern hemisphere. It is the world’s most valuable horticultural crop with ~8 million hectares planted, most of which is processed into wine. To gain insights into the use of wild Vitis species during the past century of interspecific grape breeding and to provide a foundation for marker-assisted breeding programmes, we present a principal components analysis (PCA) based ancestry estimation method to calculate admixture proportions of hybrid grapes in the United States Department of Agriculture grape germplasm collection using genome-wide polymorphism data. We find that grape breeders have backcrossed to both the domesticated V. vinifera and wild Vitis species and that reasonably accurate genome-wide ancestry estimation can be performed on interspecific Vitis hybrids using a panel of fewer than 50 ancestry informative markers (AIMs). We compare measures of ancestry informativeness used in selecting SNP panels for two-way admixture estimation, and verify the accuracy of our method on simulated populations of admixed offspring. Our method of ancestry deconvolution provides a first step towards selection at the seed or seedling stage for desirable admixture profiles, which will facilitate marker-assisted breeding that aims to introgress traits from wild Vitis species while retaining the desirable characteristics of elite V. vinifera cultivars. PMID:24244717

  7. Genomics assisted ancestry deconvolution in grape.

    Directory of Open Access Journals (Sweden)

    Jason Sawler

    Full Text Available The genus Vitis (the grapevine is a group of highly diverse, diploid woody perennial vines consisting of approximately 60 species from across the northern hemisphere. It is the world's most valuable horticultural crop with ~8 million hectares planted, most of which is processed into wine. To gain insights into the use of wild Vitis species during the past century of interspecific grape breeding and to provide a foundation for marker-assisted breeding programmes, we present a principal components analysis (PCA based ancestry estimation method to calculate admixture proportions of hybrid grapes in the United States Department of Agriculture grape germplasm collection using genome-wide polymorphism data. We find that grape breeders have backcrossed to both the domesticated V. vinifera and wild Vitis species and that reasonably accurate genome-wide ancestry estimation can be performed on interspecific Vitis hybrids using a panel of fewer than 50 ancestry informative markers (AIMs. We compare measures of ancestry informativeness used in selecting SNP panels for two-way admixture estimation, and verify the accuracy of our method on simulated populations of admixed offspring. Our method of ancestry deconvolution provides a first step towards selection at the seed or seedling stage for desirable admixture profiles, which will facilitate marker-assisted breeding that aims to introgress traits from wild Vitis species while retaining the desirable characteristics of elite V. vinifera cultivars.

  8. An integrated approach for finding overlooked genes in Shigella.

    Directory of Open Access Journals (Sweden)

    Junping Peng

    Full Text Available BACKGROUND: The completion of numerous genome sequences introduced an era of whole-genome study. However, many genes are missed during genome annotation, including small RNAs (sRNAs and small open reading frames (sORFs. In order to improve genome annotation, we aimed to identify novel sRNAs and sORFs in Shigella, the principal etiologic agents of bacillary dysentery. METHODOLOGY/PRINCIPAL FINDINGS: We identified 64 sRNAs in Shigella, which were experimentally validated in other bacteria based on sequence conservation. We employed computer-based and tiling array-based methods to search for sRNAs, followed by RT-PCR and northern blots, to identify nine sRNAs in Shigella flexneri strain 301 (Sf301 and 256 regions containing possible sRNA genes. We found 29 candidate sORFs using bioinformatic prediction, array hybridization and RT-PCR verification. We experimentally validated 557 (57.9% DOOR operon predictions in the chromosomes of Sf301 and 46 (76.7% in virulence plasmid.We found 40 additional co-expressed gene pairs that were not predicted by DOOR. CONCLUSIONS/SIGNIFICANCE: We provide an updated and comprehensive annotation of the Shigella genome. Our study increased the expected numbers of sORFs and sRNAs, which will impact on future functional genomics and proteomics studies. Our method can be used for large scale reannotation of sRNAs and sORFs in any microbe with a known genome sequence.

  9. Family genome browser: visualizing genomes with pedigree information.

    Science.gov (United States)

    Juan, Liran; Liu, Yongzhuang; Wang, Yongtian; Teng, Mingxiang; Zang, Tianyi; Wang, Yadong

    2015-07-15

    Families with inherited diseases are widely used in Mendelian/complex disease studies. Owing to the advances in high-throughput sequencing technologies, family genome sequencing becomes more and more prevalent. Visualizing family genomes can greatly facilitate human genetics studies and personalized medicine. However, due to the complex genetic relationships and high similarities among genomes of consanguineous family members, family genomes are difficult to be visualized in traditional genome visualization framework. How to visualize the family genome variants and their functions with integrated pedigree information remains a critical challenge. We developed the Family Genome Browser (FGB) to provide comprehensive analysis and visualization for family genomes. The FGB can visualize family genomes in both individual level and variant level effectively, through integrating genome data with pedigree information. Family genome analysis, including determination of parental origin of the variants, detection of de novo mutations, identification of potential recombination events and identical-by-decent segments, etc., can be performed flexibly. Diverse annotations for the family genome variants, such as dbSNP memberships, linkage disequilibriums, genes, variant effects, potential phenotypes, etc., are illustrated as well. Moreover, the FGB can automatically search de novo mutations and compound heterozygous variants for a selected individual, and guide investigators to find high-risk genes with flexible navigation options. These features enable users to investigate and understand family genomes intuitively and systematically. The FGB is available at http://mlg.hit.edu.cn/FGB/. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  11. Identification and Characterization of Microsatellite Markers Derived from the Whole Genome Analysis of Taenia solium.

    Science.gov (United States)

    Pajuelo, Mónica J; Eguiluz, María; Dahlstrom, Eric; Requena, David; Guzmán, Frank; Ramirez, Manuel; Sheen, Patricia; Frace, Michael; Sammons, Scott; Cama, Vitaliano; Anzick, Sarah; Bruno, Dan; Mahanty, Siddhartha; Wilkins, Patricia; Nash, Theodore; Gonzalez, Armando; García, Héctor H; Gilman, Robert H; Porcella, Steve; Zimic, Mirko

    2015-12-01

    Infections with Taenia solium are the most common cause of adult acquired seizures worldwide, and are the leading cause of epilepsy in developing countries. A better understanding of the genetic diversity of T. solium will improve parasite diagnostics and transmission pathways in endemic areas thereby facilitating the design of future control measures and interventions. Microsatellite markers are useful genome features, which enable strain typing and identification in complex pathogen genomes. Here we describe microsatellite identification and characterization in T. solium, providing information that will assist in global efforts to control this important pathogen. For genome sequencing, T. solium cysts and proglottids were collected from Huancayo and Puno in Peru, respectively. Using next generation sequencing (NGS) and de novo assembly, we assembled two draft genomes and one hybrid genome. Microsatellite sequences were identified and 36 of them were selected for further analysis. Twenty T. solium isolates were collected from Tumbes in the northern region, and twenty from Puno in the southern region of Peru. The size-polymorphism of the selected microsatellites was determined with multi-capillary electrophoresis. We analyzed the association between microsatellite polymorphism and the geographic origin of the samples. The predicted size of the hybrid (proglottid genome combined with cyst genome) T. solium genome was 111 MB with a GC content of 42.54%. A total of 7,979 contigs (>1,000 nt) were obtained. We identified 9,129 microsatellites in the Puno-proglottid genome and 9,936 in the Huancayo-cyst genome, with 5 or more repeats, ranging from mono- to hexa-nucleotide. Seven microsatellites were polymorphic and 29 were monomorphic within the analyzed isolates. T. solium tapeworms were classified into two genetic groups that correlated with the North/South geographic origin of the parasites. The availability of draft genomes for T. solium represents a significant step

  12. Identification and Characterization of Microsatellite Markers Derived from the Whole Genome Analysis of Taenia solium.

    Directory of Open Access Journals (Sweden)

    Mónica J Pajuelo

    2015-12-01

    Full Text Available Infections with Taenia solium are the most common cause of adult acquired seizures worldwide, and are the leading cause of epilepsy in developing countries. A better understanding of the genetic diversity of T. solium will improve parasite diagnostics and transmission pathways in endemic areas thereby facilitating the design of future control measures and interventions. Microsatellite markers are useful genome features, which enable strain typing and identification in complex pathogen genomes. Here we describe microsatellite identification and characterization in T. solium, providing information that will assist in global efforts to control this important pathogen.For genome sequencing, T. solium cysts and proglottids were collected from Huancayo and Puno in Peru, respectively. Using next generation sequencing (NGS and de novo assembly, we assembled two draft genomes and one hybrid genome. Microsatellite sequences were identified and 36 of them were selected for further analysis. Twenty T. solium isolates were collected from Tumbes in the northern region, and twenty from Puno in the southern region of Peru. The size-polymorphism of the selected microsatellites was determined with multi-capillary electrophoresis. We analyzed the association between microsatellite polymorphism and the geographic origin of the samples.The predicted size of the hybrid (proglottid genome combined with cyst genome T. solium genome was 111 MB with a GC content of 42.54%. A total of 7,979 contigs (>1,000 nt were obtained. We identified 9,129 microsatellites in the Puno-proglottid genome and 9,936 in the Huancayo-cyst genome, with 5 or more repeats, ranging from mono- to hexa-nucleotide. Seven microsatellites were polymorphic and 29 were monomorphic within the analyzed isolates. T. solium tapeworms were classified into two genetic groups that correlated with the North/South geographic origin of the parasites.The availability of draft genomes for T. solium represents a

  13. eGenomics: Cataloguing Our Complete Genome Collection III

    Directory of Open Access Journals (Sweden)

    Dawn Field

    2007-01-01

    Full Text Available This meeting report summarizes the proceedings of the “eGenomics: Cataloguing our Complete Genome Collection III” workshop held September 11–13, 2006, at the National Institute for Environmental eScience (NIEeS, Cambridge, United Kingdom. This 3rd workshop of the Genomic Standards Consortium was divided into two parts. The first half of the three-day workshop was dedicated to reviewing the genomic diversity of our current and future genome and metagenome collection, and exploring linkages to a series of existing projects through formal presentations. The second half was dedicated to strategic discussions. Outcomes of the workshop include a revised “Minimum Information about a Genome Sequence” (MIGS specification (v1.1, consensus on a variety of features to be added to the Genome Catalogue (GCat, agreement by several researchers to adopt MIGS for imminent genome publications, and an agreement by the EBI and NCBI to input their genome collections into GCat for the purpose of quantifying the amount of optional data already available (e.g., for geographic location coordinates and working towards a single, global list of all public genomes and metagenomes.

  14. Genome Sequencing of Museum Specimens Reveals Rapid Changes in the Genetic Composition of Honey Bees in California.

    Science.gov (United States)

    Cridland, Julie M; Ramirez, Santiago R; Dean, Cheryl A; Sciligo, Amber; Tsutsui, Neil D

    2018-02-01

    The western honey bee, Apis mellifera, is an enormously influential pollinator in both natural and managed ecosystems. In North America, this species has been introduced numerous times from a variety of different source populations in Europe and Africa. Since then, feral populations have expanded into many different environments across their broad introduced range. Here, we used whole genome sequencing of historical museum specimens and newly collected modern populations from California (USA) to analyze the impact of demography and selection on introduced populations during the past 105 years. We find that populations from both northern and southern California exhibit pronounced genetic changes, but have changed in different ways. In northern populations, honey bees underwent a substantial shift from western European to eastern European ancestry since the 1960s, whereas southern populations are dominated by the introgression of Africanized genomes during the past two decades. Additionally, we identify an isolated island population that has experienced comparatively little change over a large time span. Fine-scale comparison of different populations and time points also revealed SNPs that differ in frequency, highlighting a number of genes that may be important for recent adaptations in these introduced populations. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Early modern human dispersal from Africa: genomic evidence for multiple waves of migration.

    Science.gov (United States)

    Tassi, Francesca; Ghirotto, Silvia; Mezzavilla, Massimo; Vilaça, Sibelle Torres; De Santi, Lisa; Barbujani, Guido

    2015-01-01

    Anthropological and genetic data agree in indicating the African continent as the main place of origin for anatomically modern humans. However, it is unclear whether early modern humans left Africa through a single, major process, dispersing simultaneously over Asia and Europe, or in two main waves, first through the Arab Peninsula into southern Asia and Oceania, and later through a northern route crossing the Levant. Here, we show that accurate genomic estimates of the divergence times between European and African populations are more recent than those between Australo-Melanesia and Africa and incompatible with the effects of a single dispersal. This difference cannot possibly be accounted for by the effects of either hybridization with archaic human forms in Australo-Melanesia or back migration from Europe into Africa. Furthermore, in several populations of Asia we found evidence for relatively recent genetic admixture events, which could have obscured the signatures of the earliest processes. We conclude that the hypothesis of a single major human dispersal from Africa appears hardly compatible with the observed historical and geographical patterns of genome diversity and that Australo-Melanesian populations seem still to retain a genomic signature of a more ancient divergence from Africa.

  16. Genomic Prediction from Whole Genome Sequence in Livestock: The 1000 Bull Genomes Project

    DEFF Research Database (Denmark)

    Hayes, Benjamin J; MacLeod, Iona M; Daetwyler, Hans D

    Advantages of using whole genome sequence data to predict genomic estimated breeding values (GEBV) include better persistence of accuracy of GEBV across generations and more accurate GEBV across breeds. The 1000 Bull Genomes Project provides a database of whole genome sequenced key ancestor bulls....... In a dairy data set, predictions using BayesRC and imputed sequence data from 1000 Bull Genomes were 2% more accurate than with 800k data. We could demonstrate the method identified causal mutations in some cases. Further improvements will come from more accurate imputation of sequence variant genotypes...

  17. A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

    Science.gov (United States)

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

    2004-09-01

    Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

  18. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  19. Between Lake Baikal and the Baltic Sea: genomic history of the gateway to Europe.

    Science.gov (United States)

    Triska, Petr; Chekanov, Nikolay; Stepanov, Vadim; Khusnutdinova, Elza K; Kumar, Ganesh Prasad Arun; Akhmetova, Vita; Babalyan, Konstantin; Boulygina, Eugenia; Kharkov, Vladimir; Gubina, Marina; Khidiyatova, Irina; Khitrinskaya, Irina; Khrameeva, Ekaterina E; Khusainova, Rita; Konovalova, Natalia; Litvinov, Sergey; Marusin, Andrey; Mazur, Alexandr M; Puzyrev, Valery; Ivanoshchuk, Dinara; Spiridonova, Maria; Teslyuk, Anton; Tsygankova, Svetlana; Triska, Martin; Trofimova, Natalya; Vajda, Edward; Balanovsky, Oleg; Baranova, Ancha; Skryabin, Konstantin; Tatarinova, Tatiana V; Prokhortchouk, Egor

    2017-12-28

    The history of human populations occupying the plains and mountain ridges separating Europe from Asia has been eventful, as these natural obstacles were crossed westward by multiple waves of Turkic and Uralic-speaking migrants as well as eastward by Europeans. Unfortunately, the material records of history of this region are not dense enough to reconstruct details of population history. These considerations stimulate growing interest to obtain a genetic picture of the demographic history of migrations and admixture in Northern Eurasia. We genotyped and analyzed 1076 individuals from 30 populations with geographical coverage spanning from Baltic Sea to Baikal Lake. Our dense sampling allowed us to describe in detail the population structure, provide insight into genomic history of numerous European and Asian populations, and significantly increase quantity of genetic data available for modern populations in region of North Eurasia. Our study doubles the amount of genome-wide profiles available for this region. We detected unusually high amount of shared identical-by-descent (IBD) genomic segments between several Siberian populations, such as Khanty and Ket, providing evidence of genetic relatedness across vast geographic distances and between speakers of different language families. Additionally, we observed excessive IBD sharing between Khanty and Bashkir, a group of Turkic speakers from Southern Urals region. While adding some weight to the "Finno-Ugric" origin of Bashkir, our studies highlighted that the Bashkir genepool lacks the main "core", being a multi-layered amalgamation of Turkic, Ugric, Finnish and Indo-European contributions, which points at intricacy of genetic interface between Turkic and Uralic populations. Comparison of the genetic structure of Siberian ethnicities and the geography of the region they inhabit point at existence of the "Great Siberian Vortex" directing genetic exchanges in populations across the Siberian part of Asia. Slavic speakers

  20. Detection of KatG Gen Mutation on Mycobacterium Tuberculosis by Means of PCR-Dot Blot Hybridization with 32P Labeled Oligonucleotide Probe Methods

    International Nuclear Information System (INIS)

    Maria Lina R; Budiman Bela; Andi Yasmon

    2009-01-01

    Handling and controlling of tuberculosis, a disease caused by Mycobacterium tuberculosis (MTB), is now complicated since there are many MTBs that are resistant against anti-tuberculosis drugs such as isoniazid. The drug resistance could occurred due to the inadequate and un-regular drug utilization that cause gene mutation of the drug target such as katG gene for isoniazid. The molecular biology techniques such as the PCR- dot blot hybridization with radioisotope ( 32 P) labeled oligonucleotide probe, has been reported as a technique that is more sensitive and rapid for detection of gene mutations related with drug resistances. Hence, the aim of this study was to apply the PCR- dot blot hybridization technique using 32 P labeled oligonucleotide probe for detection of single mutation at codon 315 of katG gene of MTBs that rise the isoniazid resistance. In this study, we used 89 sputum specimens and a standard MTB (MTB H 37 RV) as a control. DNA extractions were performed by the BOOM method and the phenol chloroform for sputum samples and standard MTB, respectively. Primers used for PCR technique were Pt8 and Pt9 and RTB59 and RTB36 for detecting tuberculosis causing Mycobacterium and the existence of katG gene, respectively. Both of the primers are specific for IS6110 region and katG gene, respectively. PCR products were detected by an agarose gel electrophoresis technique. Dot blot hybridization with 32 P-oligonucleotide probe 315mu was performed to detect mutation at codon 315 of tested samples. Results of the PCR using primer Pt8 and Pt9 showed that all sputum specimens had positive results. Mutation detection by PCR- dot blot hybridization with 32 P-oligonucleotide probe 315mu, revealed that 11 of 89 tested samples had a mutation at their codon 315 of katG gene. Based upon these results, it is concluded that PCR-dot blot hybridization with 32 P-oligonucleotide probe is a technique that is rapid and highly specific and sensitive for detection of mutation at codon

  1. Note sur la présence de lames aménagées par technique de Kostienki dans les couches gravettiennes du Blot (Cerzat,Haute-Loire).

    OpenAIRE

    Klaric , Laurent

    2000-01-01

    International audience; The unprecedented presence of Kostienki-technique prepared blades (also called Kostienki knives) in the Gravettian layers at Le Blot leads to a new analysis of these artefacts. Thorough technological study has pointed to the possible role of these items as cores, in association with or complementary to burin-forms, in particular context of backed-bladelet production. Le Blot is the second French site yielding such artefacts, the other being Corbiac (Dordogne). The aim ...

  2. Genomic constitution of an H-2:Tla variant leukemia.

    Science.gov (United States)

    Shen, F W; Chaganti, R S; Doucette, L A; Litman, G W; Steinmetz, M; Hood, L; Boyse, E A

    1984-10-01

    A TL+ leukemia of a (B6 X A)F1 hybrid mouse (H-2b/H-2a) was previously subjected to immunoselection against H-2a by passage in (B6 X A.SW)F1 mice (H-2b/H-2s). A variant leukemia line was obtained that serologically lacked not only the H-2a phenotype but also the TL phenotype determined by the linked cis Tlaa allele of strain A. The H-2b phenotype and the TL phenotype of the Tlab allele of the B6 strain, which is expressed only by leukemia cells, were retained by the variant. Southern blotting with an H-2 cDNA probe that identifies restriction fragment polymorphisms distinguishing alleles of the H-2 and Tla regions of the B6 and A strains indicates that both the H-2a and Tlaa alleles are missing from the genome of this H-2a:Tlaa negative variant. Since the variant has two apparently unaltered chromosomes 17, where the H-2:Tla complex is situated, and since the intensity of bands in Southern blotting is suggestive of H-2b homozygosity, it is considered that loss of the H-2a:Tlaa haplotype by the variant was accompanied by duplication of the H-2b:Tlab haplotype. The implied change from heterozygosity to homozygosity that the variant has undergone with respect to H-2:Tla was not paralleled by a similar change at the three other loci tested, since the variant retained heterozygosity for Pep-3 (chromosome 1), Gpi-1 (chromosome 7), and Es-1 (chromosome 8).

  3. Detection of human papilloma virus 16 and 18 DNA sequences by southern blot hybridization in oral leukoplakia and squamous cell carcinoma.

    Science.gov (United States)

    Khanna, Rahul; Rao, G R K; Tiwary, S K; Rai, Ashish; Khanna, Seema; Khanna, A K

    2009-04-01

    The etiopathological role of human papilloma virus (HPV) in the causation of oral cancer is till a subject of speculation. We used the technique of Southern blot hybridization to detect the presence of HPV types 16 & 18 in biopsy specimens from oral cancer and leukoplakia patients as well as normal oral mucosal biopsies. The prevalence of either HPV type 16 or 18 was found in 64.5% (29/45) of oral cancer, 40%(12/30) of leukoplakia and 20%(9/45) of normal oral mucosal biopsies. No association could be demonstrated between tobacco usage habits or a history of genital warts with HPV prevalence. A significant finding was that none of the oral cancer patients were negative for both: a history of tobacco usage as well as presence of HPV infection, on Southern blot hybridization.

  4. Mitochondrial genomes suggest rapid evolution of dwarf California Channel Islands foxes (Urocyon littoralis).

    Science.gov (United States)

    Hofman, Courtney A; Rick, Torben C; Hawkins, Melissa T R; Funk, W Chris; Ralls, Katherine; Boser, Christina L; Collins, Paul W; Coonan, Tim; King, Julie L; Morrison, Scott A; Newsome, Seth D; Sillett, T Scott; Fleischer, Robert C; Maldonado, Jesus E

    2015-01-01

    Island endemics are typically differentiated from their mainland progenitors in behavior, morphology, and genetics, often resulting from long-term evolutionary change. To examine mechanisms for the origins of island endemism, we present a phylogeographic analysis of whole mitochondrial genomes from the endangered island fox (Urocyon littoralis), endemic to California's Channel Islands, and mainland gray foxes (U. cinereoargenteus). Previous genetic studies suggested that foxes first appeared on the islands >16,000 years ago, before human arrival (~13,000 cal BP), while archaeological and paleontological data supported a colonization >7000 cal BP. Our results are consistent with initial fox colonization of the northern islands probably by rafting or human introduction ~9200-7100 years ago, followed quickly by human translocation of foxes from the northern to southern Channel Islands. Mitogenomes indicate that island foxes are monophyletic and most closely related to gray foxes from northern California that likely experienced a Holocene climate-induced range shift. Our data document rapid morphological evolution of island foxes (in ~2000 years or less). Despite evidence for bottlenecks, island foxes have generated and maintained multiple mitochondrial haplotypes. This study highlights the intertwined evolutionary history of island foxes and humans, and illustrates a new approach for investigating the evolutionary histories of other island endemics.

  5. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa zea larval development and pupation.

    Science.gov (United States)

    Jin, Shuangxia; Singh, Nameirakpam D; Li, Lebin; Zhang, Xianlong; Daniell, Henry

    2015-04-01

    In the past two decades, chloroplast genetic engineering has been advanced to achieve high-level protein accumulation but not for down-regulation of targeted genes. Therefore, in this report, lepidopteran chitin synthase (Chi), cytochrome P450 monooxygenase (P450) and V-ATPase dsRNAs were expressed via the chloroplast genome to study RNA interference (RNAi) of target genes in intended hosts. PCR and Southern blot analysis confirmed homoplasmy and site-specific integration of transgene cassettes into the chloroplast genomes. Northern blots and real-time qRT-PCR confirmed abundant processed and unprocessed dsRNA transcripts (up to 3.45 million copies of P450 dsRNAs/μg total RNA); the abundance of cleaved dsRNA was greater than the endogenous psbA transcript. Feeding of leaves expressing P450, Chi and V-ATPase dsRNA decreased transcription of the targeted gene to almost undetectable levels in the insect midgut, likely after further processing of dsRNA in their gut. Consequently, the net weight of larvae, growth and pupation rates were significantly reduced by chloroplast-derived dsRNAs. Taken together, successful expression of dsRNAs via the chloroplast genome for the first time opens the door to study RNA interference/processing within plastids. Most importantly, dsRNA expressed in chloroplasts can be utilized for gene inactivation to confer desired agronomic traits or for various biomedical applications, including down-regulation of dysfunctional genes in cancer or autoimmune disorders, after oral delivery of dsRNA bioencapsulated within plant cells. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Prevalence of α-thalassaemia genotypes in pregnant women in northern Thailand

    Science.gov (United States)

    Pharephan, Somphon; Sirivatanapa, Pannee; Makonkawkeyoon, Sanit; Tuntiwechapikul, Wirote; Makonkawkeyoon, Luksana

    2016-01-01

    Background & objectives: Alpha-thalassaemias are genetic disorders with high prevalence in northern Thailand. However, common genotypes and current data on the prevalence of α-thalassaemias have not been reported in this region. Therefore, the objective of the present study was to determine the prevalence of α-thalassaemia genotypes in pregnant women in northern Thailand. Methods: Genomic DNA was extracted from blood samples of pregnant women who came to Maharaj Nakorn Chiang Mai University Hospital during July 2009 to 2010. The common deletion and point mutation genotypes of α-thalassaemia were evaluated by gap- polymerase chain reaction (PCR) and PCR with restriction fragment length polymorphism (RFLP). Results: Genotypes of 638 pregnant women were: 409 samples (64.11%) being normal subjects (αα/αα) and 229 samples (35.89%) with α-thalassaemias. These 229 samples could be classified into deletional HbH disease (--SEA/-α3.7) for 18 samples (2.82%); heterozygous α0-thalassaemia --SEA type (--SEA/αα)) for 78 (12.23%); heterozygous α+-thalassaemia - α3.7 type (-α3.7/αα) for 99 (15.52%); homozygous α+-thalassaemia - α3.7 type (-α3.7/- α3.7) for five (0.78%); heterozygous α+-thalassaemia - α4.2 type (-α4.2/αα) for two (0.31%); and heterozygous HbCS (αCSα/αα) for 27 (4.23%) cases. Interpretation & conclusions: The prevalence of α-thalassaemias in pregnant women in northern Thailand was high. This finding supports the implementation of the prevention and control of this common genetic disorder by screening for α-thalassaemia genotypes. PMID:27241645

  7. Genome U-Plot: a whole genome visualization.

    Science.gov (United States)

    Gaitatzes, Athanasios; Johnson, Sarah H; Smadbeck, James B; Vasmatzis, George

    2018-05-15

    The ability to produce and analyze whole genome sequencing (WGS) data from samples with structural variations (SV) generated the need to visualize such abnormalities in simplified plots. Conventional two-dimensional representations of WGS data frequently use either circular or linear layouts. There are several diverse advantages regarding both these representations, but their major disadvantage is that they do not use the two-dimensional space very efficiently. We propose a layout, termed the Genome U-Plot, which spreads the chromosomes on a two-dimensional surface and essentially quadruples the spatial resolution. We present the Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities. We compare conventional visualization schemas with the Genome U-Plot using visualization metrics such as number of line crossings and crossing angle resolution measures. Based on our metrics, we improve the readability of the resulting graph by at least 2-fold, making apparent important features and making it easy to identify important genomic changes. A whole genome visualization tool with high spatial resolution and improved aesthetic qualities. An implementation and documentation of the Genome U-Plot is publicly available at https://github.com/gaitat/GenomeUPlot. vasmatzis.george@mayo.edu. Supplementary data are available at Bioinformatics online.

  8. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  9. A Thousand Fly Genomes: An Expanded Drosophila Genome Nexus.

    Science.gov (United States)

    Lack, Justin B; Lange, Jeremy D; Tang, Alison D; Corbett-Detig, Russell B; Pool, John E

    2016-12-01

    The Drosophila Genome Nexus is a population genomic resource that provides D. melanogaster genomes from multiple sources. To facilitate comparisons across data sets, genomes are aligned using a common reference alignment pipeline which involves two rounds of mapping. Regions of residual heterozygosity, identity-by-descent, and recent population admixture are annotated to enable data filtering based on the user's needs. Here, we present a significant expansion of the Drosophila Genome Nexus, which brings the current data object to a total of 1,121 wild-derived genomes. New additions include 305 previously unpublished genomes from inbred lines representing six population samples in Egypt, Ethiopia, France, and South Africa, along with another 193 genomes added from recently-published data sets. We also provide an aligned D. simulans genome to facilitate divergence comparisons. This improved resource will broaden the range of population genomic questions that can addressed from multi-population allele frequencies and haplotypes in this model species. The larger set of genomes will also enhance the discovery of functionally relevant natural variation that exists within and between populations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Visualization for genomics: the Microbial Genome Viewer.

    Science.gov (United States)

    Kerkhoven, Robert; van Enckevort, Frank H J; Boekhorst, Jos; Molenaar, Douwe; Siezen, Roland J

    2004-07-22

    A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a MySQL database. The generated images are in scalable vector graphics (SVG) format, which is suitable for creating high-quality scalable images and dynamic Web representations. Gene-related data such as transcriptome and time-course microarray experiments can be superimposed on the maps for visual inspection. The Microbial Genome Viewer 1.0 is freely available at http://www.cmbi.kun.nl/MGV

  11. Evidence for a Pneumocystis carinii Flo8-like transcription factor: insights into organism adhesion.

    Science.gov (United States)

    Kottom, Theodore J; Limper, Andrew H

    2016-02-01

    Pneumocystis carinii (Pc) adhesion to alveolar epithelial cells is well established and is thought to be a prerequisite for the initiation of Pneumocystis pneumonia. Pc binding events occur in part through the major Pc surface glycoprotein Msg, as well as an integrin-like molecule termed PcInt1. Recent data from the Pc sequencing project also demonstrate DNA sequences homologous to other genes important in Candida spp. binding to mammalian host cells, as well as organism binding to polystyrene surfaces and in biofilm formation. One of these genes, flo8, a transcription factor needed for downstream cAMP/PKA-pathway-mediated activation of the major adhesion/flocculin Flo11 in yeast, was cloned from a Pc cDNA library utilizing a partial sequence available in the Pc genome database. A CHEF blot of Pc genomic DNA yielded a single band providing evidence this gene is present in the organism. BLASTP analysis of the predicted protein demonstrated 41 % homology to the Saccharomyces cerevisiae Flo8. Northern blotting demonstrated greatest expression at pH 6.0-8.0, pH comparable to reported fungal biofilm milieu. Western blot and immunoprecipitation assays of PcFlo8 protein in isolated cyst and tropic life forms confirmed the presence of the cognate protein in these Pc life forms. Heterologous expression of Pcflo8 cDNA in flo8Δ-deficient yeast strains demonstrated that the Pcflo8 was able to restore yeast binding to polystyrene and invasive growth of yeast flo8Δ cells. Furthermore, Pcflo8 promoted yeast binding to HEK293 human epithelial cells, strengthening its functional classification as a Flo8 transcription factor. Taken together, these data suggest that PcFlo8 is expressed by Pc and may exert activity in organism adhesion and biofilm formation.

  12. Chromosome microdissection and cloning in human genome and genetic disease analysis

    International Nuclear Information System (INIS)

    Kao, Faten; Yu, Jingwei

    1991-01-01

    A procedure has been described for microdissection and microcloning of human chromosomal DNA sequences in which universal amplification of the dissected fragments by Mbo I linker adaptor and polymerase chain reaction is used. A very large library comprising 700,000 recombinant plasmid microclones from 30 dissected chromosomes of human chromosome 21 was constructed. Colony hybridization showed that 42% of the clones contained repetitive sequences and 58% contained single or low-copy sequences. The insert sizes generated by complete Mbo I cleavage ranged from 50 to 1,100 base pairs with a mean of 416 base pairs. Southern blot analysis of microclones from the library confirmed their human origin and chromosome 21 specificity. Some of these clones have also been regionally mapped to specific sites of chromosome 21 by using a regional mapping panel of cell hybrids. This chromosome microtechnology can generate large numbers of microclones with unique sequences from defined chromosomal regions and can be used for processes such as (i) isolating corresponding yeast artificial chromosome clones with large inserts, (ii) screening various cDNA libraries for isolating expressed sequences, and (iii) constructing region-specific libraries of the entire human genome. The studies described here demonstrate the power of this technology for high-resolution genome analysis and explicate their use in an efficient search for disease-associated genes localized to specific chromosomal regions

  13. Aberrant immunoglobulin and c-myc gene rearrangements in patients with nonmalignant monoclonal cryoglobulinemia

    International Nuclear Information System (INIS)

    Perl, A.; Wang, N.; Williams, J.M.; Hunt, M.J.; Rosenfeld, S.I.; Condemi, J.J.; Packman, C.H.; Abraham, G.N.

    1987-01-01

    The status of the immunoglobulin (Ig) genes was investigated in patients with idiopathic nonmalignant monoclonal IgG cryoglobulinemia (NCG). In NCG, monoclonal antibodies are synthesized at an accelerated rate by nonmalignant B lymphocytes. In order to determine whether this high production rate is related to a clonal B cell expansion, the rearrangement of the Ig genes was investigated by Southern blot analysis of genomic, 32 P-labelled, DNA extracted from the peripheral blood lymphocytes of four NCG patients. In three of four (VI, BR, and CH) clonal expansion of B cells was detected using probes specific for the genes. BamHI digestion of DNA from VI and BR produced three rearranged fragments which cohybridized with two of the probes. This finding suggested the presence of additional nonsecretory B cell clones and/or disruption of the gene segments spanned by and detected with the probes. In addition, the possibility of aberrant gene rearrangements was supported by noting the alteration of the c-myc gene locus in genomic DNA from peripheral blood leukocytes of VI and CH. Northern blot analysis of RNA isolated from peripheral blood B cells of VI and CH demonstrated aberrant transcripts of the c-myc gene, showing an active role of the altered c-myc locus. Detection of c-myc rearrangement in NCG patients clearly shows that this event may not be a final step in malignant B cell transformation

  14. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  15. Trophic ecology of largemouth bass and northern pike in allopatric and sympatric assemblages in northern boreal lakes

    Science.gov (United States)

    Soupir, Craig A.; Brown, Michael L.; Kallemeyn, Larry W.

    2000-01-01

    Largemouth bass (Micropterus salmoides) and northern pike (Esox lucius) are top predators in the food chain in most aquatic environments that they occupy; however, limited information exists on species interactions in the northern reaches of largemouth bass distribution. We investigated the seasonal food habits of allopatric and sympatric assemblages of largemouth bass and northern pike in six interior lakes within Voyageurs National Park, Minnesota. Percentages of empty stomachs were variable for largemouth bass (38-54%) and northern pike (34.7-66.7%). Fishes (mainly yellow perch, Perca flavescens) comprised greater than 60% (mean percent mass, MPM) of the northern pike diet during all seasons in both allopatric and sympatric assemblages. Aquatic insects (primarily Odonata and Hemiptera) were important in the diets of largemouth bass in all communities (0.0-79.7 MPM). Although largemouth bass were observed in the diet of northern pike, largemouth bass apparently did not prey on northern pike. Seasonal differences were observed in the proportion of aquatic insects (P = 0.010) and fishes (P = 0.023) in the diets of northern pike and largemouth bass. Based on three food categories, jackknifed classifications correctly classified 77 and 92% of northern pike and largemouth bass values, respectively. Percent resource overlap values were biologically significant (greater than 60%) during at least one season in each sympatric assemblage, suggesting some diet overlap.

  16. GenColors-based comparative genome databases for small eukaryotic genomes.

    Science.gov (United States)

    Felder, Marius; Romualdi, Alessandro; Petzold, Andreas; Platzer, Matthias; Sühnel, Jürgen; Glöckner, Gernot

    2013-01-01

    Many sequence data repositories can give a quick and easily accessible overview on genomes and their annotations. Less widespread is the possibility to compare related genomes with each other in a common database environment. We have previously described the GenColors database system (http://gencolors.fli-leibniz.de) and its applications to a number of bacterial genomes such as Borrelia, Legionella, Leptospira and Treponema. This system has an emphasis on genome comparison. It combines data from related genomes and provides the user with an extensive set of visualization and analysis tools. Eukaryote genomes are normally larger than prokaryote genomes and thus pose additional challenges for such a system. We have, therefore, adapted GenColors to also handle larger datasets of small eukaryotic genomes and to display eukaryotic gene structures. Further recent developments include whole genome views, genome list options and, for bacterial genome browsers, the display of horizontal gene transfer predictions. Two new GenColors-based databases for two fungal species (http://fgb.fli-leibniz.de) and for four social amoebas (http://sacgb.fli-leibniz.de) were set up. Both new resources open up a single entry point for related genomes for the amoebozoa and fungal research communities and other interested users. Comparative genomics approaches are greatly facilitated by these resources.

  17. Implementing genomics and pharmacogenomics in the clinic: The National Human Genome Research Institute's genomic medicine portfolio.

    Science.gov (United States)

    Manolio, Teri A

    2016-10-01

    Increasing knowledge about the influence of genetic variation on human health and growing availability of reliable, cost-effective genetic testing have spurred the implementation of genomic medicine in the clinic. As defined by the National Human Genome Research Institute (NHGRI), genomic medicine uses an individual's genetic information in his or her clinical care, and has begun to be applied effectively in areas such as cancer genomics, pharmacogenomics, and rare and undiagnosed diseases. In 2011 NHGRI published its strategic vision for the future of genomic research, including an ambitious research agenda to facilitate and promote the implementation of genomic medicine. To realize this agenda, NHGRI is consulting and facilitating collaborations with the external research community through a series of "Genomic Medicine Meetings," under the guidance and leadership of the National Advisory Council on Human Genome Research. These meetings have identified and begun to address significant obstacles to implementation, such as lack of evidence of efficacy, limited availability of genomics expertise and testing, lack of standards, and difficulties in integrating genomic results into electronic medical records. The six research and dissemination initiatives comprising NHGRI's genomic research portfolio are designed to speed the evaluation and incorporation, where appropriate, of genomic technologies and findings into routine clinical care. Actual adoption of successful approaches in clinical care will depend upon the willingness, interest, and energy of professional societies, practitioners, patients, and payers to promote their responsible use and share their experiences in doing so. Published by Elsevier Ireland Ltd.

  18. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.

    Science.gov (United States)

    Machado, Henrique; Gram, Lone

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.

  19. Rodent malaria parasites : genome organization & comparative genomics

    NARCIS (Netherlands)

    Kooij, Taco W.A.

    2006-01-01

    The aim of the studies described in this thesis was to investigate the genome organization of rodent malaria parasites (RMPs) and compare the organization and gene content of the genomes of RMPs and the human malaria parasite P. falciparum. The release of the complete genome sequence of P.

  20. A new HCV genotype 6 subtype designated 6v was confirmed with three complete genome sequences.

    Science.gov (United States)

    Wang, Yizhong; Xia, Xueshan; Li, Chunhua; Maneekarn, Niwat; Xia, Wenjie; Zhao, Wenhua; Feng, Yue; Kung, Hsiang Fu; Fu, Yongshui; Lu, Ling

    2009-03-01

    Although hepatitis C virus (HCV) genotype 6 is classified into 21 subtypes, 6a-6u, new variants continue to be identified. To characterize the full-length genomes of three novel HCV genotype 6 variants: KMN02, KM046 and KM181. From sera of patients with HCV infection, the entire HCV genome was amplified by RT-PCR followed by direct DNA sequencing and phylogenetic analysis. The sera contained HCV genomes of 9461, 9429, and 9461nt in length, and each harboured a single ORF of 9051nt. The genomes showed 95.3-98.1% nucleotide similarity to each other and 72.2-75.4% similarity to 23 genotype 6 reference sequences, which represent subtypes 6a-6u and unassigned variants km41 and gz52557. Phylogenetic analyses demonstrated that they were genotype 6, but were subtypically distinct. Based on the current criteria of HCV classification, they were designed to represent a new subtype, 6v. Analysis of E1 and NS5B region partial sequences revealed two additional related variants, CMBD-14 and CMBD-86 that had been previously reported in northern Thailand and sequences dropped into Genbank. Three novel HCV genotype 6 variants were entirely sequenced and designated subtype 6v.

  1. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    Science.gov (United States)

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  2. The population genomics of archaeological transition in west Iberia: Investigation of ancient substructure using imputation and haplotype-based methods.

    Directory of Open Access Journals (Sweden)

    Rui Martiniano

    2017-07-01

    Full Text Available We analyse new genomic data (0.05-2.95x from 14 ancient individuals from Portugal distributed from the Middle Neolithic (4200-3500 BC to the Middle Bronze Age (1740-1430 BC and impute genomewide diploid genotypes in these together with published ancient Eurasians. While discontinuity is evident in the transition to agriculture across the region, sensitive haplotype-based analyses suggest a significant degree of local hunter-gatherer contribution to later Iberian Neolithic populations. A more subtle genetic influx is also apparent in the Bronze Age, detectable from analyses including haplotype sharing with both ancient and modern genomes, D-statistics and Y-chromosome lineages. However, the limited nature of this introgression contrasts with the major Steppe migration turnovers within third Millennium northern Europe and echoes the survival of non-Indo-European language in Iberia. Changes in genomic estimates of individual height across Europe are also associated with these major cultural transitions, and ancestral components continue to correlate with modern differences in stature.

  3. TSE strain differentiation in mice by immunohistochemical PrP(Sc) profiles and triplex Western blot.

    Science.gov (United States)

    van Keulen, Lucien J M; Langeveld, Jan P M; Dolstra, Corry H; Jacobs, Jorg; Bossers, Alex; van Zijderveld, Fred G

    2015-10-01

    TSE strains are routinely identified by their incubation period and vacuolation profile in the brain after intracerebral inoculation and serial passaging in inbred mouse lines. There are some major drawbacks to this method that are related to the variation in vacuolation that exists in the brains of mice infected with the same TSE strain and to variation between observers and laboratories in scoring vacuolation and determining the final incubation period. We investigated the potential of PrP(Sc) immunohistochemistry and triplex Western blotting as possible alternative methods to differentiate between TSE strains. TSE reference strains ME7, 87A/87V, 22A/22C, 79A/79V and 301C/301V were intracerebrally inoculated in RIII or VM inbred mice that differ in their PrP genotype. Immunohistochemical PrP(Sc) profiles were drawn up by scanning light microscopy both on coronal and sagittal sections. On the basis of the localization of PrP(Sc) in the cerebral cortex, hippocampus, and cerebellar cortex and the overall type of PrP(Sc) staining, all TSE strains could be well differentiated from each other through their typical strain dependent characteristics. In addition, Western blot showed that the combination of glycosylation profile and 12B2 epitope content of PrP(Sc) allowed to distinguish between all reference strains except for ME7 and 22A in VM mice. TSE strains in mice can be identified on the basis of their PrP(Sc) profile alone. The potential to identify TSE strains in ruminants with these PrP(Sc) profiles after a single primary passage in mice will be the topic of future studies. © 2014 British Neuropathological Society.

  4. RIP-seq of BmAgo2-associated small RNAs reveal various types of small non-coding RNAs in the silkworm, Bombyx mori

    Science.gov (United States)

    2013-01-01

    Background Small non-coding RNAs (ncRNAs) are important regulators of gene expression in eukaryotes. Previously, only microRNAs (miRNAs) and piRNAs have been identified in the silkworm, Bombyx mori. Furthermore, only ncRNAs (50-500nt) of intermediate size have been systematically identified in the silkworm. Results Here, we performed a systematic identification and analysis of small RNAs (18-50nt) associated with the Bombyx mori argonaute2 (BmAgo2) protein. Using RIP-seq, we identified various types of small ncRNAs associated with BmAGO2. These ncRNAs showed a multimodal length distribution, with three peaks at ~20nt, ~27nt and ~33nt, which included tRNA-, transposable element (TE)-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. The tRNA-derived fragments (tRFs) were found at an extremely high abundance and accounted for 69.90% of the BmAgo2-associated small RNAs. Northern blotting confirmed that many tRFs were expressed or up-regulated only in the BmNPV-infected cells, implying that the tRFs play a prominent role by binding to BmAgo2 during BmNPV infection. Additional evidence suggested that there are potential cleavage sites on the D, anti-codon and TψC loops of the tRNAs. TE-derived small RNAs and piRNAs also accounted for a significant proportion of the BmAgo2-associated small RNAs, suggesting that BmAgo2 could be involved in the maintenance of genome stability by suppressing the activities of transposons guided by these small RNAs. Finally, Northern blotting was also used to confirm the Bombyx 5.8 s rRNA-derived small RNAs, demonstrating that various novel small RNAs exist in the silkworm. Conclusions Using an RIP-seq method in combination with Northern blotting, we identified various types of small RNAs associated with the BmAgo2 protein, including tRNA-, TE-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. Our findings provide new clues for future functional studies of the role of small RNAs in insect

  5. RPAN: rice pan-genome browser for ∼3000 rice genomes.

    Science.gov (United States)

    Sun, Chen; Hu, Zhiqiang; Zheng, Tianqing; Lu, Kuangchen; Zhao, Yue; Wang, Wensheng; Shi, Jianxin; Wang, Chunchao; Lu, Jinyuan; Zhang, Dabing; Li, Zhikang; Wei, Chaochun

    2017-01-25

    A pan-genome is the union of the gene sets of all the individuals of a clade or a species and it provides a new dimension of genome complexity with the presence/absence variations (PAVs) of genes among these genomes. With the progress of sequencing technologies, pan-genome study is becoming affordable for eukaryotes with large-sized genomes. The Asian cultivated rice, Oryza sativa L., is one of the major food sources for the world and a model organism in plant biology. Recently, the 3000 Rice Genome Project (3K RGP) sequenced more than 3000 rice genomes with a mean sequencing depth of 14.3×, which provided a tremendous resource for rice research. In this paper, we present a genome browser, Rice Pan-genome Browser (RPAN), as a tool to search and visualize the rice pan-genome derived from 3K RGP. RPAN contains a database of the basic information of 3010 rice accessions, including genomic sequences, gene annotations, PAV information and gene expression data of the rice pan-genome. At least 12 000 novel genes absent in the reference genome were included. RPAN also provides multiple search and visualization functions. RPAN can be a rich resource for rice biology and rice breeding. It is available at http://cgm.sjtu.edu.cn/3kricedb/ or http://www.rmbreeding.cn/pan3k. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Identification of genomic sites for CRISPR/Cas9-based genome editing in the Vitis vinifera genome

    Science.gov (United States)

    CRISPR/Cas9 has been recently demonstrated as an effective and popular genome editing tool for modifying genomes of human, animals, microorganisms, and plants. Success of such genome editing is highly dependent on the availability of suitable target sites in the genomes to be edited. Many specific t...

  7. Simultaneous and independent detection of C9ORF72 alleles with low and high number of GGGGCC repeats using an optimised protocol of Southern blot hybridisation.

    Science.gov (United States)

    Buchman, Vladimir L; Cooper-Knock, Johnathan; Connor-Robson, Natalie; Higginbottom, Adrian; Kirby, Janine; Razinskaya, Olga D; Ninkina, Natalia; Shaw, Pamela J

    2013-04-08

    Sizing of GGGGCC hexanucleotide repeat expansions within the C9ORF72 locus, which account for approximately 10% of all amyotrophic lateral sclerosis (ALS) cases, is urgently required to answer fundamental questions about mechanisms of pathogenesis in this important genetic variant. Currently employed PCR protocols are limited to discrimination between the presence and absence of a modified allele with more than 30 copies of the repeat, while Southern hybridisation-based methods are confounded by the somatic heterogeneity commonly present in blood samples, which might cause false-negative or ambiguous results. We describe an optimised Southern hybridisation-based protocol that allows confident detection of the presence of a C9ORF72 repeat expansion alongside independent assessment of its heterogeneity and the number of repeat units. The protocol can be used with either a radiolabeled or non-radiolabeled probe. Using this method we have successfully sized the C9ORF72 repeat expansion in lymphoblastoid cells, peripheral blood, and post-mortem central nervous system (CNS) tissue from ALS patients. It was also possible to confidently demonstrate the presence of repeat expansion, although of different magnitude, in both C9ORF72 alleles of the genome of one patient. The suggested protocol has sufficient advantages to warrant adoption as a standard for Southern blot hybridisation analysis of GGGGCC repeat expansions in the C9ORF72 locus.

  8. Genomics Portals: integrative web-platform for mining genomics data.

    Science.gov (United States)

    Shinde, Kaustubh; Phatak, Mukta; Johannes, Freudenberg M; Chen, Jing; Li, Qian; Vineet, Joshi K; Hu, Zhen; Ghosh, Krishnendu; Meller, Jaroslaw; Medvedovic, Mario

    2010-01-13

    A large amount of experimental data generated by modern high-throughput technologies is available through various public repositories. Our knowledge about molecular interaction networks, functional biological pathways and transcriptional regulatory modules is rapidly expanding, and is being organized in lists of functionally related genes. Jointly, these two sources of information hold a tremendous potential for gaining new insights into functioning of living systems. Genomics Portals platform integrates access to an extensive knowledge base and a large database of human, mouse, and rat genomics data with basic analytical visualization tools. It provides the context for analyzing and interpreting new experimental data and the tool for effective mining of a large number of publicly available genomics datasets stored in the back-end databases. The uniqueness of this platform lies in the volume and the diversity of genomics data that can be accessed and analyzed (gene expression, ChIP-chip, ChIP-seq, epigenomics, computationally predicted binding sites, etc), and the integration with an extensive knowledge base that can be used in such analysis. The integrated access to primary genomics data, functional knowledge and analytical tools makes Genomics Portals platform a unique tool for interpreting results of new genomics experiments and for mining the vast amount of data stored in the Genomics Portals backend databases. Genomics Portals can be accessed and used freely at http://GenomicsPortals.org.

  9. i-Genome: A database to summarize oligonucleotide data in genomes

    Directory of Open Access Journals (Sweden)

    Chang Yu-Chung

    2004-10-01

    Full Text Available Abstract Background Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. Results The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. Conclusions This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.

  10. The Perennial Ryegrass GenomeZipper: Targeted Use of Genome Resources for Comparative Grass Genomics1[C][W

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F.X.; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-01-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species. PMID:23184232

  11. Implementing genomics and pharmacogenomics in the clinic: The National Human Genome Research Institute’s genomic medicine portfolio

    Science.gov (United States)

    Manolio, Teri A.

    2016-01-01

    Increasing knowledge about the influence of genetic variation on human health and growing availability of reliable, cost-effective genetic testing have spurred the implementation of genomic medicine in the clinic. As defined by the National Human Genome Research Institute (NHGRI), genomic medicine uses an individual’s genetic information in his or her clinical care, and has begun to be applied effectively in areas such as cancer genomics, pharmacogenomics, and rare and undiagnosed diseases. In 2011 NHGRI published its strategic vision for the future of genomic research, including an ambitious research agenda to facilitate and promote the implementation of genomic medicine. To realize this agenda, NHGRI is consulting and facilitating collaborations with the external research community through a series of “Genomic Medicine Meetings,” under the guidance and leadership of the National Advisory Council on Human Genome Research. These meetings have identified and begun to address significant obstacles to implementation, such as lack of evidence of efficacy, limited availability of genomics expertise and testing, lack of standards, and diffficulties in integrating genomic results into electronic medical records. The six research and dissemination initiatives comprising NHGRI’s genomic research portfolio are designed to speed the evaluation and incorporation, where appropriate, of genomic technologies and findings into routine clinical care. Actual adoption of successful approaches in clinical care will depend upon the willingness, interest, and energy of professional societies, practitioners, patients, and payers to promote their responsible use and share their experiences in doing so. PMID:27612677

  12. Comparing Mycobacterium tuberculosis genomes using genome topology networks.

    Science.gov (United States)

    Jiang, Jianping; Gu, Jianlei; Zhang, Liang; Zhang, Chenyi; Deng, Xiao; Dou, Tonghai; Zhao, Guoping; Zhou, Yan

    2015-02-14

    Over the last decade, emerging research methods, such as comparative genomic analysis and phylogenetic study, have yielded new insights into genotypes and phenotypes of closely related bacterial strains. Several findings have revealed that genomic structural variations (SVs), including gene gain/loss, gene duplication and genome rearrangement, can lead to different phenotypes among strains, and an investigation of genes affected by SVs may extend our knowledge of the relationships between SVs and phenotypes in microbes, especially in pathogenic bacteria. In this work, we introduce a 'Genome Topology Network' (GTN) method based on gene homology and gene locations to analyze genomic SVs and perform phylogenetic analysis. Furthermore, the concept of 'unfixed ortholog' has been proposed, whose members are affected by SVs in genome topology among close species. To improve the precision of 'unfixed ortholog' recognition, a strategy to detect annotation differences and complete gene annotation was applied. To assess the GTN method, a set of thirteen complete M. tuberculosis genomes was analyzed as a case study. GTNs with two different gene homology-assigning methods were built, the Clusters of Orthologous Groups (COG) method and the orthoMCL clustering method, and two phylogenetic trees were constructed accordingly, which may provide additional insights into whole genome-based phylogenetic analysis. We obtained 24 unfixable COG groups, of which most members were related to immunogenicity and drug resistance, such as PPE-repeat proteins (COG5651) and transcriptional regulator TetR gene family members (COG1309). The GTN method has been implemented in PERL and released on our website. The tool can be downloaded from http://homepage.fudan.edu.cn/zhouyan/gtn/ , and allows re-annotating the 'lost' genes among closely related genomes, analyzing genes affected by SVs, and performing phylogenetic analysis. With this tool, many immunogenic-related and drug resistance-related genes

  13. A universal genomic coordinate translator for comparative genomics.

    Science.gov (United States)

    Zamani, Neda; Sundström, Görel; Meadows, Jennifer R S; Höppner, Marc P; Dainat, Jacques; Lantz, Henrik; Haas, Brian J; Grabherr, Manfred G

    2014-06-30

    Genomic duplications constitute major events in the evolution of species, allowing paralogous copies of genes to take on fine-tuned biological roles. Unambiguously identifying the orthology relationship between copies across multiple genomes can be resolved by synteny, i.e. the conserved order of genomic sequences. However, a comprehensive analysis of duplication events and their contributions to evolution would require all-to-all genome alignments, which increases at N2 with the number of available genomes, N. Here, we introduce Kraken, software that omits the all-to-all requirement by recursively traversing a graph of pairwise alignments and dynamically re-computing orthology. Kraken scales linearly with the number of targeted genomes, N, which allows for including large numbers of genomes in analyses. We first evaluated the method on the set of 12 Drosophila genomes, finding that orthologous correspondence computed indirectly through a graph of multiple synteny maps comes at minimal cost in terms of sensitivity, but reduces overall computational runtime by an order of magnitude. We then used the method on three well-annotated mammalian genomes, human, mouse, and rat, and show that up to 93% of protein coding transcripts have unambiguous pairwise orthologous relationships across the genomes. On a nucleotide level, 70 to 83% of exons match exactly at both splice junctions, and up to 97% on at least one junction. We last applied Kraken to an RNA-sequencing dataset from multiple vertebrates and diverse tissues, where we confirmed that brain-specific gene family members, i.e. one-to-many or many-to-many homologs, are more highly correlated across species than single-copy (i.e. one-to-one homologous) genes. Not limited to protein coding genes, Kraken also identifies thousands of newly identified transcribed loci, likely non-coding RNAs that are consistently transcribed in human, chimpanzee and gorilla, and maintain significant correlation of expression levels across

  14. Northern Ireland gas industry

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, R S [Belfast City Council Gas Dept.; Asquith, R S; Brown, J M; McKay, G

    1977-07-01

    Throughout Northern Ireland the production of town gas is derived from hydrocarbon feedstocks. In the larger undertakings in Northern Ireland the feedstock is light distillate; a light petroleum feedstock which is a crude gasoline comprised mainly of pentanes, reformed in catalytic plants. The remaining gas undertakings produce a liquefied petroleum gas (LPG)/air mixture using a mixture of either butane or propane and air. The individual gas units and the type of reforming feedstock are shown. A review of the oil-dependence of town gas and electricity production in Northern Ireland has been considered and is mainly responsible for the high fuel prices experienced in the community. A detailed description of the reforming process has been described, and considerable efforts have been made to optimize the process. In spite of substantial economic savings being made on the processing unit, the gas industry is very susceptible to the changes in oil prices which have escalated rapidly in recent years. The difference in gas prices between the United Kingdom and Northern Ireland indicates that North Sea gas would offer major economic benefits to the gas industry in Northern Ireland, which is operating at a substantial loss at the moment. The industrial concerns, which are dependent on gas and therefore paying high fuel costs, suffer in competition with outside companies. The injection of a moderately cheap natural gas supply to the community may encourage industrial expansion and provide work in a high unemployment area. Although substantial costs must be incurred in distribution pipelines and burner conversions if Northern Ireland changes to natural gas, there appears to be a strong case to introduce North Sea gas in the near future.

  15. Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2 in human oral cancer cell line.

    Directory of Open Access Journals (Sweden)

    Daisuke Yamamoto

    2010-09-01

    Full Text Available Methylation of CpG islands of genome DNA and lysine residues of histone H3 and H4 tails regulates gene transcription. Inhibition of polyamine synthesis by ornithine decarboxylase antizyme-1 (OAZ in human oral cancer cell line resulted in accumulation of decarboxylated S-adenosylmethionine (dcSAM, which acts as a competitive inhibitor of methylation reactions. We anticipated that accumulation of dcSAM impaired methylation reactions and resulted in hypomethylation of genome DNA and histone tails.Global methylation state of genome DNA and lysine residues of histone H3 and H4 tails were assayed by Methylation by Isoschizomers (MIAMI method and western blotting, respectively, in the presence or absence of OAZ expression. Ectopic expression of OAZ mediated hypomethylation of CpG islands of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2. Protein level of DNA methyltransferase 3B (DNMT3B and histone H3K9me specific methyltransferase G9a were down-regulated in OAZ transfectant.OAZ induced hypomethylation of CpG islands of global genome DNA and H3K9me2 by down-regulating DNMT3B and G9a protein level. Hypomethylation of CpG islands of genome DNA and histone H3K9me2 is a potent mechanism of induction of the genes related to tumor suppression and DNA double strand break repair.

  16. Prediction of the optimum hybridization conditions of dot-blot-SNP analysis using estimated melting temperature of oligonucleotide probes.

    Science.gov (United States)

    Shiokai, Sachiko; Kitashiba, Hiroyasu; Nishio, Takeshi

    2010-08-01

    Although the dot-blot-SNP technique is a simple cost-saving technique suitable for genotyping of many plant individuals, optimization of hybridization and washing conditions for each SNP marker requires much time and labor. For prediction of the optimum hybridization conditions for each probe, we compared T (m) values estimated from nucleotide sequences using the DINAMelt web server, measured T (m) values, and hybridization conditions yielding allele-specific signals. The estimated T (m) values were comparable to the measured T (m) values with small differences of less than 3 degrees C for most of the probes. There were differences of approximately 14 degrees C between the specific signal detection conditions and estimated T (m) values. Change of one level of SSC concentrations of 0.1, 0.2, 0.5, and 1.0x SSC corresponded to a difference of approximately 5 degrees C in optimum signal detection temperature. Increasing the sensitivity of signal detection by shortening the exposure time to X-ray film changed the optimum hybridization condition for specific signal detection. Addition of competitive oligonucleotides to the hybridization mixture increased the suitable hybridization conditions by 1.8. Based on these results, optimum hybridization conditions for newly produced dot-blot-SNP markers will become predictable.

  17. Radiological monitoring of northern slopes of Mogoltau

    International Nuclear Information System (INIS)

    Murtazaev, Kh.; Boboev, B.D.; Bolibekov, Sh.; Akhmedov, M.Z.

    2010-01-01

    Present article is devoted to radiological monitoring of northern slopes of Mogoltau. The physicochemical properties of water of northern slopes of Mogoltau were studied. The radiation monitoring of northern slopes of Mogoltau was carried out during several years under various weather conditions. The exposure rate of human settlements of northern part of Mogoltau was defined.

  18. Genomics Portals: integrative web-platform for mining genomics data

    Directory of Open Access Journals (Sweden)

    Ghosh Krishnendu

    2010-01-01

    Full Text Available Abstract Background A large amount of experimental data generated by modern high-throughput technologies is available through various public repositories. Our knowledge about molecular interaction networks, functional biological pathways and transcriptional regulatory modules is rapidly expanding, and is being organized in lists of functionally related genes. Jointly, these two sources of information hold a tremendous potential for gaining new insights into functioning of living systems. Results Genomics Portals platform integrates access to an extensive knowledge base and a large database of human, mouse, and rat genomics data with basic analytical visualization tools. It provides the context for analyzing and interpreting new experimental data and the tool for effective mining of a large number of publicly available genomics datasets stored in the back-end databases. The uniqueness of this platform lies in the volume and the diversity of genomics data that can be accessed and analyzed (gene expression, ChIP-chip, ChIP-seq, epigenomics, computationally predicted binding sites, etc, and the integration with an extensive knowledge base that can be used in such analysis. Conclusion The integrated access to primary genomics data, functional knowledge and analytical tools makes Genomics Portals platform a unique tool for interpreting results of new genomics experiments and for mining the vast amount of data stored in the Genomics Portals backend databases. Genomics Portals can be accessed and used freely at http://GenomicsPortals.org.

  19. Citrus psorosis virus RNA 1 is of negative polarity and potentially encodes in its complementary strand a 24K protein of unknown function and 280K putative RNA dependent RNA polymerase.

    Science.gov (United States)

    Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura

    2003-10-01

    Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.

  20. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  1. An efficient protocol for the Agrobacterium-mediated genetic transformation of microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    Pratheesh, P T; Vineetha, M; Kurup, G Muraleedhara

    2014-06-01

    Algal-based recombinant protein production has gained immense interest in recent years. The development of algal expression system was earlier hindered due to the lack of efficient and cost-effective transformation techniques capable of heterologous gene integration and expression. The recent development of Agrobacterium-mediated genetic transformation method is expected to be the ideal solution for these problems. We have developed an efficient protocol for the Agrobacterium-mediated genetic transformation of microalga Chlamydomonas reinhardtii. Pre-treatment of Agrobacterium in TAP induction medium (pH 5.2) containing 100 μM acetosyringone and 1 mM glycine betaine and infection of Chlamydomonas with the induced Agrobacterium greatly improved transformation frequency. This protocol was found to double the number of transgenic events on selection media compared to that of previous reports. PCR was used successfully to amplify fragments of the hpt and GUS genes from transformed cells, while Southern blot confirmed the integration of GUS gene into the genome of C. reinhardtii. RT-PCR, Northern blot and GUS histochemical analyses confirm GUS gene expression in the transgenic cell lines of Chlamydomonas. This protocol provides a quick, efficient, economical and high-frequency transformation method for microalgae.

  2. Characterization of ribonuclease III from Brucella.

    Science.gov (United States)

    Wu, Chang-Xian; Xu, Xian-Jin; Zheng, Ke; Liu, Fang; Yang, Xu-Dong; Chen, Chuang-Fu; Chen, Huan-Chun; Liu, Zheng-Fei

    2016-04-01

    Bacterial ribonuclease III (RNase III) is a highly conserved endonuclease, which plays pivotal roles in RNA maturation and decay pathways by cleaving double-stranded structure of RNAs. Here we cloned rncS gene from the genomic DNA of Brucella melitensis, and analyzed the cleavage properties of RNase III from Brucella. We identified Brucella-encoding small RNA (sRNA) by high-throughput sequencing and northern blot, and found that sRNA of Brucella and Homo miRNA precursor (pre-miRNA) can be bound and cleaved by B.melitensis ribonuclease III (Bm-RNase III). Cleavage activity of Bm-RNase III is bivalent metal cations- and alkaline buffer-dependent. We constructed several point mutations in Bm-RNase III, whose cleavage activity indicated that the 133th Glutamic acid residue was required for catalytic activity. Western blot revealed that Bm-RNase III was differently expressed in Brucella virulence strain 027 and vaccine strain M5-90. Collectively, our data suggest that Brucella RNase III can efficiently bind and cleave stem-loop structure of small RNA, and might participate in regulation of virulence in Brucella. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Identification and expression analyses of two genes encoding putative low-affinity nitrate transporters from Nicotiana plumbaginifolia.

    Science.gov (United States)

    Fraisier, V; Dorbe, M F; Daniel-Vedele, F

    2001-01-01

    Higher plants have both high- and low-affinity nitrate uptake systems (HATS and LATS respectively). Here we report the isolation and characterization of two genes, NpNRT1.1 and NpNRT1.2, from Nicotiana plumbaginifolia whose structural features suggest that they both belong to the NRT1 gene family, which is involved in the LATS. Amino acid sequence alignment showed that the N. plumbaginifolia proteins have greater similarity to their corresponding tomato homologues than to each other. Genomic Southern blot analysis indicates that there are probably more than two members of this family in N. plumbaginifolia. Northern blot analysis shows that NpNRT1.2 expression is restricted strictly to roots, whereas NpNRT1.1, in addition to roots, is expressed at a basal level in all other plant organs. Likewise, differential expression in response to external treatments with various N sources was observed for these two genes: NpNRT1.1 can be considered as a constitutively expressed gene whereas NpNRT1.2 expression is dependent strictly on high nitrate concentrations. Finally, over-expression of a gene involved in the HATS does not lead to any modification of LATS gene expression.

  4. Profiling EGFR activity in head and neck squamous cell carcinoma by using a novel layered membrane Western blot technology.

    Science.gov (United States)

    Patel, Vyomesh; Ramesh, Arun; Traicoff, June L; Baibakov, Galina; Emmert-Buck, Michael R; Gutkind, J Silvio; Knezevic, Vladimir

    2005-05-01

    Given the role of epidermal growth factor receptor (EGFR) in head and neck squamous cell carcinomas (HNSCC), several rational approaches have now been utilized to abrogate tyrosine kinase activity and its disengagement from downstream signal transducers. Monitoring the activity of these molecules could potentially be useful to determine not only drug efficacy but also to identify HNSCC patients most likely to benefit from this type of therapy. In this study we have used a novel high throughput multi-layered Western blotting (MLWestern) method that allows the detection of multiple proteins from a single experiment in order to characterize key components in the EGFR signaling pathway in HNSCC cells. Total and activated forms of EGFR and the downstream effectors, Erk and Akt were readily detected in HNSCC cells, where in the control cells (HaCaT) these proteins could only be detected in EGF stimulated cells. Results from conventional Western blot and MLWestern were comparable. Clustering analysis of protein expression revealed similarities in cellular response between some of the cell lines indicative of similarities in their biological response. The data indicate that MLWestern can be potentially applied to identify molecular targets that could be used for rational therapeutic intervention strategies.

  5. 2b-RAD genotyping for population genomic studies of Chagas disease vectors: Rhodnius ecuadoriensis in Ecuador.

    Directory of Open Access Journals (Sweden)

    Luis E Hernandez-Castro

    2017-07-01

    Full Text Available Rhodnius ecuadoriensis is the main triatomine vector of Chagas disease, American trypanosomiasis, in Southern Ecuador and Northern Peru. Genomic approaches and next generation sequencing technologies have become powerful tools for investigating population diversity and structure which is a key consideration for vector control. Here we assess the effectiveness of three different 2b restriction site-associated DNA (2b-RAD genotyping strategies in R. ecuadoriensis to provide sufficient genomic resolution to tease apart microevolutionary processes and undertake some pilot population genomic analyses.The 2b-RAD protocol was carried out in-house at a non-specialized laboratory using 20 R. ecuadoriensis adults collected from the central coast and southern Andean region of Ecuador, from June 2006 to July 2013. 2b-RAD sequencing data was performed on an Illumina MiSeq instrument and analyzed with the STACKS de novo pipeline for loci assembly and Single Nucleotide Polymorphism (SNP discovery. Preliminary population genomic analyses (global AMOVA and Bayesian clustering were implemented. Our results showed that the 2b-RAD genotyping protocol is effective for R. ecuadoriensis and likely for other triatomine species. However, only BcgI and CspCI restriction enzymes provided a number of markers suitable for population genomic analysis at the read depth we generated. Our preliminary genomic analyses detected a signal of genetic structuring across the study area.Our findings suggest that 2b-RAD genotyping is both a cost effective and methodologically simple approach for generating high resolution genomic data for Chagas disease vectors with the power to distinguish between different vector populations at epidemiologically relevant scales. As such, 2b-RAD represents a powerful tool in the hands of medical entomologists with limited access to specialized molecular biological equipment.

  6. 2b-RAD genotyping for population genomic studies of Chagas disease vectors: Rhodnius ecuadoriensis in Ecuador.

    Science.gov (United States)

    Hernandez-Castro, Luis E; Paterno, Marta; Villacís, Anita G; Andersson, Björn; Costales, Jaime A; De Noia, Michele; Ocaña-Mayorga, Sofía; Yumiseva, Cesar A; Grijalva, Mario J; Llewellyn, Martin S

    2017-07-01

    Rhodnius ecuadoriensis is the main triatomine vector of Chagas disease, American trypanosomiasis, in Southern Ecuador and Northern Peru. Genomic approaches and next generation sequencing technologies have become powerful tools for investigating population diversity and structure which is a key consideration for vector control. Here we assess the effectiveness of three different 2b restriction site-associated DNA (2b-RAD) genotyping strategies in R. ecuadoriensis to provide sufficient genomic resolution to tease apart microevolutionary processes and undertake some pilot population genomic analyses. The 2b-RAD protocol was carried out in-house at a non-specialized laboratory using 20 R. ecuadoriensis adults collected from the central coast and southern Andean region of Ecuador, from June 2006 to July 2013. 2b-RAD sequencing data was performed on an Illumina MiSeq instrument and analyzed with the STACKS de novo pipeline for loci assembly and Single Nucleotide Polymorphism (SNP) discovery. Preliminary population genomic analyses (global AMOVA and Bayesian clustering) were implemented. Our results showed that the 2b-RAD genotyping protocol is effective for R. ecuadoriensis and likely for other triatomine species. However, only BcgI and CspCI restriction enzymes provided a number of markers suitable for population genomic analysis at the read depth we generated. Our preliminary genomic analyses detected a signal of genetic structuring across the study area. Our findings suggest that 2b-RAD genotyping is both a cost effective and methodologically simple approach for generating high resolution genomic data for Chagas disease vectors with the power to distinguish between different vector populations at epidemiologically relevant scales. As such, 2b-RAD represents a powerful tool in the hands of medical entomologists with limited access to specialized molecular biological equipment.

  7. Genomic selection: genome-wide prediction in plant improvement.

    Science.gov (United States)

    Desta, Zeratsion Abera; Ortiz, Rodomiro

    2014-09-01

    Association analysis is used to measure relations between markers and quantitative trait loci (QTL). Their estimation ignores genes with small effects that trigger underpinning quantitative traits. By contrast, genome-wide selection estimates marker effects across the whole genome on the target population based on a prediction model developed in the training population (TP). Whole-genome prediction models estimate all marker effects in all loci and capture small QTL effects. Here, we review several genomic selection (GS) models with respect to both the prediction accuracy and genetic gain from selection. Phenotypic selection or marker-assisted breeding protocols can be replaced by selection, based on whole-genome predictions in which phenotyping updates the model to build up the prediction accuracy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. OryzaGenome: Genome Diversity Database of Wild Oryza Species

    KAUST Repository

    Ohyanagi, Hajime

    2015-11-18

    The species in the genus Oryza, encompassing nine genome types and 23 species, are a rich genetic resource and may have applications in deeper genomic analyses aiming to understand the evolution of plant genomes. With the advancement of next-generation sequencing (NGS) technology, a flood of Oryza species reference genomes and genomic variation information has become available in recent years. This genomic information, combined with the comprehensive phenotypic information that we are accumulating in our Oryzabase, can serve as an excellent genotype-phenotype association resource for analyzing rice functional and structural evolution, and the associated diversity of the Oryza genus. Here we integrate our previous and future phenotypic/habitat information and newly determined genotype information into a united repository, named OryzaGenome, providing the variant information with hyperlinks to Oryzabase. The current version of OryzaGenome includes genotype information of 446 O. rufipogon accessions derived by imputation and of 17 accessions derived by imputation-free deep sequencing. Two variant viewers are implemented: SNP Viewer as a conventional genome browser interface and Variant Table as a textbased browser for precise inspection of each variant one by one. Portable VCF (variant call format) file or tabdelimited file download is also available. Following these SNP (single nucleotide polymorphism) data, reference pseudomolecules/ scaffolds/contigs and genome-wide variation information for almost all of the closely and distantly related wild Oryza species from the NIG Wild Rice Collection will be available in future releases. All of the resources can be accessed through http://viewer.shigen.info/oryzagenome/.

  9. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  10. The combination of quantitative PCR and western blot detecting CP4-EPSPS component in Roundup Ready soy plant tissues and commercial soy-related foodstuffs.

    Science.gov (United States)

    Xiao, Xiao; Wu, Honghong; Zhou, Xinghu; Xu, Sheng; He, Jian; Shen, Wenbiao; Zhou, Guanghong; Huang, Ming

    2012-06-01

    With the widespread use of Roundup Ready soy (event 40-3-2) (RRS), the comprehensive detection of genetically modified component in foodstuffs is of significant interest, but few protein-based approaches have been found useful in processed foods. In this report, the combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different RRS plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing both meat and plant protein concentrates. The validity of the 2 methods was confirmed first. We also showed that the CP4-EPSPS protein existed in different RRS plant tissues. In certain cases, the results from the western blot and the qPCR were not consistent. To be specific, at least 2 degraded fragments of CP4-EPSPS protein (35.5 and 24.6 kDa) were observed. For dried bean curd crust and deep-fried bean curd, a degraded protein fragment with the size of 24.6 kDa appeared, while cp4-epsps gene could not be traced by qPCR. In contrast, we found a signal of cp4-epsps DNA in 3 foodstuffs, including soy-containing ham cutlet product, meat ball, and sausage by qPCR, while CP4-EPSPS protein could not be detected by western blot in such samples. Our study therefore concluded that the combination of DNA- and protein-based methods would compensate each other, thus resulting in a more comprehensive detection from nucleic acid and protein levels. The combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different Roundup Ready soy (event 40-3-2) plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing a combination of both meat and plant protein concentrates. This study indicated that the combination of DNA- and protein-based methods

  11. Adaptability of black walnut, black cherry, and Northern red oak to Northern California

    Science.gov (United States)

    Philip M. McDonald

    1987-01-01

    When planted in sheltered sites in northern California, only 49% of black walnut (Juglans nigra L.) and 58% of black cherry (Prunus serotina Ehrh.) survived for 15 years, and 20% of northern red oak (Quercus rubra L.) survived for 10 years. The black walnut trees averaged 0.6 inches diameter at breast...

  12. From the Northern Eurasia Earth Science Partnership Initiative to the Northern Eurasia Future Initiative

    Science.gov (United States)

    Streletskiy, D. A.; Groisman, P. Y.; Shugart, H. H., Jr.; Gulev, S.; Maksyutov, S. S.; Qi, J.

    2017-12-01

    Since 2004, the Northern Eurasia Earth Science Partnership Initiative (NEESPI) - an interdisciplinary program of internationally-supported Earth systems and science research - has addressed large-scale and long-term manifestations of climate and environmental changes over Northern Eurasia and their impact on the Global Earth system. With 40 books and more than 1500 peer-reviewed journal publications to its credit, NEESPI's output can now be used to directly support decision-making for societal needs. Specifically, it was decided to shift gradually the foci of regional studies in Northern Eurasia towards applications with the following major Science Question: "What dynamic and interactive change(s) will affect societal well-being, activities, and health, and what might be the mitigation and adaptation strategies that could support sustainable development and decision-making activities in Northern Eurasia?" To answer this question requires a stronger socio-economic component in the ongoing and future regional studies focused on sustainable societal development under changing climatic and environmental conditions. The NEESPI Research Team has reorganized itself into "Northern Eurasia Future Initiative" (NEFI) and developed a new Science Plan released in June 2016. The Plan underwent a 6-month-long public review and was finalized at the end of 2016. Its description was thereafter split between two review papers: Groisman et al. (2017) and Monier et al. (2017). The first paper describes the Plan rationale and a new set of topical questions. The second paper describes a major modeling approach that will be employed in addressing the "what to do" questions of the NEFI Research (cf., presentation by Monier et al. at this Session). In the current presentation, we outline the new NEFI research foci and present latest NEFI findings including international projects in the Eurasian Arctic, boreal zone, and the Dry Land Belt of Northern Eurasia (cf., also presentations at sister

  13. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  14. Grass genomes

    OpenAIRE

    Bennetzen, Jeffrey L.; SanMiguel, Phillip; Chen, Mingsheng; Tikhonov, Alexander; Francki, Michael; Avramova, Zoya

    1998-01-01

    For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that in...

  15. Genomic organization of the rat alpha 2u-globulin gene cluster.

    Science.gov (United States)

    McFadyen, D A; Addison, W; Locke, J

    1999-05-01

    The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.

  16. Contribution of dot-blot assay to the diagnosis and management of myositis: a three-year practice at a university hospital centre.

    Science.gov (United States)

    Martel, Clothilde; Vignaud, Guillaume; Liozon, Eric; Magy, Laurent; Gallouedec, Gael; Ly, Kim; Bezanahary, Holly; Cypierre, Anne; Lapébie, François-Xavier; Palat, Sylvain; Gondran, Guillaume; Jauberteau, Marie-Odile; Fauchais, Anne-Laure

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) are heterogeneous autoimmune diseases with wide clinical spectrum that may lead to delayed diagnosis. The aim of this study was to examine the impact of IIM-specific dot-blot assay on diagnostic process of patients presenting with muscular or systemic symptoms evocating of IIM. We collected all the prescriptions of an IIM specific dot-blot assay (8 autoantigens including Jo-1, PL-7, PL-12, SRP, Mi-2, Ku, PM/Scl and Scl-70) over a 38-month period. 316 myositis dot-blot assays (MSD) were performed in 274 patients (156 women, mean age 53±10.6 years) referring for muscular and/or systemic symptoms suggesting IIM. The timing of dot prescription through the diagnostic process was highly variable: without (35%), concomitantly (16%) or after electromyographic studies (35%). Fifty-nine patients (22%) had IIM according to Bohan and Peter's criteria. Among them, 29 (49%) had positive dot (8 Jo-1, 6 PM-Scl, 5 PL-12, 5 SRP, 2 Mi-2, 2 PL-7 and 1 Ku). Various other diagnoses were performed including 35 autoimmune disease or granulomatosis (12%), 19 inflammatory rheumatic disease (7%), 16 non inflammatory muscular disorders (6%), 10 drug-induced myalgia (4%), 11 infectious myositis (4%). Except 11 borderline SRP results and one transient PM-Scl, MSD was positive only in one case of IIM. Dot allowed clinicians to correct diagnosis in 4 cases and improved the diagnosis of IIM subtypes in 4 cases. This study reflects the interest of myositis dot in the rapid diagnosis process of patients with non-specific muscular symptoms leading to various diagnoses including IIM.

  17. The genomic ancestry, landscape genetics and invasion history of introduced mice in New Zealand.

    Science.gov (United States)

    Veale, Andrew J; Russell, James C; King, Carolyn M

    2018-01-01

    The house mouse ( Mus musculus ) provides a fascinating system for studying both the genomic basis of reproductive isolation, and the patterns of human-mediated dispersal. New Zealand has a complex history of mouse invasions, and the living descendants of these invaders have genetic ancestry from all three subspecies, although most are primarily descended from M. m. domesticus . We used the GigaMUGA genotyping array (approximately 135 000 loci) to describe the genomic ancestry of 161 mice, sampled from 34 locations from across New Zealand (and one Australian city-Sydney). Of these, two populations, one in the south of the South Island, and one on Chatham Island, showed complete mitochondrial lineage capture, featuring two different lineages of M. m. castaneus mitochondrial DNA but with only M. m. domesticus nuclear ancestry detectable. Mice in the northern and southern parts of the North Island had small traces (approx. 2-3%) of M. m. castaneus nuclear ancestry, and mice in the upper South Island had approximately 7-8% M. m. musculus nuclear ancestry including some Y-chromosomal ancestry-though no detectable M. m. musculus mitochondrial ancestry. This is the most thorough genomic study of introduced populations of house mice yet conducted, and will have relevance to studies of the isolation mechanisms separating subspecies of mice.

  18. Goodbye genome paper, hello genome report: the increasing popularity of 'genome announcements' and their impact on science.

    Science.gov (United States)

    Smith, David Roy

    2017-05-01

    Next-generation sequencing technologies have revolutionized genomics and altered the scientific publication landscape. Life-science journals abound with genome papers-peer-reviewed descriptions of newly sequenced chromosomes. Although they once filled the pages of Nature and Science, genome papers are now mostly relegated to journals with low-impact factors. Some have forecast the death of the genome paper and argued that they are using up valuable resources and not advancing science. However, the publication rate of genome papers is on the rise. This increase is largely because some journals have created a new category of manuscript called genome reports, which are short, fast-tracked papers describing a chromosome sequence(s), its GenBank accession number and little else. In 2015, for example, more than 2000 genome reports were published, and 2016 is poised to bring even more. Here, I highlight the growing popularity of genome reports and discuss their merits, drawbacks and impact on science and the academic publication infrastructure. Genome reports can be excellent assets for the research community, but they are also being used as quick and easy routes to a publication, and in some instances they are not peer reviewed. One of the best arguments for genome reports is that they are a citable, user-generated genomic resource providing essential methodological and biological information, which may not be present in the sequence database. But they are expensive and time-consuming avenues for achieving such a goal. © The Author 2016. Published by Oxford University Press.

  19. Tibrogargan and Coastal Plains rhabdoviruses: genomic characterization, evolution of novel genes and seroprevalence in Australian livestock.

    Science.gov (United States)

    Gubala, Aneta; Davis, Steven; Weir, Richard; Melville, Lorna; Cowled, Chris; Boyle, David

    2011-09-01

    Tibrogargan virus (TIBV) and Coastal Plains virus (CPV) were isolated from cattle in Australia and TIBV has also been isolated from the biting midge Culicoides brevitarsis. Complete genomic sequencing revealed that the viruses share a novel genome structure within the family Rhabdoviridae, each virus containing two additional putative genes between the matrix protein (M) and glycoprotein (G) genes and one between the G and viral RNA polymerase (L) genes. The predicted novel protein products are highly diverged at the sequence level but demonstrate clear conservation of secondary structure elements, suggesting conservation of biological functions. Phylogenetic analyses showed that TIBV and CPV form an independent group within the 'dimarhabdovirus supergroup'. Although no disease has been observed in association with these viruses, antibodies were detected at high prevalence in cattle and buffalo in northern Australia, indicating the need for disease monitoring and further study of this distinctive group of viruses.

  20. The mitochondrial genome of Elodia flavipalpis Aldrich (Diptera: Tachinidae and the evolutionary timescale of Tachinid flies.

    Directory of Open Access Journals (Sweden)

    Zhe Zhao

    Full Text Available Tachinid flies are natural enemies of many lepidopteran and coleopteran pests of forests, crops, and fruit trees. In order to address the lack of genetic data in this economically important group, we sequenced the complete mitochondrial genome of the Palaearctic tachinid fly Elodia flavipalpis Aldrich, 1933. Usually found in Northern China and Japan, this species is one of the primary natural enemies of the leaf-roller moths (Tortricidae, which are major pests of various fruit trees. The 14,932-bp mitochondrial genome was typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes. However, its control region is only 105 bp in length, which is the shortest found so far in flies. In order to estimate dipteran evolutionary relationships, we conducted a phylogenetic analysis of 58 mitochondrial genomes from 23 families. Maximum-likelihood and Bayesian methods supported the monophyly of both Tachinidae and superfamily Oestroidea. Within the subsection Calyptratae, Muscidae was inferred as the sister group to Oestroidea. Within Oestroidea, Calliphoridae and Sarcophagidae formed a sister clade to Oestridae and Tachinidae. Using a Bayesian relaxed clock calibrated with fossil data, we estimated that Tachinidae originated in the middle Eocene.

  1. Salinity- and population-dependent genome regulatory response during osmotic acclimation in the killifish (Fundulus heteroclitus) gill.

    Science.gov (United States)

    Whitehead, Andrew; Roach, Jennifer L; Zhang, Shujun; Galvez, Fernando

    2012-04-15

    The killifish Fundulus heteroclitus is abundant in osmotically dynamic estuaries and it can quickly adjust to extremes in environmental salinity. We performed a comparative osmotic challenge experiment to track the transcriptomic and physiological responses to two salinities throughout a time course of acclimation, and to explore the genome regulatory mechanisms that enable extreme osmotic acclimation. One southern and one northern coastal population, known to differ in their tolerance to hypo-osmotic exposure, were used as our comparative model. Both populations could maintain osmotic homeostasis when transferred from 32 to 0.4 p.p.t., but diverged in their compensatory abilities when challenged down to 0.1 p.p.t., in parallel with divergent transformation of gill morphology. Genes involved in cell volume regulation, nucleosome maintenance, ion transport, energetics, mitochondrion function, transcriptional regulation and apoptosis showed population- and salinity-dependent patterns of expression during acclimation. Network analysis confirmed the role of cytokine and kinase signaling pathways in coordinating the genome regulatory response to osmotic challenge, and also posited the importance of signaling coordinated through the transcription factor HNF-4α. These genome responses support hypotheses of which regulatory mechanisms are particularly relevant for enabling extreme physiological flexibility.

  2. Characterization of Nora Virus Structural Proteins via Western Blot Analysis.

    Science.gov (United States)

    Ericson, Brad L; Carlson, Darby J; Carlson, Kimberly A

    2016-01-01

    Nora virus is a single stranded RNA picorna-like virus with four open reading frames (ORFs). The coding potentials of the ORFs are not fully characterized, but ORF3 and ORF4 are believed to encode the capsid proteins (VP3, VP4a, VP4b, and VP4c) comprising the virion. To determine the polypeptide composition of Nora virus virions, polypeptides from purified virus were compared to polypeptides detected in Nora virus infected Drosophila melanogaster. Nora virus was purified from infected flies and used to challenge mice for the production of antisera. ORF3, ORF4a, ORF4b, and ORF4c were individually cloned and expressed in E. coli; resultant recombinant proteins purified and were used to make monospecific antisera. Antisera were evaluated via Western blot against whole virus particles and Nora virus infected fly lysates. Viral purification yielded two particle types with densities of ~1.31 g/mL (empty particles) and ~1.33 g/mL (complete virions). Comparison of purified virus polypeptide composition to Nora virus infected D. melanogaster lysate showed the number of proteins in infected cell lysates is less than purified virus. Our results suggest the virion is composed of 6 polypeptides, VP3, VP4a, two forms of VP4b, and two forms of VP4c. This polypeptide composition is similar to other small RNA insect viruses.

  3. Rosette Assay: Highly Customizable Dot-Blot for SH2 Domain Screening.

    Science.gov (United States)

    Ng, Khong Y; Machida, Kazuya

    2017-01-01

    With a growing number of high-throughput studies, structural analyses, and availability of protein-protein interaction databases, it is now possible to apply web-based prediction tools to SH2 domain-interactions. However, in silico prediction is not always reliable and requires experimental validation. Rosette assay is a dot blot-based reverse-phase assay developed for the assessment of binding between SH2 domains and their ligands. It is conveniently customizable, allowing for low- to high-throughput analysis of interactions between various numbers of SH2 domains and their ligands, e.g., short peptides, purified proteins, and cell lysates. The binding assay is performed in a 96-well plate (MBA or MWA apparatus) in which a sample spotted membrane is incubated with up to 96 labeled SH2 domains. Bound domains are detected and quantified using a chemiluminescence or near-infrared fluorescence (IR) imaging system. In this chapter, we describe a practical protocol for rosette assay to assess interactions between synthesized tyrosine phosphorylated peptides and a library of GST-tagged SH2 domains. Since the methodology is not confined to assessment of SH2-pTyr interactions, rosette assay can be broadly utilized for ligand and drug screening using different protein interaction domains or antibodies.

  4. Genome update: the 1000th genome - a cautionary tale

    DEFF Research Database (Denmark)

    Lagesen, Karin; Ussery, David; Wassenaar, Gertrude Maria

    2010-01-01

    conclusions for example about the largest bacterial genome sequenced. Biological diversity is far greater than many have thought. For example, analysis of multiple Escherichia coli genomes has led to an estimate of around 45 000 gene families more genes than are recognized in the human genome. Moreover......There are now more than 1000 sequenced prokaryotic genomes deposited in public databases and available for analysis. Currently, although the sequence databases GenBank, DNA Database of Japan and EMBL are synchronized continually, there are slight differences in content at the genomes level...... for a variety of logistical reasons, including differences in format and loading errors, such as those caused by file transfer protocol interruptions. This means that the 1000th genome will be different in the various databases. Some of the data on the highly accessed web pages are inaccurate, leading to false...

  5. Pre-genomic, genomic and post-genomic study of microbial communities involved in bioenergy.

    Science.gov (United States)

    Rittmann, Bruce E; Krajmalnik-Brown, Rosa; Halden, Rolf U

    2008-08-01

    Microorganisms can produce renewable energy in large quantities and without damaging the environment or disrupting food supply. The microbial communities must be robust and self-stabilizing, and their essential syntrophies must be managed. Pre-genomic, genomic and post-genomic tools can provide crucial information about the structure and function of these microbial communities. Applying these tools will help accelerate the rate at which microbial bioenergy processes move from intriguing science to real-world practice.

  6. Delineation of pulmonary airway fluid protein fractions with HRPO binding-avidity by far-Western ligand blot and mass spectrometry analyses: a model methodology for detecting mannose-binding protein expression profiles.

    Science.gov (United States)

    Coyne, Cody P; Rashmir-Raven, Ann; Jones, Toni; Mochal, Cathleen; Linford, Robert L; Brashier, Michael; Eddy, Alison

    2009-01-01

    Limited research to date has characterized the potential for HRPO to function as a primary molecular probe. Pulmonary airway fluid was developed by non-reducing far-Western (ligand) blot analyses utilizing conjugated HRPO-strepavidin or non-conjugated HRPO without the presence of primary immunoglobulin. Endogenous esterase-like biochemical activity of fractions within pulmonary airway fluid was inactivated to determine if they were capable of biochemically converting HRPO chemiluminescent substrate. Complementary analyses modified pulmonary fluid and HRPO with beta-galactosidase and alpha-mannosidase respectively, in addition to determining the influence of mannose and maltose competitive binding on HRPO far-Western (ligand) blot analyses. Identification of pulmonary fluid fractions detected by HRPO far-Western blot analyses was determined by mass spectrometry. Modification of pulmonary fluid with beta-galactosidase, and HRPO with alpha-mannosidase in concert with maltose and mannose competitive binding analyses altered the intensity and spectrum of pulmonary fluid fractions detected by HRPO far-Western blot analysis. Identity of pulmonary airway fluid fractions detected by HRPO far-Western (ligand) blot analysis were transferrin, dynein, albumin precursor, and two 156 kDa equine peptide fragments. HRPO can function as a partially-selective primary molecular probe when applied in either a conjugated or non-conjugated form. Some protein fractions can form complexes with HRPO through molecular mechanisms that involve physical interactions at the terminal alpha-mannose-rich regions of HRPO glycan side-chains. Based on its known molecular composition and structure, HRPO provides an opportunity for the development of diagnostics methodologies relevant to disease biomarkers that possess mannose-binding avidity.

  7. Comparison of Multispot EIA with Western blot for confirmatory serodiagnosis of HIV.

    Science.gov (United States)

    Torian, Lucia V; Forgione, Lisa A; Punsalang, Amado E; Pirillo, Robert E; Oleszko, William R

    2011-12-01

    Recent improvements in the sensitivity of immunoassays (IA) used for HIV screening, coupled with increasing recognition of the importance of rapid point-of-care testing, have led to proposals to adjust the algorithm for serodiagnosis of HIV so that screening and confirmation can be performed using a dual or triple IA sequence that does not require Western blotting for confirmation. One IA that has been proposed as a second or confirmatory test is the Bio-Rad Multispot(®) Rapid HIV-1/HIV-2 Test. This test would have the added advantage of differentiating between HIV-1 and HIV-2 antibodies. To compare the sensitivity and type-specificity of an algorithm combining a 3rd generation enzyme immunoassay (EIA) followed by a confirmatory Multispot with the conventional algorithm that combines a 3rd generation EIA (Bio-Rad GS HIV-1/HIV-2 Plus O EIA) followed by confirmatory Western blot (Bio-Rad GS HIV-1 WB). 8760 serum specimens submitted for HIV testing to the New York City Public Health Laboratory between May 22, 2007, and April 30, 2010, tested repeatedly positive on 3rd generation HIV-1-2+O EIA screening and received parallel confirmatory testing by WB and Multispot (MS). 8678/8760 (99.1%) specimens tested WB-positive; 82 (0.9%) tested WB-negative or indeterminate (IND). 8690/8760 specimens (99.2%) tested MS-positive, of which 14 (17.1%) had been classified as negative or IND by WB. Among the HIV-1 WB-positive specimens, MS classified 26 (0.29%) as HIV-2. Among the HIV-1 WB negative and IND, MS detected 12 HIV-2. MS detected an additional 14 HIV-1 infections among WB negative or IND specimens, differentiated 26 HIV-1 WB positives as HIV-2, and detected 12 additional HIV-2 infections among WB negative/IND. A dual 3rd generation EIA algorithm incorporating MS had equivalent HIV-1 sensitivity to the 3rd generation EIA-WB algorithm and had the added advantage of detecting 12 HIV-2 specimens that were not HIV-1 WB cross-reactors. In this series an algorithm using EIA

  8. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  9. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    Science.gov (United States)

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  10. Genome Surfing As Driver of Microbial Genomic Diversity.

    Science.gov (United States)

    Choudoir, Mallory J; Panke-Buisse, Kevin; Andam, Cheryl P; Buckley, Daniel H

    2017-08-01

    Historical changes in population size, such as those caused by demographic range expansions, can produce nonadaptive changes in genomic diversity through mechanisms such as gene surfing. We propose that demographic range expansion of a microbial population capable of horizontal gene exchange can result in genome surfing, a mechanism that can cause widespread increase in the pan-genome frequency of genes acquired by horizontal gene exchange. We explain that patterns of genetic diversity within Streptomyces are consistent with genome surfing, and we describe several predictions for testing this hypothesis both in Streptomyces and in other microorganisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Characterization and Complete Genome Sequences of Three N4-Like Roseobacter Phages Isolated from the South China Sea.

    Science.gov (United States)

    Li, Baolian; Zhang, Si; Long, Lijuan; Huang, Sijun

    2016-09-01

    Three bacteriophages (RD-1410W1-01, RD-1410Ws-07, and DS-1410Ws-06) were isolated from the surface water of Sanya Bay, northern South China Sea, on two marine bacteria type strains of the Roseobacter lineage. These phages have an isometric head and a short tail, morphologically belonging to the Podoviridae family. Two of these phages can infect four of seven marine roseobacter strains tested and the other one can infect three of them, showing relatively broader host ranges compared to known N4-like roseophages. One-step growth curves showed that these phages have similar short latent periods (1-2 h) but highly variable burst sizes (27-341 pfu cell(-1)). Their complete genomes show high level of similarities to known N4-like roseophages in terms of genome size, G + C content, gene content, and arrangement. The morphological and genomic features of these phages indicate that they belong to the N4likevirus genus. Moreover, comparative genomic analysis based on 43 N4-like phages (10 roseobacter phages and 33 phages infecting other lineages of bacteria) revealed a core genome of 18 genes shared by all the 43 phages and 38 genes shared by all the ten roseophages. The 38 core genes of N4-like roseophages nearly make up 70 % of each genome in length. Phylogenetic analysis based on the concatenated core gene products showed that our phage isolates represent two new phyletic branches, suggesting the broad genetic diversity of marine N4-like roseophages remains.

  12. Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-03-12

    The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scale genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.

  13. Comparative Genome Analysis and Genome Evolution

    NARCIS (Netherlands)

    Snel, Berend

    2002-01-01

    This thesis described a collection of bioinformatic analyses on complete genome sequence data. We have studied the evolution of gene content and find that vertical inheritance dominates over horizontal gene trasnfer, even to the extent that we can use the gene content to make genome phylogenies.

  14. Genome projects and the functional-genomic era.

    Science.gov (United States)

    Sauer, Sascha; Konthur, Zoltán; Lehrach, Hans

    2005-12-01

    The problems we face today in public health as a result of the -- fortunately -- increasing age of people and the requirements of developing countries create an urgent need for new and innovative approaches in medicine and in agronomics. Genomic and functional genomic approaches have a great potential to at least partially solve these problems in the future. Important progress has been made by procedures to decode genomic information of humans, but also of other key organisms. The basic comprehension of genomic information (and its transfer) should now give us the possibility to pursue the next important step in life science eventually leading to a basic understanding of biological information flow; the elucidation of the function of all genes and correlative products encoded in the genome, as well as the discovery of their interactions in a molecular context and the response to environmental factors. As a result of the sequencing projects, we are now able to ask important questions about sequence variation and can start to comprehensively study the function of expressed genes on different levels such as RNA, protein or the cell in a systematic context including underlying networks. In this article we review and comment on current trends in large-scale systematic biological research. A particular emphasis is put on technology developments that can provide means to accomplish the tasks of future lines of functional genomics.

  15. GAAP: Genome-organization-framework-Assisted Assembly Pipeline for prokaryotic genomes.

    Science.gov (United States)

    Yuan, Lina; Yu, Yang; Zhu, Yanmin; Li, Yulai; Li, Changqing; Li, Rujiao; Ma, Qin; Siu, Gilman Kit-Hang; Yu, Jun; Jiang, Taijiao; Xiao, Jingfa; Kang, Yu

    2017-01-25

    Next-generation sequencing (NGS) technologies have greatly promoted the genomic study of prokaryotes. However, highly fragmented assemblies due to short reads from NGS are still a limiting factor in gaining insights into the genome biology. Reference-assisted tools are promising in genome assembly, but tend to result in false assembly when the assigned reference has extensive rearrangements. Herein, we present GAAP, a genome assembly pipeline for scaffolding based on core-gene-defined Genome Organizational Framework (cGOF) described in our previous study. Instead of assigning references, we use the multiple-reference-derived cGOFs as indexes to assist in order and orientation of the scaffolds and build a skeleton structure, and then use read pairs to extend scaffolds, called local scaffolding, and distinguish between true and chimeric adjacencies in the scaffolds. In our performance tests using both empirical and simulated data of 15 genomes in six species with diverse genome size, complexity, and all three categories of cGOFs, GAAP outcompetes or achieves comparable results when compared to three other reference-assisted programs, AlignGraph, Ragout and MeDuSa. GAAP uses both cGOF and pair-end reads to create assemblies in genomic scale, and performs better than the currently available reference-assisted assembly tools as it recovers more assemblies and makes fewer false locations, especially for species with extensive rearranged genomes. Our method is a promising solution for reconstruction of genome sequence from short reads of NGS.

  16. Characterization of A-11, a newly discovered X-chromosomal gene that is under both single-active-X control and tissue-specific control

    International Nuclear Information System (INIS)

    Nadon, N.L.

    1987-01-01

    The A-11 transcript is present in fibroblasts, but is not normally expressed in B- or T-lymphoblastoid cells. The regulation of the A-11 loci on both the active and inactive X chromosomes is very easily perturbed. The A-11 locus on the fibroblast-derived inactive X in a hybrid cell is reactivated at a very high rate by 5-azacytidine, an inhibitor of DNA methylation, while the A-11 locus on the active X in B-lymphoblastoid cells is derepressed at a very high rate after gamma irradiation. The A-11 gene codes for a mature transcript of about 1.9 kb. The A-11 cDNA clone is incomplete, and contains 753 bases from the 3' end of the gene. A genomic clone that contains about 17 kb of human DNA and hybridizes to the A-11 cDNA was isolated. This clone contains at least the last exon of the A-11 gene, as determined by Northern blotting, nuclease protection experiments, and DNA sequencing. When the genomic clone is transferred into mouse cells. A-11 transcripts of both normal and abnormal sizes are produced, indicating that it is possible that the genomic clone contains the entire locus. However, at this time, the 5' end of the gene has not been located

  17. The Perennial Ryegrass GenomeZipper – Targeted Use of Genome Resources for Comparative Grass Genomics

    DEFF Research Database (Denmark)

    Pfeiffer, Matthias; Martis, Mihaela; Asp, Torben

    2013-01-01

    (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold......Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass...... to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous...

  18. Population Genomics of Infectious and Integrated Wolbachia pipientis Genomes in Drosophila ananassae

    Science.gov (United States)

    Choi, Jae Young; Bubnell, Jaclyn E.; Aquadro, Charles F.

    2015-01-01

    Coevolution between Drosophila and its endosymbiont Wolbachia pipientis has many intriguing aspects. For example, Drosophila ananassae hosts two forms of W. pipientis genomes: One being the infectious bacterial genome and the other integrated into the host nuclear genome. Here, we characterize the infectious and integrated genomes of W. pipientis infecting D. ananassae (wAna), by genome sequencing 15 strains of D. ananassae that have either the infectious or integrated wAna genomes. Results indicate evolutionarily stable maternal transmission for the infectious wAna genome suggesting a relatively long-term coevolution with its host. In contrast, the integrated wAna genome showed pseudogene-like characteristics accumulating many variants that are predicted to have deleterious effects if present in an infectious bacterial genome. Phylogenomic analysis of sequence variation together with genotyping by polymerase chain reaction of large structural variations indicated several wAna variants among the eight infectious wAna genomes. In contrast, only a single wAna variant was found among the seven integrated wAna genomes examined in lines from Africa, south Asia, and south Pacific islands suggesting that the integration occurred once from a single infectious wAna genome and then spread geographically. Further analysis revealed that for all D. ananassae we examined with the integrated wAna genomes, the majority of the integrated wAna genomic regions is represented in at least two copies suggesting a double integration or single integration followed by an integrated genome duplication. The possible evolutionary mechanism underlying the widespread geographical presence of the duplicate integration of the wAna genome is an intriguing question remaining to be answered. PMID:26254486

  19. Dramatic improvement in genome assembly achieved using doubled-haploid genomes.

    Science.gov (United States)

    Zhang, Hong; Tan, Engkong; Suzuki, Yutaka; Hirose, Yusuke; Kinoshita, Shigeharu; Okano, Hideyuki; Kudoh, Jun; Shimizu, Atsushi; Saito, Kazuyoshi; Watabe, Shugo; Asakawa, Shuichi

    2014-10-27

    Improvement in de novo assembly of large genomes is still to be desired. Here, we improved draft genome sequence quality by employing doubled-haploid individuals. We sequenced wildtype and doubled-haploid Takifugu rubripes genomes, under the same conditions, using the Illumina platform and assembled contigs with SOAPdenovo2. We observed 5.4-fold and 2.6-fold improvement in the sizes of the N50 contig and scaffold of doubled-haploid individuals, respectively, compared to the wildtype, indicating that the use of a doubled-haploid genome aids in accurate genome analysis.

  20. Cancer genomics

    DEFF Research Database (Denmark)

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  1. Genomic resources and draft assemblies of the human and porcine varieties of scabies mites, Sarcoptes scabiei var. hominis and var. suis.

    Science.gov (United States)

    Mofiz, Ehtesham; Holt, Deborah C; Seemann, Torsten; Currie, Bart J; Fischer, Katja; Papenfuss, Anthony T

    2016-06-02

    The scabies mite, Sarcoptes scabiei, is a parasitic arachnid and cause of the infectious skin disease scabies in humans and mange in other animal species. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where secondary group A streptococcal and Staphylococcus aureus infections of scabies sores are thought to drive the high rate of rheumatic heart disease and chronic kidney disease. We sequenced the genome of two samples of Sarcoptes scabiei var. hominis obtained from unrelated patients with crusted scabies located in different parts of northern Australia using the Illumina HiSeq. We also sequenced samples of Sarcoptes scabiei var. suis from a pig model. Because of the small size of the scabies mite, these data are derived from pools of thousands of mites and are metagenomic, including host and microbiome DNA. We performed cleaning and de novo assembly and present Sarcoptes scabiei var. hominis and var. suis draft reference genomes. We have constructed a preliminary annotation of this reference comprising 13,226 putative coding sequences based on sequence similarity to known proteins. We have developed extensive genomic resources for the scabies mite, including reference genomes and a preliminary annotation.

  2. Personal genomics services: whose genomes?

    Science.gov (United States)

    Gurwitz, David; Bregman-Eschet, Yael

    2009-07-01

    New companies offering personal whole-genome information services over the internet are dynamic and highly visible players in the personal genomics field. For fees currently ranging from US$399 to US$2500 and a vial of saliva, individuals can now purchase online access to their individual genetic information regarding susceptibility to a range of chronic diseases and phenotypic traits based on a genome-wide SNP scan. Most of the companies offering such services are based in the United States, but their clients may come from nearly anywhere in the world. Although the scientific validity, clinical utility and potential future implications of such services are being hotly debated, several ethical and regulatory questions related to direct-to-consumer (DTC) marketing strategies of genetic tests have not yet received sufficient attention. For example, how can we minimize the risk of unauthorized third parties from submitting other people's DNA for testing? Another pressing question concerns the ownership of (genotypic and phenotypic) information, as well as the unclear legal status of customers regarding their own personal information. Current legislation in the US and Europe falls short of providing clear answers to these questions. Until the regulation of personal genomics services catches up with the technology, we call upon commercial providers to self-regulate and coordinate their activities to minimize potential risks to individual privacy. We also point out some specific steps, along the trustee model, that providers of DTC personal genomics services as well as regulators and policy makers could consider for addressing some of the concerns raised below.

  3. Insights into structural variations and genome rearrangements in prokaryotic genomes.

    Science.gov (United States)

    Periwal, Vinita; Scaria, Vinod

    2015-01-01

    Structural variations (SVs) are genomic rearrangements that affect fairly large fragments of DNA. Most of the SVs such as inversions, deletions and translocations have been largely studied in context of genetic diseases in eukaryotes. However, recent studies demonstrate that genome rearrangements can also have profound impact on prokaryotic genomes, leading to altered cell phenotype. In contrast to single-nucleotide variations, SVs provide a much deeper insight into organization of bacterial genomes at a much better resolution. SVs can confer change in gene copy number, creation of new genes, altered gene expression and many other functional consequences. High-throughput technologies have now made it possible to explore SVs at a much refined resolution in bacterial genomes. Through this review, we aim to highlight the importance of the less explored field of SVs in prokaryotic genomes and their impact. We also discuss its potential applicability in the emerging fields of synthetic biology and genome engineering where targeted SVs could serve to create sophisticated and accurate genome editing. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Northern Eurasia Future Initiative (NEFI)

    DEFF Research Database (Denmark)

    Groisman, Pavel; Shugart, Herman; Kicklighter, David

    2017-01-01

    . The Northern Eurasia Future Initiative (NEFI) has been designed as an essential continuation of the Northern Eurasia Earth Science Partnership Initiative (NEESPI), which was launched in 2004. NEESPI sought to elucidate all aspects of ongoing environmental change, to inform societies and, thus, to better...

  5. Genome-wide study of the defective sucrose fermenter strain of Vibrio cholerae from the Latin American cholera epidemic.

    Directory of Open Access Journals (Sweden)

    Daniel Rios Garza

    Full Text Available The 7th cholera pandemic reached Latin America in 1991, spreading from Peru to virtually all Latin American countries. During the late epidemic period, a strain that failed to ferment sucrose dominated cholera outbreaks in the Northern Brazilian Amazon region. In order to understand the genomic characteristics and the determinants of this altered sucrose fermenting phenotype, the genome of the strain IEC224 was sequenced. This paper reports a broad genomic study of this strain, showing its correlation with the major epidemic lineage. The potentially mobile genomic regions are shown to possess GC content deviation, and harbor the main V. cholera virulence genes. A novel bioinformatic approach was applied in order to identify the putative functions of hypothetical proteins, and was compared with the automatic annotation by RAST. The genome of a large bacteriophage was found to be integrated to the IEC224's alanine aminopeptidase gene. The presence of this phage is shown to be a common characteristic of the El Tor strains from the Latin American epidemic, as well as its putative ancestor from Angola. The defective sucrose fermenting phenotype is shown to be due to a single nucleotide insertion in the V. cholerae sucrose-specific transportation gene. This frame-shift mutation truncated a membrane protein, altering its structural pore-like conformation. Further, the identification of a common bacteriophage reinforces both the monophyletic and African-Origin hypotheses for the main causative agent of the 1991 Latin America cholera epidemics.

  6. Parasite Genome Projects and the Trypanosoma cruzi Genome Initiative

    Directory of Open Access Journals (Sweden)

    Wim Degrave

    1997-11-01

    Full Text Available Since the start of the human genome project, a great number of genome projects on other "model" organism have been initiated, some of them already completed. Several initiatives have also been started on parasite genomes, mainly through support from WHO/TDR, involving North-South and South-South collaborations, and great hopes are vested in that these initiatives will lead to new tools for disease control and prevention, as well as to the establishment of genomic research technology in developing countries. The Trypanosoma cruzi genome project, using the clone CL-Brener as starting point, has made considerable progress through the concerted action of more than 20 laboratories, most of them in the South. A brief overview of the current state of the project is given

  7. Standardization of micro-enzyme-linked immunosorbent assay (ELISA) and Western blot for detection of Trypanosoma cruzi antibodies using extracts from Mexican strains as antigens.

    Science.gov (United States)

    Sánchez, B; Monteón, V; Reyes, P A; Espinoza, B

    2001-01-01

    This report describes two assays for the detection of anti-Trypanosoma cruzi antibodies using Mexican strains of the parasite and the concordance with two assays previously evaluated at the Instituto Nacional de Cardiología Ignacio Chávez in Mexico City. Micro-enzyme-linked immunosorbent assay (ELISA) and Western blot were used for the detection of T. cruzi antibodies with a total extract of epimastigote from Ninoa and Queretaro, which are Mexican strains of T. cruzi. To standardize these methods, a total of 246 serum samples was used. In addition, sera from six confirmed Mexican chronic individuals in the asymptomatic phase were also used for comparison with the Argentinean antigen. ELISA was 100% specific in that no false positive results were found with sera of both healthy individuals and non-Chagasic cardiopaths. Sera from individuals infected with Leishmania sp. showed approximately 16% of cross-reaction with ELISA. The test showed a positive predictive value of 90% and a negative predictive value of 100%. Western blot was also a highly sensitive test for detecting chronic Chagasic symptomatic patients from Mexico because no false negative results were obtained. Furthermore, it was possible to use Western blot to detect seven immunodominant antigens of approximately 30, 32, 40, 42, 65, 70, and 83 kDa. Concordance with two previous standardized tests at the Instituto Nacional de Cardiología showed a Kappa index of 0.96, indicating high concordance between the results obtained at these two laboratories. Finally, ELISA using Ninoa antigen extract was more sensitive than ELISA with an Argentinean extract, which failed to detect individuals in the chronic asymptomatic phase (undetermined phase) of infection. This study indicates that ELISA and Western blot using Ninoa and/or Queretaro extracts of T. cruzi as antigens are useful tools in the detection of individuals who have been exposed to T. cruzi both in the undetermined/asymptomatic and symptomatic phases

  8. Genome-wide association study of primary tooth eruption identifies pleiotropic loci associated with height and craniofacial distances

    DEFF Research Database (Denmark)

    Fatemifar, Ghazaleh; Hoggart, Clive J; Paternoster, Lavinia

    2013-01-01

    Twin and family studies indicate that the timing of primary tooth eruption is highly heritable, with estimates typically exceeding 80%. To identify variants involved in primary tooth eruption, we performed a population-based genome-wide association study of 'age at first tooth' and 'number of teeth......' using 5998 and 6609 individuals, respectively, from the Avon Longitudinal Study of Parents and Children (ALSPAC) and 5403 individuals from the 1966 Northern Finland Birth Cohort (NFBC1966). We tested 2 446 724 SNPs imputed in both studies. Analyses were controlled for the effect of gestational age, sex...

  9. Demonstration of functional low-density lipoprotein receptors by protein blotting in fibroblasts from a subject with homozygous receptor-negative familial hypercholesterolemia

    International Nuclear Information System (INIS)

    Semenkovich, C.F.; Ostlund, R.E. Jr.; Yang, J.; Reaban, M.E.

    1985-01-01

    We report the detection of low-density lipoprotein (LDL) receptors by the technique of receptor blotting in fibroblasts from a patient with homozygous familial hypercholesterolemia (FHC) previously classified as ''receptor negative.'' Solubilized receptors were electrophoresed, transferred to nitrocellulose paper, treated with LDL followed by radiolabeled antibody to LDL, and visualized by autoradiography. GM 2000 FHC fibroblasts revealed LDL receptors with an apparent molecular weight of approximately 140,000, the same as in normal cells. LDL receptor activity by blotting in GM 2000 cells was greatly diminished in comparison with normal cells, but was calcium dependent. Receptor activity was also detectable by conventional monolayer binding and degradation assays. Thus, GM 2000 cells have profoundly diminished LDL receptor activity, but retain the genetic capacity to make LDL receptor material of normal molecular weight that is capable of binding LDL. Previous studies have demonstrated the presence of trace amounts of immunoreactive LDL receptor protein in fibroblasts from some receptor-negative FHC homozygotes. These studies are extended by demonstrating the ability of this material to bind LDL

  10. Short and long-term genome stability analysis of prokaryotic genomes.

    Science.gov (United States)

    Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

    2013-05-08

    Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were

  11. Prevalence and diversity of H9N2 avian influenza in chickens of Northern Vietnam, 2014.

    Science.gov (United States)

    Thuy, Duong Mai; Peacock, Thomas P; Bich, Vu Thi Ngoc; Fabrizio, Thomas; Hoang, Dang Nguyen; Tho, Nguyen Dang; Diep, Nguyen Thi; Nguyen, Minh; Hoa, Le Nguyen Minh; Trang, Hau Thi Thu; Choisy, Marc; Inui, Ken; Newman, Scott; Trung, Nguyen Vu; van Doorn, Rogier; To, Thanh Long; Iqbal, Munir; Bryant, Juliet E

    2016-10-01

    Despite their classification as low pathogenicity avian influenza viruses (LPAIV), A/H9N2 viruses cause significant losses in poultry in many countries throughout Asia, the Middle East and North Africa. To date, poultry surveillance in Vietnam has focused on detection of influenza H5 viruses, and there is limited understanding of influenza H9 epidemiology and transmission dynamics. We determined prevalence and diversity of influenza A viruses in chickens from live bird markets (LBM) of 7 northern Vietnamese provinces, using pooled oropharyngeal swabs collected from October to December 2014. Screening by real time RT-PCR revealed 1207/4900 (24.6%) of pooled swabs to be influenza A virus positive; overall prevalence estimates after accounting for pooling (5 swabs/pools) were 5.8% (CI 5.4-6.0). Subtyping was performed on 468 pooled swabs with M gene Ctinfluenza H7 was detected; 422 (90.1%) were H9 positive; and 22 (4.7%) were H5 positive. There was no evidence was of interaction between H9 and H5 virus detection rates. We sequenced 17 whole genomes of A/H9N2, 2 of A/H5N6, and 11 partial genomes. All H9N2 viruses had internal genes that clustered with genotype 57 and were closely related to Chinese human isolates of A/H7N9 and A/H10N8. Using a nucleotide divergence cutoff of 98%, we identified 9 distinct H9 genotypes. Phylogenetic analysis suggested multiple introductions of H9 viruses to northern Vietnam rather than in-situ transmission. Further investigations of H9 prevalence and diversity in other regions of Vietnam are warranted to assess H9 endemicity elsewhere in the country. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Proposed purchasing, employment and training policies for northern projects

    International Nuclear Information System (INIS)

    1991-09-01

    Manitoba Hydro is about to embark on a major construction project in the northern part of the province. Important considerations involved in this project include purchasing the necessary materials, products, and services, and employing a suitable work force. An outline is presented of draft policies being considered by Manitoba Hydro to enhance northern-aboriginal and northern participation in its future development projects in northern Manitoba. The policies are presented in four sections: purchasing for northern construction and operation activities; training and employment for construction of a generation station and expansion of a converter station; training and employment for construction of a major north-south transmission line; and training and employment for northern operations and maintenance work at existing facilities. Aspects of these policies include giving preference in purchasing to northern and aboriginal businesses, training initiatives and employee counselling for aboriginal employees, and hiring preferences directed toward northern aboriginals and northern residents

  13. Genomic Data Commons and Genomic Cloud Pilots - Google Hangout

    Science.gov (United States)

    Join us for a live, moderated discussion about two NCI efforts to expand access to cancer genomics data: the Genomic Data Commons and Genomic Cloud Pilots. NCI subject matters experts will include Louis M. Staudt, M.D., Ph.D., Director Center for Cancer Genomics, Warren Kibbe, Ph.D., Director, NCI Center for Biomedical Informatics and Information Technology, and moderated by Anthony Kerlavage, Ph.D., Chief, Cancer Informatics Branch, Center for Biomedical Informatics and Information Technology. We welcome your questions before and during the Hangout on Twitter using the hashtag #AskNCI.

  14. The genomes and comparative genomics of Lactobacillus delbrueckii phages.

    Science.gov (United States)

    Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

    2011-07-01

    Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

  15. Genome-wide characterization of centromeric satellites from multiple mammalian genomes.

    Science.gov (United States)

    Alkan, Can; Cardone, Maria Francesca; Catacchio, Claudia Rita; Antonacci, Francesca; O'Brien, Stephen J; Ryder, Oliver A; Purgato, Stefania; Zoli, Monica; Della Valle, Giuliano; Eichler, Evan E; Ventura, Mario

    2011-01-01

    Despite its importance in cell biology and evolution, the centromere has remained the final frontier in genome assembly and annotation due to its complex repeat structure. However, isolation and characterization of the centromeric repeats from newly sequenced species are necessary for a complete understanding of genome evolution and function. In recent years, various genomes have been sequenced, but the characterization of the corresponding centromeric DNA has lagged behind. Here, we present a computational method (RepeatNet) to systematically identify higher-order repeat structures from unassembled whole-genome shotgun sequence and test whether these sequence elements correspond to functional centromeric sequences. We analyzed genome datasets from six species of mammals representing the diversity of the mammalian lineage, namely, horse, dog, elephant, armadillo, opossum, and platypus. We define candidate monomer satellite repeats and demonstrate centromeric localization for five of the six genomes. Our analysis revealed the greatest diversity of centromeric sequences in horse and dog in contrast to elephant and armadillo, which showed high-centromeric sequence homogeneity. We could not isolate centromeric sequences within the platypus genome, suggesting that centromeres in platypus are not enriched in satellite DNA. Our method can be applied to the characterization of thousands of other vertebrate genomes anticipated for sequencing in the near future, providing an important tool for annotation of centromeres.

  16. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    DEFF Research Database (Denmark)

    Machado, Henrique; Gram, Lone

    2017-01-01

    was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.......Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand...... the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur, amino-acid usage, ANI), which allowed us to identify two...

  17. SNUGB: a versatile genome browser supporting comparative and functional fungal genomics

    Directory of Open Access Journals (Sweden)

    Kim Seungill

    2008-12-01

    Full Text Available Abstract Background Since the full genome sequences of Saccharomyces cerevisiae were released in 1996, genome sequences of over 90 fungal species have become publicly available. The heterogeneous formats of genome sequences archived in different sequencing centers hampered the integration of the data for efficient and comprehensive comparative analyses. The Comparative Fungal Genomics Platform (CFGP was developed to archive these data via a single standardized format that can support multifaceted and integrated analyses of the data. To facilitate efficient data visualization and utilization within and across species based on the architecture of CFGP and associated databases, a new genome browser was needed. Results The Seoul National University Genome Browser (SNUGB integrates various types of genomic information derived from 98 fungal/oomycete (137 datasets and 34 plant and animal (38 datasets species, graphically presents germane features and properties of each genome, and supports comparison between genomes. The SNUGB provides three different forms of the data presentation interface, including diagram, table, and text, and six different display options to support visualization and utilization of the stored information. Information for individual species can be quickly accessed via a new tool named the taxonomy browser. In addition, SNUGB offers four useful data annotation/analysis functions, including 'BLAST annotation.' The modular design of SNUGB makes its adoption to support other comparative genomic platforms easy and facilitates continuous expansion. Conclusion The SNUGB serves as a powerful platform supporting comparative and functional genomics within the fungal kingdom and also across other kingdoms. All data and functions are available at the web site http://genomebrowser.snu.ac.kr/.

  18. Challenges in Whole-Genome Annotation of Pyrosequenced Eukaryotic Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alan; Grigoriev, Igor

    2009-04-17

    Pyrosequencing technologies such as 454/Roche and Solexa/Illumina vastly lower the cost of nucleotide sequencing compared to the traditional Sanger method, and thus promise to greatly expand the number of sequenced eukaryotic genomes. However, the new technologies also bring new challenges such as shorter reads and new kinds and higher rates of sequencing errors, which complicate genome assembly and gene prediction. At JGI we are deploying 454 technology for the sequencing and assembly of ever-larger eukaryotic genomes. Here we describe our first whole-genome annotation of a purely 454-sequenced fungal genome that is larger than a yeast (>30 Mbp). The pezizomycotine (filamentous ascomycote) Aspergillus carbonarius belongs to the Aspergillus section Nigri species complex, members of which are significant as platforms for bioenergy and bioindustrial technology, as members of soil microbial communities and players in the global carbon cycle, and as agricultural toxigens. Application of a modified version of the standard JGI Annotation Pipeline has so far predicted ~;;10k genes. ~;;12percent of these preliminary annotations suffer a potential frameshift error, which is somewhat higher than the ~;;9percent rate in the Sanger-sequenced and conventionally assembled and annotated genome of fellow Aspergillus section Nigri member A. niger. Also,>90percent of A. niger genes have potential homologs in the A. carbonarius preliminary annotation. Weconclude, and with further annotation and comparative analysis expect to confirm, that 454 sequencing strategies provide a promising substrate for annotation of modestly sized eukaryotic genomes. We will also present results of annotation of a number of other pyrosequenced fungal genomes of bioenergy interest.

  19. Peroxisomal monodehydroascorbate reductase. Genomic clone characterization and functional analysis under environmental stress conditions.

    Science.gov (United States)

    Leterrier, Marina; Corpas, Francisco J; Barroso, Juan B; Sandalio, Luisa M; del Río, Luis A

    2005-08-01

    In plant cells, ascorbate is a major antioxidant that is involved in the ascorbate-glutathione cycle. Monodehydroascorbate reductase (MDAR) is the enzymatic component of this cycle involved in the regeneration of reduced ascorbate. The identification of the intron-exon organization and the promoter region of the pea (Pisum sativum) MDAR 1 gene was achieved in pea leaves using the method of walking polymerase chain reaction on genomic DNA. The nuclear gene of MDAR 1 comprises nine exons and eight introns, giving a total length of 3,770 bp. The sequence of 544 bp upstream of the initiation codon, which contains the promoter and 5' untranslated region, and 190 bp downstream of the stop codon were also determined. The presence of different regulatory motifs in the promoter region of the gene might indicate distinct responses to various conditions. The expression analysis in different plant organs by northern blots showed that fruits had the highest level of MDAR. Confocal laser scanning microscopy analysis of pea leaves transformed with Agrobacterium tumefaciens having the binary vectors pGD, which contain the autofluorescent proteins enhanced green fluorescent protein and enhanced yellow fluorescent protein with the full-length cDNA for MDAR 1 and catalase, indicated that the MDAR 1 encoded the peroxisomal isoform. The functional analysis of MDAR by activity and protein expression was studied in pea plants grown under eight stress conditions, including continuous light, high light intensity, continuous dark, mechanical wounding, low and high temperature, cadmium, and the herbicide 2,4-dichlorophenoxyacetic acid. This functional analysis is representative of all the MDAR isoforms present in the different cell compartments. Results obtained showed a significant induction by high light intensity and cadmium. On the other hand, expression studies, performed by semiquantitative reverse transcription-polymerase chain reaction demonstrated differential expression patterns of

  20. Northern Dimension: Participant Strategies

    Directory of Open Access Journals (Sweden)

    Busygina I.

    2009-01-01

    Full Text Available his article is devoted to the “Northern Dimension” initiative of the EU which also includes North-West Russia, Norway and Iceland. It is noted that the “Northern Dimension” in the theoretical perspective can be considered as part of strategic multi-level interactions between member-states of the EU and Russia. On this basis, the authors analyze implications and effects of the strategic interdependence of all the EU-Russia relation levels.

  1. Northern Dimension: Participant Strategies

    Directory of Open Access Journals (Sweden)

    Busygina Irina

    2009-03-01

    Full Text Available This article is devoted to the “Northern Dimension” initiative of the EU which also includes North-West Russia, Norway and Iceland. It is noted that the “Northern Dimension” in the theoretical perspective can be considered as part of strategic multi-level interactions between member-states of the EU and Russia. On this basis, the authors analyze implications and effects of the strategic interdependence of all the EU-Russia relation levels.

  2. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  3. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  4. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  5. Genome-derived vaccines.

    Science.gov (United States)

    De Groot, Anne S; Rappuoli, Rino

    2004-02-01

    Vaccine research entered a new era when the complete genome of a pathogenic bacterium was published in 1995. Since then, more than 97 bacterial pathogens have been sequenced and at least 110 additional projects are now in progress. Genome sequencing has also dramatically accelerated: high-throughput facilities can draft the sequence of an entire microbe (two to four megabases) in 1 to 2 days. Vaccine developers are using microarrays, immunoinformatics, proteomics and high-throughput immunology assays to reduce the truly unmanageable volume of information available in genome databases to a manageable size. Vaccines composed by novel antigens discovered from genome mining are already in clinical trials. Within 5 years we can expect to see a novel class of vaccines composed by genome-predicted, assembled and engineered T- and Bcell epitopes. This article addresses the convergence of three forces--microbial genome sequencing, computational immunology and new vaccine technologies--that are shifting genome mining for vaccines onto the forefront of immunology research.

  6. JGI Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  7. Genomic Encyclopedia of Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-08-10

    Genomes of fungi relevant to energy and environment are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 150 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such parts suggested by comparative genomics and functional analysis in these areas are presented here.

  8. The Genomic Code: Genome Evolution and Potential Applications

    KAUST Repository

    Bernardi, Giorgio

    2016-01-25

    The genome of metazoans is organized according to a genomic code which comprises three laws: 1) Compositional correlations hold between contiguous coding and non-coding sequences, as well as among the three codon positions of protein-coding genes; these correlations are the consequence of the fact that the genomes under consideration consist of fairly homogeneous, long (≥200Kb) sequences, the isochores; 2) Although isochores are defined on the basis of purely compositional properties, GC levels of isochores are correlated with all tested structural and functional properties of the genome; 3) GC levels of isochores are correlated with chromosome architecture from interphase to metaphase; in the case of interphase the correlation concerns isochores and the three-dimensional “topological associated domains” (TADs); in the case of mitotic chromosomes, the correlation concerns isochores and chromosomal bands. Finally, the genomic code is the fourth and last pillar of molecular biology, the first three pillars being 1) the double helix structure of DNA; 2) the regulation of gene expression in prokaryotes; and 3) the genetic code.

  9. The genomic ancestry, landscape genetics and invasion history of introduced mice in New Zealand

    Science.gov (United States)

    Russell, James C.; King, Carolyn M.

    2018-01-01

    The house mouse (Mus musculus) provides a fascinating system for studying both the genomic basis of reproductive isolation, and the patterns of human-mediated dispersal. New Zealand has a complex history of mouse invasions, and the living descendants of these invaders have genetic ancestry from all three subspecies, although most are primarily descended from M. m. domesticus. We used the GigaMUGA genotyping array (approximately 135 000 loci) to describe the genomic ancestry of 161 mice, sampled from 34 locations from across New Zealand (and one Australian city—Sydney). Of these, two populations, one in the south of the South Island, and one on Chatham Island, showed complete mitochondrial lineage capture, featuring two different lineages of M. m. castaneus mitochondrial DNA but with only M. m. domesticus nuclear ancestry detectable. Mice in the northern and southern parts of the North Island had small traces (approx. 2–3%) of M. m. castaneus nuclear ancestry, and mice in the upper South Island had approximately 7–8% M. m. musculus nuclear ancestry including some Y-chromosomal ancestry—though no detectable M. m. musculus mitochondrial ancestry. This is the most thorough genomic study of introduced populations of house mice yet conducted, and will have relevance to studies of the isolation mechanisms separating subspecies of mice. PMID:29410804

  10. PSAT: A web tool to compare genomic neighborhoods of multiple prokaryotic genomes

    Directory of Open Access Journals (Sweden)

    Wasnick Michael

    2008-03-01

    Full Text Available Abstract Background The conservation of gene order among prokaryotic genomes can provide valuable insight into gene function, protein interactions, or events by which genomes have evolved. Although some tools are available for visualizing and comparing the order of genes between genomes of study, few support an efficient and organized analysis between large numbers of genomes. The Prokaryotic Sequence homology Analysis Tool (PSAT is a web tool for comparing gene neighborhoods among multiple prokaryotic genomes. Results PSAT utilizes a database that is preloaded with gene annotation, BLAST hit results, and gene-clustering scores designed to help identify regions of conserved gene order. Researchers use the PSAT web interface to find a gene of interest in a reference genome and efficiently retrieve the sequence homologs found in other bacterial genomes. The tool generates a graphic of the genomic neighborhood surrounding the selected gene and the corresponding regions for its homologs in each comparison genome. Homologs in each region are color coded to assist users with analyzing gene order among various genomes. In contrast to common comparative analysis methods that filter sequence homolog data based on alignment score cutoffs, PSAT leverages gene context information for homologs, including those with weak alignment scores, enabling a more sensitive analysis. Features for constraining or ordering results are designed to help researchers browse results from large numbers of comparison genomes in an organized manner. PSAT has been demonstrated to be useful for helping to identify gene orthologs and potential functional gene clusters, and detecting genome modifications that may result in loss of function. Conclusion PSAT allows researchers to investigate the order of genes within local genomic neighborhoods of multiple genomes. A PSAT web server for public use is available for performing analyses on a growing set of reference genomes through any

  11. Complete mitochondrial genome of Concholepas concholepas inferred by 454 pyrosequencing and mtDNA expression in two mollusc populations.

    Science.gov (United States)

    Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Gallardo-Escárate, Cristian

    2013-03-01

    Despite the great relevance of mitochondrial genome analysis in evolutionary studies, there is scarce information on how the transcripts associated with the mitogenome are expressed and their role in the genetic structuring of populations. This work reports the complete mitochondrial genome of the marine gastropod Concholepas concholepas, obtained by 454 pryosequencing, and an analysis of mitochondrial transcripts of two populations 1000 km apart along the Chilean coast. The mitochondrion of C. concholepas is 15,495 base pairs (bp) in size and contains the 37 subunits characteristic of metazoans, as well as a non-coding region of 330 bp. In silico analysis of mitochondrial gene variability showed significant differences among populations. In terms of levels of relative abundance of transcripts associated with mitochondrion in the two populations (assessed by qPCR), the genes associated with complexes III and IV of the mitochondrial genome had the highest levels of expression in the northern population while transcripts associated with the ATP synthase complex had the highest levels of expression in the southern population. Moreover, fifteen polymorphic SNPs were identified in silico between the mitogenomes of the two populations. Four of these markers implied different amino acid substitutions (non-synonymous SNPs). This work contributes novel information regarding the mitochondrial genome structure and mRNA expression levels of C. concholepas. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

    Science.gov (United States)

    Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

    2016-10-11

    Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

  13. Discussion on several geological problems and uranium metallogeny on northern border of northern China block (platform)

    International Nuclear Information System (INIS)

    Chen Hong.

    1987-01-01

    According to the informations from the satellite image and the field investigation the following geological events on the northern border of the Northern China Block are recognized and confirmed, duch as suture zones between blocks, folding-reversed fault zones, back-arc collision zones (faulted zones), transitional zone between platform and geosyncline, magmatic are and the double sturcture composed of NNE trend magmatic active belt and fault-depression belts (basins) of Yenshan-Ximalaya age. On thsee bases the following problems, such as the unique structural environment of uranium mineralization related to abyssal magmatic rocks and Yenshan magmatic active zone (including volcanic belt) on the northern border of the Northern China Block, the metallogenetic modes for urnaium deposits of 'magmatic type' and 'neutralized surface type' in fault-depression zone and the classification of uranium metallogenetic belts and the criteria for such classification are studied and discussed. Several uranium deposits are given for illustrations

  14. A recombination point is conserved in the mitochondrial genome of higher plant species and located downstream from the cox2 pseudogene in Solanum tuberosum L.

    Directory of Open Access Journals (Sweden)

    Susely F.S. Tada

    2006-01-01

    Full Text Available The potato (Solanum tuberosum L. mitochondrial cox3/sdh4/pseudo-cox2 gene cluster has previously been identified by heterologous hybridization using a Marchantia polymorpha sdh4 probe. In our present study we used Southern blotting using sdh4 and cox2 probes to show that the sdh4 and cox2 genes are clustered in the mitochondria of potato, soybean and pea. Northern blotting revealed cotranscription of sdh4 and cox2 in potato but not in cauliflower, indicating that these genes are not clustered in cauliflower. A putative recombination point was detected downstream of the cox2 pseudogene (pseudo-cox2 in potato mitochondrial DNA (mtDNA. This sequence corresponds to a 32 bp sequence which appears to be well-conserved and is adjacent to the terminals of some mitochondrial genes in Citrullus lanatus, Beta vulgaris and Arabidopsis thaliana and is probably involved in the genic rearrangements. It is possible the potato mtDNA pseudo-cox2 gene was generated by recombination during evolution in the same way as that of several other mitochondrial genes and remains as an inactive partial copy of the functional cox2 which was also detected in potato mtDNA.

  15. Bacterial genomics reveal the complex epidemiology of an emerging pathogen in arctic and boreal ungulates

    Science.gov (United States)

    Forde, Taya L.; Orsel, Karin; Zadoks, Ruth N.; Biek, Roman; Adams, Layne G.; Checkley, Sylvia L.; Davison, Tracy; De Buck, Jeroen; Dumond, Mathieu; Elkin, Brett T.; Finnegan, Laura; Macbeth, Bryan J.; Nelson, Cait; Niptanatiak, Amanda; Sather, Shane; Schwantje, Helen M.; van der Meer, Frank; Kutz, Susan J.

    2016-01-01

    Northern ecosystems are currently experiencing unprecedented ecological change, largely driven by a rapidly changing climate. Pathogen range expansion, and emergence and altered patterns of infectious disease, are increasingly reported in wildlife at high latitudes. Understanding the causes and consequences of shifting pathogen diversity and host-pathogen interactions in these ecosystems is important for wildlife conservation, and for indigenous populations that depend on wildlife. Among the key questions are whether disease events are associated with endemic or recently introduced pathogens, and whether emerging strains are spreading throughout the region. In this study, we used a phylogenomic approach to address these questions of pathogen endemicity and spread for Erysipelothrix rhusiopathiae, an opportunistic multi-host bacterial pathogen associated with recent mortalities in arctic and boreal ungulate populations in North America. We isolated E. rhusiopathiae from carcasses associated with large-scale die-offs of muskoxen in the Canadian Arctic Archipelago, and from contemporaneous mortality events and/or population declines among muskoxen in northwestern Alaska and caribou and moose in western Canada. Bacterial genomic diversity differed markedly among these locations; minimal divergence was present among isolates from muskoxen in the Canadian Arctic, while in caribou and moose populations, strains from highly divergent clades were isolated from the same location, or even from within a single carcass. These results indicate that mortalities among northern ungulates are not associated with a single emerging strain of E. rhusiopathiae, and that alternate hypotheses need to be explored. Our study illustrates the value and limitations of bacterial genomic data for discriminating between ecological hypotheses of disease emergence, and highlights the importance of studying emerging pathogens within the broader context of environmental and host factors.

  16. Brief Guide to Genomics: DNA, Genes and Genomes

    Science.gov (United States)

    ... clinic. Most new drugs based on genome-based research are estimated to be at least 10 to 15 years away, though recent genome-driven efforts in lipid-lowering therapy have considerably shortened that interval. According ...

  17. MIPS plant genome information resources.

    Science.gov (United States)

    Spannagl, Manuel; Haberer, Georg; Ernst, Rebecca; Schoof, Heiko; Mayer, Klaus F X

    2007-01-01

    The Munich Institute for Protein Sequences (MIPS) has been involved in maintaining plant genome databases since the Arabidopsis thaliana genome project. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable data sets for model plant genomes as a backbone against which experimental data, for example from high-throughput functional genomics, can be organized and evaluated. In addition, model genomes also form a scaffold for comparative genomics, and much can be learned from genome-wide evolutionary studies.

  18. Genomic insights into natural selection in the common loon (Gavia immer): evidence for aquatic adaptation.

    Science.gov (United States)

    Gayk, Zach G; Le Duc, Diana; Horn, Jeffrey; Lindsay, Alec R

    2018-04-27

    The common loon (Gavia immer) is one of five species that comprise the avian order Gaviiformes. Loons are specialized divers, reaching depths up to 60 m while staying submerged for intervals up to three minutes. In this study we used comparative genomics to investigate the genetic basis of the common loon adaptations to its ecological niche. We used Illumina short read DNA sequence data from a female bird to produce a draft assembly of the common loon (Gavia immer) genome. We identified 14,169 common loon genes, which based on well-resolved avian genomes, represent approximately 80.7% of common loon genes. Evolutionary analyses between common loon and Adelie penguin (Pygoscelis adeliae), red-throated loon (Gavia stellata), chicken (Gallus gallus), northern fulmar (Fulmarus glacialis), and rock pigeon (Columba livia) show 164 positively selected genes in common and red-throated loons. These genes were enriched for a number of protein classes, including those involved in muscle tissue development, immunoglobulin function, hemoglobin iron binding, G-protein coupled receptors, and ATP metabolism. Signatures of positive selection in these areas suggest the genus Gavia may have adapted for underwater diving by modulating their oxidative and metabolic pathways. While more research is required, these adaptations likely result in (1) compensations in oxygen respiration and energetic metabolism, (2) low-light visual acuity, and (3) elevated solute exchange. This work represents the first effort to understand the genomic adaptations of the common loon as well as other Gavia and may have implications for subsequent studies that target particular genes for loon population genetic, ecological or conservation studies.

  19. Switchgrass genomic diversity, ploidy, and evolution: novel insights from a network-based SNP discovery protocol.

    Directory of Open Access Journals (Sweden)

    Fei Lu

    Full Text Available Switchgrass (Panicum virgatum L. is a perennial grass that has been designated as an herbaceous model biofuel crop for the United States of America. To facilitate accelerated breeding programs of switchgrass, we developed both an association panel and linkage populations for genome-wide association study (GWAS and genomic selection (GS. All of the 840 individuals were then genotyped using genotyping by sequencing (GBS, generating 350 GB of sequence in total. As a highly heterozygous polyploid (tetraploid and octoploid species lacking a reference genome, switchgrass is highly intractable with earlier methodologies of single nucleotide polymorphism (SNP discovery. To access the genetic diversity of species like switchgrass, we developed a SNP discovery pipeline based on a network approach called the Universal Network-Enabled Analysis Kit (UNEAK. Complexities that hinder single nucleotide polymorphism discovery, such as repeats, paralogs, and sequencing errors, are easily resolved with UNEAK. Here, 1.2 million putative SNPs were discovered in a diverse collection of primarily upland, northern-adapted switchgrass populations. Further analysis of this data set revealed the fundamentally diploid nature of tetraploid switchgrass. Taking advantage of the high conservation of genome structure between switchgrass and foxtail millet (Setaria italica (L. P. Beauv., two parent-specific, synteny-based, ultra high-density linkage maps containing a total of 88,217 SNPs were constructed. Also, our results showed clear patterns of isolation-by-distance and isolation-by-ploidy in natural populations of switchgrass. Phylogenetic analysis supported a general south-to-north migration path of switchgrass. In addition, this analysis suggested that upland tetraploid arose from upland octoploid. All together, this study provides unparalleled insights into the diversity, genomic complexity, population structure, phylogeny, phylogeography, ploidy, and evolutionary dynamics

  20. The red deer Cervus elaphus genome CerEla1.0: sequencing, annotating, genes, and chromosomes.

    Science.gov (United States)

    Bana, Nóra Á; Nyiri, Anna; Nagy, János; Frank, Krisztián; Nagy, Tibor; Stéger, Viktor; Schiller, Mátyás; Lakatos, Péter; Sugár, László; Horn, Péter; Barta, Endre; Orosz, László

    2018-01-02

    We present here the de novo genome assembly CerEla1.0 for the red deer, Cervus elaphus, an emblematic member of the natural megafauna of the Northern Hemisphere. Humans spread the species in the South. Today, the red deer is also a farm-bred animal and is becoming a model animal in biomedical and population studies. Stag DNA was sequenced at 74× coverage by Illumina technology. The ALLPATHS-LG assembly of the reads resulted in 34.7 × 10 3 scaffolds, 26.1 × 10 3 of which were utilized in Cer.Ela1.0. The assembly spans 3.4 Gbp. For building the red deer pseudochromosomes, a pre-established genetic map was used for main anchor points. A nearly complete co-linearity was found between the mapmarker sequences of the deer genetic map and the order and orientation of the orthologous sequences in the syntenic bovine regions. Syntenies were also conserved at the in-scaffold level. The cM distances corresponded to 1.34 Mbp uniformly along the deer genome. Chromosomal rearrangements between deer and cattle were demonstrated. 2.8 × 10 6 SNPs, 365 × 10 3 indels and 19368 protein-coding genes were identified in CerEla1.0, along with positions for centromerons. CerEla1.0 demonstrates the utilization of dual references, i.e., when a target genome (here C. elaphus) already has a pre-established genetic map, and is combined with the well-established whole genome sequence of a closely related species (here Bos taurus). Genome-wide association studies (GWAS) that CerEla1.0 (NCBI, MKHE00000000) could serve for are discussed.

  1. Ensembl Genomes 2013: scaling up access to genome-wide data.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Hughes, Daniel Seth Toney; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Langridge, Nicholas; McDowall, Mark D; Maheswari, Uma; Maslen, Gareth; Nuhn, Michael; Ong, Chuang Kee; Paulini, Michael; Pedro, Helder; Toneva, Iliana; Tuli, Mary Ann; Walts, Brandon; Williams, Gareth; Wilson, Derek; Youens-Clark, Ken; Monaco, Marcela K; Stein, Joshua; Wei, Xuehong; Ware, Doreen; Bolser, Daniel M; Howe, Kevin Lee; Kulesha, Eugene; Lawson, Daniel; Staines, Daniel Michael

    2014-01-01

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species. The project exploits and extends technologies for genome annotation, analysis and dissemination, developed in the context of the vertebrate-focused Ensembl project, and provides a complementary set of resources for non-vertebrate species through a consistent set of programmatic and interactive interfaces. These provide access to data including reference sequence, gene models, transcriptional data, polymorphisms and comparative analysis. This article provides an update to the previous publications about the resource, with a focus on recent developments. These include the addition of important new genomes (and related data sets) including crop plants, vectors of human disease and eukaryotic pathogens. In addition, the resource has scaled up its representation of bacterial genomes, and now includes the genomes of over 9000 bacteria. Specific extensions to the web and programmatic interfaces have been developed to support users in navigating these large data sets. Looking forward, analytic tools to allow targeted selection of data for visualization and download are likely to become increasingly important in future as the number of available genomes increases within all domains of life, and some of the challenges faced in representing bacterial data are likely to become commonplace for eukaryotes in future.

  2. A comparison of the immune parameters of dogs infected with visceral leishmaniasis using Western blot and neutralization techniques Comparação dos parâmetros imunológicos de cães infectados com leishmaniose visceral usando as técnicas de Western blot e neutralização

    Directory of Open Access Journals (Sweden)

    Yeda L. Nogueira

    2007-12-01

    Full Text Available The Western blot technique was used to demonstrate the presence of antibodies in the blood of dogs that presented canine visceral leishmaniasis. This technique was used against some specific molecules present in the lysate of the promastigote form of Leshmania chagasi.Through the association of the results of the Western blot technique with the morphological alterations seen as a result of the serum neutralization technique performed in McCoy cells (which mimetizes the macrophage it was possible to observe the role of some molecules of great relevance in determining the disease in symptomatic dogs as well as that of some other molecules associated with asymptomatic infected dogs that may become transmitters as well as differentiating them as asymptomatic resistant dogs. In the sera analyses carried out during the immunobloting a variation of 9 to 27 immunoreacting bands was observed, which were then compared using Dice's similarity coefficient. In the dendrogram constructed on the basis of the coefficient, 50% similarity was observed among the total number of reagent bands with the promastigote lysate, thus creating five groups. The main difference observed related to the clinical condition of the dogs: symptomatic and asymptomatic dogs were found in separate groups. The asymptomatic group of dogs was distributed in two different places in the dendrogram because they presented two different behavior patterns regarding the cellular morphology in the serum neutralization reaction: the presence or absence of cellular lysis. According to this analysis it is possible to evaluate the immune status and associate it with specific markers observed in the reaction found in the Western blot strips.A técnica de Western blot foi utilizada para demonstrar a presença de anticorpos do soro de cães, que apresentavam leishmaniose visceral canina, contra algumas moléculas específicas no lisado da forma promastigota de Leshmania chagasi.Através da associa

  3. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Irish cattle population

    Directory of Open Access Journals (Sweden)

    Hartshorne David

    2010-01-01

    Full Text Available Abstract Background Animal identification is pivotal in governmental agricultural policy, enabling the management of subsidy payments, movement of livestock, test scheduling and control of disease. Advances in bovine genomics have made it possible to utilise inherent genetic variability to uniquely identify individual animals by DNA profiling, much as has been achieved with humans over the past 20 years. A DNA profiling test based on bi-allelic single nucleotide polymorphism (SNP markers would offer considerable advantages over current short tandem repeat (STR based industry standard tests, in that it would be easier to analyse and interpret. In this study, a panel of 51 genome-wide SNPs were genotyped across panels of semen DNA from 6 common breeds for the purposes of ascertaining allelic frequency. For SNPs on the same chromosome, the extent of linkage disequilbrium was determined from genotype data by Expectation Maximization (EM algorithm. Minimum probabilities of unique identification were determined for each breed panel. The usefulness of this SNP panel was ascertained by comparison to the current bovine STR Stockmarks II assay. A statistically representative random sampling of bovine animals from across Northern Ireland was assembled for the purposes of determining the population allele frequency for these STR loci and subsequently, the minimal probability of unique identification they conferred in sampled bovine animals from Northern Ireland. Results 6 SNPs exhibiting a minor allele frequency of less than 0.2 in more than 3 of the breed panels were excluded. 2 Further SNPs were found to reside in coding areas of the cattle genome and were excluded from the final panel. The remaining 43 SNPs exhibited genotype frequencies which were in Hardy Weinberg Equilibrium. SNPs on the same chromosome were observed to have no significant linkage disequilibrium/allelic association. Minimal probabilities of uniquely identifying individual animals from

  4. Toward genome-enabled mycology.

    Science.gov (United States)

    Hibbett, David S; Stajich, Jason E; Spatafora, Joseph W

    2013-01-01

    Genome-enabled mycology is a rapidly expanding field that is characterized by the pervasive use of genome-scale data and associated computational tools in all aspects of fungal biology. Genome-enabled mycology is integrative and often requires teams of researchers with diverse skills in organismal mycology, bioinformatics and molecular biology. This issue of Mycologia presents the first complete fungal genomes in the history of the journal, reflecting the ongoing transformation of mycology into a genome-enabled science. Here, we consider the prospects for genome-enabled mycology and the technical and social challenges that will need to be overcome to grow the database of complete fungal genomes and enable all fungal biologists to make use of the new data.

  5. Insect-resistance and high-yield transgenic tobacco obtained by ...

    African Journals Online (AJOL)

    The modified synthesized VHb gene and insectidal gene (GFMcryIA) were transferred to tobacco plants by Agrobacterium-mediated transformation. The bivalent genes were inserted successfully into the tobacco genome and detected by PCR amplification. Southern blot and Western blot analyses showed that VHb gene ...

  6. Plantagora: modeling whole genome sequencing and assembly of plant genomes.

    Directory of Open Access Journals (Sweden)

    Roger Barthelson

    Full Text Available BACKGROUND: Genomics studies are being revolutionized by the next generation sequencing technologies, which have made whole genome sequencing much more accessible to the average researcher. Whole genome sequencing with the new technologies is a developing art that, despite the large volumes of data that can be produced, may still fail to provide a clear and thorough map of a genome. The Plantagora project was conceived to address specifically the gap between having the technical tools for genome sequencing and knowing precisely the best way to use them. METHODOLOGY/PRINCIPAL FINDINGS: For Plantagora, a platform was created for generating simulated reads from several different plant genomes of different sizes. The resulting read files mimicked either 454 or Illumina reads, with varying paired end spacing. Thousands of datasets of reads were created, most derived from our primary model genome, rice chromosome one. All reads were assembled with different software assemblers, including Newbler, Abyss, and SOAPdenovo, and the resulting assemblies were evaluated by an extensive battery of metrics chosen for these studies. The metrics included both statistics of the assembly sequences and fidelity-related measures derived by alignment of the assemblies to the original genome source for the reads. The results were presented in a website, which includes a data graphing tool, all created to help the user compare rapidly the feasibility and effectiveness of different sequencing and assembly strategies prior to testing an approach in the lab. Some of our own conclusions regarding the different strategies were also recorded on the website. CONCLUSIONS/SIGNIFICANCE: Plantagora provides a substantial body of information for comparing different approaches to sequencing a plant genome, and some conclusions regarding some of the specific approaches. Plantagora also provides a platform of metrics and tools for studying the process of sequencing and assembly

  7. Genomes in turmoil: quantification of genome dynamics in prokaryote supergenomes.

    Science.gov (United States)

    Puigbò, Pere; Lobkovsky, Alexander E; Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

    2014-08-21

    Genomes of bacteria and archaea (collectively, prokaryotes) appear to exist in incessant flux, expanding via horizontal gene transfer and gene duplication, and contracting via gene loss. However, the actual rates of genome dynamics and relative contributions of different types of event across the diversity of prokaryotes are largely unknown, as are the sizes of microbial supergenomes, i.e. pools of genes that are accessible to the given microbial species. We performed a comprehensive analysis of the genome dynamics in 35 groups (34 bacterial and one archaeal) of closely related microbial genomes using a phylogenetic birth-and-death maximum likelihood model to quantify the rates of gene family gain and loss, as well as expansion and reduction. The results show that loss of gene families dominates the evolution of prokaryotes, occurring at approximately three times the rate of gain. The rates of gene family expansion and reduction are typically seven and twenty times less than the gain and loss rates, respectively. Thus, the prevailing mode of evolution in bacteria and archaea is genome contraction, which is partially compensated by the gain of new gene families via horizontal gene transfer. However, the rates of gene family gain, loss, expansion and reduction vary within wide ranges, with the most stable genomes showing rates about 25 times lower than the most dynamic genomes. For many groups, the supergenome estimated from the fraction of repetitive gene family gains includes about tenfold more gene families than the typical genome in the group although some groups appear to have vast, 'open' supergenomes. Reconstruction of evolution for groups of closely related bacteria and archaea reveals an extremely rapid and highly variable flux of genes in evolving microbial genomes, demonstrates that extensive gene loss and horizontal gene transfer leading to innovation are the two dominant evolutionary processes, and yields robust estimates of the supergenome size.

  8. A Web-Based Comparative Genomics Tutorial for Investigating Microbial Genomes

    Directory of Open Access Journals (Sweden)

    Michael Strong

    2009-12-01

    Full Text Available As the number of completely sequenced microbial genomes continues to rise at an impressive rate, it is important to prepare students with the skills necessary to investigate microorganisms at the genomic level. As a part of the core curriculum for first-year graduate students in the biological sciences, we have implemented a web-based tutorial to introduce students to the fields of comparative and functional genomics. The tutorial focuses on recent computational methods for identifying functionally linked genes and proteins on a genome-wide scale and was used to introduce students to the Rosetta Stone, Phylogenetic Profile, conserved Gene Neighbor, and Operon computational methods. Students learned to use a number of publicly available web servers and databases to identify functionally linked genes in the Escherichia coli genome, with emphasis on genome organization and operon structure. The overall effectiveness of the tutorial was assessed based on student evaluations and homework assignments. The tutorial is available to other educators at http://www.doe-mbi.ucla.edu/~strong/m253.php.

  9. Northern pipelines : backgrounder

    International Nuclear Information System (INIS)

    2002-04-01

    Most analysts agree that demand for natural gas in North America will continue to grow. Favourable market conditions created by rising demand and declining production have sparked renewed interest in northern natural gas development. The 2002 Annual Energy Outlook forecasted U.S. consumption to increase at an annual average rate of 2 per cent from 22.8 trillion cubic feet to 33.8 TCF by 2020, mostly due to rapid growth in demand for electric power generation. Natural gas prices are also expected to increase at an annual average rate of 1.6 per cent, reaching $3.26 per thousand cubic feet in 2020. There are currently 3 proposals for pipelines to move northern gas to US markets. They include a stand-alone Mackenzie Delta Project, the Alaska Highway Pipeline Project, and an offshore route that would combine Alaskan and Canadian gas in a pipeline across the floor of the Beaufort Sea. Current market conditions and demand suggest that the projects are not mutually exclusive, but complimentary. The factors that differentiate northern pipeline proposals are reserves, preparedness for market, costs, engineering, and environmental differences. Canada has affirmed its role to provide the regulatory and fiscal certainty needed by industry to make investment decisions. The Government of the Yukon does not believe that the Alaska Highway Project will shut in Mackenzie Delta gas, but will instead pave the way for development of a new northern natural gas industry. The Alaska Highway Pipeline Project will bring significant benefits for the Yukon, the Northwest Territories and the rest of Canada. Unresolved land claims are one of the challenges that has to be addressed for both Yukon and the Northwest Territories, as the proposed Alaska Highway Pipeline will travel through traditional territories of several Yukon first Nations. 1 tab., 4 figs

  10. Variation in Linked Selection and Recombination Drive Genomic Divergence during Allopatric Speciation of European and American Aspens.

    Science.gov (United States)

    Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K

    2016-07-01

    Despite the global economic and ecological importance of forest trees, the genomic basis of differential adaptation and speciation in tree species is still poorly understood. Populus tremula and Populus tremuloides are two of the most widespread tree species in the Northern Hemisphere. Using whole-genome re-sequencing data of 24 P. tremula and 22 P. tremuloides individuals, we find that the two species diverged ∼2.2-3.1 million years ago, coinciding with the severing of the Bering land bridge and the onset of dramatic climatic oscillations during the Pleistocene. Both species have experienced substantial population expansions following long-term declines after species divergence. We detect widespread and heterogeneous genomic differentiation between species, and in accordance with the expectation of allopatric speciation, coalescent simulations suggest that neutral evolutionary processes can account for most of the observed patterns of genetic differentiation. However, there is an excess of regions exhibiting extreme differentiation relative to those expected under demographic simulations, which is indicative of the action of natural selection. Overall genetic differentiation is negatively associated with recombination rate in both species, providing strong support for a role of linked selection in generating the heterogeneous genomic landscape of differentiation between species. Finally, we identify a number of candidate regions and genes that may have been subject to positive and/or balancing selection during the speciation process. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

    Science.gov (United States)

    Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

    2014-07-01

    Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. Between Two Fern Genomes

    Science.gov (United States)

    2014-01-01

    Ferns are the only major lineage of vascular plants not represented by a sequenced nuclear genome. This lack of genome sequence information significantly impedes our ability to understand and reconstruct genome evolution not only in ferns, but across all land plants. Azolla and Ceratopteris are ideal and complementary candidates to be the first ferns to have their nuclear genomes sequenced. They differ dramatically in genome size, life history, and habit, and thus represent the immense diversity of extant ferns. Together, this pair of genomes will facilitate myriad large-scale comparative analyses across ferns and all land plants. Here we review the unique biological characteristics of ferns and describe a number of outstanding questions in plant biology that will benefit from the addition of ferns to the set of taxa with sequenced nuclear genomes. We explain why the fern clade is pivotal for understanding genome evolution across land plants, and we provide a rationale for how knowledge of fern genomes will enable progress in research beyond the ferns themselves. PMID:25324969

  13. Exploring Other Genomes: Bacteria.

    Science.gov (United States)

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  14. Comparative Pan-Genome Analysis of Piscirickettsia salmonis Reveals Genomic Divergences within Genogroups

    Directory of Open Access Journals (Sweden)

    Guillermo Nourdin-Galindo

    2017-10-01

    Full Text Available Piscirickettsia salmonis is the etiological agent of salmonid rickettsial septicemia, a disease that seriously affects the salmonid industry. Despite efforts to genomically characterize P. salmonis, functional information on the life cycle, pathogenesis mechanisms, diagnosis, treatment, and control of this fish pathogen remain lacking. To address this knowledge gap, the present study conducted an in silico pan-genome analysis of 19 P. salmonis strains from distinct geographic locations and genogroups. Results revealed an expected open pan-genome of 3,463 genes and a core-genome of 1,732 genes. Two marked genogroups were identified, as confirmed by phylogenetic and phylogenomic relationships to the LF-89 and EM-90 reference strains, as well as by assessments of genomic structures. Different structural configurations were found for the six identified copies of the ribosomal operon in the P. salmonis genome, indicating translocation throughout the genetic material. Chromosomal divergences in genomic localization and quantity of genetic cassettes were also found for the Dot/Icm type IVB secretion system. To determine divergences between core-genomes, additional pan-genome descriptions were compiled for the so-termed LF and EM genogroups. Open pan-genomes composed of 2,924 and 2,778 genes and core-genomes composed of 2,170 and 2,228 genes were respectively found for the LF and EM genogroups. The core-genomes were functionally annotated using the Gene Ontology, KEGG, and Virulence Factor databases, revealing the presence of several shared groups of genes related to basic function of intracellular survival and bacterial pathogenesis. Additionally, the specific pan-genomes for the LF and EM genogroups were defined, resulting in the identification of 148 and 273 exclusive proteins, respectively. Notably, specific virulence factors linked to adherence, colonization, invasion factors, and endotoxins were established. The obtained data suggest that these

  15. A Genome-Wide Landscape of Retrocopies in Primate Genomes.

    Science.gov (United States)

    Navarro, Fábio C P; Galante, Pedro A F

    2015-07-29

    Gene duplication is a key factor contributing to phenotype diversity across and within species. Although the availability of complete genomes has led to the extensive study of genomic duplications, the dynamics and variability of gene duplications mediated by retrotransposition are not well understood. Here, we predict mRNA retrotransposition and use comparative genomics to investigate their origin and variability across primates. Analyzing seven anthropoid primate genomes, we found a similar number of mRNA retrotranspositions (∼7,500 retrocopies) in Catarrhini (Old Word Monkeys, including humans), but a surprising large number of retrocopies (∼10,000) in Platyrrhini (New World Monkeys), which may be a by-product of higher long interspersed nuclear element 1 activity in these genomes. By inferring retrocopy orthology, we dated most of the primate retrocopy origins, and estimated a decrease in the fixation rate in recent primate history, implying a smaller number of species-specific retrocopies. Moreover, using RNA-Seq data, we identified approximately 3,600 expressed retrocopies. As expected, most of these retrocopies are located near or within known genes, present tissue-specific and even species-specific expression patterns, and no expression correlation to their parental genes. Taken together, our results provide further evidence that mRNA retrotransposition is an active mechanism in primate evolution and suggest that retrocopies may not only introduce great genetic variability between lineages but also create a large reservoir of potentially functional new genomic loci in primate genomes. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. In situ optical sequencing and structure analysis of a trinucleotide repeat genome region by localization microscopy after specific COMBO-FISH nano-probing

    Science.gov (United States)

    Stuhlmüller, M.; Schwarz-Finsterle, J.; Fey, E.; Lux, J.; Bach, M.; Cremer, C.; Hinderhofer, K.; Hausmann, M.; Hildenbrand, G.

    2015-10-01

    Trinucleotide repeat expansions (like (CGG)n) of chromatin in the genome of cell nuclei can cause neurological disorders such as for example the Fragile-X syndrome. Until now the mechanisms are not clearly understood as to how these expansions develop during cell proliferation. Therefore in situ investigations of chromatin structures on the nanoscale are required to better understand supra-molecular mechanisms on the single cell level. By super-resolution localization microscopy (Spectral Position Determination Microscopy; SPDM) in combination with nano-probing using COMBO-FISH (COMBinatorial Oligonucleotide FISH), novel insights into the nano-architecture of the genome will become possible. The native spatial structure of trinucleotide repeat expansion genome regions was analysed and optical sequencing of repetitive units was performed within 3D-conserved nuclei using SPDM after COMBO-FISH. We analysed a (CGG)n-expansion region inside the 5' untranslated region of the FMR1 gene. The number of CGG repeats for a full mutation causing the Fragile-X syndrome was found and also verified by Southern blot. The FMR1 promotor region was similarly condensed like a centromeric region whereas the arrangement of the probes labelling the expansion region seemed to indicate a loop-like nano-structure. These results for the first time demonstrate that in situ chromatin structure measurements on the nanoscale are feasible. Due to further methodological progress it will become possible to estimate the state of trinucleotide repeat mutations in detail and to determine the associated chromatin strand structural changes on the single cell level. In general, the application of the described approach to any genome region will lead to new insights into genome nano-architecture and open new avenues for understanding mechanisms and their relevance in the development of heredity diseases.

  17. Comparative genomics of the marine bacterial genus Glaciecola reveals the high degree of genomic diversity and genomic characteristic for cold adaptation.

    Science.gov (United States)

    Qin, Qi-Long; Xie, Bin-Bin; Yu, Yong; Shu, Yan-Li; Rong, Jin-Cheng; Zhang, Yan-Jiao; Zhao, Dian-Li; Chen, Xiu-Lan; Zhang, Xi-Ying; Chen, Bo; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2014-06-01

    To what extent the genomes of different species belonging to one genus can be diverse and the relationship between genomic differentiation and environmental factor remain unclear for oceanic bacteria. With many new bacterial genera and species being isolated from marine environments, this question warrants attention. In this study, we sequenced all the type strains of the published species of Glaciecola, a recently defined cold-adapted genus with species from diverse marine locations, to study the genomic diversity and cold-adaptation strategy in this genus.The genome size diverged widely from 3.08 to 5.96 Mb, which can be explained by massive gene gain and loss events. Horizontal gene transfer and new gene emergence contributed substantially to the genome size expansion. The genus Glaciecola had an open pan-genome. Comparative genomic research indicated that species of the genus Glaciecola had high diversity in genome size, gene content and genetic relatedness. This may be prevalent in marine bacterial genera considering the dynamic and complex environments of the ocean. Species of Glaciecola had some common genomic features related to cold adaptation, which enable them to thrive and play a role in biogeochemical cycle in the cold marine environments.

  18. Funding Opportunity: Genomic Data Centers

    Science.gov (United States)

    Funding Opportunity CCG, Funding Opportunity Center for Cancer Genomics, CCG, Center for Cancer Genomics, CCG RFA, Center for cancer genomics rfa, genomic data analysis network, genomic data analysis network centers,

  19. MicroScope: a platform for microbial genome annotation and comparative genomics.

    Science.gov (United States)

    Vallenet, D; Engelen, S; Mornico, D; Cruveiller, S; Fleury, L; Lajus, A; Rouy, Z; Roche, D; Salvignol, G; Scarpelli, C; Médigue, C

    2009-01-01

    The initial outcome of genome sequencing is the creation of long text strings written in a four letter alphabet. The role of in silico sequence analysis is to assist biologists in the act of associating biological knowledge with these sequences, allowing investigators to make inferences and predictions that can be tested experimentally. A wide variety of software is available to the scientific community, and can be used to identify genomic objects, before predicting their biological functions. However, only a limited number of biologically interesting features can be revealed from an isolated sequence. Comparative genomics tools, on the other hand, by bringing together the information contained in numerous genomes simultaneously, allow annotators to make inferences based on the idea that evolution and natural selection are central to the definition of all biological processes. We have developed the MicroScope platform in order to offer a web-based framework for the systematic and efficient revision of microbial genome annotation and comparative analysis (http://www.genoscope.cns.fr/agc/microscope). Starting with the description of the flow chart of the annotation processes implemented in the MicroScope pipeline, and the development of traditional and novel microbial annotation and comparative analysis tools, this article emphasizes the essential role of expert annotation as a complement of automatic annotation. Several examples illustrate the use of implemented tools for the review and curation of annotations of both new and publicly available microbial genomes within MicroScope's rich integrated genome framework. The platform is used as a viewer in order to browse updated annotation information of available microbial genomes (more than 440 organisms to date), and in the context of new annotation projects (117 bacterial genomes). The human expertise gathered in the MicroScope database (about 280,000 independent annotations) contributes to improve the quality of

  20. Ebolavirus comparative genomics

    DEFF Research Database (Denmark)

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat

    2015-01-01

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms...

  1. SIGMA: A System for Integrative Genomic Microarray Analysis of Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Davies Jonathan J

    2006-12-01

    Full Text Available Abstract Background The prevalence of high resolution profiling of genomes has created a need for the integrative analysis of information generated from multiple methodologies and platforms. Although the majority of data in the public domain are gene expression profiles, and expression analysis software are available, the increase of array CGH studies has enabled integration of high throughput genomic and gene expression datasets. However, tools for direct mining and analysis of array CGH data are limited. Hence, there is a great need for analytical and display software tailored to cross platform integrative analysis of cancer genomes. Results We have created a user-friendly java application to facilitate sophisticated visualization and analysis such as cross-tumor and cross-platform comparisons. To demonstrate the utility of this software, we assembled array CGH data representing Affymetrix SNP chip, Stanford cDNA arrays and whole genome tiling path array platforms for cross comparison. This cancer genome database contains 267 profiles from commonly used cancer cell lines representing 14 different tissue types. Conclusion In this study we have developed an application for the visualization and analysis of data from high resolution array CGH platforms that can be adapted for analysis of multiple types of high throughput genomic datasets. Furthermore, we invite researchers using array CGH technology to deposit both their raw and processed data, as this will be a continually expanding database of cancer genomes. This publicly available resource, the System for Integrative Genomic Microarray Analysis (SIGMA of cancer genomes, can be accessed at http://sigma.bccrc.ca.

  2. Genomics With Cloud Computing

    OpenAIRE

    Sukhamrit Kaur; Sandeep Kaur

    2015-01-01

    Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computin...

  3. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  4. Use of a sensitive EnVision +-based detection system for Western blotting: avoidance of streptavidin binding to endogenous biotin and biotin-containing proteins in kidney and other tissues.

    Science.gov (United States)

    Banks, Rosamonde E; Craven, Rachel A; Harnden, Patricia A; Selby, Peter J

    2003-04-01

    Western blotting remains a central technique in confirming identities of proteins, their quantitation and analysis of various isoforms. The biotin-avidin/streptavidin system is often used as an amplification step to increase sensitivity but in some tissues such as kidney, "nonspecific" interactions may be a problem due to high levels of endogenous biotin-containing proteins. The EnVision system, developed for immunohistochemical applications, relies on binding of a polymeric conjugate consisting of up to 100 peroxidase molecules and 20 secondary antibody molecules linked directly to an activated dextran backbone, to the primary antibody. This study demonstrates that it is also a viable and sensitive alternative detection system in Western blotting applications.

  5. The genome portal of the Department of Energy Joint Genome Institute: 2014 updates

    Energy Technology Data Exchange (ETDEWEB)

    Nordberg, Henrik [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Cantor, Michael [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Dusheyko, Serge [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Hua, Susan [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Poliakov, Alexander [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Shabalov, Igor [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Smirnova, Tatyana [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Grigoriev, Igor V. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Dubchak, Inna [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States)

    2013-11-12

    The U.S. Department of Energy (DOE) Joint Genome Institute (JGI), a national user facility, serves the diverse scientific community by providing integrated high-throughput sequencing and computational analysis to enable system-based scientific approaches in support of DOE missions related to clean energy generation and environmental characterization. The JGI Genome Portal (http://genome.jgi.doe.gov) provides unified access to all JGI genomic databases and analytical tools. The JGI maintains extensive data management systems and specialized analytical capabilities to manage and interpret complex genomic data. A user can search, download and explore multiple data sets available for all DOE JGI sequencing projects including their status, assemblies and annotations of sequenced genomes. In this paper, we describe major updates of the Genome Portal in the past 2 years with a specific emphasis on efficient handling of the rapidly growing amount of diverse genomic data accumulated in JGI.

  6. Herbarium genomics

    DEFF Research Database (Denmark)

    Bakker, Freek T.; Lei, Di; Yu, Jiaying

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...... up to 146 years old. We use genome skimming and an automated assembly pipeline, Iterative Organelle Genome Assembly, that assembles paired-end reads into a series of candidate assemblies, the best one of which is selected based on likelihood estimation. We used 93 specimens from 12 different...... correlation between plastome coverage and nuclear genome size (C value) in our samples, but the range of C values included is limited. Finally, we conclude that routine plastome sequencing from herbarium specimens is feasible and cost-effective (compared with Sanger sequencing or plastome...

  7. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  8. Effects of sample treatments on genome recovery via single-cell genomics

    Energy Technology Data Exchange (ETDEWEB)

    Clingenpeel, Scott [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Schwientek, Patrick [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Hugenholtz, Philip [Univ. of Queensland, Brisbane (Australia); Woyke, Tanja [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States)

    2014-06-13

    It is known that single-cell genomics is a powerful tool for accessing genetic information from uncultivated microorganisms. Methods of handling samples before single-cell genomic amplification may affect the quality of the genomes obtained. Using three bacterial strains we demonstrate that, compared to cryopreservation, lower-quality single-cell genomes are recovered when the sample is preserved in ethanol or if the sample undergoes fluorescence in situ hybridization, while sample preservation in paraformaldehyde renders it completely unsuitable for sequencing.

  9. [Western Blot diagnostic yield for simultaneous antibody-detection in patients with human cysticercosis, hydatidosis, and human fascioliasis].

    Science.gov (United States)

    Davelois, Kelly; Escalante, Hermes; Jara, César

    2016-01-01

    . To determine the diagnostic yield using western blotting to simultaneously detect antibodies in patients with human cysticercosis, hydatidosis, and human fascioliasis. Materials and methods . Cross-sectional study of diagnostic yield assessment. Excretory/secretory antigens were obtained from Taenia solium larvae, Echinococcus granulosus cysts, and the adult flukes of Fasciola hepática, which were then separated using the polyacrylamide gel electrophoresis technique, transferred, and attached to a nitrocellulose membrane to be probed with sera from the patient infected with the three parasites. The sensitivity of the technique was assessed using 300 individual serum samples, 60 pools of two parasites, and 20 pools of three parasites with 75 sera from patients with other parasites, 10 from patients with other diseases, and 15 from patients without parasites. Results . The technique revealed 13 glycoproteins (GP): GP 35, 31, 24, 23, 18, 17, 14, and 13 kDa for cysticercosis; GP 8, 16, and 21 kDa for hydatidosis; and GP 17 and 23 kDa for fascioliasis. The test detected the presence of antibodies with a sensitivity of 96% (95% confidence interval [CI] = 94.62-98.54%) in the detection of one or the thirteen bands, a specificity of 100% (95% CI = 99.50-100.00%); individually, there was a sensitivity for cysticercosis of 97% (95% CI = 93.16-100.00%), for hydatidosis of 94% (95% CI = 88.85-99.15%) and for fascioliasis of 96% (95% CI = 91.66-100.00%). Conclusions . Western blotting is effective in the simultaneous detection of antibodies in patients with human cysticercosis, hydatidosis, and fascioliasis, and it can be used as a diagnostic test to either rule out or confirm the presence of antibodies in endemic areas.

  10. Informational laws of genome structures

    Science.gov (United States)

    Bonnici, Vincenzo; Manca, Vincenzo

    2016-06-01

    In recent years, the analysis of genomes by means of strings of length k occurring in the genomes, called k-mers, has provided important insights into the basic mechanisms and design principles of genome structures. In the present study, we focus on the proper choice of the value of k for applying information theoretic concepts that express intrinsic aspects of genomes. The value k = lg2(n), where n is the genome length, is determined to be the best choice in the definition of some genomic informational indexes that are studied and computed for seventy genomes. These indexes, which are based on information entropies and on suitable comparisons with random genomes, suggest five informational laws, to which all of the considered genomes obey. Moreover, an informational genome complexity measure is proposed, which is a generalized logistic map that balances entropic and anti-entropic components of genomes and is related to their evolutionary dynamics. Finally, applications to computational synthetic biology are briefly outlined.

  11. How genome complexity can explain the difficulty of aligning reads to genomes.

    Science.gov (United States)

    Phan, Vinhthuy; Gao, Shanshan; Tran, Quang; Vo, Nam S

    2015-01-01

    Although it is frequently observed that aligning short reads to genomes becomes harder if they contain complex repeat patterns, there has not been much effort to quantify the relationship between complexity of genomes and difficulty of short-read alignment. Existing measures of sequence complexity seem unsuitable for the understanding and quantification of this relationship. We investigated several measures of complexity and found that length-sensitive measures of complexity had the highest correlation to accuracy of alignment. In particular, the rate of distinct substrings of length k, where k is similar to the read length, correlated very highly to alignment performance in terms of precision and recall. We showed how to compute this measure efficiently in linear time, making it useful in practice to estimate quickly the difficulty of alignment for new genomes without having to align reads to them first. We showed how the length-sensitive measures could provide additional information for choosing aligners that would align consistently accurately on new genomes. We formally established a connection between genome complexity and the accuracy of short-read aligners. The relationship between genome complexity and alignment accuracy provides additional useful information for selecting suitable aligners for new genomes. Further, this work suggests that the complexity of genomes sometimes should be thought of in terms of specific computational problems, such as the alignment of short reads to genomes.

  12. Species delimitation and interspecific relationships of the genus Orychophragmus (Brassicaceae inferred from whole chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Huan Hu

    2016-12-01

    Full Text Available IntroductionIt is rather difficult to delimit recently diverged species and construct their interspecific relationships because of insufficient informative variations of sampled DNA fragments (Schluter, 2000; Arnold, 2006. The genome-scale sequence variations were found to increase the phylogenetic resolutions of both high- and low-taxonomic groups (e.g., Yoder et al., 2013; Lamichhaney et al., 2015. It is still expensive to collect nuclear genome variations between species for most none-model genera without the reference genome. However, chloroplast genomes (plastome are relatively easy to be assembled to examine interspecific relationships for phylogenetic analyses, especially in addressing unresolved relationship at low taxonomic levels (Wu et al., 2010; Nock et al., 2011; Yang et al., 2013; Huang et al., 2014; Carbonell-Caballero et al., 2015. Plastomes are haploid with maternal inheritance in most angiosperms (Corriveau and Coleman, 1988; Zhang and Liu, 2003; Hagemann, 2004 and are highly conservative in gene order and genome structure with rare recombinations (Jansen et al., 2007; Moore et al., 2010. In this study, we aimed to examine species delimitation and interspecific relationships in Orychophragmus through assembling chloroplast genomes of multiple individuals of tentatively delimited species (Hu et al., 2015a. Orychophragmus is a small genus in the mustard family (Brassicaceae, Cruciferae distributed in northern, central, and southeastern China (Zhou et al., 2001. Its plants have been widely cultivated as ornamentals, vegetables, or source of seed oil (Sun et al., 2011. Despite controversial species delimitations in the genus (Zhou et al., 1987; Tan et al., 1998; Wu and Zhao, 2003; Al-Shehbaz and Yang, 2000; Zhou et al., 2001; Sun et al., 2012, our recent study based on nuclear (nr ITS sequence variations suggested the recognition of seven species (Hu et al., 2015a. Orychophragmus is sister to Sinalliaria, which is a genus endemic

  13. Phytozome Comparative Plant Genomics Portal

    Energy Technology Data Exchange (ETDEWEB)

    Goodstein, David; Batra, Sajeev; Carlson, Joseph; Hayes, Richard; Phillips, Jeremy; Shu, Shengqiang; Schmutz, Jeremy; Rokhsar, Daniel

    2014-09-09

    The Dept. of Energy Joint Genome Institute is a genomics user facility supporting DOE mission science in the areas of Bioenergy, Carbon Cycling, and Biogeochemistry. The Plant Program at the JGI applies genomic, analytical, computational and informatics platforms and methods to: 1. Understand and accelerate the improvement (domestication) of bioenergy crops 2. Characterize and moderate plant response to climate change 3. Use comparative genomics to identify constrained elements and infer gene function 4. Build high quality genomic resource platforms of JGI Plant Flagship genomes for functional and experimental work 5. Expand functional genomic resources for Plant Flagship genomes

  14. A Taste of Algal Genomes from the Joint Genome Institute

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alan; Grigoriev, Igor

    2012-06-17

    Algae play profound roles in aquatic food chains and the carbon cycle, can impose health and economic costs through toxic blooms, provide models for the study of symbiosis, photosynthesis, and eukaryotic evolution, and are candidate sources for bio-fuels; all of these research areas are part of the mission of DOE's Joint Genome Institute (JGI). To date JGI has sequenced, assembled, annotated, and released to the public the genomes of 18 species and strains of algae, sampling almost all of the major clades of photosynthetic eukaryotes. With more algal genomes currently undergoing analysis, JGI continues its commitment to driving forward basic and applied algal science. Among these ongoing projects are the pan-genome of the dominant coccolithophore Emiliania huxleyi, the interrelationships between the 4 genomes in the nucleomorph-containing Bigelowiella natans and Guillardia theta, and the search for symbiosis genes of lichens.

  15. Population Genomics Reveals Seahorses (Hippocampus erectus) of the Western Mid-Atlantic Coast to Be Residents Rather than Vagrants

    Science.gov (United States)

    Boehm, J. T.; Waldman, John; Robinson, John D.; Hickerson, Michael J.

    2015-01-01

    Understanding population structure and areas of demographic persistence and transients is critical for effective species management. However, direct observational evidence to address the geographic scale and delineation of ephemeral or persistent populations for many marine fishes is limited. The Lined seahorse (Hippocampus erectus) can be commonly found in three western Atlantic zoogeographic provinces, though inhabitants of the temperate northern Virginia Province are often considered tropical vagrants that only arrive during warm seasons from the southern provinces and perish as temperatures decline. Although genetics can locate regions of historical population persistence and isolation, previous evidence of Virginia Province persistence is only provisional due to limited genetic sampling (i.e., mitochondrial DNA and five nuclear loci). To test alternative hypotheses of historical persistence versus the ephemerality of a northern Virginia Province population we used a RADseq generated dataset consisting of 11,708 single nucleotide polymorphisms (SNP) sampled from individuals collected from the eastern Gulf of Mexico to Long Island, NY. Concordant results from genomic analyses all infer three genetically divergent subpopulations, and strongly support Virginia Province inhabitants as a genetically diverged and a historically persistent ancestral gene pool. These results suggest that individuals that emerge in coastal areas during the warm season can be considered “local” and supports offshore migration during the colder months. This research demonstrates how a large number of genes sampled across a geographical range can capture the diversity of coalescent histories (across loci) while inferring population history. Moreover, these results clearly demonstrate the utility of population genomic data to infer peripheral subpopulation persistence in difficult-to-observe species. PMID:25629166

  16. Population genomics reveals seahorses (Hippocampus erectus of the western mid-Atlantic coast to be residents rather than vagrants.

    Directory of Open Access Journals (Sweden)

    J T Boehm

    Full Text Available Understanding population structure and areas of demographic persistence and transients is critical for effective species management. However, direct observational evidence to address the geographic scale and delineation of ephemeral or persistent populations for many marine fishes is limited. The Lined seahorse (Hippocampus erectus can be commonly found in three western Atlantic zoogeographic provinces, though inhabitants of the temperate northern Virginia Province are often considered tropical vagrants that only arrive during warm seasons from the southern provinces and perish as temperatures decline. Although genetics can locate regions of historical population persistence and isolation, previous evidence of Virginia Province persistence is only provisional due to limited genetic sampling (i.e., mitochondrial DNA and five nuclear loci. To test alternative hypotheses of historical persistence versus the ephemerality of a northern Virginia Province population we used a RADseq generated dataset consisting of 11,708 single nucleotide polymorphisms (SNP sampled from individuals collected from the eastern Gulf of Mexico to Long Island, NY. Concordant results from genomic analyses all infer three genetically divergent subpopulations, and strongly support Virginia Province inhabitants as a genetically diverged and a historically persistent ancestral gene pool. These results suggest that individuals that emerge in coastal areas during the warm season can be considered "local" and supports offshore migration during the colder months. This research demonstrates how a large number of genes sampled across a geographical range can capture the diversity of coalescent histories (across loci while inferring population history. Moreover, these results clearly demonstrate the utility of population genomic data to infer peripheral subpopulation persistence in difficult-to-observe species.

  17. PGSB/MIPS Plant Genome Information Resources and Concepts for the Analysis of Complex Grass Genomes.

    Science.gov (United States)

    Spannagl, Manuel; Bader, Kai; Pfeifer, Matthias; Nussbaumer, Thomas; Mayer, Klaus F X

    2016-01-01

    PGSB (Plant Genome and Systems Biology; formerly MIPS-Munich Institute for Protein Sequences) has been involved in developing, implementing and maintaining plant genome databases for more than a decade. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable datasets for model plant genomes as a backbone against which experimental data, e.g., from high-throughput functional genomics, can be organized and analyzed. In addition, genomes from both model and crop plants form a scaffold for comparative genomics, assisted by specialized tools such as the CrowsNest viewer to explore conserved gene order (synteny) between related species on macro- and micro-levels.The genomes of many economically important Triticeae plants such as wheat, barley, and rye present a great challenge for sequence assembly and bioinformatic analysis due to their enormous complexity and large genome size. Novel concepts and strategies have been developed to deal with these difficulties and have been applied to the genomes of wheat, barley, rye, and other cereals. This includes the GenomeZipper concept, reference-guided exome assembly, and "chromosome genomics" based on flow cytometry sorted chromosomes.

  18. Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

    Science.gov (United States)

    Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

    2013-01-01

    Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal

  19. Next-Generation Genomics Facility at C-CAMP: Accelerating Genomic Research in India

    Science.gov (United States)

    S, Chandana; Russiachand, Heikham; H, Pradeep; S, Shilpa; M, Ashwini; S, Sahana; B, Jayanth; Atla, Goutham; Jain, Smita; Arunkumar, Nandini; Gowda, Malali

    2014-01-01

    Next-Generation Sequencing (NGS; http://www.genome.gov/12513162) is a recent life-sciences technological revolution that allows scientists to decode genomes or transcriptomes at a much faster rate with a lower cost. Genomic-based studies are in a relatively slow pace in India due to the non-availability of genomics experts, trained personnel and dedicated service providers. Using NGS there is a lot of potential to study India's national diversity (of all kinds). We at the Centre for Cellular and Molecular Platforms (C-CAMP) have launched the Next Generation Genomics Facility (NGGF) to provide genomics service to scientists, to train researchers and also work on national and international genomic projects. We have HiSeq1000 from Illumina and GS-FLX Plus from Roche454. The long reads from GS FLX Plus, and high sequence depth from HiSeq1000, are the best and ideal hybrid approaches for de novo and re-sequencing of genomes and transcriptomes. At our facility, we have sequenced around 70 different organisms comprising of more than 388 genomes and 615 transcriptomes – prokaryotes and eukaryotes (fungi, plants and animals). In addition we have optimized other unique applications such as small RNA (miRNA, siRNA etc), long Mate-pair sequencing (2 to 20 Kb), Coding sequences (Exome), Methylome (ChIP-Seq), Restriction Mapping (RAD-Seq), Human Leukocyte Antigen (HLA) typing, mixed genomes (metagenomes) and target amplicons, etc. Translating DNA sequence data from NGS sequencer into meaningful information is an important exercise. Under NGGF, we have bioinformatics experts and high-end computing resources to dissect NGS data such as genome assembly and annotation, gene expression, target enrichment, variant calling (SSR or SNP), comparative analysis etc. Our services (sequencing and bioinformatics) have been utilized by more than 45 organizations (academia and industry) both within India and outside, resulting several publications in peer-reviewed journals and several genomic

  20. Extreme genomes

    OpenAIRE

    DeLong, Edward F

    2000-01-01

    The complete genome sequence of Thermoplasma acidophilum, an acid- and heat-loving archaeon, has recently been reported. Comparative genomic analysis of this 'extremophile' is providing new insights into the metabolic machinery, ecology and evolution of thermophilic archaea.

  1. GenomePeek—an online tool for prokaryotic genome and metagenome analysis

    Directory of Open Access Journals (Sweden)

    Katelyn McNair

    2015-06-01

    Full Text Available As more and more prokaryotic sequencing takes place, a method to quickly and accurately analyze this data is needed. Previous tools are mainly designed for metagenomic analysis and have limitations; such as long runtimes and significant false positive error rates. The online tool GenomePeek (edwards.sdsu.edu/GenomePeek was developed to analyze both single genome and metagenome sequencing files, quickly and with low error rates. GenomePeek uses a sequence assembly approach where reads to a set of conserved genes are extracted, assembled and then aligned against the highly specific reference database. GenomePeek was found to be faster than traditional approaches while still keeping error rates low, as well as offering unique data visualization options.

  2. Detection of anti-HIV-1 IgG antibodies in whole saliva by GACELISA and Western blot assays.

    Science.gov (United States)

    Matee, M I; Lyamuya, E F; Simon, E; Mbena, E C; Kagoma, C; Samaranayake, L P; Scheutz, F

    1996-05-01

    The present study, based on 158 HIV seropositives and 167 HIV seronegatives, demonstrates that saliva collected with the Omni-SAL device and tested with GACELISA (an IgG antibody capture ELISA) is an effective non-invasive alternative to serum for anti-HIV IgG antibody screening. The study also shows that a conventional serum Western blot kit can be used, with slight modifications, for confirmatory testing of saliva specimens. Collecting saliva with the Omni-SAL device had a very good acceptance rate among Tanzanian subjects, and although this diagnostic method is not yet known by the general public, 65% of the study participants preferred to give saliva instead of blood for HIV testing.

  3. Genome-wide profiling of the PIWI-interacting RNA-mRNA regulatory networks in epithelial ovarian cancers.

    Science.gov (United States)

    Singh, Garima; Roy, Jyoti; Rout, Pratiti; Mallick, Bibekanand

    2018-01-01

    PIWI-interacting (piRNAs), ~23-36 nucleotide-long small non-coding RNAs (sncRNAs), earlier believed to be germline-specific, have now been identified in somatic cells, including cancer cells. These sncRNAs impact critical biological processes by fine-tuning gene expression at post-transcriptional and epigenetic levels. The expression of piRNAs in ovarian cancer, the most lethal gynecologic cancer is largely uncharted. In this study, we investigated the expression of PIWILs by qRT-PCR and western blotting and then identified piRNA transcriptomes in tissues of normal ovary and two most prevalent epithelial ovarian cancer subtypes, serous and endometrioid by small RNA sequencing. We detected 219, 256 and 234 piRNAs in normal ovary, endometrioid and serous ovarian cancer samples respectively. We observed piRNAs are encoded from various genomic regions, among which introns harbor the majority of them. Surprisingly, piRNAs originated from different genomic contexts showed the varied level of conservations across vertebrates. The functional analysis of predicted targets of differentially expressed piRNAs revealed these could modulate key processes and pathways involved in ovarian oncogenesis. Our study provides the first comprehensive piRNA landscape in these samples and a useful resource for further functional studies to decipher new mechanistic views of piRNA-mediated gene regulatory networks affecting ovarian oncogenesis. The RNA-seq data is submitted to GEO database (GSE83794).

  4. Early nongenomic events in aldosterone action in renal collecting duct cells: PKCalpha activation, mineralocorticoid receptor phosphorylation, and cross-talk with the genomic response.

    Science.gov (United States)

    Le Moëllic, Cathy; Ouvrard-Pascaud, Antoine; Capurro, Claudia; Cluzeaud, Francoise; Fay, Michel; Jaisser, Frederic; Farman, Nicolette; Blot-Chabaud, Marcel

    2004-05-01

    Effects of aldosterone on its target cells have long been considered to be mediated exclusively through the genomic pathway; however, evidence has been provided for rapid effects of the hormone that may involve nongenomic mechanisms. Whether an interaction exists between these two signaling pathways is not yet established. In this study, the authors show that aldosterone triggers both early nongenomic and late genomic increase in sodium transport in the RCCD(2) rat cortical collecting duct cell line. In these cells, the early (up to 2.5 h) aldosterone-induced increase in short-circuit current (Isc) is not blocked by the mineralocorticoid receptor (MR) antagonist RU26752, it does not require mRNA or protein synthesis, and it involves the PKCalpha signaling pathway. In addition, this early response is reproduced by aldosterone-BSA, which acts at the cell surface and presumably does not enter the cells (aldo-BSA is unable to trigger the late response). The authors also show that MR is rapidly phosphorylated on serine and threonine residues by aldosterone or aldosterone-BSA. In contrast, the late (4 to 24 h) aldosterone-induced increase in ion transport occurs through activation of the MR and requires mRNA and protein synthesis. Interestingly, nongenomic and genomic aldosterone actions appear to be interdependent. Blocking the PKCalpha pathway results in the inhibition of the late genomic response to aldosterone, as demonstrated by the suppression of aldosterone-induced increase in MR transactivation activity, alpha1 Na(+)/K(+)/ATPase mRNA, and Isc. These data suggest cross-talk between the nongenomic and genomic responses to aldosterone in renal cells and suggest that the aldosterone-MR mediated increase in mRNA/protein synthesis and ion transport depends, at least in part, upon PKCalpha activation. E-mail: marcel.blot-chabaud@pharmacie.univ-mrs.fr

  5. 7 CFR 457.143 - Northern potato crop insurance-quality endorsement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Northern potato crop insurance-quality endorsement... Northern potato crop insurance—quality endorsement. The Northern Potato Crop Insurance Quality Endorsement...) Both FCIC and reinsured policies: Northern Potato Crop Insurance Quality Endorsement 1. Definitions...

  6. Executive Summary: Forests of the Northern United States

    Science.gov (United States)

    Stephen R. Shifley; Francisco X. Aguilar; Nianfu Song; Susan I. Stewart; David J. Nowak; Dale D. Gormanson; W. Keith Moser; Sherri Wormstead; Eric J. Greenfield

    2012-01-01

    This executive summary provides an overview of the 200-page report, Forests of the Northern United States, which covers in detail current forest conditions, recent trends, issues, threats and opportunities in the forests in the 20 Northern States. It provides a context for subsequent Northern Forest Futures Project analyses that will forecast alternative future...

  7. GRAbB : Selective Assembly of Genomic Regions, a New Niche for Genomic Research

    NARCIS (Netherlands)

    Brankovics, Balázs; Zhang, Hao; van Diepeningen, Anne D; van der Lee, Theo A J; Waalwijk, Cees; de Hoog, G Sybren

    GRAbB (Genomic Region Assembly by Baiting) is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often

  8. Comparative Genome Viewer

    International Nuclear Information System (INIS)

    Molineris, I.; Sales, G.

    2009-01-01

    The amount of information about genomes, both in the form of complete sequences and annotations, has been exponentially increasing in the last few years. As a result there is the need for tools providing a graphical representation of such information that should be comprehensive and intuitive. Visual representation is especially important in the comparative genomics field since it should provide a combined view of data belonging to different genomes. We believe that existing tools are limited in this respect as they focus on a single genome at a time (conservation histograms) or compress alignment representation to a single dimension. We have therefore developed a web-based tool called Comparative Genome Viewer (Cgv): it integrates a bidimensional representation of alignments between two regions, both at small and big scales, with the richness of annotations present in other genome browsers. We give access to our system through a web-based interface that provides the user with an interactive representation that can be updated in real time using the mouse to move from region to region and to zoom in on interesting details.

  9. Glycophospholipid Formulation with NADH and CoQ10 Significantly Reduces Intractable Fatigue in Western Blot-Positive ‘Chronic Lyme Disease’ Patients: Preliminary Report

    Directory of Open Access Journals (Sweden)

    Garth L. Nicolson

    2012-03-01

    Full Text Available Background: An open label 8-week preliminary study was conducted in a small number of patients to determine if a combination oral supplement containing a mixture of phosphoglycolipids, coenzyme Q10 and microencapsulated NADH and other nutrients could affect fatigue levels in long-term, Western blot-positive, multi-symptom ‘chronic Lyme disease’ patients (also called ‘post-treatment Lyme disease’ or ‘post Lyme syndrome’ with intractable fatigue. Methods: The subjects in this study were 6 males (mean age = 45.1 ± 12.4 years and 10 females (mean age = 54.6 ± 7.4 years with ‘chronic Lyme disease’ (determined by multiple symptoms and positive Western blot analysis that had been symptomatic with chronic fatigue for an average of 12.7 ± 6.6 years. They had been seen by multiple physicians (13.3 ± 7.6 and had used many other remedies, supplements and drugs (14.4 ± 7.4 without fatigue relief. Fatigue was monitored at 0, 7, 30 and 60 days using a validated instrument, the Piper Fatigue Scale.Results: Patients in this preliminary study responded to the combination test supplement, showing a 26% reduction in overall fatigue by the end of the 8-week trial (p< 0.0003. Analysis of subcategories of fatigue indicated that there were significant improvements in the ability to complete tasks and activities as well as significant improvements in mood and cognitive abilities. Regression analysis of the data indicated that reductions in fatigue were consistent and occurred with a high degree of confidence (R2= 0.998. Functional Foods in Health and Disease 2012, 2(3:35-47 Conclusions: The combination supplement was a safe and effective method to significantly reduce intractable fatigue in long-term patients with Western blot-positive ‘chronic Lyme disease.’

  10. Interim report to the Northern Ecosystem Initiative from the Northern Ecological Monitoring and Assessment Network (EMAN-North)

    International Nuclear Information System (INIS)

    Wakelyn, L.; Eamer, J.

    2001-01-01

    The Northern Ecological Monitoring and Assessment Network (EMAN-North) has received funding for a proposal submitted to the Northern Ecosystems Initiative (NEI) in January 2001. EMAN-North is a network that coordinates ecological monitoring in northern Canada. Its geographic scope comprises 40 per cent of the geographic area of Canada, including Yukon, Northwest Territories and Nunavut, and an area near Churchill, Manitoba. Funding was awarded because the proposed EMAN-North project addressed the NEI priority of Monitoring Ecosystem Status and Trends, and Ecosystem Impacts of Climate Change. The project was also aimed at improving the network's capacity for long-term ecological monitoring, assessment and reporting. Several activities deal specifically with ecological impacts of climate change. This paper described the need and the context for ecological monitoring in northern Canada and defined a strategic direction for EMAN-North. The project will include many individuals involved in ecological monitoring in the north to deliver information on ecosystem changes to decision-makers and the public. refs., tabs., figs

  11. Genomics With Cloud Computing

    Directory of Open Access Journals (Sweden)

    Sukhamrit Kaur

    2015-04-01

    Full Text Available Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computing to genomics are like easy access and sharing of data security of data less cost to pay for resources but still there are some demerits like large time needed to transfer data less network bandwidth.

  12. IMA Genome-F 5G

    OpenAIRE

    Wingfield, Brenda D.; Barnes, Irene; Wilhelm de Beer, Z.; De Vos, Lieschen; Duong, Tuan A.; Kanzi, Aquillah M.; Naidoo, Kershney; Nguyen, Hai D.T.; Santana, Quentin C.; Sayari, Mohammad; Seifert, Keith A.; Steenkamp, Emma T.; Trollip, Conrad; van der Merwe, Nicolaas A.; van der Nest, Magriet A.

    2015-01-01

    The genomes of Ceratocystis eucalypticola, Chrysoporthe cubensis, Chrysoporthe deuterocubensis, Davidsoniella virescens, Fusarium temperatum, Graphilbum fragrans, Penicillium nordicum and Thielaviopsis musarum are presented in this genome announcement. These seven genomes are from plant pathogens and otherwise economically important fungal species. The genome sizes range from 28 Mb in the case of T. musarum to 45 Mb for Fusarium temperatum. These genomes include the first reports of genomes f...

  13. Experimental Induction of Genome Chaos.

    Science.gov (United States)

    Ye, Christine J; Liu, Guo; Heng, Henry H

    2018-01-01

    Genome chaos, or karyotype chaos, represents a powerful survival strategy for somatic cells under high levels of stress/selection. Since the genome context, not the gene content, encodes the genomic blueprint of the cell, stress-induced rapid and massive reorganization of genome topology functions as a very important mechanism for genome (karyotype) evolution. In recent years, the phenomenon of genome chaos has been confirmed by various sequencing efforts, and many different terms have been coined to describe different subtypes of the chaotic genome including "chromothripsis," "chromoplexy," and "structural mutations." To advance this exciting field, we need an effective experimental system to induce and characterize the karyotype reorganization process. In this chapter, an experimental protocol to induce chaotic genomes is described, following a brief discussion of the mechanism and implication of genome chaos in cancer evolution.

  14. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  15. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  16. Genome Variation Map: a data repository of genome variations in BIG Data Center

    OpenAIRE

    Song, Shuhui; Tian, Dongmei; Li, Cuiping; Tang, Bixia; Dong, Lili; Xiao, Jingfa; Bao, Yiming; Zhao, Wenming; He, Hang; Zhang, Zhang

    2017-01-01

    Abstract The Genome Variation Map (GVM; http://bigd.big.ac.cn/gvm/) is a public data repository of genome variations. As a core resource in the BIG Data Center, Beijing Institute of Genomics, Chinese Academy of Sciences, GVM dedicates to collect, integrate and visualize genome variations for a wide range of species, accepts submissions of different types of genome variations from all over the world and provides free open access to all publicly available data in support of worldwide research a...

  17. Patient-controlled encrypted genomic data: an approach to advance clinical genomics

    Directory of Open Access Journals (Sweden)

    Trakadis Yannis J

    2012-07-01

    Full Text Available Abstract Background The revolution in DNA sequencing technologies over the past decade has made it feasible to sequence an individual’s whole genome at a relatively low cost. The potential value of the information generated by genomic technologies for medicine and society is enormous. However, in order for exome sequencing, and eventually whole genome sequencing, to be implemented clinically, a number of major challenges need to be overcome. For instance, obtaining meaningful informed-consent, managing incidental findings and the great volume of data generated (including multiple findings with uncertain clinical significance, re-interpreting the genomic data and providing additional counselling to patients as genetic knowledge evolves are issues that need to be addressed. It appears that medical genetics is shifting from the present “phenotype-first” medical model to a “data-first” model which leads to multiple complexities. Discussion This manuscript discusses the different challenges associated with integrating genomic technologies into clinical practice and describes a “phenotype-first” approach, namely, “Individualized Mutation-weighed Phenotype Search”, and its benefits. The proposed approach allows for a more efficient prioritization of the genes to be tested in a clinical lab based on both the patient’s phenotype and his/her entire genomic data. It simplifies “informed-consent” for clinical use of genomic technologies and helps to protect the patient’s autonomy and privacy. Overall, this approach could potentially render widespread use of genomic technologies, in the immediate future, practical, ethical and clinically useful. Summary The “Individualized Mutation-weighed Phenotype Search” approach allows for an incremental integration of genomic technologies into clinical practice. It ensures that we do not over-medicalize genomic data but, rather, continue our current medical model which is based on serving

  18. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  19. Sowing pregerminated northern red oak acorns

    Science.gov (United States)

    Richard M. Godman; Gilbert A. Mattson

    1992-01-01

    Northern red oak is extremely difficult to regenerate, although it has produced good acorn crops nearly half of the last 32 years in northern Wisconsin. Field trials have shown that for successful seeding, you must protect acorns from predation by wildlife and sow them when temperatures are most favorable for germination.

  20. EUPAN enables pan-genome studies of a large number of eukaryotic genomes.

    Science.gov (United States)

    Hu, Zhiqiang; Sun, Chen; Lu, Kuang-Chen; Chu, Xixia; Zhao, Yue; Lu, Jinyuan; Shi, Jianxin; Wei, Chaochun

    2017-08-01

    Pan-genome analyses are routinely carried out for bacteria to interpret the within-species gene presence/absence variations (PAVs). However, pan-genome analyses are rare for eukaryotes due to the large sizes and higher complexities of their genomes. Here we proposed EUPAN, a eukaryotic pan-genome analysis toolkit, enabling automatic large-scale eukaryotic pan-genome analyses and detection of gene PAVs at a relatively low sequencing depth. In the previous studies, we demonstrated the effectiveness and high accuracy of EUPAN in the pan-genome analysis of 453 rice genomes, in which we also revealed widespread gene PAVs among individual rice genomes. Moreover, EUPAN can be directly applied to the current re-sequencing projects primarily focusing on single nucleotide polymorphisms. EUPAN is implemented in Perl, R and C ++. It is supported under Linux and preferred for a computer cluster with LSF and SLURM job scheduling system. EUPAN together with its standard operating procedure (SOP) is freely available for non-commercial use (CC BY-NC 4.0) at http://cgm.sjtu.edu.cn/eupan/index.html . ccwei@sjtu.edu.cn or jianxin.shi@sjtu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  1. The Drosophila genome nexus: a population genomic resource of 623 Drosophila melanogaster genomes, including 197 from a single ancestral range population.

    Science.gov (United States)

    Lack, Justin B; Cardeno, Charis M; Crepeau, Marc W; Taylor, William; Corbett-Detig, Russell B; Stevens, Kristian A; Langley, Charles H; Pool, John E

    2015-04-01

    Hundreds of wild-derived Drosophila melanogaster genomes have been published, but rigorous comparisons across data sets are precluded by differences in alignment methodology. The most common approach to reference-based genome assembly is a single round of alignment followed by quality filtering and variant detection. We evaluated variations and extensions of this approach and settled on an assembly strategy that utilizes two alignment programs and incorporates both substitutions and short indels to construct an updated reference for a second round of mapping prior to final variant detection. Utilizing this approach, we reassembled published D. melanogaster population genomic data sets and added unpublished genomes from several sub-Saharan populations. Most notably, we present aligned data from phase 3 of the Drosophila Population Genomics Project (DPGP3), which provides 197 genomes from a single ancestral range population of D. melanogaster (from Zambia). The large sample size, high genetic diversity, and potentially simpler demographic history of the DPGP3 sample will make this a highly valuable resource for fundamental population genetic research. The complete set of assemblies described here, termed the Drosophila Genome Nexus, presently comprises 623 consistently aligned genomes and is publicly available in multiple formats with supporting documentation and bioinformatic tools. This resource will greatly facilitate population genomic analysis in this model species by reducing the methodological differences between data sets. Copyright © 2015 by the Genetics Society of America.

  2. Identification of toxocara canis antigens by Western blot in experimentally infected rabbits

    Directory of Open Access Journals (Sweden)

    MORALES Olga Lucía

    2002-01-01

    Full Text Available Toxocariasis is a frequent helminthiasis that can cause visceral and ocular damage in humans specially in children. The identification of specific antigens of Toxocara canis is important in order to develop better diagnostic techniques. Ten rabbits were infected orally with a dose of 5000 Toxocara canis embryonated eggs. Rabbits were bled periodically and an ELISA assay was performed to determine levels of specific Toxocara IgG antibodies. ELISA detected antibodies at day 15 after infection. Western blot (WB assay was performed using excretory/secretory antigens (E/S of T. canis second stage larvae. Different antigen concentrations were evaluated: 150, 200, 250 and 300 µg/mL. The concentration of 250 µg/mL was retained for analysis. Rabbit sera were diluted 1:100. Secondary antibody was used at a dilution of 1:1000. Results of WB indicated that in the first month after infection specific antibodies against the 200 KDa, 116 KDa, 92 KDa and 35 KDa antigens were detected; antibodies against the 92 KDa, 80 KDa, 66 KDa, 45 KDa, 31 KDa and 28 KDa antigens appeared later. All positive sera in the ELISA test were also positive in WB. Two antigen bands, 92 KDa and 35 KDa, were identified since the beginning and throughout the course of infection. These antigens merit further evaluation as candidates for use in diagnosis.

  3. Direct tissue blot immunoassay for detection of Xylella fastidiosa in olive trees

    Directory of Open Access Journals (Sweden)

    Khaled DJELOUAH

    2015-01-01

    Full Text Available A direct tissue blot immunoassay (DTBIA technique has been compared with ELISA and PCR for detection of Xylella fastidiosa in olive trees from Apulia (southern Italy. Fresh cross-sections of young twigs and leaf petioles were printed onto nitrocellulose membranes and analyzed in the laboratory. Analyses of a first group of 61 samples gave similar efficiency for the three diagnostic techniques for detection the bacterium (24 positive and 36 negative samples, except for a single sample which was positive only with DTBIA and PCR. Similar results were obtained by separately analyzing suckers and twigs collected from different sectors of tree canopies of a second group of 20 olive trees (ten symptomatic and ten symptomless. In this second test the three diagnostic techniques confirmed the irregular distribution of the bacterium in the tree canopies and erratic detectability of the pathogen in the young suckers. It is therefore necessary to analyse composite samples per tree which should be prepared with twigs collected from different sides of the canopy. The efficiency comparable to ELISA and PCR, combined with the advantages of easier handling, speed and cost, make DTBIA a valid alternative to ELISA in large-scale surveys for occurrence of X. fastidiosa. Moreover, the printing of membranes directly in the field prevents infections spreading to Xylella-free areas, through movement of plant material with pathogen vectors for laboratory testing.

  4. GI-POP: a combinational annotation and genomic island prediction pipeline for ongoing microbial genome projects.

    Science.gov (United States)

    Lee, Chi-Ching; Chen, Yi-Ping Phoebe; Yao, Tzu-Jung; Ma, Cheng-Yu; Lo, Wei-Cheng; Lyu, Ping-Chiang; Tang, Chuan Yi

    2013-04-10

    Sequencing of microbial genomes is important because of microbial-carrying antibiotic and pathogenetic activities. However, even with the help of new assembling software, finishing a whole genome is a time-consuming task. In most bacteria, pathogenetic or antibiotic genes are carried in genomic islands. Therefore, a quick genomic island (GI) prediction method is useful for ongoing sequencing genomes. In this work, we built a Web server called GI-POP (http://gipop.life.nthu.edu.tw) which integrates a sequence assembling tool, a functional annotation pipeline, and a high-performance GI predicting module, in a support vector machine (SVM)-based method called genomic island genomic profile scanning (GI-GPS). The draft genomes of the ongoing genome projects in contigs or scaffolds can be submitted to our Web server, and it provides the functional annotation and highly probable GI-predicting results. GI-POP is a comprehensive annotation Web server designed for ongoing genome project analysis. Researchers can perform annotation and obtain pre-analytic information include possible GIs, coding/non-coding sequences and functional analysis from their draft genomes. This pre-analytic system can provide useful information for finishing a genome sequencing project. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. The Amaranth Genome: Genome, Transcriptome, and Physical Map Assembly

    Directory of Open Access Journals (Sweden)

    J. W. Clouse

    2016-03-01

    Full Text Available Amaranth ( L. is an emerging pseudocereal native to the New World that has garnered increased attention in recent years because of its nutritional quality, in particular its seed protein and more specifically its high levels of the essential amino acid lysine. It belongs to the Amaranthaceae family, is an ancient paleopolyploid that shows disomic inheritance (2 = 32, and has an estimated genome size of 466 Mb. Here we present a high-quality draft genome sequence of the grain amaranth. The genome assembly consisted of 377 Mb in 3518 scaffolds with an N of 371 kb. Repetitive element analysis predicted that 48% of the genome is comprised of repeat sequences, of which -like elements were the most commonly classified retrotransposon. A de novo transcriptome consisting of 66,370 contigs was assembled from eight different amaranth tissue and abiotic stress libraries. Annotation of the genome identified 23,059 protein-coding genes. Seven grain amaranths (, , and and their putative progenitor ( were resequenced. A single nucleotide polymorphism (SNP phylogeny supported the classification of as the progenitor species of the grain amaranths. Lastly, we generated a de novo physical map for using the BioNano Genomics’ Genome Mapping platform. The physical map spanned 340 Mb and a hybrid assembly using the BioNano physical maps nearly doubled the N of the assembly to 697 kb. Moreover, we analyzed synteny between amaranth and sugar beet ( L. and estimated, using analysis, the age of the most recent polyploidization event in amaranth.

  6. Whole genome sequencing and bioinformatics analysis of two Egyptian genomes.

    Science.gov (United States)

    ElHefnawi, Mahmoud; Jeon, Sungwon; Bhak, Youngjune; ElFiky, Asmaa; Horaiz, Ahmed; Jun, JeHoon; Kim, Hyunho; Bhak, Jong

    2018-05-15

    We report two Egyptian male genomes (EGP1 and EGP2) sequenced at ~ 30× sequencing depths. EGP1 had 4.7 million variants, where 198,877 were novel variants while EGP2 had 209,109 novel variants out of 4.8 million variants. The mitochondrial haplogroup of the two individuals were identified to be H7b1 and L2a1c, respectively. We also identified the Y haplogroup of EGP1 (R1b) and EGP2 (J1a2a1a2 > P58 > FGC11). EGP1 had a mutation in the NADH gene of the mitochondrial genome ND4 (m.11778 G > A) that causes Leber's hereditary optic neuropathy. Some SNPs shared by the two genomes were associated with an increased level of cholesterol and triglycerides, probably related with Egyptians obesity. Comparison of these genomes with African and Western-Asian genomes can provide insights on Egyptian ancestry and genetic history. This resource can be used to further understand genomic diversity and functional classification of variants as well as human migration and evolution across Africa and Western-Asia. Copyright © 2017. Published by Elsevier B.V.

  7. Genomic Testing

    Science.gov (United States)

    ... this database. Top of Page Evaluation of Genomic Applications in Practice and Prevention (EGAPP™) In 2004, the Centers for Disease Control and Prevention launched the EGAPP initiative to establish and test a ... and other applications of genomic technology that are in transition from ...

  8. Whole-genome resequencing reveals candidate mutations for pig prolificacy.

    Science.gov (United States)

    Li, Wen-Ting; Zhang, Meng-Meng; Li, Qi-Gang; Tang, Hui; Zhang, Li-Fan; Wang, Ke-Jun; Zhu, Mu-Zhen; Lu, Yun-Feng; Bao, Hai-Gang; Zhang, Yuan-Ming; Li, Qiu-Yan; Wu, Ke-Liang; Wu, Chang-Xin

    2017-12-20

    Changes in pig fertility have occurred as a result of domestication, but are not understood at the level of genetic variation. To identify variations potentially responsible for prolificacy, we sequenced the genomes of the highly prolific Taihu pig breed and four control breeds. Genes involved in embryogenesis and morphogenesis were targeted in the Taihu pig, consistent with the morphological differences observed between the Taihu pig and others during pregnancy. Additionally, excessive functional non-coding mutations have been specifically fixed or nearly fixed in the Taihu pig. We focused attention on an oestrogen response element (ERE) within the first intron of the bone morphogenetic protein receptor type-1B gene ( BMPR1B ) that overlaps with a known quantitative trait locus (QTL) for pig fecundity. Using 242 pigs from 30 different breeds, we confirmed that the genotype of the ERE was nearly fixed in the Taihu pig. ERE function was assessed by luciferase assays, examination of histological sections, chromatin immunoprecipitation, quantitative polymerase chain reactions, and western blots. The results suggest that the ERE may control pig prolificacy via the cis-regulation of BMPR1B expression. This study provides new insight into changes in reproductive performance and highlights the role of non-coding mutations in generating phenotypic diversity between breeds. © 2017 The Author(s).

  9. African Journals Online: Northern Mariana Islands

    African Journals Online (AJOL)

    African Journals Online: Northern Mariana Islands. Home > African Journals Online: Northern Mariana Islands. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Browse By Category · Browse Alphabetically · Browse By Country · List All Titles · Free to read Titles This ...

  10. Whole genome sequencing as the ultimate tool to diagnose tuberculosis

    Directory of Open Access Journals (Sweden)

    Dick van Soolingen

    2016-01-01

    Full Text Available In the past two decades, DNA techniques have been increasingly used in the laboratory diagnosis of tuberculosis (TB. The (sub species of the Mycobacterium tuberculosis complex are usually identified using reverse line blot techniques. The resistance is predicted by the detection of mutations in genes associated with resistance. Nevertheless, all cases are still subjected to cumbersome phenotypic resistance testing. The production of a strain-characteristic DNA fingerprint, to investigate the epidemiology of TB, is done by the 24-locus variable number tandem repeat (VNTR typing. However, most of the molecular techniques in the diagnosis of TB can eventually be replaced by whole genome sequencing (WGS. Many international TB reference laboratories are currently working on the introduction of WGS; however, standardization in the international context is lacking. The European Centre for Infectious Disease Prevention and Control in Stockholm, Sweden organizes a yearly round of quality control on VNTR typing and in 2015 for the first time also WGS. In this first proficiency study, only three out of eight international TB laboratories produced WGS results in line with those of the reference laboratory. The whole process of DNA isolation, purification, quantification, sequencing, and analysis/interpretation of data is still under development. In this presentation, many aspects will be covered that influence the quality and interpretation of WGS results. The turn-around-time, analysis, and utility of WGS will be discussed. Moreover, the experiences in the use of WGS in the molecular epidemiology of TB in The Netherlands are detailed. It can be concluded that many difficulties still have to be conquered. The state of the art is that bacteria still have to be cultured to have sufficient quality and quantity of DNA for succesful WGS. The quality of sequencing has improved significantly over the past 7 years, and the detection of mutations has, therefore

  11. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    OpenAIRE

    Henrique Machado; Henrique Machado; Lone Gram

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationship...

  12. Baculovirus Genomics

    NARCIS (Netherlands)

    Oers, van M.M.; Vlak, J.M.

    2007-01-01

    Baculovirus genomes are covalently closed circles of double stranded-DNA varying in size between 80 and 180 kilobase-pair. The genomes of more than fourty-one baculoviruses have been sequenced to date. The majority of these (37) are pathogenic to lepidopteran hosts; three infect sawflies

  13. Genome-wide association study of retinopathy in individuals without diabetes.

    Directory of Open Access Journals (Sweden)

    Richard A Jensen

    Full Text Available Mild retinopathy (microaneurysms or dot-blot hemorrhages is observed in persons without diabetes or hypertension and may reflect microvascular disease in other organs. We conducted a genome-wide association study (GWAS of mild retinopathy in persons without diabetes.A working group agreed on phenotype harmonization, covariate selection and analytic plans for within-cohort GWAS. An inverse-variance weighted fixed effects meta-analysis was performed with GWAS results from six cohorts of 19,411 Caucasians. The primary analysis included individuals without diabetes and secondary analyses were stratified by hypertension status. We also singled out the results from single nucleotide polymorphisms (SNPs previously shown to be associated with diabetes and hypertension, the two most common causes of retinopathy.No SNPs reached genome-wide significance in the primary analysis or the secondary analysis of participants with hypertension. SNP, rs12155400, in the histone deacetylase 9 gene (HDAC9 on chromosome 7, was associated with retinopathy in analysis of participants without hypertension, -1.3±0.23 (beta ± standard error, p = 6.6×10(-9. Evidence suggests this was a false positive finding. The minor allele frequency was low (∼2%, the quality of the imputation was moderate (r(2 ∼0.7, and no other common variants in the HDAC9 gene were associated with the outcome. SNPs found to be associated with diabetes and hypertension in other GWAS were not associated with retinopathy in persons without diabetes or in subgroups with or without hypertension.This GWAS of retinopathy in individuals without diabetes showed little evidence of genetic associations. Further studies are needed to identify genes associated with these signs in order to help unravel novel pathways and determinants of microvascular diseases.

  14. Molluscan Evolutionary Genomics

    Energy Technology Data Exchange (ETDEWEB)

    Simison, W. Brian; Boore, Jeffrey L.

    2005-12-01

    In the last 20 years there have been dramatic advances in techniques of high-throughput DNA sequencing, most recently accelerated by the Human Genome Project, a program that has determined the three billion base pair code on which we are based. Now this tremendous capability is being directed at other genome targets that are being sampled across the broad range of life. This opens up opportunities as never before for evolutionary and organismal biologists to address questions of both processes and patterns of organismal change. We stand at the dawn of a new 'modern synthesis' period, paralleling that of the early 20th century when the fledgling field of genetics first identified the underlying basis for Darwin's theory. We must now unite the efforts of systematists, paleontologists, mathematicians, computer programmers, molecular biologists, developmental biologists, and others in the pursuit of discovering what genomics can teach us about the diversity of life. Genome-level sampling for mollusks to date has mostly been limited to mitochondrial genomes and it is likely that these will continue to provide the best targets for broad phylogenetic sampling in the near future. However, we are just beginning to see an inroad into complete nuclear genome sequencing, with several mollusks and other eutrochozoans having been selected for work about to begin. Here, we provide an overview of the state of molluscan mitochondrial genomics, highlight a few of the discoveries from this research, outline the promise of broadening this dataset, describe upcoming projects to sequence whole mollusk nuclear genomes, and challenge the community to prepare for making the best use of these data.

  15. Molecular cytogenetic and genomic analyses reveal new insights into the origin of the wheat B genome.

    Science.gov (United States)

    Zhang, Wei; Zhang, Mingyi; Zhu, Xianwen; Cao, Yaping; Sun, Qing; Ma, Guojia; Chao, Shiaoman; Yan, Changhui; Xu, Steven S; Cai, Xiwen

    2018-02-01

    This work pinpointed the goatgrass chromosomal segment in the wheat B genome using modern cytogenetic and genomic technologies, and provided novel insights into the origin of the wheat B genome. Wheat is a typical allopolyploid with three homoeologous subgenomes (A, B, and D). The donors of the subgenomes A and D had been identified, but not for the subgenome B. The goatgrass Aegilops speltoides (genome SS) has been controversially considered a possible candidate for the donor of the wheat B genome. However, the relationship of the Ae. speltoides S genome with the wheat B genome remains largely obscure. The present study assessed the homology of the B and S genomes using an integrative cytogenetic and genomic approach, and revealed the contribution of Ae. speltoides to the origin of the wheat B genome. We discovered noticeable homology between wheat chromosome 1B and Ae. speltoides chromosome 1S, but not between other chromosomes in the B and S genomes. An Ae. speltoides-originated segment spanning a genomic region of approximately 10.46 Mb was detected on the long arm of wheat chromosome 1B (1BL). The Ae. speltoides-originated segment on 1BL was found to co-evolve with the rest of the B genome. Evidently, Ae. speltoides had been involved in the origin of the wheat B genome, but should not be considered an exclusive donor of this genome. The wheat B genome might have a polyphyletic origin with multiple ancestors involved, including Ae. speltoides. These novel findings will facilitate genome studies in wheat and other polyploids.

  16. RadGenomics project

    Energy Technology Data Exchange (ETDEWEB)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu [National Inst. of Radiological Sciences, Chiba (Japan). Frontier Research Center] [and others

    2002-06-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  17. RadGenomics project

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu

    2002-01-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  18. Rumen microbial genomics

    International Nuclear Information System (INIS)

    Morrison, M.; Nelson, K.E.

    2005-01-01

    Improving microbial degradation of plant cell wall polysaccharides remains one of the highest priority goals for all livestock enterprises, including the cattle herds and draught animals of developing countries. The North American Consortium for Genomics of Fibrolytic Ruminal Bacteria was created to promote the sequencing and comparative analysis of rumen microbial genomes, offering the potential to fully assess the genetic potential in a functional and comparative fashion. It has been found that the Fibrobacter succinogenes genome encodes many more endoglucanases and cellodextrinases than previously isolated, and several new processive endoglucanases have been identified by genome and proteomic analysis of Ruminococcus albus, in addition to a variety of strategies for its adhesion to fibre. The ramifications of acquiring genome sequence data for rumen microorganisms are profound, including the potential to elucidate and overcome the biochemical, ecological or physiological processes that are rate limiting for ruminal fibre degradation. (author)

  19. microRNA biosensors: Opportunities and challenges among conventional and commercially available techniques.

    Science.gov (United States)

    Kilic, Tugba; Erdem, Arzum; Ozsoz, Mehmet; Carrara, Sandro

    2018-01-15

    As being the most extensively studied, non-coding, evolutionary conserved, post-transcriptional gene regulators of genome, microRNAs (miRNAs) have taken great attention among various disciplines due to their important roles in biological processes and link with cancer. Due to their diagnostic value, there have been many conventional methods used in detection of miRNAs including northern blotting, quantitative real time PCR (qRT-PCR) and microarray technology besides novel techniques based on various nanotechnology approaches and molecular biology tools including miRNA biosensors. The aim of this review is to explain the importance of miRNAs in biomedical field with an emphasis on early cancer diagnosis by overviewing both research based and commercially available miRNA detection methods in the last decade considering their strengths and weakness with an emphasis on miRNA biosensors. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Structure and expression of the chicken calmodulin I gene

    DEFF Research Database (Denmark)

    Ye, Q; Berchtold, M W

    1997-01-01

    The chicken calmodulin I (CaMI) gene has been isolated and characterized on the level of cDNA and genomic DNA. The deduced amino acid (aa) sequence is identical to the one of chicken CaMII which consists of 148 aa. The CaMI gene contains six exons. Its intron/exon organization is identical...... to that of the chicken CaMII and the CaMI and CaMIII genes of rat and human. Expression of the CaMI gene was detected in all chicken tissues examined, although at varying levels. The gene is transcribed into four mRNAs of 0.8, 1.4, 1.7 and 4.4 kb as determined by Northern blot analysis. Our results demonstrate...... that the "multigene-one-protein" principle of CaM synthesis is not only applicable to mammals whose CaM is encoded by three different genes, but also to chickens....

  1. Molecular biology - Part I: Techniques, terminology, and concepts

    International Nuclear Information System (INIS)

    Brown, J. Martin

    1996-01-01

    Purpose/Objective: One of the barriers to understanding modern molecular biology is the lack of a clear understanding of the relevant terminology, techniques, and concepts. This refresher course is intended to address these deficiencies starting from a basic level. The lecture will cover many of the common uses of recombinant DNA, including gene cloning and manipulation. The goal is to enable the nonspecialist to increase his or her understanding of molecular biology in order to more fully enjoy reading current publications and/or listening seminars. Radiation biologists trying to understand a little more molecular biology should also benefit. The following concepts will be among those explained and illustrated: restriction endonucleases, gel electrophoresis, gene cloning, use of vectors such as plasmids, bacteriophage, cosmids and viruses, cDNA and genomic libraries, Southern, Northern, and Western blotting, fluorescent in situ hybridization, polymerase chain reaction (PCR), gel retardation, and reporter gene assays

  2. Comparative genomics reveals insights into avian genome evolution and adaptation

    Science.gov (United States)

    Zhang, Guojie; Li, Cai; Li, Qiye; Li, Bo; Larkin, Denis M.; Lee, Chul; Storz, Jay F.; Antunes, Agostinho; Greenwold, Matthew J.; Meredith, Robert W.; Ödeen, Anders; Cui, Jie; Zhou, Qi; Xu, Luohao; Pan, Hailin; Wang, Zongji; Jin, Lijun; Zhang, Pei; Hu, Haofu; Yang, Wei; Hu, Jiang; Xiao, Jin; Yang, Zhikai; Liu, Yang; Xie, Qiaolin; Yu, Hao; Lian, Jinmin; Wen, Ping; Zhang, Fang; Li, Hui; Zeng, Yongli; Xiong, Zijun; Liu, Shiping; Zhou, Long; Huang, Zhiyong; An, Na; Wang, Jie; Zheng, Qiumei; Xiong, Yingqi; Wang, Guangbiao; Wang, Bo; Wang, Jingjing; Fan, Yu; da Fonseca, Rute R.; Alfaro-Núñez, Alonzo; Schubert, Mikkel; Orlando, Ludovic; Mourier, Tobias; Howard, Jason T.; Ganapathy, Ganeshkumar; Pfenning, Andreas; Whitney, Osceola; Rivas, Miriam V.; Hara, Erina; Smith, Julia; Farré, Marta; Narayan, Jitendra; Slavov, Gancho; Romanov, Michael N; Borges, Rui; Machado, João Paulo; Khan, Imran; Springer, Mark S.; Gatesy, John; Hoffmann, Federico G.; Opazo, Juan C.; Håstad, Olle; Sawyer, Roger H.; Kim, Heebal; Kim, Kyu-Won; Kim, Hyeon Jeong; Cho, Seoae; Li, Ning; Huang, Yinhua; Bruford, Michael W.; Zhan, Xiangjiang; Dixon, Andrew; Bertelsen, Mads F.; Derryberry, Elizabeth; Warren, Wesley; Wilson, Richard K; Li, Shengbin; Ray, David A.; Green, Richard E.; O’Brien, Stephen J.; Griffin, Darren; Johnson, Warren E.; Haussler, David; Ryder, Oliver A.; Willerslev, Eske; Graves, Gary R.; Alström, Per; Fjeldså, Jon; Mindell, David P.; Edwards, Scott V.; Braun, Edward L.; Rahbek, Carsten; Burt, David W.; Houde, Peter; Zhang, Yong; Yang, Huanming; Wang, Jian; Jarvis, Erich D.; Gilbert, M. Thomas P.; Wang, Jun

    2015-01-01

    Birds are the most species-rich class of tetrapod vertebrates and have wide relevance across many research fields. We explored bird macroevolution using full genomes from 48 avian species representing all major extant clades. The avian genome is principally characterized by its constrained size, which predominantly arose because of lineage-specific erosion of repetitive elements, large segmental deletions, and gene loss. Avian genomes furthermore show a remarkably high degree of evolutionary stasis at the levels of nucleotide sequence, gene synteny, and chromosomal structure. Despite this pattern of conservation, we detected many non-neutral evolutionary changes in protein-coding genes and noncoding regions. These analyses reveal that pan-avian genomic diversity covaries with adaptations to different lifestyles and convergent evolution of traits. PMID:25504712

  3. Nucleotide variation in the mitochondrial genome provides evidence for dual routes of postglacial recolonization and genetic recombination in the northeastern brook trout (Salvelinus fontinalis).

    Science.gov (United States)

    Pilgrim, B L; Perry, R C; Barron, J L; Marshall, H D

    2012-09-26

    Levels and patterns of mitochondrial DNA (mtDNA) variation were examined to investigate the population structure and possible routes of postglacial recolonization of the world's northernmost native populations of brook trout (Salvelinus fontinalis), which are found in Labrador, Canada. We analyzed the sequence diversity of a 1960-bp portion of the mitochondrial genome (NADH dehydrogenase 1 gene and part of cytochrome oxidase 1) of 126 fish from 32 lakes distributed throughout seven regions of northeastern Canada. These populations were found to have low levels of mtDNA diversity, a characteristic trait of populations at northern extremes, with significant structuring at the level of the watershed. Upon comparison of northeastern brook trout sequences to the publicly available brook trout whole mitochondrial genome (GenBank AF154850), we infer that the GenBank sequence is from a fish whose mtDNA has recombined with that of Arctic charr (S. alpinus). The haplotype distribution provides evidence of two different postglacial founding groups contributing to present-day brook trout populations in the northernmost part of their range; the evolution of the majority of the haplotypes coincides with the timing of glacier retreat from Labrador. Our results exemplify the strong influence that historical processes such as glaciations have had on shaping the current genetic structure of northern species such as the brook trout.

  4. The Arabidopsis lyrata genome sequence and the basis of rapid genome size change

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Tina T.; Pattyn, Pedro; Bakker, Erica G.; Cao, Jun; Cheng, Jan-Fang; Clark, Richard M.; Fahlgren, Noah; Fawcett, Jeffrey A.; Grimwood, Jane; Gundlach, Heidrun; Haberer, Georg; Hollister, Jesse D.; Ossowski, Stephan; Ottilar, Robert P.; Salamov, Asaf A.; Schneeberger, Korbinian; Spannagl, Manuel; Wang, Xi; Yang, Liang; Nasrallah, Mikhail E.; Bergelson, Joy; Carrington, James C.; Gaut, Brandon S.; Schmutz, Jeremy; Mayer, Klaus F. X.; Van de Peer, Yves; Grigoriev, Igor V.; Nordborg, Magnus; Weigel, Detlef; Guo, Ya-Long

    2011-04-29

    In our manuscript, we present a high-quality genome sequence of the Arabidopsis thaliana relative, Arabidopsis lyrata, produced by dideoxy sequencing. We have performed the usual types of genome analysis (gene annotation, dN/dS studies etc. etc.), but this is relegated to the Supporting Information. Instead, we focus on what was a major motivation for sequencing this genome, namely to understand how A. thaliana lost half its genome in a few million years and lived to tell the tale. The rather surprising conclusion is that there is not a single genomic feature that accounts for the reduced genome, but that every aspect centromeres, intergenic regions, transposable elements, gene family number is affected through hundreds of thousands of cuts. This strongly suggests that overall genome size in itself is what has been under selection, a suggestion that is strongly supported by our demonstration (using population genetics data from A. thaliana) that new deletions seem to be driven to fixation.

  5. Estandarización de la técnica de Western blot para el diagnóstico de la fasciolosis humana utilizando antígenos de excreción-secreción de Fasciola hepática Western blot technique standardization of the diagnosis of human fasciolosis using Fasciola hepatica excreted-secreted antigens

    Directory of Open Access Journals (Sweden)

    Hermes Escalante

    2011-09-01

    Full Text Available Objetivos. Evaluar la eficacia de la técnica de electroinmunotransferencia (EITB o Western blot utilizando antígenos de excreción-secreción de las formas adultas de Fasciola hepatica (Fh E/S Ag para el diagnóstico de la fasciolosis humana. Materiales y métodos. Los antígenos fueron obtenidos a las 18 horas de incubación en medio Minimum Essential Eagle y preparados a la concentración proteica de 0,15 ug/uL; los cuales, al ser enfrentados con un pool de sueros de pacientes con fasciolosis confirmada por el hallazgo de huevos del parásito en las heces, se detectaron los antígenos de 10, 12, 17, 23, 27, 30, 36, 43, 66 y 136 KDa, con los cuales se desarrolló la técnica de Western blot. La sensibilidad se evaluó empleando sueros de 67 pacientes con fasciolosis, y la especificidad con sueros de 57 pacientes con otras parasitosis y diez sueros de personas no parasitadas. Resultados. De los 67 sueros, 64 reaccionaron con la banda de 23 KDa y 61 con la banda de 17KDa. Estas dos bandas no fueron detectadas por ninguno de los sueros de pacientes con otras parasitosis, ni de personas no parasitadas, siendo por ello consideradas como específicas y diagnósticas. Conclusiones. La sensibilidad de la prueba, utilizando las bandas de 17 y 23 KDa, fue de 95,5 % cuando se presenta reacción positiva en una o en las dos bandas, siendo la especificidad para estos dos antígenos de 100 % con un valor predictivo positivo de 100 % y un valor predictivo negativo de 95,71 %.Objectives. To evaluate the performance of the enzyme-linked immunoelectrotransfer blot assay (EITB, Western blot using excretory/secretory antigens from adult forms of Fasciola hepatica (Fh E/S Ag for the diagnosis of human fasciolosis. Materials and methods. Antigens were obtained after 18 hours of incubation in culture medium Minimum Essential Eagle, prepared at a protein concentration of 0.15 ug/uL and run against a pool of sera of patients with proven fasciolosis (confirmed by the

  6. Plastid Genome Evolution in the Early-Diverging Legume Subfamily Cercidoideae (Fabaceae

    Directory of Open Access Journals (Sweden)

    Yin-Huan Wang

    2018-02-01

    Full Text Available The subfamily Cercidoideae is an early-branching legume lineage, which consists of 13 genera distributed in the tropical and warm temperate Northern Hemisphere. A previous study detected two plastid genomic variations in this subfamily, but the limited taxon sampling left the overall plastid genome (plastome diversification across the subfamily unaddressed, and phylogenetic relationships within this clade remained unresolved. Here, we assembled eight plastomes from seven Cercidoideae genera and conducted phylogenomic-comparative analyses in a broad evolutionary framework across legumes. The plastomes of Cercidoideae all exhibited a typical quadripartite structure with a conserved gene content typical of most angiosperm plastomes. Plastome size ranged from 151,705 to 165,416 bp, mainly due to the expansion and contraction of inverted repeat (IR regions. The order of genes varied due to the occurrence of several inversions. In Tylosema species, a plastome with a 29-bp IR-mediated inversion was found to coexist with a canonical-type plastome, and the abundance of the two arrangements of isomeric molecules differed between individuals. Complete plastome data were much more efficient at resolving intergeneric relationships of Cercidoideae than the previously used selection of only a few plastid or nuclear loci. In sum, our study revealed novel insights into the structural diversification of plastomes in an early-branching legume lineage, and, thus, into the evolutionary trajectories of legume plastomes in general.

  7. Papillomavirus genomes in human cervical carcinoma: Analysis of their integration and transcriptional activity

    International Nuclear Information System (INIS)

    Matulic, M.; Soric, J.

    1994-01-01

    Eighty-four biopsies derived from cervical tissues were analyzed for the presence of human papillomavirus (HPV) DNA types 6, 16 and 18 using Southern blot hybridization. HPV 6 was found in none of the cervical biopsies, and HPV types 16 and 18 were found in 44% of them. The rate of HPV 16/18 positive samples increased proportionally to the severity of the lesion. In normal tissue there were no positive samples, in mild and moderate dysplasia HPV 16/18 was present in 20% and in severe dysplasia and invasive carcinomas in 37 and 50%, respectively. In biopsies from 13 cases with squamous cell carcinoma of the uterine cervix and CIN III lesions HPV 16 was integrated within the host genome. It was concluded that the virus could be integrated at variable, presumably randomly selected chromosomal loci and with different number of copies. Transcription of HPV 16 and 18 was detected in one cervical cancer in HeLa cells, respectively. These results imply that HPV types 16 and 18 play an etiological role in the carcinogenesis of human cervical epithelial cells. (author)

  8. Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

    Science.gov (United States)

    Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

    1992-04-01

    This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

  9. Genome Imprinting

    Indian Academy of Sciences (India)

    the cell nucleus (mitochondrial and chloroplast genomes), and. (3) traits governed ... tively good embryonic development but very poor development of membranes and ... Human homologies for the type of situation described above are naturally ..... imprint; (b) New modifications of the paternal genome in germ cells of each ...

  10. Standardisation of Western blotting to detect HTLV-1 antibodies synthesised in the central nervous system of HAM/TSP patients

    Directory of Open Access Journals (Sweden)

    Luiz Claudio Pereira Ribeiro

    2013-09-01

    Full Text Available Intrathecal synthesis of human T-lymphotropic virus type 1 (HTLV-1 antibodies (Abs represents conclusive evidence of a specific immune response in the central nervous system of HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP patients. Western blotting (WB for HTLV Abs in serum is a confirmatory test for HTLV-1 infection. The aim of this study was to standardise the Western blot to demonstrate the intrathecal pattern of Abs against HTLV-1 proteins in HAM/TSP patients. Paired cerebrospinal fluid (CSF and serum samples were selected from 20 patients with definite HAM/TSP, 19 HTLV-1 seronegative patients and two HTLV-1 patients without definite HAM/TSP. The presence of reactive bands of greater intensity in the CSF compared to serum (or bands in only the CSF indicated the intrathecal synthesis of anti-HTLV-1 Abs. All definite HAM/TSP patients presented with an intrathecal synthesis of anti-HTLV-1 Abs; these Abs were not detected in the control patients. The most frequent intrathecal targets of anti-HTLV-1 Abs were GD21, rgp46-I and p24 and, to a lesser extent, p19, p26, p28, p32, p36, p53 gp21 and gp46. The intrathecal immune response against env (GD21 and rgp46-I and gag (p24 proteins represents the most important humoral pattern in HAM/TSP. This response may be used as a diagnostic marker, considering the frequent association of intrathecal anti-HTLV-1 Ab synthesis with HAM/TSP and the pathogenesis of this neurological disease.

  11. Murine interleukin 1 receptor. Direct identification by ligand blotting and purification to homogeneity of an interleukin 1-binding glycoprotein

    International Nuclear Information System (INIS)

    Bird, T.A.; Gearing, A.J.; Saklatvala, J.

    1988-01-01

    Functional receptors (IL1-R) for the proinflammatory cytokine interleukin 1 (IL1) were solubilized from plasma membranes of the NOB-1 subclone of murine EL4 6.1 thymoma cells using the zwitterionic detergent 3[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS). Membrane extracts were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and ligand blotted with 125 I-labeled recombinant human IL1 alpha in order to reveal proteins capable of specifically binding IL1. A single polydisperse polypeptide of Mr approximately equal to 80,000 was identified in this way, which bound IL1 alpha and IL1 beta with the same affinity as the IL1-R on intact NOB-1 cells (approximately equal to 10(-10) M). The IL1-binding polypeptide was only seen in membranes from IL1-R-bearing cells and did not react with interleukin 2, tumor necrosis factor alpha, or interferon. IL1-R was purified to apparent homogeneity from solubilized NOB-1 membranes by affinity chromatography on wheat germ agglutinin-Sepharose and IL1 alpha-Sepharose. Gel electrophoresis and silver staining of purified preparations revealed a single protein of Mr approximately equal to 80,000 which reacted positively in the ligand-blotting procedure and which we identify as the ligand-binding moiety of the murine IL1-R. Purified IL1-R exhibited the same affinity and specificity as the receptor on intact cells. The relationship of this protein to proteins identified by covalent cross-linking studies is discussed

  12. Genomes to Proteomes

    Energy Technology Data Exchange (ETDEWEB)

    Panisko, Ellen A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Grigoriev, Igor [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Daly, Don S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Webb-Robertson, Bobbie-Jo [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2009-03-01

    Biologists are awash with genomic sequence data. In large part, this is due to the rapid acceleration in the generation of DNA sequence that occurred as public and private research institutes raced to sequence the human genome. In parallel with the large human genome effort, mostly smaller genomes of other important model organisms were sequenced. Projects following on these initial efforts have made use of technological advances and the DNA sequencing infrastructure that was built for the human and other organism genome projects. As a result, the genome sequences of many organisms are available in high quality draft form. While in many ways this is good news, there are limitations to the biological insights that can be gleaned from DNA sequences alone; genome sequences offer only a bird's eye view of the biological processes endemic to an organism or community. Fortunately, the genome sequences now being produced at such a high rate can serve as the foundation for other global experimental platforms such as proteomics. Proteomic methods offer a snapshot of the proteins present at a point in time for a given biological sample. Current global proteomics methods combine enzymatic digestion, separations, mass spectrometry and database searching for peptide identification. One key aspect of proteomics is the prediction of peptide sequences from mass spectrometry data. Global proteomic analysis uses computational matching of experimental mass spectra with predicted spectra based on databases of gene models that are often generated computationally. Thus, the quality of gene models predicted from a genome sequence is crucial in the generation of high quality peptide identifications. Once peptides are identified they can be assigned to their parent protein. Proteins identified as expressed in a given experiment are most useful when compared to other expressed proteins in a larger biological context or biochemical pathway. In this chapter we will discuss the automatic

  13. Genome Improvement at JGI-HAGSC

    Energy Technology Data Exchange (ETDEWEB)

    Grimwood, Jane; Schmutz, Jeremy J.; Myers, Richard M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the Joint Genome Institute (JGI) has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  14. 7 CFR 457.142 - Northern potato crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Northern potato crop insurance provisions. 457.142... INSURANCE CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.142 Northern potato crop insurance provisions. The Northern Potato Crop Insurance Provisions for the 2008 and succeeding...

  15. The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics.

    Directory of Open Access Journals (Sweden)

    Lincoln D Stein

    2003-11-01

    Full Text Available The soil nematodes Caenorhabditis briggsae and Caenorhabditis elegans diverged from a common ancestor roughly 100 million years ago and yet are almost indistinguishable by eye. They have the same chromosome number and genome sizes, and they occupy the same ecological niche. To explore the basis for this striking conservation of structure and function, we have sequenced the C. briggsae genome to a high-quality draft stage and compared it to the finished C. elegans sequence. We predict approximately 19,500 protein-coding genes in the C. briggsae genome, roughly the same as in C. elegans. Of these, 12,200 have clear C. elegans orthologs, a further 6,500 have one or more clearly detectable C. elegans homologs, and approximately 800 C. briggsae genes have no detectable matches in C. elegans. Almost all of the noncoding RNAs (ncRNAs known are shared between the two species. The two genomes exhibit extensive colinearity, and the rate of divergence appears to be higher in the chromosomal arms than in the centers. Operons, a distinctive feature of C. elegans, are highly conserved in C. briggsae, with the arrangement of genes being preserved in 96% of cases. The difference in size between the C. briggsae (estimated at approximately 104 Mbp and C. elegans (100.3 Mbp genomes is almost entirely due to repetitive sequence, which accounts for 22.4% of the C. briggsae genome in contrast to 16.5% of the C. elegans genome. Few, if any, repeat families are shared, suggesting that most were acquired after the two species diverged or are undergoing rapid evolution. Coclustering the C. elegans and C. briggsae proteins reveals 2,169 protein families of two or more members. Most of these are shared between the two species, but some appear to be expanding or contracting, and there seem to be as many as several hundred novel C. briggsae gene families. The C. briggsae draft sequence will greatly improve the annotation of the C. elegans genome. Based on similarity to C

  16. A comprehensive crop genome research project: the Superhybrid Rice Genome Project in China.

    Science.gov (United States)

    Yu, Jun; Wong, Gane Ka-Shu; Liu, Siqi; Wang, Jian; Yang, Huanming

    2007-06-29

    In May 2000, the Beijing Institute of Genomics formally announced the launch of a comprehensive crop genome research project on rice genomics, the Chinese Superhybrid Rice Genome Project. SRGP is not simply a sequencing project targeted to a single rice (Oryza sativa L.) genome, but a full-swing research effort with an ultimate goal of providing inclusive basic genomic information and molecular tools not only to understand biology of the rice, both as an important crop species and a model organism of cereals, but also to focus on a popular superhybrid rice landrace, LYP9. We have completed the first phase of SRGP and provide the rice research community with a finished genome sequence of an indica variety, 93-11 (the paternal cultivar of LYP9), together with ample data on subspecific (between subspecies) polymorphisms, transcriptomes and proteomes, useful for within-species comparative studies. In the second phase, we have acquired the genome sequence of the maternal cultivar, PA64S, together with the detailed catalogues of genes uniquely expressed in the parental cultivars and the hybrid as well as allele-specific markers that distinguish parental alleles. Although SRGP in China is not an open-ended research programme, it has been designed to pave a way for future plant genomics research and application, such as to interrogate fundamentals of plant biology, including genome duplication, polyploidy and hybrid vigour, as well as to provide genetic tools for crop breeding and to carry along a social burden-leading a fight against the world's hunger. It began with genomics, the newly developed and industry-scale research field, and from the world's most populous country. In this review, we summarize our scientific goals and noteworthy discoveries that exploit new territories of systematic investigations on basic and applied biology of rice and other major cereal crops.

  17. Lactobacillus paracasei comparative genomics: towards species pan-genome definition and exploitation of diversity.

    Directory of Open Access Journals (Sweden)

    Tamara Smokvina

    Full Text Available Lactobacillus paracasei is a member of the normal human and animal gut microbiota and is used extensively in the food industry in starter cultures for dairy products or as probiotics. With the development of low-cost, high-throughput sequencing techniques it has become feasible to sequence many different strains of one species and to determine its "pan-genome". We have sequenced the genomes of 34 different L. paracasei strains, and performed a comparative genomics analysis. We analysed genome synteny and content, focussing on the pan-genome, core genome and variable genome. Each genome was shown to contain around 2800-3100 protein-coding genes, and comparative analysis identified over 4200 ortholog groups that comprise the pan-genome of this species, of which about 1800 ortholog groups make up the conserved core. Several factors previously associated with host-microbe interactions such as pili, cell-envelope proteinase, hydrolases p40 and p75 or the capacity to produce short branched-chain fatty acids (bkd operon are part of the L. paracasei core genome present in all analysed strains. The variome consists mainly of hypothetical proteins, phages, plasmids, transposon/conjugative elements, and known functions such as sugar metabolism, cell-surface proteins, transporters, CRISPR-associated proteins, and EPS biosynthesis proteins. An enormous variety and variability of sugar utilization gene cassettes were identified, with each strain harbouring between 25-53 cassettes, reflecting the high adaptability of L. paracasei to different niches. A phylogenomic tree was constructed based on total genome contents, and together with an analysis of horizontal gene transfer events we conclude that evolution of these L. paracasei strains is complex and not always related to niche adaptation. The results of this genome content comparison was used, together with high-throughput growth experiments on various carbohydrates, to perform gene-trait matching analysis

  18. Electrospun nitrocellulose and nylon: Design and fabrication of novel high performance platforms for protein blotting applications

    Directory of Open Access Journals (Sweden)

    Bowlin Gary L

    2007-10-01

    Full Text Available Abstract Background Electrospinning is a non-mechanical processing strategy that can be used to process a variety of native and synthetic polymers into highly porous materials composed of nano-scale to micron-scale diameter fibers. By nature, electrospun materials exhibit an extensive surface area and highly interconnected pore spaces. In this study we adopted a biological engineering approach to ask how the specific unique advantages of the electrospinning process might be exploited to produce a new class of research/diagnostic tools. Methods The electrospinning properties of nitrocellulose, charged nylon and blends of these materials are characterized. Results Nitrocellulose electrospun from a starting concentration of Conclusion The flexibility afforded by electrospinning process makes it possible to tailor blotting membranes to specific applications. Electrospinning has a variety of potential applications in the clinical diagnostic field of use.

  19. A Trichosporonales genome tree based on 27 haploid and three evolutionarily conserved 'natural' hybrid genomes.

    Science.gov (United States)

    Takashima, Masako; Sriswasdi, Sira; Manabe, Ri-Ichiroh; Ohkuma, Moriya; Sugita, Takashi; Iwasaki, Wataru

    2018-01-01

    To construct a backbone tree consisting of basidiomycetous yeasts, draft genome sequences from 25 species of Trichosporonales (Tremellomycetes, Basidiomycota) were generated. In addition to the hybrid genomes of Trichosporon coremiiforme and Trichosporon ovoides that we described previously, we identified an interspecies hybrid genome in Cutaneotrichosporon mucoides (formerly Trichosporon mucoides). This hybrid genome had a gene retention rate of ~55%, and its closest haploid relative was Cutaneotrichosporon dermatis. After constructing the C. mucoides subgenomes, we generated a phylogenetic tree using genome data from the 27 haploid species and the subgenome data from the three hybrid genome species. It was a high-quality tree with 100% bootstrap support for all of the branches. The genome-based tree provided superior resolution compared with previous multi-gene analyses. Although our backbone tree does not include all Trichosporonales genera (e.g. Cryptotrichosporon), it will be valuable for future analyses of genome data. Interest in interspecies hybrid fungal genomes has recently increased because they may provide a basis for new technologies. The three Trichosporonales hybrid genomes described in this study are different from well-characterized hybrid genomes (e.g. those of Saccharomyces pastorianus and Saccharomyces bayanus) because these hybridization events probably occurred in the distant evolutionary past. Hence, they will be useful for studying genome stability following hybridization and speciation events. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  20. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes

    Science.gov (United States)

    Liu, Shengyi; Liu, Yumei; Yang, Xinhua; Tong, Chaobo; Edwards, David; Parkin, Isobel A. P.; Zhao, Meixia; Ma, Jianxin; Yu, Jingyin; Huang, Shunmou; Wang, Xiyin; Wang, Junyi; Lu, Kun; Fang, Zhiyuan; Bancroft, Ian; Yang, Tae-Jin; Hu, Qiong; Wang, Xinfa; Yue, Zhen; Li, Haojie; Yang, Linfeng; Wu, Jian; Zhou, Qing; Wang, Wanxin; King, Graham J; Pires, J. Chris; Lu, Changxin; Wu, Zhangyan; Sampath, Perumal; Wang, Zhuo; Guo, Hui; Pan, Shengkai; Yang, Limei; Min, Jiumeng; Zhang, Dong; Jin, Dianchuan; Li, Wanshun; Belcram, Harry; Tu, Jinxing; Guan, Mei; Qi, Cunkou; Du, Dezhi; Li, Jiana; Jiang, Liangcai; Batley, Jacqueline; Sharpe, Andrew G; Park, Beom-Seok; Ruperao, Pradeep; Cheng, Feng; Waminal, Nomar Espinosa; Huang, Yin; Dong, Caihua; Wang, Li; Li, Jingping; Hu, Zhiyong; Zhuang, Mu; Huang, Yi; Huang, Junyan; Shi, Jiaqin; Mei, Desheng; Liu, Jing; Lee, Tae-Ho; Wang, Jinpeng; Jin, Huizhe; Li, Zaiyun; Li, Xun; Zhang, Jiefu; Xiao, Lu; Zhou, Yongming; Liu, Zhongsong; Liu, Xuequn; Qin, Rui; Tang, Xu; Liu, Wenbin; Wang, Yupeng; Zhang, Yangyong; Lee, Jonghoon; Kim, Hyun Hee; Denoeud, France; Xu, Xun; Liang, Xinming; Hua, Wei; Wang, Xiaowu; Wang, Jun; Chalhoub, Boulos; Paterson, Andrew H

    2014-01-01

    Polyploidization has provided much genetic variation for plant adaptive evolution, but the mechanisms by which the molecular evolution of polyploid genomes establishes genetic architecture underlying species differentiation are unclear. Brassica is an ideal model to increase knowledge of polyploid evolution. Here we describe a draft genome sequence of Brassica oleracea, comparing it with that of its sister species B. rapa to reveal numerous chromosome rearrangements and asymmetrical gene loss in duplicated genomic blocks, asymmetrical amplification of transposable elements, differential gene co-retention for specific pathways and variation in gene expression, including alternative splicing, among a large number of paralogous and orthologous genes. Genes related to the production of anticancer phytochemicals and morphological variations illustrate consequences of genome duplication and gene divergence, imparting biochemical and morphological variation to B. oleracea. This study provides insights into Brassica genome evolution and will underpin research into the many important crops in this genus. PMID:24852848

  1. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  2. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  3. Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes.

    Science.gov (United States)

    Sun, Yan-Bo; Xiong, Zi-Jun; Xiang, Xue-Yan; Liu, Shi-Ping; Zhou, Wei-Wei; Tu, Xiao-Long; Zhong, Li; Wang, Lu; Wu, Dong-Dong; Zhang, Bao-Lin; Zhu, Chun-Ling; Yang, Min-Min; Chen, Hong-Man; Li, Fang; Zhou, Long; Feng, Shao-Hong; Huang, Chao; Zhang, Guo-Jie; Irwin, David; Hillis, David M; Murphy, Robert W; Yang, Huan-Ming; Che, Jing; Wang, Jun; Zhang, Ya-Ping

    2015-03-17

    The development of efficient sequencing techniques has resulted in large numbers of genomes being available for evolutionary studies. However, only one genome is available for all amphibians, that of Xenopus tropicalis, which is distantly related from the majority of frogs. More than 96% of frogs belong to the Neobatrachia, and no genome exists for this group. This dearth of amphibian genomes greatly restricts genomic studies of amphibians and, more generally, our understanding of tetrapod genome evolution. To fill this gap, we provide the de novo genome of a Tibetan Plateau frog, Nanorana parkeri, and compare it to that of X. tropicalis and other vertebrates. This genome encodes more than 20,000 protein-coding genes, a number similar to that of Xenopus. Although the genome size of Nanorana is considerably larger than that of Xenopus (2.3 vs. 1.5 Gb), most of the difference is due to the respective number of transposable elements in the two genomes. The two frogs exhibit considerable conserved whole-genome synteny despite having diverged approximately 266 Ma, indicating a slow rate of DNA structural evolution in anurans. Multigenome synteny blocks further show that amphibians have fewer interchromosomal rearrangements than mammals but have a comparable rate of intrachromosomal rearrangements. Our analysis also identifies 11 Mb of anuran-specific highly conserved elements that will be useful for comparative genomic analyses of frogs. The Nanorana genome offers an improved understanding of evolution of tetrapod genomes and also provides a genomic reference for other evolutionary studies.

  4. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    Science.gov (United States)

    Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

    2013-01-01

    Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  5. Microbial Genomes Multiply

    Science.gov (United States)

    Doolittle, Russell F.

    2002-01-01

    The publication of the first complete sequence of a bacterial genome in 1995 was a signal event, underscored by the fact that the article has been cited more than 2,100 times during the intervening seven years. It was a marvelous technical achievement, made possible by automatic DNA-sequencing machines. The feat is the more impressive in that complete genome sequencing has now been adopted in many different laboratories around the world. Four years ago in these columns I examined the situation after a dozen microbial genomes had been completed. Now, with upwards of 60 microbial genome sequences determined and twice that many in progress, it seems reasonable to assess just what is being learned. Are new concepts emerging about how cells work? Have there been practical benefits in the fields of medicine and agriculture? Is it feasible to determine the genomic sequence of every bacterial species on Earth? The answers to these questions maybe Yes, Perhaps, and No, respectively.

  6. Genomic research perspectives in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Ainur Akilzhanova

    2014-01-01

    Full Text Available Introduction: Technological advancements rapidly propel the field of genome research. Advances in genetics and genomics such as the sequence of the human genome, the human haplotype map, open access databases, cheaper genotyping and chemical genomics, have transformed basic and translational biomedical research. Several projects in the field of genomic and personalized medicine have been conducted at the Center for Life Sciences in Nazarbayev University. The prioritized areas of research include: genomics of multifactorial diseases, cancer genomics, bioinformatics, genetics of infectious diseases and population genomics. At present, DNA-based risk assessment for common complex diseases, application of molecular signatures for cancer diagnosis and prognosis, genome-guided therapy, and dose selection of therapeutic drugs are the important issues in personalized medicine. Results: To further develop genomic and biomedical projects at Center for Life Sciences, the development of bioinformatics research and infrastructure and the establishment of new collaborations in the field are essential. Widespread use of genetic tools will allow the identification of diseases before the onset of clinical symptoms, the individualization of drug treatment, and could induce individual behavioral changes on the basis of calculated disease risk. However, many challenges remain for the successful translation of genomic knowledge and technologies into health advances, such as medicines and diagnostics. It is important to integrate research and education in the fields of genomics, personalized medicine, and bioinformatics, which will be possible with opening of the new Medical Faculty at Nazarbayev University. People in practice and training need to be educated about the key concepts of genomics and engaged so they can effectively apply their knowledge in a matter that will bring the era of genomic medicine to patient care. This requires the development of well

  7. Efficient Breeding by Genomic Mating.

    Science.