WorldWideScience

Sample records for genome duplication drive

  1. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  2. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  3. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  4. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Science.gov (United States)

    Cuypers, Thomas D; Hogeweg, Paulien

    2014-04-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  5. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Directory of Open Access Journals (Sweden)

    Thomas D Cuypers

    2014-04-01

    Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  6. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  7. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  8. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  9. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  10. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  11. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  12. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  13. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  14. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  15. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2011-02-01

    Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.

  16. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  17. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  18. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  19. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  20. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  2. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  3. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  4. Detection and analysis of ancient segmental duplications in mammalian genomes.

    Science.gov (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A

    2018-05-07

    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  6. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  7. Detection and correction of false segmental duplications caused by genome mis-assembly

    Science.gov (United States)

    2010-01-01

    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  8. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  9. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  10. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  11. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.

    Science.gov (United States)

    Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E

    2006-09-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.

  12. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  13. Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Fadista, João; Bendixen, Christian

    Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...

  14. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  15. Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.

    Science.gov (United States)

    McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael

    2014-08-01

    Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.

  16. Whole genome duplication of intra- and inter-chromosomes in the tomato genome.

    Science.gov (United States)

    Song, Chi; Guo, Juan; Sun, Wei; Wang, Ying

    2012-07-20

    Whole genome duplication (WGD) events have been proven to occur in the evolutionary history of most angiosperms. Tomato is considered a model species of the Solanaceae family. In this study, we describe the details of the evolutionary process of the tomato genome by detecting collinearity blocks and dating the WGD events on the tree of life by combining two different methods: synonymous substitution rates (Ks) and phylogenetic trees. In total, 593 collinearity blocks were discovered out of 12 pseudo-chromosomes constructed. It was evident that chromosome 2 had experienced an intra-chromosomal duplication event. Major inter-chromosomal duplication occurred among all the pseudo-chromosome. We calculated the Ks value of these collinearity blocks. Two peaks of Ks distribution were found, corresponding to two WGD events occurring approximately 36-82 million years ago (MYA) and 148-205 MYA. Additionally, the results of phylogenetic trees suggested that the more recent WGD event may have occurred after the divergence of the rosid-asterid clade, but before the major diversification in Solanaceae. The older WGD event was shown to have occurred before the divergence of the rosid-asterid clade and after the divergence of rice-Arabidopsis (monocot-dicot). Copyright © 2012. Published by Elsevier Ltd.

  17. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  18. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  19. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Two Rounds of Whole Genome Duplication in the AncestralVertebrate

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir; Boore, Jeffrey L.

    2005-04-12

    The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

  1. Decoding Synteny Blocks and Large-Scale Duplications in Mammalian and Plant Genomes

    Science.gov (United States)

    Peng, Qian; Alekseyev, Max A.; Tesler, Glenn; Pevzner, Pavel A.

    The existing synteny block reconstruction algorithms use anchors (e.g., orthologous genes) shared over all genomes to construct the synteny blocks for multiple genomes. This approach, while efficient for a few genomes, cannot be scaled to address the need to construct synteny blocks in many mammalian genomes that are currently being sequenced. The problem is that the number of anchors shared among all genomes quickly decreases with the increase in the number of genomes. Another problem is that many genomes (plant genomes in particular) had extensive duplications, which makes decoding of genomic architecture and rearrangement analysis in plants difficult. The existing synteny block generation algorithms in plants do not address the issue of generating non-overlapping synteny blocks suitable for analyzing rearrangements and evolution history of duplications. We present a new algorithm based on the A-Bruijn graph framework that overcomes these difficulties and provides a unified approach to synteny block reconstruction for multiple genomes, and for genomes with large duplications.

  2. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  3. The sea lamprey meiotic map improves resolution of ancient vertebrate genome duplications.

    Science.gov (United States)

    Smith, Jeramiah J; Keinath, Melissa C

    2015-08-01

    It is generally accepted that many genes present in vertebrate genomes owe their origin to two whole-genome duplications that occurred deep in the ancestry of the vertebrate lineage. However, details regarding the timing and outcome of these duplications are not well resolved. We present high-density meiotic and comparative genomic maps for the sea lamprey (Petromyzon marinus), a representative of an ancient lineage that diverged from all other vertebrates ∼550 million years ago. Linkage analyses yielded a total of 95 linkage groups, similar to the estimated number of germline chromosomes (1n ∼ 99), spanning a total of 5570.25 cM. Comparative mapping data yield strong support for the hypothesis that a single whole-genome duplication occurred in the basal vertebrate lineage, but do not strongly support a hypothetical second event. Rather, these comparative maps reveal several evolutionarily independent segmental duplications occurring over the last 600+ million years of chordate evolution. This refined history of vertebrate genome duplication should permit more precise investigations of vertebrate evolution. © 2015 Smith and Keinath; Published by Cold Spring Harbor Laboratory Press.

  4. Genome Organization Drives Chromosome Fragility.

    Science.gov (United States)

    Canela, Andres; Maman, Yaakov; Jung, Seolkyoung; Wong, Nancy; Callen, Elsa; Day, Amanda; Kieffer-Kwon, Kyong-Rim; Pekowska, Aleksandra; Zhang, Hongliang; Rao, Suhas S P; Huang, Su-Chen; Mckinnon, Peter J; Aplan, Peter D; Pommier, Yves; Aiden, Erez Lieberman; Casellas, Rafael; Nussenzweig, André

    2017-07-27

    In this study, we show that evolutionarily conserved chromosome loop anchors bound by CCCTC-binding factor (CTCF) and cohesin are vulnerable to DNA double strand breaks (DSBs) mediated by topoisomerase 2B (TOP2B). Polymorphisms in the genome that redistribute CTCF/cohesin occupancy rewire DNA cleavage sites to novel loop anchors. While transcription- and replication-coupled genomic rearrangements have been well documented, we demonstrate that DSBs formed at loop anchors are largely transcription-, replication-, and cell-type-independent. DSBs are continuously formed throughout interphase, are enriched on both sides of strong topological domain borders, and frequently occur at breakpoint clusters commonly translocated in cancer. Thus, loop anchors serve as fragile sites that generate DSBs and chromosomal rearrangements. VIDEO ABSTRACT. Published by Elsevier Inc.

  5. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  6. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  7. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  8. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  9. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  10. Sorting duplicated loci disentangles complexities of polyploid genomes masked by genotyping by sequencing

    DEFF Research Database (Denmark)

    Limborg, Morten; Seeb, Lisa W.; Seeb, J. E.

    2016-01-01

    Many plants and animals of polyploid origin are currently enjoying a genomics explosion enabled by modern sequencing and genotyping technologies. However, routine filtering of duplicated loci in most studies using genotyping by sequencing introduces an unacceptable, but often overlooked, bias when...... particularly stress the sometimes overlooked fact that basing genomic studies on dense maps provides value added in the form of locating and annotating outlier loci or colocating outliers into islands of divergenc...

  11. Development of genome- and transcriptome-derived microsatellites in related species of snapping shrimps with highly duplicated genomes.

    Science.gov (United States)

    Gaynor, Kaitlyn M; Solomon, Joseph W; Siller, Stefanie; Jessell, Linnet; Duffy, J Emmett; Rubenstein, Dustin R

    2017-11-01

    Molecular markers are powerful tools for studying patterns of relatedness and parentage within populations and for making inferences about social evolution. However, the development of molecular markers for simultaneous study of multiple species presents challenges, particularly when species exhibit genome duplication or polyploidy. We developed microsatellite markers for Synalpheus shrimp, a genus in which species exhibit not only great variation in social organization, but also interspecific variation in genome size and partial genome duplication. From the four primary clades within Synalpheus, we identified microsatellites in the genomes of four species and in the consensus transcriptome of two species. Ultimately, we designed and tested primers for 143 microsatellite markers across 25 species. Although the majority of markers were disomic, many markers were polysomic for certain species. Surprisingly, we found no relationship between genome size and the number of polysomic markers. As expected, markers developed for a given species amplified better for closely related species than for more distant relatives. Finally, the markers developed from the transcriptome were more likely to work successfully and to be disomic than those developed from the genome, suggesting that consensus transcriptomes are likely to be conserved across species. Our findings suggest that the transcriptome, particularly consensus sequences from multiple species, can be a valuable source of molecular markers for taxa with complex, duplicated genomes. © 2017 John Wiley & Sons Ltd.

  12. Whole genome duplication affects evolvability of flowering time in an autotetraploid plant.

    Directory of Open Access Journals (Sweden)

    Sara L Martin

    Full Text Available Whole genome duplications have occurred recurrently throughout the evolutionary history of eukaryotes. The resulting genetic and phenotypic changes can influence physiological and ecological responses to the environment; however, the impact of genome copy number on evolvability has rarely been examined experimentally. Here, we evaluate the effect of genome duplication on the ability to respond to selection for early flowering time in lines drawn from naturally occurring diploid and autotetraploid populations of the plant Chamerion angustifolium (fireweed. We contrast this with the result of four generations of selection on synthesized neoautotetraploids, whose genic variability is similar to diploids but genome copy number is similar to autotetraploids. In addition, we examine correlated responses to selection in all three groups. Diploid and both extant tetraploid and neoautotetraploid lines responded to selection with significant reductions in time to flowering. Evolvability, measured as realized heritability, was significantly lower in extant tetraploids (^b(T =  0.31 than diploids (^b(T =  0.40. Neotetraploids exhibited the highest evolutionary response (^b(T  =  0.55. The rapid shift in flowering time in neotetraploids was associated with an increase in phenotypic variability across generations, but not with change in genome size or phenotypic correlations among traits. Our results suggest that whole genome duplications, without hybridization, may initially alter evolutionary rate, and that the dynamic nature of neoautopolyploids may contribute to the prevalence of polyploidy throughout eukaryotes.

  13. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  14. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  15. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  16. Persistence drives gene clustering in bacterial genomes

    Directory of Open Access Journals (Sweden)

    Rocha Eduardo PC

    2008-01-01

    Full Text Available Abstract Background Gene clustering plays an important role in the organization of the bacterial chromosome and several mechanisms have been proposed to explain its extent. However, the controversies raised about the validity of each of these mechanisms remind us that the cause of this gene organization remains an open question. Models proposed to explain clustering did not take into account the function of the gene products nor the likely presence or absence of a given gene in a genome. However, genomes harbor two very different categories of genes: those genes present in a majority of organisms – persistent genes – and those present in very few organisms – rare genes. Results We show that two classes of genes are significantly clustered in bacterial genomes: the highly persistent and the rare genes. The clustering of rare genes is readily explained by the selfish operon theory. Yet, genes persistently present in bacterial genomes are also clustered and we try to understand why. We propose a model accounting specifically for such clustering, and show that indispensability in a genome with frequent gene deletion and insertion leads to the transient clustering of these genes. The model describes how clusters are created via the gene flux that continuously introduces new genes while deleting others. We then test if known selective processes, such as co-transcription, physical interaction or functional neighborhood, account for the stabilization of these clusters. Conclusion We show that the strong selective pressure acting on the function of persistent genes, in a permanent state of flux of genes in bacterial genomes, maintaining their size fairly constant, that drives persistent genes clustering. A further selective stabilization process might contribute to maintaining the clustering.

  17. Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio)

    Science.gov (United States)

    2012-01-01

    Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

  18. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  19. Genome specific PPARαB duplicates in salmonids and insights into estrogenic regulation in brown trout.

    Science.gov (United States)

    Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph

    2017-06-01

    Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  1. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere

    2008-09-01

    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  2. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  3. Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Guo

    Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

  4. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  5. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  6. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Directory of Open Access Journals (Sweden)

    Michael J Considine

    Full Text Available Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised

  7. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Science.gov (United States)

    Considine, Michael J; Wan, Yizhen; D'Antuono, Mario F; Zhou, Qian; Han, Mingyu; Gao, Hua; Wang, Man

    2012-01-01

    Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised. Impacts of

  8. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  9. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  10. Inference of the ancestral vertebrate phenotype through vestiges of the whole-genome duplications.

    Science.gov (United States)

    Onimaru, Koh; Kuraku, Shigehiro

    2018-03-16

    Inferring the phenotype of the last common ancestor of living vertebrates is a challenging problem because of several unresolvable factors. They include the lack of reliable out-groups of living vertebrates, poor information about less fossilizable organs and specialized traits of phylogenetically important species, such as lampreys and hagfishes (e.g. secondary loss of vertebrae in adult hagfishes). These factors undermine the reliability of ancestral reconstruction by traditional character mapping approaches based on maximum parsimony. In this article, we formulate an approach to hypothesizing ancestral vertebrate phenotypes using information from the phylogenetic and functional properties of genes duplicated by genome expansions in early vertebrate evolution. We named the conjecture as 'chronological reconstruction of ohnolog functions (CHROF)'. This CHROF conjecture raises the possibility that the last common ancestor of living vertebrates may have had more complex traits than currently thought.

  11. The genomic distribution of intraspecific and interspecific sequence divergence of human segmental duplications relative to human/chimpanzee chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Eichler Evan E

    2008-08-01

    Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.

  12. SINEs as driving forces in genome evolution.

    Science.gov (United States)

    Schmitz, J

    2012-01-01

    SINEs are short interspersed elements derived from cellular RNAs that repetitively retropose via RNA intermediates and integrate more or less randomly back into the genome. SINEs propagate almost entirely vertically within their host cells and, once established in the germline, are passed on from generation to generation. As non-autonomous elements, their reverse transcription (from RNA to cDNA) and genomic integration depends on the activity of the enzymatic machinery of autonomous retrotransposons, such as long interspersed elements (LINEs). SINEs are widely distributed in eukaryotes, but are especially effectively propagated in mammalian species. For example, more than a million Alu-SINE copies populate the human genome (approximately 13% of genomic space), and few master copies of them are still active. In the organisms where they occur, SINEs are a challenge to genomic integrity, but in the long term also can serve as beneficial building blocks for evolution, contributing to phenotypic heterogeneity and modifying gene regulatory networks. They substantially expand the genomic space and introduce structural variation to the genome. SINEs have the potential to mutate genes, to alter gene expression, and to generate new parts of genes. A balanced distribution and controlled activity of such properties is crucial to maintaining the organism's dynamic and thriving evolution. Copyright © 2012 S. Karger AG, Basel.

  13. Genetic diversity and population structure inferred from the partially duplicated genome of domesticated carp, Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Feldman Marcus W

    2007-04-01

    Full Text Available Abstract Genetic relationships among eight populations of domesticated carp (Cyprinus carpio L., a species with a partially duplicated genome, were studied using 12 microsatellites and 505 AFLP bands. The populations included three aquacultured carp strains and five ornamental carp (koi variants. Grass carp (Ctenopharyngodon idella was used as an outgroup. AFLP-based gene diversity varied from 5% (grass carp to 32% (koi and reflected the reasonably well understood histories and breeding practices of the populations. A large fraction of the molecular variance was due to differences between aquacultured and ornamental carps. Further analyses based on microsatellite data, including cluster analysis and neighbor-joining trees, supported the genetic distinctiveness of aquacultured and ornamental carps, despite the recent divergence of the two groups. In contrast to what was observed for AFLP-based diversity, the frequency of heterozygotes based on microsatellites was comparable among all populations. This discrepancy can potentially be explained by duplication of some loci in Cyprinus carpio L., and a model that shows how duplication can increase heterozygosity estimates for microsatellites but not for AFLP loci is discussed. Our analyses in carp can help in understanding the consequences of genotyping duplicated loci and in interpreting discrepancies between dominant and co-dominant markers in species with recent genome duplication.

  14. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  15. Nested radiations and the pulse of angiosperm diversification: increased diversification rates often follow whole genome duplications.

    Science.gov (United States)

    Tank, David C; Eastman, Jonathan M; Pennell, Matthew W; Soltis, Pamela S; Soltis, Douglas E; Hinchliff, Cody E; Brown, Joseph W; Sessa, Emily B; Harmon, Luke J

    2015-07-01

    Our growing understanding of the plant tree of life provides a novel opportunity to uncover the major drivers of angiosperm diversity. Using a time-calibrated phylogeny, we characterized hot and cold spots of lineage diversification across the angiosperm tree of life by modeling evolutionary diversification using stepwise AIC (MEDUSA). We also tested the whole-genome duplication (WGD) radiation lag-time model, which postulates that increases in diversification tend to lag behind established WGD events. Diversification rates have been incredibly heterogeneous throughout the evolutionary history of angiosperms and reveal a pattern of 'nested radiations' - increases in net diversification nested within other radiations. This pattern in turn generates a negative relationship between clade age and diversity across both families and orders. We suggest that stochastically changing diversification rates across the phylogeny explain these patterns. Finally, we demonstrate significant statistical support for the WGD radiation lag-time model. Across angiosperms, nested shifts in diversification led to an overall increasing rate of net diversification and declining relative extinction rates through time. These diversification shifts are only rarely perfectly associated with WGD events, but commonly follow them after a lag period. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. Impact of whole-genome duplication events on diversification rates in angiosperms.

    Science.gov (United States)

    Landis, Jacob B; Soltis, Douglas E; Li, Zheng; Marx, Hannah E; Barker, Michael S; Tank, David C; Soltis, Pamela S

    2018-03-01

    Polyploidy or whole-genome duplication (WGD) pervades the evolutionary history of angiosperms. Despite extensive progress in our understanding of WGD, the role of these events in promoting diversification is still not well understood. We seek to clarify the possible association between WGD and diversification rates in flowering plants. Using a previously published phylogeny spanning all land plants (31,749 tips) and WGD events inferred from analyses of the 1000 Plants (1KP) transcriptome data, we analyzed the association of WGDs and diversification rates following numerous WGD events across the angiosperms. We used a stepwise AIC approach (MEDUSA), a Bayesian mixture model approach (BAMM), and state-dependent diversification analyses (MuSSE) to investigate patterns of diversification. Sister-clade comparisons were used to investigate species richness after WGDs. Based on the density of 1KP taxon sampling, 106 WGDs were unambiguously placed on the angiosperm phylogeny. We identified 334-530 shifts in diversification rates. We found that 61 WGD events were tightly linked to changes in diversification rates, and state-dependent diversification analyses indicated higher speciation rates for subsequent rounds of WGD. Additionally, 70 of 99 WGD events showed an increase in species richness compared to the sister clade. Forty-six of the 106 WGDs analyzed appear to be closely associated with upshifts in the rate of diversification in angiosperms. Shifts in diversification do not appear more likely than random within a four-node lag phase following a WGD; however, younger WGD events are more likely to be followed by an upshift in diversification than older WGD events. © 2018 Botanical Society of America.

  17. Genetic Competence Drives Genome Diversity in Bacillus subtilis

    Science.gov (United States)

    Chevreux, Bastien; Serra, Cláudia R; Schyns, Ghislain; Henriques, Adriano O

    2018-01-01

    Abstract Prokaryote genomes are the result of a dynamic flux of genes, with increases achieved via horizontal gene transfer and reductions occurring through gene loss. The ecological and selective forces that drive this genomic flexibility vary across species. Bacillus subtilis is a naturally competent bacterium that occupies various environments, including plant-associated, soil, and marine niches, and the gut of both invertebrates and vertebrates. Here, we quantify the genomic diversity of B. subtilis and infer the genome dynamics that explain the high genetic and phenotypic diversity observed. Phylogenomic and comparative genomic analyses of 42 B. subtilis genomes uncover a remarkable genome diversity that translates into a core genome of 1,659 genes and an asymptotic pangenome growth rate of 57 new genes per new genome added. This diversity is due to a large proportion of low-frequency genes that are acquired from closely related species. We find no gene-loss bias among wild isolates, which explains why the cloud genome, 43% of the species pangenome, represents only a small proportion of each genome. We show that B. subtilis can acquire xenologous copies of core genes that propagate laterally among strains within a niche. While not excluding the contributions of other mechanisms, our results strongly suggest a process of gene acquisition that is largely driven by competence, where the long-term maintenance of acquired genes depends on local and global fitness effects. This competence-driven genomic diversity provides B. subtilis with its generalist character, enabling it to occupy a wide range of ecological niches and cycle through them. PMID:29272410

  18. Array comparative genomic hybridization analysis of a familial duplication of chromosome 13q: A recognizable syndrome

    NARCIS (Netherlands)

    Mathijssen, Inge B.; Hoovers, Jan M. N.; Mul, Adri N. P. M.; Man, Hai-Yen; Ket, Jan L.; Hennekam, Raoul C. M.

    2005-01-01

    We report on a family with six persons in three generations who have mild mental retardation, behavioral problems, seizures, hearing loss, strabismus, dental anomalies, hypermobility, juvenile hallux valgus, and mild dysmorphic features. Classical cytogenetic analysis showed a partial duplication of

  19. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  20. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  1. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  2. Array comparative genomic hybridisation analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical region at Xq27 containing SOX3.

    NARCIS (Netherlands)

    Solomon, N.M.; Ross, S.; Morgan, T.; Belsky, J.L.; Hol, F.A.; Karnes, P.; Hopwood, N.J.; Myers, S.E.; Tan, A.; Warne, G.L.; Forrest, S.M.; Thomas, P.Q.

    2004-01-01

    INTRODUCTION: Array comparative genomic hybridisation (array CGH) is a powerful method that detects alteration of gene copy number with greater resolution and efficiency than traditional methods. However, its ability to detect disease causing duplications in constitutional genomic DNA has not been

  3. De novo assembly of the zucchini genome reveals a whole-genome duplication associated with the origin of the Cucurbita genus.

    Science.gov (United States)

    Montero-Pau, Javier; Blanca, José; Bombarely, Aureliano; Ziarsolo, Peio; Esteras, Cristina; Martí-Gómez, Carlos; Ferriol, María; Gómez, Pedro; Jamilena, Manuel; Mueller, Lukas; Picó, Belén; Cañizares, Joaquín

    2017-11-07

    The Cucurbita genus (squashes, pumpkins and gourds) includes important domesticated species such as C. pepo, C. maxima and C. moschata. In this study, we present a high-quality draft of the zucchini (C. pepo) genome. The assembly has a size of 263 Mb, a scaffold N50 of 1.8 Mb and 34 240 gene models. It includes 92% of the conserved BUSCO core gene set, and it is estimated to cover 93.0% of the genome. The genome is organized in 20 pseudomolecules that represent 81.4% of the assembly, and it is integrated with a genetic map of 7718 SNPs. Despite the small genome size, three independent lines of evidence support that the C. pepo genome is the result of a whole-genome duplication: the topology of the gene family phylogenies, the karyotype organization and the distribution of 4DTv distances. Additionally, 40 transcriptomes of 12 species of the genus were assembled and analysed together with all the other published genomes of the Cucurbitaceae family. The duplication was detected in all the Cucurbita species analysed, including C. maxima and C. moschata, but not in the more distant cucurbits belonging to the Cucumis and Citrullus genera, and it is likely to have occurred 30 ± 4 Mya in the ancestral species that gave rise to the genus. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

    Science.gov (United States)

    Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

    2013-11-02

    Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

  5. Genome duplication and mutations in ACE2 cause multicellular, fast-sedimenting phenotypes in evolved Saccharomyces cerevisiae.

    Science.gov (United States)

    Oud, Bart; Guadalupe-Medina, Victor; Nijkamp, Jurgen F; de Ridder, Dick; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc

    2013-11-05

    Laboratory evolution of the yeast Saccharomyces cerevisiae in bioreactor batch cultures yielded variants that grow as multicellular, fast-sedimenting clusters. Knowledge of the molecular basis of this phenomenon may contribute to the understanding of natural evolution of multicellularity and to manipulating cell sedimentation in laboratory and industrial applications of S. cerevisiae. Multicellular, fast-sedimenting lineages obtained from a haploid S. cerevisiae strain in two independent evolution experiments were analyzed by whole genome resequencing. The two evolved cell lines showed different frameshift mutations in a stretch of eight adenosines in ACE2, which encodes a transcriptional regulator involved in cell cycle control and mother-daughter cell separation. Introduction of the two ace2 mutant alleles into the haploid parental strain led to slow-sedimenting cell clusters that consisted of just a few cells, thus representing only a partial reconstruction of the evolved phenotype. In addition to single-nucleotide mutations, a whole-genome duplication event had occurred in both evolved multicellular strains. Construction of a diploid reference strain with two mutant ace2 alleles led to complete reconstruction of the multicellular-fast sedimenting phenotype. This study shows that whole-genome duplication and a frameshift mutation in ACE2 are sufficient to generate a fast-sedimenting, multicellular phenotype in S. cerevisiae. The nature of the ace2 mutations and their occurrence in two independent evolution experiments encompassing fewer than 500 generations of selective growth suggest that switching between unicellular and multicellular phenotypes may be relevant for competitiveness of S. cerevisiae in natural environments.

  6. Comparative genomic analysis of the MHC: the evolution of class I duplication blocks, diversity and complexity from shark to man.

    Science.gov (United States)

    Kulski, Jerzy K; Shiina, Takashi; Anzai, Tatsuya; Kohara, Sakae; Inoko, Hidetoshi

    2002-12-01

    The major histocompatibility complex (MHC) genomic region is composed of a group of linked genes involved functionally with the adaptive and innate immune systems. The class I and class II genes are intrinsic features of the MHC and have been found in all the jawed vertebrates studied so far. The MHC genomic regions of the human and the chicken (B locus) have been fully sequenced and mapped, and the mouse MHC sequence is almost finished. Information on the MHC genomic structures (size, complexity, genic and intergenic composition and organization, gene order and number) of other vertebrates is largely limited or nonexistent. Therefore, we are mapping, sequencing and analyzing the MHC genomic regions of different human haplotypes and at least eight nonhuman species. Here, we review our progress with these sequences and compare the human MHC structure with that of the nonhuman primates (chimpanzee and rhesus macaque), other mammals (pigs, mice and rats) and nonmammalian vertebrates such as birds (chicken and quail), bony fish (medaka, pufferfish and zebrafish) and cartilaginous fish (nurse shark). This comparison reveals a complex MHC structure for mammals and a relatively simpler design for nonmammalian animals with a hypothetical prototypic structure for the shark. In the mammalian MHC, there are two to five different class I duplication blocks embedded within a framework of conserved nonclass I and/or nonclass II genes. With a few exceptions, the class I framework genes are absent from the MHC of birds, bony fish and sharks. Comparative genomics of the MHC reveal a highly plastic region with major structural differences between the mammalian and nonmammalian vertebrates. Additional genomic data are needed on animals of the reptilia, crocodilia and marsupial classes to find the origins of the class I framework genes and examples of structures that may be intermediate between the simple and complex MHC organizations of birds and mammals, respectively.

  7. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  8. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  9. Yeast "make-accumulate-consume" life strategy evolved as a multi-step process that predates the whole genome duplication.

    Science.gov (United States)

    Hagman, Arne; Säll, Torbjörn; Compagno, Concetta; Piskur, Jure

    2013-01-01

    When fruits ripen, microbial communities start a fierce competition for the freely available fruit sugars. Three yeast lineages, including baker's yeast Saccharomyces cerevisiae, have independently developed the metabolic activity to convert simple sugars into ethanol even under fully aerobic conditions. This fermentation capacity, named Crabtree effect, reduces the cell-biomass production but provides in nature a tool to out-compete other microorganisms. Here, we analyzed over forty Saccharomycetaceae yeasts, covering over 200 million years of the evolutionary history, for their carbon metabolism. The experiments were done under strictly controlled and uniform conditions, which has not been done before. We show that the origin of Crabtree effect in Saccharomycetaceae predates the whole genome duplication and became a settled metabolic trait after the split of the S. cerevisiae and Kluyveromyces lineages, and coincided with the origin of modern fruit bearing plants. Our results suggest that ethanol fermentation evolved progressively, involving several successive molecular events that have gradually remodeled the yeast carbon metabolism. While some of the final evolutionary events, like gene duplications of glucose transporters and glycolytic enzymes, have been deduced, the earliest molecular events initiating Crabtree effect are still to be determined.

  10. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  11. Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

    Science.gov (United States)

    Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

    2018-01-15

    Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula)

    Czech Academy of Sciences Publication Activity Database

    Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr

    2017-01-01

    Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016

  13. A SNP Based Linkage Map of the Arctic Charr (Salvelinus alpinus Genome Provides Insights into the Diploidization Process After Whole Genome Duplication

    Directory of Open Access Journals (Sweden)

    Cameron M. Nugent

    2017-02-01

    Full Text Available Diploidization, which follows whole genome duplication events, does not occur evenly across the genome. In salmonid fishes, certain pairs of homeologous chromosomes preserve tetraploid loci in higher frequencies toward the telomeres due to residual tetrasomic inheritance. Research suggests this occurs only in homeologous pairs where one chromosome arm has undergone a fusion event. We present a linkage map for Arctic charr (Salvelinus alpinus, a salmonid species with relatively fewer chromosome fusions. Genotype by sequencing identified 19,418 SNPs, and a linkage map consisting of 4508 markers was constructed from a subset of high quality SNPs and microsatellite markers that were used to anchor the new map to previous versions. Both male- and female-specific linkage maps contained the expected number of 39 linkage groups. The chromosome type associated with each linkage group was determined, and 10 stable metacentric chromosomes were identified, along with a chromosome polymorphism involving the sex chromosome AC04. Two instances of a weak form of pseudolinkage were detected in the telomeric regions of homeologous chromosome arms in both female and male linkage maps. Chromosome arm homologies within the Atlantic salmon (Salmo salar and rainbow trout (Oncorhynchus mykiss genomes were determined. Paralogous sequence variants (PSVs were identified, and their comparative BLASTn hit locations showed that duplicate markers exist in higher numbers on seven pairs of homeologous arms, previously identified as preserving tetrasomy in salmonid species. Homeologous arm pairs where neither arm has been part of a fusion event in Arctic charr had fewer PSVs, suggesting faster diploidization rates in these regions.

  14. Genome-wide analysis of SSR and ILP markers in trees: diversity profiling, alternate distribution, and applications in duplication.

    Science.gov (United States)

    Xia, Xinyao; Luan, Lin Lin; Qin, Guanghua; Yu, Li Fang; Wang, Zhi Wei; Dong, Wan Chen; Song, Yumin; Qiao, Yuling; Zhang, Xian Sheng; Sang, Ya Lin; Yang, Long

    2017-12-20

    Molecular markers are efficient tools for breeding and genetic studies. However, despite their ecological and economic importance, their development and application have long been hampered. In this study, we identified 524,170 simple sequence repeat (SSR), 267,636 intron length polymorphism (ILP), and 11,872 potential intron polymorphism (PIP) markers from 16 tree species based on recently available genome sequences. Larger motifs, including hexamers and heptamers, accounted for most of the seven different types of SSR loci. Within these loci, A/T bases comprised a significantly larger proportion of sequence than G/C. SSR and ILP markers exhibited an alternative distribution pattern. Most SSRs were monomorphic markers, and the proportions of polymorphic markers were positively correlated with genome size. By verifying with all 16 tree species, 54 SSR, 418 ILP, and four PIP universal markers were obtained, and their efficiency was examined by PCR. A combination of five SSR and six ILP markers were used for the phylogenetic analysis of 30 willow samples, revealing a positive correlation between genetic diversity and geographic distance. We also found that SSRs can be used as tools for duplication analysis. Our findings provide important foundations for the development of breeding and genetic studies in tree species.

  15. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  16. Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch.

    Directory of Open Access Journals (Sweden)

    Raúl A Ortiz-Merino

    2017-05-01

    Full Text Available Many interspecies hybrids have been discovered in yeasts, but most of these hybrids are asexual and can replicate only mitotically. Whole-genome duplication has been proposed as a mechanism by which interspecies hybrids can regain fertility, restoring their ability to perform meiosis and sporulate. Here, we show that this process occurred naturally during the evolution of Zygosaccharomyces parabailii, an interspecies hybrid that was formed by mating between 2 parents that differed by 7% in genome sequence and by many interchromosomal rearrangements. Surprisingly, Z. parabailii has a full sexual cycle and is genetically haploid. It goes through mating-type switching and autodiploidization, followed by immediate sporulation. We identified the key evolutionary event that enabled Z. parabailii to regain fertility, which was breakage of 1 of the 2 homeologous copies of the mating-type (MAT locus in the hybrid, resulting in a chromosomal rearrangement and irreparable damage to 1 MAT locus. This rearrangement was caused by HO endonuclease, which normally functions in mating-type switching. With 1 copy of MAT inactivated, the interspecies hybrid now behaves as a haploid. Our results provide the first demonstration that MAT locus damage is a naturally occurring evolutionary mechanism for whole-genome duplication and restoration of fertility to interspecies hybrids. The events that occurred in Z. parabailii strongly resemble those postulated to have caused ancient whole-genome duplication in an ancestor of Saccharomyces cerevisiae.

  17. Evolution of Rosaceae Fruit Types Based on Nuclear Phylogeny in the Context of Geological Times and Genome Duplication.

    Science.gov (United States)

    Xiang, Yezi; Huang, Chien-Hsun; Hu, Yi; Wen, Jun; Li, Shisheng; Yi, Tingshuang; Chen, Hongyi; Xiang, Jun; Ma, Hong

    2017-02-01

    Fruits are the defining feature of angiosperms, likely have contributed to angiosperm successes by protecting and dispersing seeds, and provide foods to humans and other animals, with many morphological types and important ecological and agricultural implications. Rosaceae is a family with ∼3000 species and an extraordinary spectrum of distinct fruits, including fleshy peach, apple, and strawberry prized by their consumers, as well as dry achenetum and follicetum with features facilitating seed dispersal, excellent for studying fruit evolution. To address Rosaceae fruit evolution and other questions, we generated 125 new transcriptomic and genomic datasets and identified hundreds of nuclear genes to reconstruct a well-resolved Rosaceae phylogeny with highly supported monophyly of all subfamilies and tribes. Molecular clock analysis revealed an estimated age of ∼101.6 Ma for crown Rosaceae and divergence times of tribes and genera, providing a geological and climate context for fruit evolution. Phylogenomic analysis yielded strong evidence for numerous whole genome duplications (WGDs), supporting the hypothesis that the apple tribe had a WGD and revealing another one shared by fleshy fruit-bearing members of this tribe, with moderate support for WGDs in the peach tribe and other groups. Ancestral character reconstruction for fruit types supports independent origins of fleshy fruits from dry-fruit ancestors, including the evolution of drupes (e.g., peach) and pomes (e.g., apple) from follicetum, and drupetum (raspberry and blackberry) from achenetum. We propose that WGDs and environmental factors, including animals, contributed to the evolution of the many fruits in Rosaceae, which provide a foundation for understanding fruit evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Conservation of the abscission signaling peptide IDA during Angiosperm evolution: withstanding genome duplications and gain and loss of the receptors HAE/HSL2

    Directory of Open Access Journals (Sweden)

    Ida M. Stø

    2015-10-01

    Full Text Available The peptide INFLORESCENCE DEFICIENT IN ABSCISSION (IDA, which signals through the leucine-rich repeat receptor-like kinases HAESA (HAE and HAESA-LIKE2 (HSL2, controls different cell separation events in Arabidopsis thaliana. We hypothesize the involvement of this signaling module in abscission processes in other plant species even though they may shed other organs than A. thaliana. As the first step towards testing this hypothesis from an evolutionarily perspective we have identified genes encoding putative orthologues of IDA and its receptors by BLAST searches of publically available protein, nucleotide and genome databases for angiosperms. Genes encoding IDA or IDA-LIKE (IDL peptides and HSL proteins were found in all investigated species, which were selected as to represent each angiosperm order with available genomic sequences. The 12 amino acids representing the bioactive peptide in A. thaliana have virtually been unchanged throughout the evolution of the angiosperms; however, the number of IDL and HSL genes varies between different orders and species. The phylogenetic analyses suggest that IDA, HSL2 and the related HSL1 gene, were present in the species that gave rise to the angiosperms. HAE has arisen from HSL1 after a genome duplication that took place after the monocot - eudicots split. HSL1 has also independently been duplicated in the monocots, while HSL2 has been lost in gingers (Zingiberales and grasses (Poales. IDA has been duplicated in eudicots to give rise to functionally divergent IDL peptides. We postulate that the high number of IDL homologs present in the core eudicots is a result of multiple whole genome duplications. We substantiate the involvement of IDA and HAE/HSL2 homologs in abscission by providing gene expression data of different organ separation events from various species.

  20. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  2. Metabolic 'engines' of flight drive genome size reduction in birds.

    Science.gov (United States)

    Wright, Natalie A; Gregory, T Ryan; Witt, Christopher C

    2014-03-22

    The tendency for flying organisms to possess small genomes has been interpreted as evidence of natural selection acting on the physical size of the genome. Nonetheless, the flight-genome link and its mechanistic basis have yet to be well established by comparative studies within a volant clade. Is there a particular functional aspect of flight such as brisk metabolism, lift production or maneuverability that impinges on the physical genome? We measured genome sizes, wing dimensions and heart, flight muscle and body masses from a phylogenetically diverse set of bird species. In phylogenetically controlled analyses, we found that genome size was negatively correlated with relative flight muscle size and heart index (i.e. ratio of heart to body mass), but positively correlated with body mass and wing loading. The proportional masses of the flight muscles and heart were the most important parameters explaining variation in genome size in multivariate models. Hence, the metabolic intensity of powered flight appears to have driven genome size reduction in birds.

  3. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  4. The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability.

    Science.gov (United States)

    Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo

    2016-01-01

    1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication

  5. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  6. Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

    Science.gov (United States)

    Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

    2018-01-01

    Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

  7. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.

    Directory of Open Access Journals (Sweden)

    Shunsuke Suzuki

    2007-04-01

    Full Text Available Among mammals, only eutherians and marsupials are viviparous and have genomic imprinting that leads to parent-of-origin-specific differential gene expression. We used comparative analysis to investigate the origin of genomic imprinting in mammals. PEG10 (paternally expressed 10 is a retrotransposon-derived imprinted gene that has an essential role for the formation of the placenta of the mouse. Here, we show that an orthologue of PEG10 exists in another therian mammal, the marsupial tammar wallaby (Macropus eugenii, but not in a prototherian mammal, the egg-laying platypus (Ornithorhynchus anatinus, suggesting its close relationship to the origin of placentation in therian mammals. We have discovered a hitherto missing link of the imprinting mechanism between eutherians and marsupials because tammar PEG10 is the first example of a differentially methylated region (DMR associated with genomic imprinting in marsupials. Surprisingly, the marsupial DMR was strictly limited to the 5' region of PEG10, unlike the eutherian DMR, which covers the promoter regions of both PEG10 and the adjacent imprinted gene SGCE. These results not only demonstrate a common origin of the DMR-associated imprinting mechanism in therian mammals but provide the first demonstration that DMR-associated genomic imprinting in eutherians can originate from the repression of exogenous DNA sequences and/or retrotransposons by DNA methylation.

  8. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  9. Actomyosin drives cancer cell nuclear dysmorphia and threatens genome stability.

    Science.gov (United States)

    Takaki, Tohru; Montagner, Marco; Serres, Murielle P; Le Berre, Maël; Russell, Matt; Collinson, Lucy; Szuhai, Karoly; Howell, Michael; Boulton, Simon J; Sahai, Erik; Petronczki, Mark

    2017-07-24

    Altered nuclear shape is a defining feature of cancer cells. The mechanisms underlying nuclear dysmorphia in cancer remain poorly understood. Here we identify PPP1R12A and PPP1CB, two subunits of the myosin phosphatase complex that antagonizes actomyosin contractility, as proteins safeguarding nuclear integrity. Loss of PPP1R12A or PPP1CB causes nuclear fragmentation, nuclear envelope rupture, nuclear compartment breakdown and genome instability. Pharmacological or genetic inhibition of actomyosin contractility restores nuclear architecture and genome integrity in cells lacking PPP1R12A or PPP1CB. We detect actin filaments at nuclear envelope rupture sites and define the Rho-ROCK pathway as the driver of nuclear damage. Lamin A protects nuclei from the impact of actomyosin activity. Blocking contractility increases nuclear circularity in cultured cancer cells and suppresses deformations of xenograft nuclei in vivo. We conclude that actomyosin contractility is a major determinant of nuclear shape and that unrestrained contractility causes nuclear dysmorphia, nuclear envelope rupture and genome instability.

  10. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  11. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  12. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  13. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  14. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  15. Parasitism drives host genome evolution: Insights from the Pasteuria ramosa-Daphnia magna system.

    Science.gov (United States)

    Bourgeois, Yann; Roulin, Anne C; Müller, Kristina; Ebert, Dieter

    2017-04-01

    Because parasitism is thought to play a major role in shaping host genomes, it has been predicted that genomic regions associated with resistance to parasites should stand out in genome scans, revealing signals of selection above the genomic background. To test whether parasitism is indeed such a major factor in host evolution and to better understand host-parasite interaction at the molecular level, we studied genome-wide polymorphisms in 97 genotypes of the planktonic crustacean Daphnia magna originating from three localities across Europe. Daphnia magna is known to coevolve with the bacterial pathogen Pasteuria ramosa for which host genotypes (clonal lines) are either resistant or susceptible. Using association mapping, we identified two genomic regions involved in resistance to P. ramosa, one of which was already known from a previous QTL analysis. We then performed a naïve genome scan to test for signatures of positive selection and found that the two regions identified with the association mapping further stood out as outliers. Several other regions with evidence for selection were also found, but no link between these regions and phenotypic variation could be established. Our results are consistent with the hypothesis that parasitism is driving host genome evolution. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  16. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  17. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  18. Step-wise and punctuated genome evolution drive phenotype changes of tumor cells

    International Nuclear Information System (INIS)

    Stepanenko, Aleksei; Andreieva, Svitlana; Korets, Kateryna; Mykytenko, Dmytro; Huleyuk, Nataliya; Vassetzky, Yegor; Kavsan, Vadym

    2015-01-01

    genome context. Temozolomide treatment of 293-pcDNA3.1 cells intensified the stochastic punctuated genome changes and CNAs, and significantly reduced viability and CFE. In contrast, temozolomide treatment of HeLa-CHI3L1 cells promoted the step-wise genome changes, CNAs, and increased viability and CFE, which did not correlate with the ectopic CHI3L1 production. Thus, consistent coevolution of karyotypes and phenotypes was observed. CIN as a driving force of genome evolution significantly influences growth characteristics of tumor cells and should be always taken into consideration during the different experimental manipulations

  19. Step-wise and punctuated genome evolution drive phenotype changes of tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Stepanenko, Aleksei, E-mail: a.a.stepanenko@gmail.com [Department of Biosynthesis of Nucleic Acids, Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv 03680 (Ukraine); Andreieva, Svitlana; Korets, Kateryna; Mykytenko, Dmytro [Department of Biosynthesis of Nucleic Acids, Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv 03680 (Ukraine); Huleyuk, Nataliya [Institute of Hereditary Pathology, National Academy of Medical Sciences of Ukraine, Lviv 79008 (Ukraine); Vassetzky, Yegor [CNRS UMR8126, Université Paris-Sud 11, Institut de Cancérologie Gustave Roussy, Villejuif 94805 (France); Kavsan, Vadym [Department of Biosynthesis of Nucleic Acids, Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv 03680 (Ukraine)

    2015-01-15

    genome context. Temozolomide treatment of 293-pcDNA3.1 cells intensified the stochastic punctuated genome changes and CNAs, and significantly reduced viability and CFE. In contrast, temozolomide treatment of HeLa-CHI3L1 cells promoted the step-wise genome changes, CNAs, and increased viability and CFE, which did not correlate with the ectopic CHI3L1 production. Thus, consistent coevolution of karyotypes and phenotypes was observed. CIN as a driving force of genome evolution significantly influences growth characteristics of tumor cells and should be always taken into consideration during the different experimental manipulations.

  20. Switches in Genomic GC Content Drive Shifts of Optimal Codons under Sustained Selection on Synonymous Sites

    Science.gov (United States)

    Sun, Yu; Tamarit, Daniel

    2017-01-01

    Abstract The major codon preference model suggests that codons read by tRNAs in high concentrations are preferentially utilized in highly expressed genes. However, the identity of the optimal codons differs between species although the forces driving such changes are poorly understood. We suggest that these questions can be tackled by placing codon usage studies in a phylogenetic framework and that bacterial genomes with extreme nucleotide composition biases provide informative model systems. Switches in the background substitution biases from GC to AT have occurred in Gardnerella vaginalis (GC = 32%), and from AT to GC in Lactobacillus delbrueckii (GC = 62%) and Lactobacillus fermentum (GC = 63%). We show that despite the large effects on codon usage patterns by these switches, all three species evolve under selection on synonymous sites. In G. vaginalis, the dramatic codon frequency changes coincide with shifts of optimal codons. In contrast, the optimal codons have not shifted in the two Lactobacillus genomes despite an increased fraction of GC-ending codons. We suggest that all three species are in different phases of an on-going shift of optimal codons, and attribute the difference to a stronger background substitution bias and/or longer time since the switch in G. vaginalis. We show that comparative and correlative methods for optimal codon identification yield conflicting results for genomes in flux and discuss possible reasons for the mispredictions. We conclude that switches in the direction of the background substitution biases can drive major shifts in codon preference patterns even under sustained selection on synonymous codon sites. PMID:27540085

  1. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  2. PBX1 Genomic Pioneer Function Drives ERα Signaling Underlying Progression in Breast Cancer

    Science.gov (United States)

    Magnani, Luca; Ballantyne, Elizabeth B.; Zhang, Xiaoyang; Lupien, Mathieu

    2011-01-01

    Altered transcriptional programs are a hallmark of diseases, yet how these are established is still ill-defined. PBX1 is a TALE homeodomain protein involved in the development of different types of cancers. The estrogen receptor alpha (ERα) is central to the development of two-thirds of all breast cancers. Here we demonstrate that PBX1 acts as a pioneer factor and is essential for the ERα-mediated transcriptional response driving aggressive tumors in breast cancer. Indeed, PBX1 expression correlates with ERα in primary breast tumors, and breast cancer cells depleted of PBX1 no longer proliferate following estrogen stimulation. Profiling PBX1 recruitment and chromatin accessibility across the genome of breast cancer cells through ChIP-seq and FAIRE-seq reveals that PBX1 is loaded and promotes chromatin openness at specific genomic locations through its capacity to read specific epigenetic signatures. Accordingly, PBX1 guides ERα recruitment to a specific subset of sites. Expression profiling studies demonstrate that PBX1 controls over 70% of the estrogen response. More importantly, the PBX1-dependent transcriptional program is associated with poor-outcome in breast cancer patients. Correspondingly, PBX1 expression alone can discriminate a priori the outcome in ERα-positive breast cancer patients. These features are markedly different from the previously characterized ERα-associated pioneer factor FoxA1. Indeed, PBX1 is the only pioneer factor identified to date that discriminates outcome such as metastasis in ERα-positive breast cancer patients. Together our results reveal that PBX1 is a novel pioneer factor defining aggressive ERα-positive breast tumors, as it guides ERα genomic activity to unique genomic regions promoting a transcriptional program favorable to breast cancer progression. PMID:22125492

  3. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  4. Neuropilin-2 genomic elements drive cre recombinase expression in primitive blood, vascular and neuronal lineages.

    Science.gov (United States)

    Wiszniak, Sophie; Scherer, Michaela; Ramshaw, Hayley; Schwarz, Quenten

    2015-11-01

    We have established a novel Cre mouse line, using genomic elements encompassing the Nrp2 locus, present within a bacterial artificial chromosome clone. By crossing this Cre driver line to R26R LacZ reporter mice, we have documented the temporal expression and lineage traced tissues in which Cre is expressed. Nrp2-Cre drives expression in primitive blood cells arising from the yolk sac, venous and lymphatic endothelial cells, peripheral sensory ganglia, and the lung bud. This mouse line will provide a new tool to researchers wishing to study the development of various tissues and organs in which this Cre driver is expressed, as well as allow tissue-specific knockout of genes of interest to study protein function. This work also presents the first evidence for expression of Nrp2 protein in a mesodermal progenitor with restricted hematopoietic potential, which will significantly advance the study of primitive erythropoiesis. genesis 53:709-717, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  5. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. No evidence that sex and transposable elements drive genome size variation in evening primroses.

    Science.gov (United States)

    Ågren, J Arvid; Greiner, Stephan; Johnson, Marc T J; Wright, Stephen I

    2015-04-01

    Genome size varies dramatically across species, but despite an abundance of attention there is little agreement on the relative contributions of selective and neutral processes in governing this variation. The rate of sex can potentially play an important role in genome size evolution because of its effect on the efficacy of selection and transmission of transposable elements (TEs). Here, we used a phylogenetic comparative approach and whole genome sequencing to investigate the contribution of sex and TE content to genome size variation in the evening primrose (Oenothera) genus. We determined genome size using flow cytometry for 30 species that vary in genetic system and find that variation in sexual/asexual reproduction cannot explain the almost twofold variation in genome size. Moreover, using whole genome sequences of three species of varying genome sizes and reproductive system, we found that genome size was not associated with TE abundance; instead the larger genomes had a higher abundance of simple sequence repeats. Although it has long been clear that sexual reproduction may affect various aspects of genome evolution in general and TE evolution in particular, it does not appear to have played a major role in genome size evolution in the evening primroses. © 2015 The Author(s).

  7. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  8. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  9. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  10. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  11. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  12. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  13. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  14. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  15. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression

    DEFF Research Database (Denmark)

    Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing

    2018-01-01

    BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...

  16. Landscape genomics: natural selection drives the evolution of mitogenome in penguins

    OpenAIRE

    Ramos, Barbara; González-Acuña, Daniel; Loyola, David E.; Johnson, Warren E.; Parker, Patricia G.; Massaro, Melanie; Dantas, Gisele P. M.; Miranda, Marcelo D.; Vianna, Juliana A.

    2018-01-01

    Background Mitochondria play a key role in the balance of energy and heat production, and therefore the mitochondrial genome is under natural selection by environmental temperature and food availability, since starvation can generate more efficient coupling of energy production. However, selection over mitochondrial DNA (mtDNA) genes has usually been evaluated at the population level. We sequenced by NGS 12 mitogenomes and with four published genomes, assessed genetic variation in ten penguin...

  17. Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC.

    Science.gov (United States)

    Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard

    2015-06-10

    Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  19. Genomes in Turmoil: Frugality Drives Microbial Community Structure in Extremely Acidic Environments

    Science.gov (United States)

    Holmes, D. S.

    2016-12-01

    Extremely acidic environments (To gain insight into these issues, we have conducted deep bioinformatic analyses, including metabolic reconstruction of key assimilatory pathways, phylogenomics and network scrutiny of >160 genomes of acidophiles, including representatives from Archaea, Bacteria and Eukarya and at least ten metagenomes of acidic environments [Cardenas JP, et al. pp 179-197 in Acidophiles, eds R. Quatrini and D. B. Johnson, Caister Academic Press, UK (2016)]. Results yielded valuable insights into cellular processes, including carbon and nitrogen management and energy production, linking biogeochemical processes to organismal physiology. They also provided insight into the evolutionary forces that shape the genomic structure of members of acidophile communities. Niche partitioning can explain diversity patterns in rapidly changing acidic environments such as bioleaching heaps. However, in spatially and temporally homogeneous acidic environments genome flux appears to provide deeper insight into the composition and evolution of acidic consortia. Acidophiles have undergone genome streamlining by gene loss promoting mutual coexistence of species that exploit complementarity use of scarce resources consistent with the Black Queen hypothesis [Morris JJ et al. mBio 3: e00036-12 (2012)]. Acidophiles also have a large pool of accessory genes (the microbial super-genome) that can be accessed by horizontal gene transfer. This further promotes dependency relationships as drivers of community structure and the evolution of keystone species. Acknowledgements: Fondecyt 1130683; Basal CCTE PFB16

  20. Symbiotic adaptation drives genome streamlining of the cyanobacterial sponge symbiont "Candidatus Synechococcus pongiarum"

    KAUST Repository

    Gao, Zhao-Ming

    2014-04-01

    "Candidatus Synechococcus spongiarum" is a cyanobacterial symbiont widely distributed in sponges, but its functions at the genome level remain unknown. Here, we obtained the draft genome (1.66 Mbp, 90% estimated genome recovery) of "Ca. Synechococcus spongiarum" strain SH4 inhabiting the Red Sea sponge Carteriospongia foliascens. Phylogenomic analysis revealed a high dissimilarity between SH4 and free-living cyanobacterial strains. Essential functions, such as photosynthesis, the citric acid cycle, and DNA replication, were detected in SH4. Eukaryoticlike domains that play important roles in sponge-symbiont interactions were identified exclusively in the symbiont. However, SH4 could not biosynthesize methionine and polyamines and had lost partial genes encoding low-molecular-weight peptides of the photosynthesis complex, antioxidant enzymes, DNA repair enzymes, and proteins involved in resistance to environmental toxins and in biosynthesis of capsular and extracellular polysaccharides. These genetic modifications imply that "Ca. Synechococcus spongiarum" SH4 represents a low-light-adapted cyanobacterial symbiont and has undergone genome streamlining to adapt to the sponge\\'s mild intercellular environment. 2014 Gao et al.

  1. Symbiotic adaptation drives genome streamlining of the cyanobacterial sponge symbiont "Candidatus Synechococcus pongiarum"

    KAUST Repository

    Gao, Zhao-Ming; Wang, Yong; Tian, Ren-Mao; Wong, Yue Him; Batang, Zenon B.; Al-Suwailem, Abdulaziz M.; Bajic, Vladimir B.; Qian, Pei-Yuan

    2014-01-01

    "Candidatus Synechococcus spongiarum" is a cyanobacterial symbiont widely distributed in sponges, but its functions at the genome level remain unknown. Here, we obtained the draft genome (1.66 Mbp, 90% estimated genome recovery) of "Ca. Synechococcus spongiarum" strain SH4 inhabiting the Red Sea sponge Carteriospongia foliascens. Phylogenomic analysis revealed a high dissimilarity between SH4 and free-living cyanobacterial strains. Essential functions, such as photosynthesis, the citric acid cycle, and DNA replication, were detected in SH4. Eukaryoticlike domains that play important roles in sponge-symbiont interactions were identified exclusively in the symbiont. However, SH4 could not biosynthesize methionine and polyamines and had lost partial genes encoding low-molecular-weight peptides of the photosynthesis complex, antioxidant enzymes, DNA repair enzymes, and proteins involved in resistance to environmental toxins and in biosynthesis of capsular and extracellular polysaccharides. These genetic modifications imply that "Ca. Synechococcus spongiarum" SH4 represents a low-light-adapted cyanobacterial symbiont and has undergone genome streamlining to adapt to the sponge's mild intercellular environment. 2014 Gao et al.

  2. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  3. Both selective and neutral processes drive GC content evolution in the human genome

    Directory of Open Access Journals (Sweden)

    Cagliani Rachele

    2008-03-01

    Full Text Available Abstract Background Mammalian genomes consist of regions differing in GC content, referred to as isochores or GC-content domains. The scientific debate is still open as to whether such compositional heterogeneity is a selected or neutral trait. Results Here we analyze SNP allele frequencies, retrotransposon insertion polymorphisms (RIPs, as well as fixed substitutions accumulated in the human lineage since its divergence from chimpanzee to indicate that biased gene conversion (BGC has been playing a role in within-genome GC content variation. Yet, a distinct contribution to GC content evolution is accounted for by a selective process. Accordingly, we searched for independent evidences that GC content distribution does not conform to neutral expectations. Indeed, after correcting for possible biases, we show that intron GC content and size display isochore-specific correlations. Conclusion We consider that the more parsimonious explanation for our results is that GC content is subjected to the action of both weak selection and BGC in the human genome with features such as nucleosome positioning or chromatin conformation possibly representing the final target of selective processes. This view might reconcile previous contrasting findings and add some theoretical background to recent evidences suggesting that GC content domains display different behaviors with respect to highly regulated biological processes such as developmentally-stage related gene expression and programmed replication timing during neural stem cell differentiation.

  4. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  5. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  7. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  8. Genomic Instability: The Driving Force behind Refractory/Relapsing Hodgkin’s Lymphoma

    International Nuclear Information System (INIS)

    Knecht, Hans; Righolt, Christiaan; Mai, Sabine

    2013-01-01

    In classical Hodgkin’s lymphoma (HL) the malignant mononuclear Hodgkin (H) and multinuclear, diagnostic Reed-Sternberg (RS) cells are rare and generally make up <3% of the total cellular mass of the affected lymph nodes. During recent years, the introduction of laser micro-dissection techniques at the single cell level has substantially improved our understanding of the molecular pathogenesis of HL. Gene expression profiling, comparative genomic hybridization analysis, micro-RNA expression profiling and viral oncogene sequencing have deepened our knowledge of numerous facets of H- and RS-cell gene expression deregulation. The question remains whether disturbed signaling pathways and deregulated transcription factors are at the origin of refractory/relapsing Hodgkin’s lymphoma or whether these hallmarks are at least partially related to another major factor. We recently showed that the 3D nuclear organization of telomeres and chromosomes marked the transition from H- to RS-cells in HL cell lines. This transition is associated with progression of telomere dysfunction, shelterin disruption and progression of complex chromosomal rearrangements. We reported analogous findings in refractory/relapsing HL and identified the shelterin proteins TRF1, TRF2 and POT1 as targets of the LMP1 oncogene in post-germinal center B-cells. Here we summarize our findings, including data not previously published, and propose a model in which progressive disruption of nuclear integrity, a form of genomic instability, is the key-player in refractory/relapsing HL. Therapeutic approaches should take these findings into account

  9. Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

    Science.gov (United States)

    Trotta, Edoardo

    2016-05-17

    The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

  10. Landscape genomics: natural selection drives the evolution of mitogenome in penguins.

    Science.gov (United States)

    Ramos, Barbara; González-Acuña, Daniel; Loyola, David E; Johnson, Warren E; Parker, Patricia G; Massaro, Melanie; Dantas, Gisele P M; Miranda, Marcelo D; Vianna, Juliana A

    2018-01-16

    Mitochondria play a key role in the balance of energy and heat production, and therefore the mitochondrial genome is under natural selection by environmental temperature and food availability, since starvation can generate more efficient coupling of energy production. However, selection over mitochondrial DNA (mtDNA) genes has usually been evaluated at the population level. We sequenced by NGS 12 mitogenomes and with four published genomes, assessed genetic variation in ten penguin species distributed from the equator to Antarctica. Signatures of selection of 13 mitochondrial protein-coding genes were evaluated by comparing among species within and among genera (Spheniscus, Pygoscelis, Eudyptula, Eudyptes and Aptenodytes). The genetic data were correlated with environmental data obtained through remote sensing (sea surface temperature [SST], chlorophyll levels [Chl] and a combination of SST and Chl [COM]) through the distribution of these species. We identified the complete mtDNA genomes of several penguin species, including ND6 and 8 tRNAs on the light strand and 12 protein coding genes, 14 tRNAs and two rRNAs positioned on the heavy strand. The highest diversity was found in NADH dehydrogenase genes and the lowest in COX genes. The lowest evolutionary divergence among species was between Humboldt (Spheniscus humboldti) and Galapagos (S. mendiculus) penguins (0.004), while the highest was observed between little penguin (Eudyptula minor) and Adélie penguin (Pygoscelis adeliae) (0.097). We identified a signature of purifying selection (Ka/Ks penguins. In contrast, COX1 had a signature of strong negative selection. ND4 Ka/Ks ratios were highly correlated with SST (Mantel, p-value: 0.0001; GLM, p-value: 0.00001) and thus may be related to climate adaptation throughout penguin speciation. These results identify mtDNA candidate genes under selection which could be involved in broad-scale adaptations of penguins to their environment. Such knowledge may be

  11. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  12. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  13. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  14. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  15. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  16. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  17. Adaptive selection on bracovirus genomes drives the specialization of Cotesia parasitoid wasps.

    Directory of Open Access Journals (Sweden)

    Séverine Jancek

    Full Text Available The geographic mosaic of coevolution predicts parasite virulence should be locally adapted to the host community. Cotesia parasitoid wasps adapt to local lepidopteran species possibly through their symbiotic bracovirus. The virus, essential for the parasitism success, is at the heart of the complex coevolutionary relationship linking the wasps and their hosts. The large segmented genome contained in the virus particles encodes virulence genes involved in host immune and developmental suppression. Coevolutionary arms race should result in the positive selection of particular beneficial alleles. To understand the global role of bracoviruses in the local adaptation or specialization of parasitoid wasps to their hosts, we studied the molecular evolution of four bracoviruses associated with wasps of the genus Cotesia, including C congregata, C vestalis and new data and annotation on two ecologically differentiated populations of C sesamie, Kitale and Mombasa. Paired orthologs analyses revealed more genes under positive selection when comparing the two C sesamiae bracoviruses belonging to the same species, and more genes under strong evolutionary constraint between species. Furthermore branch-site evolutionary models showed that 17 genes, out of the 54 currently available shared by the four bracoviruses, harboured sites under positive selection including: the histone H4-like, a C-type lectin, two ep1-like, ep2, a viral ankyrin, CrV1, a ben-domain, a Serine-rich, and eight unknown genes. Lastly the phylogenetic analyses of the histone, ep2 and CrV1 genes in different African C sesamiae populations showed that each gene described differently the individual relationships. In particular we found recombination had happened between the ep2 and CrV1 genes, which are localized 37.5 kb apart on the wasp chromosomes. Involved in multidirectional coevolutionary interactions, C sesamiae wasps rely on different bracovirus mediated molecular pathways to overcome

  18. Imaging-genomics reveals driving pathways of MRI derived volumetric tumor phenotype features in Glioblastoma

    International Nuclear Information System (INIS)

    Grossmann, Patrick; Gutman, David A.; Dunn, William D. Jr; Holder, Chad A.; Aerts, Hugo J. W. L.

    2016-01-01

    Glioblastoma (GBM) tumors exhibit strong phenotypic differences that can be quantified using magnetic resonance imaging (MRI), but the underlying biological drivers of these imaging phenotypes remain largely unknown. An Imaging-Genomics analysis was performed to reveal the mechanistic associations between MRI derived quantitative volumetric tumor phenotype features and molecular pathways. One hundred fourty one patients with presurgery MRI and survival data were included in our analysis. Volumetric features were defined, including the necrotic core (NE), contrast-enhancement (CE), abnormal tumor volume assessed by post-contrast T1w (tumor bulk or TB), tumor-associated edema based on T2-FLAIR (ED), and total tumor volume (TV), as well as ratios of these tumor components. Based on gene expression where available (n = 91), pathway associations were assessed using a preranked gene set enrichment analysis. These results were put into context of molecular subtypes in GBM and prognostication. Volumetric features were significantly associated with diverse sets of biological processes (FDR < 0.05). While NE and TB were enriched for immune response pathways and apoptosis, CE was associated with signal transduction and protein folding processes. ED was mainly enriched for homeostasis and cell cycling pathways. ED was also the strongest predictor of molecular GBM subtypes (AUC = 0.61). CE was the strongest predictor of overall survival (C-index = 0.6; Noether test, p = 4x10 −4 ). GBM volumetric features extracted from MRI are significantly enriched for information about the biological state of a tumor that impacts patient outcomes. Clinical decision-support systems could exploit this information to develop personalized treatment strategies on the basis of noninvasive imaging. The online version of this article (doi:10.1186/s12885-016-2659-5) contains supplementary material, which is available to authorized users

  19. Identification of Driving ALK Fusion Genes and Genomic Landscape of Medullary Thyroid Cancer.

    Directory of Open Access Journals (Sweden)

    Jun Ho Ji

    2015-08-01

    Full Text Available The genetic landscape of medullary thyroid cancer (MTC is not yet fully understood, although some oncogenic mutations have been identified. To explore genetic profiles of MTCs, formalin-fixed, paraffin-embedded tumor tissues from MTC patients were assayed on the Ion AmpliSeq Cancer Panel v2. Eighty-four sporadic MTC samples and 36 paired normal thyroid tissues were successfully sequenced. We discovered 101 hotspot mutations in 18 genes in the 84 MTC tissue samples. The most common mutation was in the ret proto-oncogene, which occurred in 47 cases followed by mutations in genes encoding Harvey rat sarcoma viral oncogene homolog (N = 14, serine/threonine kinase 11 (N = 11, v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (N = 6, mutL homolog 1 (N = 4, Kiesten rat sarcoma viral oncogene homolog (N = 3 and MET proto-oncogene (N = 3. We also evaluated anaplastic lymphoma kinase (ALK rearrangement by immunohistochemistry and break-apart fluorescence in situ hybridization (FISH. Two of 98 screened cases were positive for ALK FISH. To identify the genomic breakpoint and 5' fusion partner of ALK, customized targeted cancer panel sequencing was performed using DNA from tumor samples of the two patients. Glutamine:fructose-6-phosphate transaminase 1 (GFPT1-ALK and echinoderm microtubule-associated protein-like 4 (EML4-ALK fusions were identified. Additional PCR analysis, followed by Sanger sequencing, confirmed the GFPT1-ALK fusion, indicating that the fusion is a result of intra-chromosomal translocation or deletion. Notably, a metastatic MTC case harboring the EML4-ALK fusion showed a dramatic response to an ALK inhibitor, crizotinib. In conclusion, we found several genetic mutations in MTC and are the first to identify ALK fusions in MTC. Our results suggest that the EML4-ALK fusion in MTC may be a potential driver mutation and a valid target of ALK inhibitors. Furthermore, the GFPT1-ALK fusion may be a potential candidate for molecular

  20. Universal features in the genome-level evolution of protein domains.

    Science.gov (United States)

    Cosentino Lagomarsino, Marco; Sellerio, Alessandro L; Heijning, Philip D; Bassetti, Bruno

    2009-01-01

    Protein domains can be used to study proteome evolution at a coarse scale. In particular, they are found on genomes with notable statistical distributions. It is known that the distribution of domains with a given topology follows a power law. We focus on a further aspect: these distributions, and the number of distinct topologies, follow collective trends, or scaling laws, depending on the total number of domains only, and not on genome-specific features. We present a stochastic duplication/innovation model, in the class of the so-called 'Chinese restaurant processes', that explains this observation with two universal parameters, representing a minimal number of domains and the relative weight of innovation to duplication. Furthermore, we study a model variant where new topologies are related to occurrence in genomic data, accounting for fold specificity. Both models have general quantitative agreement with data from hundreds of genomes, which indicates that the domains of a genome are built with a combination of specificity and robust self-organizing phenomena. The latter are related to the basic evolutionary 'moves' of duplication and innovation, and give rise to the observed scaling laws, a priori of the specific evolutionary history of a genome. We interpret this as the concurrent effect of neutral and selective drives, which increase duplication and decrease innovation in larger and more complex genomes. The validity of our model would imply that the empirical observation of a small number of folds in nature may be a consequence of their evolution.

  1. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  2. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  3. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  4. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  5. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  6. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  7. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  8. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  9. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  10. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  11. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  12. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  13. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  15. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  16. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  17. Genomes

    National Research Council Canada - National Science Library

    Brown, T. A. (Terence A.)

    2002-01-01

    ... of genome expression and replication processes, and transcriptomics and proteomics. This text is richly illustrated with clear, easy-to-follow, full color diagrams, which are downloadable from the book's website...

  18. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  19. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  20. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  1. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  2. Variation in Linked Selection and Recombination Drive Genomic Divergence during Allopatric Speciation of European and American Aspens.

    Science.gov (United States)

    Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K

    2016-07-01

    Despite the global economic and ecological importance of forest trees, the genomic basis of differential adaptation and speciation in tree species is still poorly understood. Populus tremula and Populus tremuloides are two of the most widespread tree species in the Northern Hemisphere. Using whole-genome re-sequencing data of 24 P. tremula and 22 P. tremuloides individuals, we find that the two species diverged ∼2.2-3.1 million years ago, coinciding with the severing of the Bering land bridge and the onset of dramatic climatic oscillations during the Pleistocene. Both species have experienced substantial population expansions following long-term declines after species divergence. We detect widespread and heterogeneous genomic differentiation between species, and in accordance with the expectation of allopatric speciation, coalescent simulations suggest that neutral evolutionary processes can account for most of the observed patterns of genetic differentiation. However, there is an excess of regions exhibiting extreme differentiation relative to those expected under demographic simulations, which is indicative of the action of natural selection. Overall genetic differentiation is negatively associated with recombination rate in both species, providing strong support for a role of linked selection in generating the heterogeneous genomic landscape of differentiation between species. Finally, we identify a number of candidate regions and genes that may have been subject to positive and/or balancing selection during the speciation process. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  4. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  5. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  6. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  7. Genome-Wide Transcription and Functional Analyses Reveal Heterogeneous Molecular Mechanisms Driving Pyrethroids Resistance in the Major Malaria Vector Anopheles funestus Across Africa.

    Science.gov (United States)

    Riveron, Jacob M; Ibrahim, Sulaiman S; Mulamba, Charles; Djouaka, Rousseau; Irving, Helen; Wondji, Murielle J; Ishak, Intan H; Wondji, Charles S

    2017-06-07

    Pyrethroid resistance in malaria vector, An. funestus is increasingly reported across Africa, threatening the sustainability of pyrethroid-based control interventions, including long lasting insecticidal nets (LLINs). Managing this problem requires understanding of the molecular basis of the resistance from different regions of the continent, to establish whether it is being driven by a single or independent selective events. Here, using a genome-wide transcription profiling of pyrethroid resistant populations from southern (Malawi), East (Uganda), and West Africa (Benin), we investigated the molecular basis of resistance, revealing strong differences between the different African regions. The duplicated cytochrome P450 genes ( CYP6P9a and CYP6P9b ) which were highly overexpressed in southern Africa are not the most upregulated in other regions, where other genes are more overexpressed, including GSTe2 in West (Benin) and CYP9K1 in East (Uganda). The lack of directional selection on both CYP6P9a and CYP6P9b in Uganda in contrast to southern Africa further supports the limited role of these genes outside southern Africa. However, other genes such as the P450 CYP9J11 are commonly overexpressed in all countries across Africa. Here, CYP9J11 is functionally characterized and shown to confer resistance to pyrethroids and moderate cross-resistance to carbamates (bendiocarb). The consistent overexpression of GSTe2 in Benin is coupled with a role of allelic variation at this gene as GAL4-UAS transgenic expression in Drosophila flies showed that the resistant 119F allele is highly efficient in conferring both DDT and permethrin resistance than the L119. The heterogeneity in the molecular basis of resistance and cross-resistance to insecticides in An. funestus populations throughout sub-Saharan African should be taken into account in designing resistance management strategies. Copyright © 2017 Riveron et al.

  8. Genome-Wide Transcription and Functional Analyses Reveal Heterogeneous Molecular Mechanisms Driving Pyrethroids Resistance in the Major Malaria Vector Anopheles funestus Across Africa

    Science.gov (United States)

    Riveron, Jacob M.; Ibrahim, Sulaiman S.; Mulamba, Charles; Djouaka, Rousseau; Irving, Helen; Wondji, Murielle J.; Ishak, Intan H.; Wondji, Charles S.

    2017-01-01

    Pyrethroid resistance in malaria vector, An. funestus is increasingly reported across Africa, threatening the sustainability of pyrethroid-based control interventions, including long lasting insecticidal nets (LLINs). Managing this problem requires understanding of the molecular basis of the resistance from different regions of the continent, to establish whether it is being driven by a single or independent selective events. Here, using a genome-wide transcription profiling of pyrethroid resistant populations from southern (Malawi), East (Uganda), and West Africa (Benin), we investigated the molecular basis of resistance, revealing strong differences between the different African regions. The duplicated cytochrome P450 genes (CYP6P9a and CYP6P9b) which were highly overexpressed in southern Africa are not the most upregulated in other regions, where other genes are more overexpressed, including GSTe2 in West (Benin) and CYP9K1 in East (Uganda). The lack of directional selection on both CYP6P9a and CYP6P9b in Uganda in contrast to southern Africa further supports the limited role of these genes outside southern Africa. However, other genes such as the P450 CYP9J11 are commonly overexpressed in all countries across Africa. Here, CYP9J11 is functionally characterized and shown to confer resistance to pyrethroids and moderate cross-resistance to carbamates (bendiocarb). The consistent overexpression of GSTe2 in Benin is coupled with a role of allelic variation at this gene as GAL4-UAS transgenic expression in Drosophila flies showed that the resistant 119F allele is highly efficient in conferring both DDT and permethrin resistance than the L119. The heterogeneity in the molecular basis of resistance and cross-resistance to insecticides in An. funestus populations throughout sub-Saharan African should be taken into account in designing resistance management strategies. PMID:28428243

  9. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  10. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  11. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  12. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  13. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  14. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  15. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  17. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  18. Evolutionary and Comparative Genomics to Drive Rational Drug Design, with Particular Focus on Neuropeptide Seven-Transmembrane Receptors.

    Science.gov (United States)

    Furlong, Michael; Seong, Jae Young

    2017-01-01

    Seven transmembrane receptors (7TMRs), also known as G protein-coupled receptors, are popular targets of drug development, particularly 7TMR systems that are activated by peptide ligands. Although many pharmaceutical drugs have been discovered via conventional bulk analysis techniques the increasing availability of structural and evolutionary data are facilitating change to rational, targeted drug design. This article discusses the appeal of neuropeptide-7TMR systems as drug targets and provides an overview of concepts in the evolution of vertebrate genomes and gene families. Subsequently, methods that use evolutionary concepts and comparative analysis techniques to aid in gene discovery, gene function identification, and novel drug design are provided along with case study examples.

  19. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases.

    Science.gov (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E

    2000-03-13

    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  20. Rapid Genome-wide Recruitment of RNA Polymerase II Drives Transcription, Splicing, and Translation Events during T Cell Responses

    Directory of Open Access Journals (Sweden)

    Kathrin Davari

    2017-04-01

    Full Text Available Summary: Activation of immune cells results in rapid functional changes, but how such fast changes are accomplished remains enigmatic. By combining time courses of 4sU-seq, RNA-seq, ribosome profiling (RP, and RNA polymerase II (RNA Pol II ChIP-seq during T cell activation, we illustrate genome-wide temporal dynamics for ∼10,000 genes. This approach reveals not only immediate-early and posttranscriptionally regulated genes but also coupled changes in transcription and translation for >90% of genes. Recruitment, rather than release of paused RNA Pol II, primarily mediates transcriptional changes. This coincides with a genome-wide temporary slowdown in cotranscriptional splicing, even for polyadenylated mRNAs that are localized at the chromatin. Subsequent splicing optimization correlates with increasing Ser-2 phosphorylation of the RNA Pol II carboxy-terminal domain (CTD and activation of the positive transcription elongation factor (pTEFb. Thus, rapid de novo recruitment of RNA Pol II dictates the course of events during T cell activation, particularly transcription, splicing, and consequently translation. : Davari et al. visualize global changes in RNA Pol II binding, transcription, splicing, and translation. T cells change their functional program by rapid de novo recruitment of RNA Pol II and coupled changes in transcription and translation. This coincides with fluctuations in RNA Pol II phosphorylation and a temporary reduction in cotranscriptional splicing. Keywords: RNA Pol II, cotranscriptional splicing, T cell activation, ribosome profiling, 4sU, H3K36, Ser-5 RNA Pol II, Ser-2 RNA Pol II, immune response, immediate-early genes

  1. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    Science.gov (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  2. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  3. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  5. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  6. Ultrafast comparison of personal genomes

    OpenAIRE

    Mauldin, Denise; Hood, Leroy; Robinson, Max; Glusman, Gustavo

    2017-01-01

    We present an ultra-fast method for comparing personal genomes. We transform the standard genome representation (lists of variants relative to a reference) into 'genome fingerprints' that can be readily compared across sequencing technologies and reference versions. Because of their reduced size, computation on the genome fingerprints is fast and requires little memory. This enables scaling up a variety of important genome analyses, including quantifying relatedness, recognizing duplicative s...

  7. Promotion and Suppression of Centriole Duplication Are Catalytically Coupled through PLK4 to Ensure Centriole Homeostasis

    Directory of Open Access Journals (Sweden)

    Minhee Kim

    2016-08-01

    Full Text Available PLK4 is the major kinase driving centriole duplication. Duplication occurs only once per cell cycle, forming one new (or daughter centriole that is tightly engaged to the preexisting (or mother centriole. Centriole engagement is known to block the reduplication of mother centrioles, but the molecular identity responsible for the block remains unclear. Here, we show that the centriolar cartwheel, the geometric scaffold for centriole assembly, forms the identity of daughter centrioles essential for the block, ceasing further duplication of the mother centriole to which it is engaged. To ensure a steady block, we found that the cartwheel requires constant maintenance by PLK4 through phosphorylation of the same substrate that drives centriole assembly, revealing a parsimonious control in which “assembly” and “block for new assembly” are linked through the same catalytic reaction to achieve homeostasis. Our results support a recently deduced model that the cartwheel-bound PLK4 directly suppresses centriole reduplication.

  8. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  9. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  10. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  11. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  12. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  13. Fine mapping of a de novo interstitial 10q22-q23 duplication in a patient with congenital heart disease and microcephaly

    DEFF Research Database (Denmark)

    Erdogan, F; Belloso, J M; Gabau, E

    2008-01-01

    deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22...

  14. Drive Stands

    Data.gov (United States)

    Federal Laboratory Consortium — The Electrical Systems Laboratory (ESL)houses numerous electrically driven drive stands. A drive stand consists of an electric motor driving a gearbox and a mounting...

  15. Duplicate Record Elimination in Large Data Files.

    Science.gov (United States)

    1981-08-01

    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  16. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  17. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  18. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  19. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  20. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  1. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  2. Rectal duplication cyst in a cat.

    Science.gov (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio

    2010-12-01

    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  3. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  4. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  5. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  6. [Rectal duplication cyst--case report].

    Science.gov (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J

    2009-06-01

    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  7. The mitochondrial genomes of the acoelomorph worms Paratomella rubra, Isodiametra pulchra and Archaphanostoma ylvae.

    Science.gov (United States)

    Robertson, Helen E; Lapraz, François; Egger, Bernhard; Telford, Maximilian J; Schiffer, Philipp H

    2017-05-12

    Acoels are small, ubiquitous - but understudied - marine worms with a very simple body plan. Their internal phylogeny is still not fully resolved, and the position of their proposed phylum Xenacoelomorpha remains debated. Here we describe mitochondrial genome sequences from the acoels Paratomella rubra and Isodiametra pulchra, and the complete mitochondrial genome of the acoel Archaphanostoma ylvae. The P. rubra and A. ylvae sequences are typical for metazoans in size and gene content. The larger I. pulchra  mitochondrial genome contains both ribosomal genes, 21 tRNAs, but only 11 protein-coding genes. We find evidence suggesting a duplicated sequence in the I. pulchra mitochondrial genome. The P. rubra, I. pulchra and A. ylvae mitochondria have a unique genome organisation in comparison to other metazoan mitochondrial genomes. We found a large degree of protein-coding gene and tRNA overlap with little non-coding sequence in the compact P. rubra genome. Conversely, the A. ylvae and I. pulchra genomes have many long non-coding sequences between genes, likely driving genome size expansion in the latter. Phylogenetic trees inferred from mitochondrial genes retrieve Xenacoelomorpha as an early branching taxon in the deuterostomes. Sequence divergence analysis between P. rubra sampled in England and Spain indicates cryptic diversity.

  8. A 1.37-Mb 12p11.22-p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation.

    Science.gov (United States)

    Chen, Chih-Ping; Lin, Shuan-Pei; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Lee, Chen-Chi; Wang, Wayseen

    2014-03-01

    To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22-p11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retardation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal translocation of t(8;12)(q24.3;p11.2). A 13-year-old girl was referred to the hospital because of autism, mental retardation, and difficulty in the self-care of her menstruation. Cytogenetic analysis revealed an apparently balanced reciprocal translocation and a karyotype of 46,XX,t(8;12) (q24.3;p11.2)dn. The girl manifested microcephaly, hypertelorism, flat facial profile, prominent forehead, thick scalp hair, upslanting palpebral fissures, broad nasal bridge, bulbous nose, right simian crease, bilateral clinodactyly of the fifth fingers, bilateral pes cavus, learning difficulties, mental retardation, emotional instability, cognitive impairment, behavior problems, jumping-like gaits, and autistic spectrum disorder. aCGH was performed to evaluate genomic imbalance in this patient. aCGH analysis revealed a 1.37-Mb 12p11.22-p11.21 microdeletion or arr [hg 19] 12p11.22-p11.21 (30,645,008-32,014,774)×1 and a 367-kb 22q11.21 microduplication or arr [hg 19] 22q11.21 (18,657,470-19,024,306)×3. The 1.37-Mb 12p11.22-p11.21 microdeletion encompassed 26 genes including IPO8, CAPRIN2, and DDX11, and the 367-kb 22q11.21 microduplication encompassed 20 genes including USP18, DGCR6, PRODH, and DGCR2. An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22-p11.21 microdeletion and 22q11.2 microduplication. Copyright © 2014. Published by Elsevier B.V.

  9. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  10. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  11. Dementia & Driving

    Science.gov (United States)

    ... have to give up driving. Many people associate driving with self-reliance and freedom; the loss of driving privileges ... familiar roads and avoid long distances. Avoid heavy traffic and heavily traveled roads. Avoid driving at night and in bad weather. Reduce the ...

  12. Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2018-05-03

    Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.

  13. Quantitative measure of randomness and order for complete genomes

    Science.gov (United States)

    Kong, Sing-Guan; Fan, Wen-Lang; Chen, Hong-Da; Wigger, Jan; Torda, Andrew E.; Lee, H. C.

    2009-06-01

    We propose an order index, ϕ , which gives a quantitative measure of randomness and order of complete genomic sequences. It maps genomes to a number from 0 (random and of infinite length) to 1 (fully ordered) and applies regardless of sequence length. The 786 complete genomic sequences in GenBank were found to have ϕ values in a very narrow range, ϕg=0.031-0.015+0.028 . We show this implies that genomes are halfway toward being completely random, or, at the “edge of chaos.” We further show that artificial “genomes” converted from literary classics have ϕ ’s that almost exactly coincide with ϕg , but sequences of low information content do not. We infer that ϕg represents a high information-capacity “fixed point” in sequence space, and that genomes are driven to it by the dynamics of a robust growth and evolution process. We show that a growth process characterized by random segmental duplication can robustly drive genomes to the fixed point.

  14. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  15. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  16. Early stages of functional diversification in the Rab GTPase gene family revealed by genomic and localization studies in Paramecium species.

    Science.gov (United States)

    Bright, Lydia J; Gout, Jean-Francois; Lynch, Michael

    2017-04-15

    New gene functions arise within existing gene families as a result of gene duplication and subsequent diversification. To gain insight into the steps that led to the functional diversification of paralogues, we tracked duplicate retention patterns, expression-level divergence, and subcellular markers of functional diversification in the Rab GTPase gene family in three Paramecium aurelia species. After whole-genome duplication, Rab GTPase duplicates are more highly retained than other genes in the genome but appear to be diverging more rapidly in expression levels, consistent with early steps in functional diversification. However, by localizing specific Rab proteins in Paramecium cells, we found that paralogues from the two most recent whole-genome duplications had virtually identical localization patterns, and that less closely related paralogues showed evidence of both conservation and diversification. The functionally conserved paralogues appear to target to compartments associated with both endocytic and phagocytic recycling functions, confirming evolutionary and functional links between the two pathways in a divergent eukaryotic lineage. Because the functionally diversifying paralogues are still closely related to and derived from a clade of functionally conserved Rab11 genes, we were able to pinpoint three specific amino acid residues that may be driving the change in the localization and thus the function in these proteins. © 2017 Bright et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Somatic mosaicism of an intragenic FANCB duplication in both fibroblast and peripheral blood cells observed in a Fanconi anemia patient leads to milder phenotype.

    Science.gov (United States)

    Asur, Rajalakshmi S; Kimble, Danielle C; Lach, Francis P; Jung, Moonjung; Donovan, Frank X; Kamat, Aparna; Noonan, Raymond J; Thomas, James W; Park, Morgan; Chines, Peter; Vlachos, Adrianna; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C

    2018-01-01

    Fanconi anemia (FA) is a rare disorder characterized by congenital malformations, progressive bone marrow failure, and predisposition to cancer. Patients harboring X-linked FANCB pathogenic variants usually present with severe congenital malformations resembling VACTERL syndrome with hydrocephalus. We employed the diepoxybutane (DEB) test for FA diagnosis, arrayCGH for detection of duplication, targeted capture and next-gen sequencing for defining the duplication breakpoint, PacBio sequencing of full-length FANCB aberrant transcript, FANCD2 ubiquitination and foci formation assays for the evaluation of FANCB protein function by viral transduction of FANCB-null cells with lentiviral FANCB WT and mutant expression constructs, and droplet digital PCR for quantitation of the duplication in the genomic DNA and cDNA. We describe here an FA-B patient with a mild phenotype. The DEB diagnostic test for FA revealed somatic mosaicism. We identified a 9154 bp intragenic duplication in FANCB, covering the first coding exon 3 and the flanking regions. A four bp homology (GTAG) present at both ends of the breakpoint is consistent with microhomology-mediated duplication mechanism. The duplicated allele gives rise to an aberrant transcript containing exon 3 duplication, predicted to introduce a stop codon in FANCB protein (p.A319*). Duplication levels in the peripheral blood DNA declined from 93% to 7.9% in the span of eleven years. Moreover, the patient fibroblasts have shown 8% of wild-type (WT) allele and his carrier mother showed higher than expected levels of WT allele (79% vs. 50%) in peripheral blood, suggesting that the duplication was highly unstable. Unlike sequence point variants, intragenic duplications are difficult to precisely define, accurately quantify, and may be very unstable, challenging the proper diagnosis. The reversion of genomic duplication to the WT allele results in somatic mosaicism and may explain the relatively milder phenotype displayed by the FA

  18. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  19. THE STUDY OF SELF-BALANCED POTATO SORTING MACHINE WITH LINEAR INDUCTION DRIVE

    OpenAIRE

    Linenko A. V.; Baynazarov V. G.; Kamalov T. I.

    2016-01-01

    In the article we have considered the self-balanced potato sorting machine differing from existing designs of self-balanced potato sorting machines with an oscillatory electric drive. That drive uses a linear induction motor. As the counterbalancing device, the method of the duplicating mechanism is applied. The duplicating mechanism is a specular reflection of the main working body, and also participates in technological process. Its application in the drive of machine allows not only to inc...

  20. Duplication of Key Frames of Video Streams in Wireless Networks

    OpenAIRE

    Sagatov, Evgeny S.; Sukhov, Andrei M.

    2011-01-01

    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  1. Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.

    Science.gov (United States)

    Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario

    2008-01-01

    Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.

  2. University of Texas MD Anderson Cancer Center: High-Throughput Screening Identifying Driving Mutations in Endometrial Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Recent advances in next-generation sequencing technology have enabled the unprecedented characterization of a full spectrum of somatic alterations in cancer genomes. Given the large numbers of somatic mutations typically detected by this approach, a key challenge in the downstream analysis is to distinguish “drivers” that functionally contribute to tumorigenesis from “passengers” that occur as the consequence of genomic instability.

  3. Distracted driving

    Science.gov (United States)

    ... including maps) The Dangers of Talking on the Phone While Driving You are four times more likely to get ... of reach. If you are caught using a phone while driving, you may risk a ticket or fine. Most ...

  4. Distracted Driving

    Science.gov (United States)

    ... and increased awareness of distracted driving using radio advertisements, news stories, and similar media. After the projects ... available at www.trafficsafetymarketing.gov . Distracted Driving Enforcement – TV Ads (Paid). For re-tagging, go to: www. ...

  5. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1971-10-15

    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  6. [Intestinal volvulus due to yeyunal duplication].

    Science.gov (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L

    2014-10-01

    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  7. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William

    2010-01-01

    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  8. A case of de novo duplication of 15q24-q26.3

    Directory of Open Access Journals (Sweden)

    Hye Ran Kim

    2011-06-01

    Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.

  9. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  10. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph

    2010-09-01

    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  11. Electric drives

    CERN Document Server

    Boldea, Ion

    2005-01-01

    ENERGY CONVERSION IN ELECTRIC DRIVESElectric Drives: A DefinitionApplication Range of Electric DrivesEnergy Savings Pay Off RapidlyGlobal Energy Savings Through PEC DrivesMotor/Mechanical Load MatchMotion/Time Profile MatchLoad Dynamics and StabilityMultiquadrant OperationPerformance IndexesProblemsELECTRIC MOTORS FOR DRIVESElectric Drives: A Typical ConfigurationElectric Motors for DrivesDC Brush MotorsConventional AC MotorsPower Electronic Converter Dependent MotorsEnergy Conversion in Electric Motors/GeneratorsPOWER ELECTRONIC CONVERTERS (PECs) FOR DRIVESPower Electronic Switches (PESs)The

  12. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  13. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  14. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  15. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  16. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  17. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  18. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  19. DB2: a probabilistic approach for accurate detection of tandem duplication breakpoints using paired-end reads.

    Science.gov (United States)

    Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas

    2014-03-05

    With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available

  20. Reciprocal duplication of the Williams-Beuren syndrome deletion on chromosome 7q11.23 is associated with schizophrenia.

    Science.gov (United States)

    Mulle, Jennifer Gladys; Pulver, Ann E; McGrath, John A; Wolyniec, Paula S; Dodd, Anne F; Cutler, David J; Sebat, Jonathan; Malhotra, Dheeraj; Nestadt, Gerald; Conrad, Donald F; Hurles, Matthew; Barnes, Chris P; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F; Gejman, Pablo V; Sanders, Alan R; Duan, Jubao; Mitchell, Adele A; Peter, Inga; Sklar, Pamela; O'Dushlaine, Colm T; Grozeva, Detelina; O'Donovan, Michael C; Owen, Michael J; Hultman, Christina M; Kähler, Anna K; Sullivan, Patrick F; Kirov, George; Warren, Stephen T

    2014-03-01

    Several copy number variants (CNVs) have been implicated as susceptibility factors for schizophrenia (SZ). Some of these same CNVs also increase risk for autism spectrum disorders, suggesting an etiologic overlap between these conditions. Recently, de novo duplications of a region on chromosome 7q11.23 were associated with autism spectrum disorders. The reciprocal deletion of this region causes Williams-Beuren syndrome. We assayed an Ashkenazi Jewish cohort of 554 SZ cases and 1014 controls for genome-wide CNV. An excess of large rare and de novo CNVs were observed, including a 1.4 Mb duplication on chromosome 7q11.23 identified in two unrelated patients. To test whether this 7q11.23 duplication is also associated with SZ, we obtained data for 14,387 SZ cases and 28,139 controls from seven additional studies with high-resolution genome-wide CNV detection. We performed a meta-analysis, correcting for study population of origin, to assess whether the duplication is associated with SZ. We found duplications at 7q11.23 in 11 of 14,387 SZ cases with only 1 in 28,139 control subjects (unadjusted odds ratio 21.52, 95% confidence interval: 3.13-922.6, p value 5.5 × 10(-5); adjusted odds ratio 10.8, 95% confidence interval: 1.46-79.62, p value .007). Of three SZ duplication carriers with detailed retrospective data, all showed social anxiety and language delay premorbid to SZ onset, consistent with both human studies and animal models of the 7q11.23 duplication. We have identified a new CNV associated with SZ. Reciprocal duplication of the Williams-Beuren syndrome deletion at chromosome 7q11.23 confers an approximately tenfold increase in risk for SZ. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  1. A Genome Wide Association Study (GWAS) from a global cohort identifies common variants in FSHB and SMAD3 driving spontaneous human dizygotic twinning

    NARCIS (Netherlands)

    Aagaard, K.; Mbarek, H.; Steinberg, S.; Nyholt, D.R.; Gordon, S.D.; Miller, M.B.; McRae, A.F.; Hottenga, J.J.; Day, F.R.; Hinds, D.A.; Willemsen, G.; Geus, E.J.C. de; Davies, G.E.; Martin, H.C.; Lambalk, C.B.; Penninx, B.W.J.H.; Jansen, R.; McAloney, K.; Vink, J.M.; Kaprio, J.; Plomin, R.; Spector, T.D.; Magnusson, P.K.E.; Boomsma, D.I.

    2016-01-01

    Objective: Although dizygotic (DZ) twins occur once every 70 live births and has long been suspected to be familial, the genetic loci driving human twinning have not yet been identified. Based on our recent success in identifying "twin genes" in the marmoset primate (which exclusively gestates twins

  2. Single Cell and Metagenomic Assemblies: Biology Drives Technical Choices and Goals (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    Energy Technology Data Exchange (ETDEWEB)

    Stepanauskas, Ramunas

    2011-10-13

    DOE JGI's Tanja Woyke, chair of the Single Cells and Metagenomes session, delivers an introduction, followed by Bigelow Laboratory's Ramunas Stepanauskas on "Single Cell and Metagenomic Assemblies: Biology Drives Technical Choices and Goals" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  3. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem

    2018-05-01

    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  4. Increments and duplication events of enzymes and transcription factors influence metabolic and regulatory diversity in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Mario Alberto Martínez-Núñez

    Full Text Available In this work, the content of enzymes and DNA-binding transcription factors (TFs in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM and structural domains (Superfamily. For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22% than in the bacterial ones (27% was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected.

  5. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  6. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  7. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  8. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  9. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  10. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  11. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice

    2011-01-01

    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  12. Pile Driving

    Science.gov (United States)

    1987-01-01

    Machine-oriented structural engineering firm TERA, Inc. is engaged in a project to evaluate the reliability of offshore pile driving prediction methods to eventually predict the best pile driving technique for each new offshore oil platform. Phase I Pile driving records of 48 offshore platforms including such information as blow counts, soil composition and pertinent construction details were digitized. In Phase II, pile driving records were statistically compared with current methods of prediction. Result was development of modular software, the CRIPS80 Software Design Analyzer System, that companies can use to evaluate other prediction procedures or other data bases.

  13. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  14. Neutral Evolution of Duplicated DNA: An Evolutionary Stick-Breaking Process Causes Scale-Invariant Behavior

    Science.gov (United States)

    Massip, Florian; Arndt, Peter F.

    2013-04-01

    Recently, an enrichment of identical matching sequences has been found in many eukaryotic genomes. Their length distribution exhibits a power law tail raising the question of what evolutionary mechanism or functional constraints would be able to shape this distribution. Here we introduce a simple and evolutionarily neutral model, which involves only point mutations and segmental duplications, and produces the same statistical features as observed for genomic data. Further, we extend a mathematical model for random stick breaking to analytically show that the exponent of the power law tail is -3 and universal as it does not depend on the microscopic details of the model.

  15. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  16. A 1.37-Mb 12p11.22–p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2014-03-01

    Conclusion: An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22–p11.21 microdeletion and 22q11.2 microduplication.

  17. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)

    2013-01-15

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  18. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun

    2013-01-01

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  19. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko

    2009-01-01

    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  1. Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens.

    Science.gov (United States)

    Glinsky, Gennadi V

    2016-09-19

    Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8-10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of

  2. Cosmic abundances: The impact of stellar duplicity

    OpenAIRE

    Jorissen, A.; Van Eck, S.

    2004-01-01

    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  3. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  4. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  5. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung

    2004-01-01

    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  6. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder

    2016-01-01

    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  7. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  8. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  9. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  10. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  11. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  12. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  13. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  14. Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.

    Science.gov (United States)

    Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan

    2013-01-01

    Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.

  15. Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

    Science.gov (United States)

    Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

    2009-01-01

    Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

  16. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

    2010-07-22

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  17. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

    2010-12-01

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  18. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  19. Laparoscopic excision of a newborn rectal duplication cyst.

    Science.gov (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L

    2008-08-01

    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  20. Surgical management of complete penile duplication accompanied by multiple anomalies.

    Science.gov (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya

    2014-09-01

    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  1. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook

    2003-01-01

    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  2. Polyploidy can drive rapid adaptation in yeast

    Science.gov (United States)

    Selmecki, Anna M.; Maruvka, Yosef E.; Richmond, Phillip A.; Guillet, Marie; Shoresh, Noam; Sorenson, Amber L.; de, Subhajyoti; Kishony, Roy; Michor, Franziska; Dowell, Robin; Pellman, David

    2015-03-01

    Polyploidy is observed across the tree of life, yet its influence on evolution remains incompletely understood. Polyploidy, usually whole-genome duplication, is proposed to alter the rate of evolutionary adaptation. This could occur through complex effects on the frequency or fitness of beneficial mutations. For example, in diverse cell types and organisms, immediately after a whole-genome duplication, newly formed polyploids missegregate chromosomes and undergo genetic instability. The instability following whole-genome duplications is thought to provide adaptive mutations in microorganisms and can promote tumorigenesis in mammalian cells. Polyploidy may also affect adaptation independently of beneficial mutations through ploidy-specific changes in cell physiology. Here we perform in vitro evolution experiments to test directly whether polyploidy can accelerate evolutionary adaptation. Compared with haploids and diploids, tetraploids undergo significantly faster adaptation. Mathematical modelling suggests that rapid adaptation of tetraploids is driven by higher rates of beneficial mutations with stronger fitness effects, which is supported by whole-genome sequencing and phenotypic analyses of evolved clones. Chromosome aneuploidy, concerted chromosome loss, and point mutations all provide large fitness gains. We identify several mutations whose beneficial effects are manifest specifically in the tetraploid strains. Together, these results provide direct quantitative evidence that in some environments polyploidy can accelerate evolutionary adaptation.

  3. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  4. Gene conversion in the rice genome

    DEFF Research Database (Denmark)

    Xu, Shuqing; Clark, Terry; Zheng, Hongkun

    2008-01-01

    -chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....

  5. Impaired Driving

    Science.gov (United States)

    ... Get the Facts What Works: Strategies to Increase Car Seat and Booster Seat ... narcotics. 3 That’s one percent of the 111 million self-reported episodes of alcohol-impaired driving among U.S. ...

  6. Effects of chemical and physical mutagens on the frequency of a large genetic duplication in Salmonella typhimurium. II

    International Nuclear Information System (INIS)

    Hoffman, G.R.; Morgan, R.W.; Kirven, R.

    1978-01-01

    Strains of Salmonella typhimurium which contain a duplication of approximately 30% of the genome may be obtained by a simple selective procedure. These strains are highly unstable, losing the duplication when grown on non-selective medium. In this paper the authors report that treatment of merodiploid bacteria with mutagenic agents stimulates the rate at which haploid segregants are obtained from merodiploid strains. The mutagens which have been tested for this effect are X-rays, ultraviolet light (UV), ethyl methanesulfonate (EMS), and the azaacridine half-mustard ICR-372. (Auth.)

  7. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  8. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  9. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2016-01-01

    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  10. Split photosystem protein, linear-mapping topology, and growth of structural complexity in the plastid genome of chromera velia

    KAUST Repository

    Janouškovec, Jan

    2013-08-22

    The canonical photosynthetic plastid genomes consist of a single circular-mapping chromosome that encodes a highly conserved protein core, involved in photosynthesis and ATP generation. Here, we demonstrate that the plastid genome of the photosynthetic relative of apicomplexans, Chromera velia, departs from this view in several unique ways. Core photosynthesis proteins PsaA and AtpB have been broken into two fragments, which we show are independently transcribed, oligoU-tailed, translated, and assembled into functional photosystem I and ATP synthase complexes. Genome-wide transcription profiles support expression of many other highly modified proteins, including several that contain extensions amounting to hundreds of amino acids in length. Canonical gene clusters and operons have been fragmented and reshuffled into novel putative transcriptional units. Massive genomic coverage by paired-end reads, coupled with pulsed-field gel electrophoresis and polymerase chain reaction, consistently indicate that the C. velia plastid genome is linear-mapping, a unique state among all plastids. Abundant intragenomic duplication probably mediated by recombination can explain protein splits, extensions, and genome linearization and is perhaps the key driving force behind the many features that defy the conventional ways of plastid genome architecture and function. © The Author 2013.

  11. Driving towards ecotechnologies.

    Science.gov (United States)

    Najjar, Devora A; Normandin, Avery M; Strait, Elizabeth A; Esvelt, Kevin M

    2017-12-01

    The prospect of using genetic methods to target vector, parasite, and reservoir species offers tremendous potential benefits to public health, but the use of genome editing to alter the shared environment will require special attention to public perception and community governance in order to benefit the world. Public skepticism combined with the media scrutiny of gene drive systems could easily derail unpopular projects entirely, especially given the potential for trade barriers to be raised against countries that employ self-propagating gene drives. Hence, open and community-guided development of thoughtfully chosen applications is not only the most ethical approach, but also the most likely to overcome the economic, social, and diplomatic barriers. Here we review current and past attempts to alter ecosystems using biological methods, identify key determinants of social acceptance, and chart a stepwise path for developers towards safe and widely supported use.

  12. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  13. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira

    2014-11-01

    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  14. Concomitant urethral triplication, bladder, and colon duplication.

    Science.gov (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi

    2012-02-01

    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  15. Distribution of segmental duplications in the context of higher order chromatin organisation of human chromosome 7

    DEFF Research Database (Denmark)

    Ebert, Grit; Steininger, Anne; Weißmann, Robert

    2014-01-01

    of the Williams-Beuren syndrome locus we demonstrate by cross-species comparison that these SDs have inserted at the borders of a topological domain and that they flank regions with distinct DNA conformation. CONCLUSIONS: Our study suggests a link of nuclear architecture and the propagation of SDs across......BACKGROUND: Segmental duplications (SDs) are not evenly distributed along chromosomes. The reasons for this biased susceptibility to SD insertion are poorly understood. Accumulation of SDs is associated with increased genomic instability, which can lead to structural variants and genomic disorders...... chromosome 7, either by promoting regional SD insertion or by contributing to the establishment of higher order chromatin organisation themselves. The latter could compensate for the high risk of structural rearrangements and thus may have contributed to their evolutionary fixation in the human genome....

  16. The evolution of the tape measure protein: units, duplications and losses

    Directory of Open Access Journals (Sweden)

    Poisson Guylaine

    2011-10-01

    Full Text Available Abstract Background A large family of viruses that infect bacteria, called phages, is characterized by long tails used to inject DNA into their victims' cells. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species. A natural question is whether there exist units for these tape measures, and if different tape measures have different units and lengths. Such units would allow us to retrace the evolution of tape measure proteins using their duplication/loss history. The vast number of sequenced phages genomes allows us to attack this problem with a comparative genomics approach. Results Here we describe a subset of phages whose tape measure proteins contain variable numbers of an 11 amino acids sequence repeat, aligned with sequence similarity, structural properties, and simple arithmetics. This subset provides a unique opportunity for the combinatorial study of phage evolution, without the added uncertainties of multiple alignments, which are trivial in this case, or of protein functions, that are well established. We give a heuristic that reconstructs the duplication history of these sequences, using divergent strains to discriminate between mutations that occurred before and after speciation, or lineage divergence. The heuristic is based on an efficient algorithm that gives an exhaustive enumeration of all possible parsimonious reconstructions of the duplication/speciation history of a single nucleotide. Finally, we present a method that allows, when possible, to discriminate between duplication and loss events. Conclusions Establishing the evolutionary history of viruses is difficult, in part due to extensive recombinations and gene transfers, and high mutation rates that often erase detectable similarity between homologous genes. In this paper, we introduce new tools to address this

  17. Driving things

    DEFF Research Database (Denmark)

    Nevile, Maurice Richard

    2015-01-01

    I explore how participants organise involvement with objects brought into the car, relative to the demands of driving and social activity. Objects in cars commonly include phones or other technologies, food, body care products, texts, clothing, bags and carry items, toys, and even animals...... 2004, Haddington et al. 2012). I focus here especially on how the practical and interactional work of locating, seeing, placing, handling, hearing, and relinquishing, is ordered and accomplished relative to the emerging and contingent demands of both driving and social participation......, such that involvement with objects is constituted as secondary to driving in a multiactivity setting (e.g. Haddington et al. 2014). We see how events with, for, of, and even by objects can occur as predictable, planned and even designed for (e.g. changing glasses, applying body lotion), or might be unexpected...

  18. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  19. Tandemly Arrayed Genes in Vertebrate Genomes

    Directory of Open Access Journals (Sweden)

    Deng Pan

    2008-01-01

    Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.

  20. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  1. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  2. Spinal Accessory Nerve Duplication: A Case Report and Literature Review

    OpenAIRE

    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios

    2018-01-01

    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  3. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)

    2009-12-15

    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  4. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha

    2009-07-01

    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  5. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  6. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  7. Mitochondrial mutations drive prostate cancer aggression

    DEFF Research Database (Denmark)

    Hopkins, Julia F.; Sabelnykova, Veronica Y.; Weischenfeldt, Joachim

    2017-01-01

    Nuclear mutations are well known to drive tumor incidence, aggression and response to therapy. By contrast, the frequency and roles of mutations in the maternally inherited mitochondrial genome are poorly understood. Here we sequence the mitochondrial genomes of 384 localized prostate cancer...... in prostate cancer, and suggest interplay between nuclear and mitochondrial mutational profiles in prostate cancer....

  8. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  9. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  10. The Centrosome and Its Duplication Cycle

    Science.gov (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.

    2015-01-01

    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  11. A Distinct Class of Genome Rearrangements Driven by Heterologous Recombination.

    Science.gov (United States)

    León-Ortiz, Ana María; Panier, Stephanie; Sarek, Grzegorz; Vannier, Jean-Baptiste; Patel, Harshil; Campbell, Peter J; Boulton, Simon J

    2018-01-18

    Erroneous DNA repair by heterologous recombination (Ht-REC) is a potential threat to genome stability, but evidence supporting its prevalence is lacking. Here we demonstrate that recombination is possible between heterologous sequences and that it is a source of chromosomal alterations in mitotic and meiotic cells. Mechanistically, we find that the RTEL1 and HIM-6/BLM helicases and the BRCA1 homolog BRC-1 counteract Ht-REC in Caenorhabditis elegans, whereas mismatch repair does not. Instead, MSH-2/6 drives Ht-REC events in rtel-1 and brc-1 mutants and excessive crossovers in rtel-1 mutant meioses. Loss of vertebrate Rtel1 also causes a variety of unusually large and complex structural variations, including chromothripsis, breakage-fusion-bridge events, and tandem duplications with distant intra-chromosomal insertions, whose structure are consistent with a role for RTEL1 in preventing Ht-REC during break-induced replication. Our data establish Ht-REC as an unappreciated source of genome instability that underpins a novel class of complex genome rearrangements that likely arise during replication stress. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. X-linked congenital ptosis and associated intellectual disability, short stature, microcephaly, cleft palate, digital and genital abnormalities define novel Xq25q26 duplication syndrome

    DEFF Research Database (Denmark)

    Møller, R S; Jensen, L R; Maas, S M

    2014-01-01

    , hypogonadism and feeding difficulties. Female carriers are often phenotypically normal or show a similar but milder phenotype, as in most cases the X-chromosome harbouring the duplication is subject to inactivation. Xq28, which includes MECP2 is the major locus for submicroscopic X-chromosome duplications......, whereas duplications in Xq25 and Xq26 have been reported in only a few cases. Using genome-wide array platforms we identified overlapping interstitial Xq25q26 duplications ranging from 0.2 to 4.76 Mb in eight unrelated families with in total five affected males and seven affected females. All affected...... males shared a common phenotype with intrauterine- and postnatal growth retardation and feeding difficulties in childhood. Three had microcephaly and two out of five suffered from epilepsy. In addition, three males had a distinct facial appearance with congenital bilateral ptosis and large protruding...

  13. Community Drive

    DEFF Research Database (Denmark)

    Magnussen, Rikke

    2018-01-01

    Schools and educational institutions are challenged by not adequately educating students for independent knowledge collaboration and solving of complex societal challenges (Bundsgaard & Hansen, 2016; Slot et al., 2017). As an alternative strategy to formal learning has Community-driven research...... opportunity to break boundaries between research institutions and surrounding communities through the involvement of new types of actors, knowledge forms and institutions (OECD, 2011). This paper presents the project Community Drive a three year cross disciplinary community-driven game– and data-based project....... In the paper we present how the project Community Drive initiated in May 2018 is based on results from pilot projects conducted from 2014 – 2017. Overall these studies showed that it is a strong motivational factor for students to be given the task to change their living conditions through redesign...

  14. The ecoresponsive genome of Daphnia pulex

    Energy Technology Data Exchange (ETDEWEB)

    Colbourne, John K.; Pfrender, Michael E.; Gilbert, Donald; Thomas, W. Kelley; Tucker, Abraham; Oakley, Todd H.; Tokishita, Shinichi; Aerts, Andrea; Arnold, Georg J.; Basu, Malay Kumar; Bauer, Darren J.; Caceres, Carla E.; Carmel, Liran; Casola, Claudio; Choi, Jeong-Hyeon; Detter, John C.; Dong, Qunfeng; Dusheyko, Serge; Eads, Brian D.; Frohlich, Thomas; Geiler-Samerotte, Kerry A.; Gerlach, Daniel; Hatcher, Phil; Jogdeo, Sanjuro; Krijgsveld, Jeroen; Kriventseva, Evgenia V; Kültz, Dietmar; Laforsch, Christian; Lindquist, Erika; Lopez, Jacqueline; Manak, Robert; Muller, Jean; Pangilinan, Jasmyn; Patwardhan, Rupali P.; Pitluck, Samuel; Pritham, Ellen J.; Rechtsteiner, Andreas; Rho, Mina; Rogozin, Igor B.; Sakarya, Onur; Salamov, Asaf; Schaack, Sarah; Shapiro, Harris; Shiga, Yasuhiro; Skalitzky, Courtney; Smith, Zachary; Souvorov, Alexander; Sung, Way; Tang, Zuojian; Tsuchiya, Dai; Tu, Hank; Vos, Harmjan; Wang, Mei; Wolf, Yuri I.; Yamagata, Hideo; Yamada, Takuji; Ye, Yuzhen; Shaw, Joseph R.; Andrews, Justen; Crease, Teresa J.; Tang, Haixu; Lucas, Susan M.; Robertson, Hugh M.; Bork, Peer; Koonin, Eugene V.; Zdobnov, Evgeny M.; Grigoriev, Igor V.; Lynch, Michael; Boore, Jeffrey L.

    2011-02-04

    This document provides supporting material related to the sequencing of the ecoresponsive genome of Daphnia pulex. This material includes information on materials and methods and supporting text, as well as supplemental figures, tables, and references. The coverage of materials and methods addresses genome sequence, assembly, and mapping to chromosomes, gene inventory, attributes of a compact genome, the origin and preservation of Daphnia pulex genes, implications of Daphnia's genome structure, evolutionary diversification of duplicated genes, functional significance of expanded gene families, and ecoresponsive genes. Supporting text covers chromosome studies, gene homology among Daphnia genomes, micro-RNA and transposable elements and the 46 Daphnia pulex opsins. 36 figures, 50 tables, 183 references.

  15. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  16. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  17. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  18. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  19. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho

    2002-01-01

    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  20. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  1. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  2. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  3. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki

    2015-01-01

    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  4. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜

    1983-01-01

    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  5. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate.

    Science.gov (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun

    2010-03-01

    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  6. Rectal duplication cyst: a combined abdominal and endoanal operative approach.

    Science.gov (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri

    2007-04-01

    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  7. Ruptured rectal duplication with urogenital abnormality: Unusual presentation.

    Science.gov (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh

    2015-01-01

    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  8. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  9. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly.

    Science.gov (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag

    2017-02-01

    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  10. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  11. Neurodevelopmental and neurobehavioral characteristics in males and females with CDKL5 duplications.

    Science.gov (United States)

    Szafranski, Przemyslaw; Golla, Sailaja; Jin, Weihong; Fang, Ping; Hixson, Patricia; Matalon, Reuben; Kinney, Daniel; Bock, Hans-Georg; Craigen, William; Smith, Janice L; Bi, Weimin; Patel, Ankita; Wai Cheung, Sau; Bacino, Carlos A; Stankiewicz, Paweł

    2015-07-01

    Point mutations and genomic deletions of the CDKL5 (STK9) gene on chromosome Xp22 have been reported in patients with severe neurodevelopmental abnormalities, including Rett-like disorders. To date, only larger-sized (8-21 Mb) duplications harboring CDKL5 have been described. We report seven females and four males from seven unrelated families with CDKL5 duplications 540-935 kb in size. Three families of different ethnicities had identical 667kb duplications containing only the shorter CDKL5 isoform. Four affected boys, 8-14 years of age, and three affected girls, 6-8 years of age, manifested autistic behavior, developmental delay, language impairment, and hyperactivity. Of note, two boys and one girl had macrocephaly. Two carrier mothers of the affected boys reported a history of problems with learning and mathematics while at school. None of the patients had epilepsy. Similarly to CDKL5 mutations and deletions, the X-inactivation pattern in all six studied females was random. We hypothesize that the increased dosage of CDKL5 might have affected interactions of this kinase with its substrates, leading to perturbation of synaptic plasticity and learning, and resulting in autistic behavior, developmental and speech delay, hyperactivity, and macrocephaly.

  12. Williams syndrome deletions and duplications: Genetic windows to understanding anxiety, sociality, autism, and schizophrenia.

    Science.gov (United States)

    Crespi, Bernard J; Procyshyn, Tanya L

    2017-08-01

    We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Complete cloacal duplication imaged before and during pregnancy.

    Science.gov (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi

    2009-01-01

    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  14. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.

    Science.gov (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon

    2011-12-01

    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  15. Endoscopic ultrasonography and rectal duplication cyst in an adult.

    Science.gov (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S

    2017-01-01

    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  16. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  17. Electric drives

    Energy Technology Data Exchange (ETDEWEB)

    1986-10-01

    Several electric vehicles have been tested in long-term tests, i.e. an electric passenger car (maximum speed 115 km/h) and several busses for use in pedestrians' zones, spas, airports, natural reserves, and urban transportation (DUO busses). The ICE high-speed train is discussed in some detail, i.e. its aeroacoustic and aerodynamic design, running gear, computer-controlled drives and brakes, diagnostic systems, and electrical equipment. The Berlin Maglev system is mentioned as well as current inverters in rail vehicles. (HWJ).

  18. Genomic islands predict functional adaptation in marine actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Penn, Kevin; Jenkins, Caroline; Nett, Markus; Udwary, Daniel; Gontang, Erin; McGlinchey, Ryan; Foster, Brian; Lapidus, Alla; Podell, Sheila; Allen, Eric; Moore, Bradley; Jensen, Paul

    2009-04-01

    Linking functional traits to bacterial phylogeny remains a fundamental but elusive goal of microbial ecology 1. Without this information, it becomes impossible to resolve meaningful units of diversity and the mechanisms by which bacteria interact with each other and adapt to environmental change. Ecological adaptations among bacterial populations have been linked to genomic islands, strain-specific regions of DNA that house functionally adaptive traits 2. In the case of environmental bacteria, these traits are largely inferred from bioinformatic or gene expression analyses 2, thus leaving few examples in which the functions of island genes have been experimentally characterized. Here we report the complete genome sequences of Salinispora tropica and S. arenicola, the first cultured, obligate marine Actinobacteria 3. These two species inhabit benthic marine environments and dedicate 8-10percent of their genomes to the biosynthesis of secondary metabolites. Despite a close phylogenetic relationship, 25 of 37 secondary metabolic pathways are species-specific and located within 21 genomic islands, thus providing new evidence linking secondary metabolism to ecological adaptation. Species-specific differences are also observed in CRISPR sequences, suggesting that variations in phage immunity provide fitness advantages that contribute to the cosmopolitan distribution of S. arenicola 4. The two Salinispora genomes have evolved by complex processes that include the duplication and acquisition of secondary metabolite genes, the products of which provide immediate opportunities for molecular diversification and ecological adaptation. Evidence that secondary metabolic pathways are exchanged by Horizontal Gene Transfer (HGT) yet are fixed among globally distributed populations 5 supports a functional role for their products and suggests that pathway acquisition represents a previously unrecognized force driving bacterial diversification

  19. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  20. Genome plasticity and systems evolution in Streptomyces

    Science.gov (United States)

    2012-01-01

    Background Streptomycetes are filamentous soil-dwelling bacteria. They are best known as the producers of a great variety of natural products such as antibiotics, antifungals, antiparasitics, and anticancer agents and the decomposers of organic substances for carbon recycling. They are also model organisms for the studies of gene regulatory networks, morphological differentiation, and stress response. The availability of sets of genomes from closely related Streptomyces strains makes it possible to assess the mechanisms underlying genome plasticity and systems adaptation. Results We present the results of a comprehensive analysis of the genomes of five Streptomyces species with distinct phenotypes. These streptomycetes have a pan-genome comprised of 17,362 orthologous families which includes 3,096 components in the core genome, 5,066 components in the dispensable genome, and 9,200 components that are uniquely present in only one species. The core genome makes up about 33%-45% of each genome repertoire. It contains important genes for Streptomyces biology including those involved in gene regulation, secretion, secondary metabolism and morphological differentiation. Abundant duplicate genes have been identified, with 4%-11% of the whole genomes composed of lineage-specific expansions (LSEs), suggesting that frequent gene duplication or lateral gene transfer events play a role in shaping the genome diversification within this genus. Two patterns of expansion, single gene expansion and chromosome block expansion are observed, representing different scales of duplication. Conclusions Our results provide a catalog of genome components and their potential functional roles in gene regulatory networks and metabolic networks. The core genome components reveal the minimum requirement for streptomycetes to sustain a successful lifecycle in the soil environment, reflecting the effects of both genome evolution and environmental stress acting upon the expressed phenotypes. A

  1. A Genome-Wide Landscape of Retrocopies in Primate Genomes.

    Science.gov (United States)

    Navarro, Fábio C P; Galante, Pedro A F

    2015-07-29

    Gene duplication is a key factor contributing to phenotype diversity across and within species. Although the availability of complete genomes has led to the extensive study of genomic duplications, the dynamics and variability of gene duplications mediated by retrotransposition are not well understood. Here, we predict mRNA retrotransposition and use comparative genomics to investigate their origin and variability across primates. Analyzing seven anthropoid primate genomes, we found a similar number of mRNA retrotranspositions (∼7,500 retrocopies) in Catarrhini (Old Word Monkeys, including humans), but a surprising large number of retrocopies (∼10,000) in Platyrrhini (New World Monkeys), which may be a by-product of higher long interspersed nuclear element 1 activity in these genomes. By inferring retrocopy orthology, we dated most of the primate retrocopy origins, and estimated a decrease in the fixation rate in recent primate history, implying a smaller number of species-specific retrocopies. Moreover, using RNA-Seq data, we identified approximately 3,600 expressed retrocopies. As expected, most of these retrocopies are located near or within known genes, present tissue-specific and even species-specific expression patterns, and no expression correlation to their parental genes. Taken together, our results provide further evidence that mRNA retrotransposition is an active mechanism in primate evolution and suggest that retrocopies may not only introduce great genetic variability between lineages but also create a large reservoir of potentially functional new genomic loci in primate genomes. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Recent Duplication and Functional Divergence in Parasitic Nematode Levamisole-Sensitive Acetylcholine Receptors.

    Directory of Open Access Journals (Sweden)

    Thomas B Duguet

    2016-07-01

    Full Text Available Helminth parasites rely on fast-synaptic transmission in their neuromusculature to experience the outside world and respond to it. Acetylcholine plays a pivotal role in this and its receptors are targeted by a wide variety of both natural and synthetic compounds used in human health and for the control of parasitic disease. The model, Caenorhabditis elegans is characterized by a large number of acetylcholine receptor subunit genes, a feature shared across the nematodes. This dynamic family is characterized by both gene duplication and loss between species. The pentameric levamisole-sensitive acetylcholine receptor has been characterized from C. elegans, comprised of five different subunits. More recently, cognate receptors have been reconstituted from multiple parasitic nematodes that are found to vary in subunit composition. In order to understand the implications of receptor composition change and the origins of potentially novel drug targets, we investigated a specific example of subunit duplication based on analysis of genome data for 25 species from the 50 helminth genome initiative. We found multiple independent duplications of the unc-29, acetylcholine receptor subunit, where codon substitution rate analysis identified positive, directional selection acting on amino acid positions associated with subunit assembly. Characterization of four gene copies from a model parasitic nematode, Haemonchus contortus, demonstrated that each copy has acquired unique functional characteristics based on phenotype rescue of transgenic C. elegans and electrophysiology of receptors reconstituted in Xenopus oocytes. We found evidence that a specific incompatibility has evolved for two subunits co-expressed in muscle. We demonstrated that functional divergence of acetylcholine receptors, driven by directional selection, can occur more rapidly than previously thought and may be mediated by alteration of receptor assembly. This phenomenon is common among the

  3. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  4. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  5. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  6. Gastric duplication cyst: A cause of rectal bleeding in a young child.

    Science.gov (United States)

    Surridge, Clare A; Goodier, Matthew D

    2014-01-01

    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  7. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge

    2014-01-01

    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  8. Safe driving for teens

    Science.gov (United States)

    Driving and teenagers; Teens and safe driving; Automobile safety - teenage drivers ... months before taking friends as passengers. Teenage-related driving deaths occur more often in certain conditions. OTHER SAFETY TIPS FOR TEENS Reckless driving is still a ...

  9. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  10. Partial duplication of head--a rare congenital anomaly.

    Science.gov (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass

    2004-10-01

    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  11. Genome Sequence of the Palaeopolyploid soybean

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.

    2009-08-03

    Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.

  12. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  13. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes

    Science.gov (United States)

    Liu, Shengyi; Liu, Yumei; Yang, Xinhua; Tong, Chaobo; Edwards, David; Parkin, Isobel A. P.; Zhao, Meixia; Ma, Jianxin; Yu, Jingyin; Huang, Shunmou; Wang, Xiyin; Wang, Junyi; Lu, Kun; Fang, Zhiyuan; Bancroft, Ian; Yang, Tae-Jin; Hu, Qiong; Wang, Xinfa; Yue, Zhen; Li, Haojie; Yang, Linfeng; Wu, Jian; Zhou, Qing; Wang, Wanxin; King, Graham J; Pires, J. Chris; Lu, Changxin; Wu, Zhangyan; Sampath, Perumal; Wang, Zhuo; Guo, Hui; Pan, Shengkai; Yang, Limei; Min, Jiumeng; Zhang, Dong; Jin, Dianchuan; Li, Wanshun; Belcram, Harry; Tu, Jinxing; Guan, Mei; Qi, Cunkou; Du, Dezhi; Li, Jiana; Jiang, Liangcai; Batley, Jacqueline; Sharpe, Andrew G; Park, Beom-Seok; Ruperao, Pradeep; Cheng, Feng; Waminal, Nomar Espinosa; Huang, Yin; Dong, Caihua; Wang, Li; Li, Jingping; Hu, Zhiyong; Zhuang, Mu; Huang, Yi; Huang, Junyan; Shi, Jiaqin; Mei, Desheng; Liu, Jing; Lee, Tae-Ho; Wang, Jinpeng; Jin, Huizhe; Li, Zaiyun; Li, Xun; Zhang, Jiefu; Xiao, Lu; Zhou, Yongming; Liu, Zhongsong; Liu, Xuequn; Qin, Rui; Tang, Xu; Liu, Wenbin; Wang, Yupeng; Zhang, Yangyong; Lee, Jonghoon; Kim, Hyun Hee; Denoeud, France; Xu, Xun; Liang, Xinming; Hua, Wei; Wang, Xiaowu; Wang, Jun; Chalhoub, Boulos; Paterson, Andrew H

    2014-01-01

    Polyploidization has provided much genetic variation for plant adaptive evolution, but the mechanisms by which the molecular evolution of polyploid genomes establishes genetic architecture underlying species differentiation are unclear. Brassica is an ideal model to increase knowledge of polyploid evolution. Here we describe a draft genome sequence of Brassica oleracea, comparing it with that of its sister species B. rapa to reveal numerous chromosome rearrangements and asymmetrical gene loss in duplicated genomic blocks, asymmetrical amplification of transposable elements, differential gene co-retention for specific pathways and variation in gene expression, including alternative splicing, among a large number of paralogous and orthologous genes. Genes related to the production of anticancer phytochemicals and morphological variations illustrate consequences of genome duplication and gene divergence, imparting biochemical and morphological variation to B. oleracea. This study provides insights into Brassica genome evolution and will underpin research into the many important crops in this genus. PMID:24852848

  14. Genome sequence and genetic diversity of European ash trees

    DEFF Research Database (Denmark)

    Sollars, Elizabeth S A; Harper, Andrea L; Kelly, Laura J

    2017-01-01

    -heterozygosity Fraxinus excelsior tree from Gloucestershire, UK, annotating 38,852 protein-coding genes of which 25% appear ash specific when compared with the genomes of ten other plant species. Analyses of paralogous genes suggest a whole-genome duplication shared with olive (Olea europaea, Oleaceae). We also re...

  15. Unleashing the genome of Brassica rapa

    Directory of Open Access Journals (Sweden)

    Haibao eTang

    2012-07-01

    Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

  16. The infinite sites model of genome evolution.

    Science.gov (United States)

    Ma, Jian; Ratan, Aakrosh; Raney, Brian J; Suh, Bernard B; Miller, Webb; Haussler, David

    2008-09-23

    We formalize the problem of recovering the evolutionary history of a set of genomes that are related to an unseen common ancestor genome by operations of speciation, deletion, insertion, duplication, and rearrangement of segments of bases. The problem is examined in the limit as the number of bases in each genome goes to infinity. In this limit, the chromosomes are represented by continuous circles or line segments. For such an infinite-sites model, we present a polynomial-time algorithm to find the most parsimonious evolutionary history of any set of related present-day genomes.

  17. Polyploidy: adaptation to the genomic environment.

    Science.gov (United States)

    Hollister, Jesse D

    2015-02-01

    Genomic evidence of ancestral whole genome duplication (WGD) and polyploidy is widespread among eukaryotic species, and especially among plants. WGD is thought to provide the raw material for adaptation in the form of duplicated genes, and polyploids are thought to benefit from both physiological and genetic buffering. Comparatively little attention has focused on the genomic challenge of polyploidy, however, although much evidence exists that polyploidy severely perturbs important cellular functions. Here, I review recent progress in the study of the re-establishment of stable meiosis in recently evolved polyploids, focusing on four plant species. This work has yielded an insight into the mechanisms underlying stabilization of genome transmission in polyploids, and is revealing remarkable parallels among diverse taxa. Importantly, these studies also provide a road map for investigating how polyploids respond to the challenge of WGD.

  18. Obstetric significance of fetal craniofacial duplication. A case report.

    Science.gov (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H

    1985-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  19. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  20. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  1. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  2. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  3. Duplicate laboratory test reduction using a clinical decision support tool.

    Science.gov (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice

    2014-05-01

    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  4. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  5. Duplicate Health Insurance Coverage: Determinants of Variation Across States

    OpenAIRE

    Luft, Harold S.; Maerki, Susan C.

    1982-01-01

    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  6. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)

    1995-11-20

    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  7. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey

    2013-01-01

    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  8. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  9. An unusual presentation of a rectal duplication cyst.

    Science.gov (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D

    2012-01-01

    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  10. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin

    2018-06-01

    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  11. Identification of approximately duplicate material records in ERP systems

    Science.gov (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic

    2017-03-01

    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  12. Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice

    Directory of Open Access Journals (Sweden)

    Katerina Kraft

    2015-02-01

    Full Text Available Structural variations (SVs contribute to the variability of our genome and are often associated with disease. Their study in model systems was hampered until now by labor-intensive genetic targeting procedures and multiple mouse crossing steps. Here we present the use of CRISPR/Cas for the fast (10 weeks and efficient generation of SVs in mice. We specifically produced deletions, inversions, and also duplications at six different genomic loci ranging from 1.1 kb to 1.6 Mb with efficiencies up to 42%. After PCR-based selection, clones were successfully used to create mice via aggregation. To test the practicability of the method, we reproduced a human 500 kb disease-associated deletion and were able to recapitulate the human phenotype in mice. Furthermore, we evaluated the regulatory potential of a large genomic interval by deleting a 1.5 Mb fragment. The method presented permits rapid in vivo modeling of genomic rearrangements.

  13. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)

    1995-12-31

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  14. Recurrent reciprocal genomic rearrangements of 17q12 are associated with renal disease, diabetes, and epilepsy

    DEFF Research Database (Denmark)

    Mefford, Heather C; Clauin, Severine; Sharp, Andrew J

    2007-01-01

    predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One...

  15. Evolution of the Largest Mammalian Genome.

    Science.gov (United States)

    Evans, Ben J; Upham, Nathan S; Golding, Goeffrey B; Ojeda, Ricardo A; Ojeda, Agustina A

    2017-06-01

    The genome of the red vizcacha rat (Rodentia, Octodontidae, Tympanoctomys barrerae) is the largest of all mammals, and about double the size of their close relative, the mountain vizcacha rat Octomys mimax, even though the lineages that gave rise to these species diverged from each other only about 5 Ma. The mechanism for this rapid genome expansion is controversial, and hypothesized to be a consequence of whole genome duplication or accumulation of repetitive elements. To test these alternative but nonexclusive hypotheses, we gathered and evaluated evidence from whole transcriptome and whole genome sequences of T. barrerae and O. mimax. We recovered support for genome expansion due to accumulation of a diverse assemblage of repetitive elements, which represent about one half and one fifth of the genomes of T. barrerae and O. mimax, respectively, but we found no strong signal of whole genome duplication. In both species, repetitive sequences were rare in transcribed regions as compared with the rest of the genome, and mostly had no close match to annotated repetitive sequences from other rodents. These findings raise new questions about the genomic dynamics of these repetitive elements, their connection to widespread chromosomal fissions that occurred in the T. barrerae ancestor, and their fitness effects-including during the evolution of hypersaline dietary tolerance in T. barrerae. ©The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Alignment of whole genomes.

    Science.gov (United States)

    Delcher, A L; Kasif, S; Fleischmann, R D; Peterson, J; White, O; Salzberg, S L

    1999-01-01

    A new system for aligning whole genome sequences is described. Using an efficient data structure called a suffix tree, the system is able to rapidly align sequences containing millions of nucleotides. Its use is demonstrated on two strains of Mycoplasma tuberculosis, on two less similar species of Mycoplasma bacteria and on two syntenic sequences from human chromosome 12 and mouse chromosome 6. In each case it found an alignment of the input sequences, using between 30 s and 2 min of computation time. From the system output, information on single nucleotide changes, translocations and homologous genes can easily be extracted. Use of the algorithm should facilitate analysis of syntenic chromosomal regions, strain-to-strain comparisons, evolutionary comparisons and genomic duplications. PMID:10325427

  17. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report.

    Science.gov (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S

    2007-01-01

    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  18. Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families.

    Science.gov (United States)

    Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele

    2017-05-04

    Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Six subgroups and extensive recent duplications characterize the evolution of the eukaryotic tubulin protein family.

    Science.gov (United States)

    Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin

    2014-08-27

    Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Population Genomics of Infectious and Integrated Wolbachia pipientis Genomes in Drosophila ananassae

    Science.gov (United States)

    Choi, Jae Young; Bubnell, Jaclyn E.; Aquadro, Charles F.

    2015-01-01

    Coevolution between Drosophila and its endosymbiont Wolbachia pipientis has many intriguing aspects. For example, Drosophila ananassae hosts two forms of W. pipientis genomes: One being the infectious bacterial genome and the other integrated into the host nuclear genome. Here, we characterize the infectious and integrated genomes of W. pipientis infecting D. ananassae (wAna), by genome sequencing 15 strains of D. ananassae that have either the infectious or integrated wAna genomes. Results indicate evolutionarily stable maternal transmission for the infectious wAna genome suggesting a relatively long-term coevolution with its host. In contrast, the integrated wAna genome showed pseudogene-like characteristics accumulating many variants that are predicted to have deleterious effects if present in an infectious bacterial genome. Phylogenomic analysis of sequence variation together with genotyping by polymerase chain reaction of large structural variations indicated several wAna variants among the eight infectious wAna genomes. In contrast, only a single wAna variant was found among the seven integrated wAna genomes examined in lines from Africa, south Asia, and south Pacific islands suggesting that the integration occurred once from a single infectious wAna genome and then spread geographically. Further analysis revealed that for all D. ananassae we examined with the integrated wAna genomes, the majority of the integrated wAna genomic regions is represented in at least two copies suggesting a double integration or single integration followed by an integrated genome duplication. The possible evolutionary mechanism underlying the widespread geographical presence of the duplicate integration of the wAna genome is an intriguing question remaining to be answered. PMID:26254486

  1. Diprosopus (partially duplicated head) associated with anencephaly: a case report.

    Science.gov (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M

    1999-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  2. [Anterior rectal duplication in adult patient: a case report].

    Science.gov (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E

    2009-01-01

    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  3. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  4. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  5. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  6. Penile Duplication and Two Anal Openings; Report of a Very Rare Case

    OpenAIRE

    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad

    2012-01-01

    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  7. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  8. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  9. Multiple Whole Genome Alignments Without a Reference Organism

    Energy Technology Data Exchange (ETDEWEB)

    Dubchak, Inna; Poliakov, Alexander; Kislyuk, Andrey; Brudno, Michael

    2009-01-16

    Multiple sequence alignments have become one of the most commonly used resources in genomics research. Most algorithms for multiple alignment of whole genomes rely either on a reference genome, against which all of the other sequences are laid out, or require a one-to-one mapping between the nucleotides of the genomes, preventing the alignment of recently duplicated regions. Both approaches have drawbacks for whole-genome comparisons. In this paper we present a novel symmetric alignment algorithm. The resulting alignments not only represent all of the genomes equally well, but also include all relevant duplications that occurred since the divergence from the last common ancestor. Our algorithm, implemented as a part of the VISTA Genome Pipeline (VGP), was used to align seven vertebrate and sixDrosophila genomes. The resulting whole-genome alignments demonstrate a higher sensitivity and specificity than the pairwise alignments previously available through the VGP and have higher exon alignment accuracy than comparable public whole-genome alignments. Of the multiple alignment methods tested, ours performed the best at aligning genes from multigene families?perhaps the most challenging test for whole-genome alignments. Our whole-genome multiple alignments are available through the VISTA Browser at http://genome.lbl.gov/vista/index.shtml.

  10. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  11. Rectal duplication cyst in an adult: the laparoscopic approach.

    Science.gov (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles

    2002-12-01

    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  12. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  13. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  14. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.

    Science.gov (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat

    2015-08-01

    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  15. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  16. Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens

    Directory of Open Access Journals (Sweden)

    Ming TIAN,Suyun FANG,Yanqiang WANG,Xiaorong GU,Chungang FENG,Rui HAO,Xiaoxiang HU,Ning LI

    2014-06-01

    Full Text Available The dermal hyperpigmentation phenotype in chickens is controlled by the dominant fibromelanosis allele. One of the ten unique characteristics of Silkie chickens is the fibromelanosis phenotype, which is pigmentation in the dermal layer of the skin and connective tissue. In this study, we found a mutation of fibromelanosis, a genomic rearrangement that included an inverted duplication of endothelin3 (EDN3, is responsible. We show that, as a stimulator of melanoblast proliferation, EDN3 expression was increased in silkie embryos and in both skin and muscle throughout adulthood. EDN3 expression led to an increase in expression of the downstream genes EDNRB2 and TYRP2, and was closely relate with the hyperpigmentation phenotype. We examined eight different Chinese chicken breeds showing hyperpigmentation and conclude that this structural genetic variant exists in all fibromelanosis chicken breeds.

  17. Phenotypic variation in a large Swedish pedigree due to SNCA duplication and triplication

    DEFF Research Database (Denmark)

    Fuchs, J; Nilsson, C; Kachergus, J

    2007-01-01

    complex. The genetic basis for familial parkinsonism is an SNCA-MMRN11 multiplication, but whereas SNCA-MMRN1 duplication in the Swedish proband (Branch J) leads to late-onset autonomic dysfunction and parkinsonism, SNCA-MMRN1 triplication in the Swedish American family (Branch I) leads to early......BACKGROUND: The "Lister family complex," an extensive Swedish family with autosomal dominant Parkinson disease, was first described by Henry Mjönes in 1949. On the basis of clinical, molecular, and genealogic findings on a Swedish and an American family branch, we provide genetic evidence...... that explains the parkinsonism in this extended pedigree. METHODS: Clinical methods included a detailed neurologic exam of the proband of the Swedish family branch, MRI, and ([123]I)-beta-CIT SPECT imaging. Genomic analysis included alpha-synuclein sequencing, SNCA real-time PCR dosage, chromosome 4q21...

  18. Telomere maintenance through recruitment of internal genomic regions.

    Science.gov (United States)

    Seo, Beomseok; Kim, Chuna; Hills, Mark; Sung, Sanghyun; Kim, Hyesook; Kim, Eunkyeong; Lim, Daisy S; Oh, Hyun-Seok; Choi, Rachael Mi Jung; Chun, Jongsik; Shim, Jaegal; Lee, Junho

    2015-09-18

    Cells surviving crisis are often tumorigenic and their telomeres are commonly maintained through the reactivation of telomerase. However, surviving cells occasionally activate a recombination-based mechanism called alternative lengthening of telomeres (ALT). Here we establish stably maintained survivors in telomerase-deleted Caenorhabditis elegans that escape from sterility by activating ALT. ALT survivors trans-duplicate an internal genomic region, which is already cis-duplicated to chromosome ends, across the telomeres of all chromosomes. These 'Template for ALT' (TALT) regions consist of a block of genomic DNA flanked by telomere-like sequences, and are different between two genetic background. We establish a model that an ancestral duplication of a donor TALT region to a proximal telomere region forms a genomic reservoir ready to be incorporated into telomeres on ALT activation.

  19. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook

    2006-01-01

    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  20. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani

    2016-01-01

    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  1. Ruptured rectal duplication cyst with classical bladder exstrophy.

    Science.gov (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh

    2010-07-01

    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  2. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco

    2010-01-01

    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  3. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.

    1998-01-01

    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  4. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  5. 19q12q13.2 duplication syndrome: neuropsychiatric long-term follow-up of a new case and literature update

    Directory of Open Access Journals (Sweden)

    Nacinovich R

    2017-10-01

    Full Text Available Renata Nacinovich,1,2 Nicoletta Villa,3 Fiorenza Broggi,1,2 Cristina Tavaniello,1 Monica Bomba,1 Donatella Conconi,2 Serena Redaelli,2 Elena Sala,3 Marialuisa Lavitrano,2 Francesca Neri1,2 1Childhood and Adolescence Neuropsychiatric Unit, San Gerardo Hospital, 2School of Medicine and Surgery, University of Milano Bicocca, 3Medical Genetics Laboratory, Clinical Pathology Department, San Gerardo Hospital, Monza, Italy Abstract: Genetic syndromes are well characterized by the phenotypic point of view, but little is known about their progression and patients’ quality of life. We report a 10-year neuropsychiatric follow-up of a boy with duplication of chromosome 19. Cytogenetic investigation was requested at the age of 5 years for psychomotor and speech delay. The genomic study identified an 8.17 Mb duplication on chromosome 19q12q13.2. We propose that the long-term follow-up of our patient would help to delineate the neuropsychiatric phenotype associated with 19q duplication. This study could be a model for further long-term research in the neuropsychiatric follow-up of patients with 19q duplication syndrome. Keywords: 19q duplication, neuropsychiatric follow-up, array-CGH

  6. Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

    Science.gov (United States)

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

    2011-07-01

    A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

    Science.gov (United States)

    Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

    2008-03-01

    Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

  8. Extended driving impairs nocturnal driving performances.

    Directory of Open Access Journals (Sweden)

    Patricia Sagaspe

    Full Text Available Though fatigue and sleepiness at the wheel are well-known risk factors for traffic accidents, many drivers combine extended driving and sleep deprivation. Fatigue-related accidents occur mainly at night but there is no experimental data available to determine if the duration of prior driving affects driving performance at night. Participants drove in 3 nocturnal driving sessions (3-5 am, 1-5 am and 9 pm-5 am on open highway. Fourteen young healthy men (mean age [+/-SD] = 23.4 [+/-1.7] years participated Inappropriate line crossings (ILC in the last hour of driving of each session, sleep variables, self-perceived fatigue and sleepiness were measured. Compared to the short (3-5 am driving session, the incidence rate ratio of inappropriate line crossings increased by 2.6 (95% CI, 1.1 to 6.0; P<.05 for the intermediate (1-5 am driving session and by 4.0 (CI, 1.7 to 9.4; P<.001 for the long (9 pm-5 am driving session. Compared to the reference session (9-10 pm, the incidence rate ratio of inappropriate line crossings were 6.0 (95% CI, 2.3 to 15.5; P<.001, 15.4 (CI, 4.6 to 51.5; P<.001 and 24.3 (CI, 7.4 to 79.5; P<.001, respectively, for the three different durations of driving. Self-rated fatigue and sleepiness scores were both positively correlated to driving impairment in the intermediate and long duration sessions (P<.05 and increased significantly during the nocturnal driving sessions compared to the reference session (P<.01. At night, extended driving impairs driving performances and therefore should be limited.

  9. On Sorting Genomes with DCJ and Indels

    Science.gov (United States)

    Braga, Marília D. V.

    A previous work of Braga, Willing and Stoye compared two genomes with unequal content, but without duplications, and presented a new linear time algorithm to compute the genomic distance, considering double cut and join (DCJ) operations, insertions and deletions. Here we derive from this approach an algorithm to sort one genome into another one also using DCJ, insertions and deletions. The optimal sorting scenarios can have different compositions and we compare two types of sorting scenarios: one that maximizes and one that minimizes the number of DCJ operations with respect to the number of insertions and deletions.

  10. A universal genomic coordinate translator for comparative genomics.

    Science.gov (United States)

    Zamani, Neda; Sundström, Görel; Meadows, Jennifer R S; Höppner, Marc P; Dainat, Jacques; Lantz, Henrik; Haas, Brian J; Grabherr, Manfred G

    2014-06-30

    Genomic duplications constitute major events in the evolution of species, allowing paralogous copies of genes to take on fine-tuned biological roles. Unambiguously identifying the orthology relationship between copies across multiple genomes can be resolved by synteny, i.e. the conserved order of genomic sequences. However, a comprehensive analysis of duplication events and their contributions to evolution would require all-to-all genome alignments, which increases at N2 with the number of available genomes, N. Here, we introduce Kraken, software that omits the all-to-all requirement by recursively traversing a graph of pairwise alignments and dynamically re-computing orthology. Kraken scales linearly with the number of targeted genomes, N, which allows for including large numbers of genomes in analyses. We first evaluated the method on the set of 12 Drosophila genomes, finding that orthologous correspondence computed indirectly through a graph of multiple synteny maps comes at minimal cost in terms of sensitivity, but reduces overall computational runtime by an order of magnitude. We then used the method on three well-annotated mammalian genomes, human, mouse, and rat, and show that up to 93% of protein coding transcripts have unambiguous pairwise orthologous relationships across the genomes. On a nucleotide level, 70 to 83% of exons match exactly at both splice junctions, and up to 97% on at least one junction. We last applied Kraken to an RNA-sequencing dataset from multiple vertebrates and diverse tissues, where we confirmed that brain-specific gene family members, i.e. one-to-many or many-to-many homologs, are more highly correlated across species than single-copy (i.e. one-to-one homologous) genes. Not limited to protein coding genes, Kraken also identifies thousands of newly identified transcribed loci, likely non-coding RNAs that are consistently transcribed in human, chimpanzee and gorilla, and maintain significant correlation of expression levels across

  11. Sex drives intracellular conflict in yeast.

    Science.gov (United States)

    Harrison, E; MacLean, R C; Koufopanou, V; Burt, A

    2014-08-01

    Theory predicts that sex can drive the evolution of conflict within the cell. During asexual reproduction, genetic material within the cell is inherited as a single unit, selecting for cooperation both within the genome as well as between the extra-genomic elements within the cell (e.g. plasmids and endosymbionts). Under sexual reproduction, this unity is broken down as parental genomes are distributed between meiotic progeny. Genetic elements able to transmit to more than 50% of meiotic progeny have a transmission advantage over the rest of the genome and are able to spread, even where they reduce the fitness of the individual as a whole. Sexual reproduction is therefore expected to drive the evolution of selfish genetic elements (SGEs). Here, we directly test this hypothesis by studying the evolution of two independent SGEs, the 2-μm plasmid and selfish mitochondria, in populations of Saccharomyces cerevisiae. Following 22 rounds of sexual reproduction, 2-μm copy number increased by approximately 13.2 (±5.6) copies per cell, whereas in asexual populations copy number decreased by approximately 5.1 (±1.5) copies per cell. Given that the burden imposed by this parasite increases with copy number, these results support the idea that sex drives the evolution of increased SGE virulence. Moreover, we found that mitochondria that are respiratory-deficient rapidly invaded sexual but not asexual populations, demonstrating that frequent outcrossed sex can drive the de novo evolution of genetic parasites. Our study highlights the genomic perils of sex and suggests that SGEs may play a key role in driving major evolutionary transitions, such as uniparental inheritance. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  12. Duplication of lower lip and mandible--a rare diprosopus.

    Science.gov (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R

    2011-01-01

    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  13. Exposing region duplication through local geometrical color invariant features

    Science.gov (United States)

    Gong, Jiachang; Guo, Jichang

    2015-05-01

    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  14. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  15. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.

    1983-01-01

    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  16. Cryptorchidism due to chromosome 5q inversion duplication.

    Science.gov (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  17. Verification and characterization of chromosome duplication in haploid maize.

    Science.gov (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

    2015-06-26

    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  18. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso

    2014-08-01

    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  19. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy.

    Science.gov (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis

    2013-09-21

    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  20. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.

    1986-01-01

    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  1. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction.

    Science.gov (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D

    1997-07-01

    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  2. Different clinical presentations, diagnostic difficulties, and management of cecal duplication.

    Science.gov (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün

    2013-03-01

    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  4. 48 CFR 1352.231-71 - Duplication of effort.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  5. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.

    1949-01-01

    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  6. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari

    2014-01-01

    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  7. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  8. HARMONIC DRIVE SELECTION

    Directory of Open Access Journals (Sweden)

    Piotr FOLĘGA

    2014-03-01

    Full Text Available The variety of types and sizes currently in production harmonic drive is a problem in their rational choice. Properly selected harmonic drive must meet certain requirements during operation, and achieve the anticipated service life. The paper discusses the problems associated with the selection of the harmonic drive. It also presents the algorithm correct choice of harmonic drive. The main objective of this study was to develop a computer program that allows the correct choice of harmonic drive by developed algorithm.

  9. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. 11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.

    Science.gov (United States)

    Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata

    2015-06-01

    Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.

  11. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  12. A large duplication involving the IHH locus mimics acrocallosal syndrome.

    Science.gov (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd

    2012-06-01

    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  13. The genome of Eucalyptus grandis

    Energy Technology Data Exchange (ETDEWEB)

    Myburg, Alexander A.; Grattapaglia, Dario; Tuskan, Gerald A.; Hellsten, Uffe; Hayes, Richard D.; Grimwood, Jane; Jenkins, Jerry; Lindquist, Erika; Tice, Hope; Bauer, Diane; Goodstein, David M.; Dubchak, Inna; Poliakov, Alexandre; Mizrachi, Eshchar; Kullan, Anand R. K.; Hussey, Steven G.; Pinard, Desre; van der Merwe, Karen; Singh, Pooja; van Jaarsveld, Ida; Silva-Junior, Orzenil B.; Togawa, Roberto C.; Pappas, Marilia R.; Faria, Danielle A.; Sansaloni, Carolina P.; Petroli, Cesar D.; Yang, Xiaohan; Ranjan, Priya; Tschaplinski, Timothy J.; Ye, Chu-Yu; Li, Ting; Sterck, Lieven; Vanneste, Kevin; Murat, Florent; Soler, Marçal; Clemente, Hélène San; Saidi, Naijib; Cassan-Wang, Hua; Dunand, Christophe; Hefer, Charles A.; Bornberg-Bauer, Erich; Kersting, Anna R.; Vining, Kelly; Amarasinghe, Vindhya; Ranik, Martin; Naithani, Sushma; Elser, Justin; Boyd, Alexander E.; Liston, Aaron; Spatafora, Joseph W.; Dharmwardhana, Palitha; Raja, Rajani; Sullivan, Christopher; Romanel, Elisson; Alves-Ferreira, Marcio; Külheim, Carsten; Foley, William; Carocha, Victor; Paiva, Jorge; Kudrna, David; Brommonschenkel, Sergio H.; Pasquali, Giancarlo; Byrne, Margaret; Rigault, Philippe; Tibbits, Josquin; Spokevicius, Antanas; Jones, Rebecca C.; Steane, Dorothy A.; Vaillancourt, René E.; Potts, Brad M.; Joubert, Fourie; Barry, Kerrie; Pappas, Georgios J.; Strauss, Steven H.; Jaiswal, Pankaj; Grima-Pettenati, Jacqueline; Salse, Jérôme; Van de Peer, Yves; Rokhsar, Daniel S.; Schmutz, Jeremy

    2014-06-11

    Eucalypts are the world s most widely planted hardwood trees. Their broad adaptability, rich species diversity, fast growth and superior multipurpose wood, have made them a global renewable resource of fiber and energy that mitigates human pressures on natural forests. We sequenced and assembled >94% of the 640 Mbp genome of Eucalyptus grandis into its 11 chromosomes. A set of 36,376 protein coding genes were predicted revealing that 34% occur in tandem duplications, the largest proportion found thus far in any plant genome. Eucalypts also show the highest diversity of genes for plant specialized metabolism that act as chemical defence against biotic agents and provide unique pharmaceutical oils. Resequencing of a set of inbred tree genomes revealed regions of strongly conserved heterozygosity, likely hotspots of inbreeding depression. The resequenced genome of the sister species E. globulus underscored the high inter-specific genome colinearity despite substantial genome size variation in the genus. The genome of E. grandis is the first reference for the early diverging Rosid order Myrtales and is placed here basal to the Eurosids. This resource expands knowledge on the unique biology of large woody perennials and provides a powerful tool to accelerate comparative biology, breeding and biotechnology.

  14. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  15. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  16. The impact of genome triplication on tandem gene evolution in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Lu eFang

    2012-11-01

    Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.

  17. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  18. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  19. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  20. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  1. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  2. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  3. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  4. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  5. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  6. Electric Vehicle - Economical driving

    DEFF Research Database (Denmark)

    Jensen, VCE, Steen V.; Schøn, Henriette

    1999-01-01

    Instruct the reader in getting most satisfaction out of an EV, especially concerning driving and loading.......Instruct the reader in getting most satisfaction out of an EV, especially concerning driving and loading....

  7. Dementia and driving

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000028.htm Dementia and driving To use the sharing features on ... please enable JavaScript. If your loved one has dementia , deciding when they can no longer drive may ...

  8. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  9. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan

    2016-01-01

    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  10. Rectal duplications accompanying rectovestibular fistula: report of two cases.

    Science.gov (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur

    2013-08-01

    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  11. Recurrent rectal prolapse caused by colonic duplication in a dog.

    Science.gov (United States)

    Landon, B P; Abraham, L A; Charles, J A; Edwards, G A

    2007-09-01

    A 9-month-old female Shar Pei cross-bred dog was presented with a history of recurrent rectal prolapse over 7 months. Repeated reduction and anal purse string sutures and subsequent incisional colopexy failed to prevent recurrent rectal prolapse. Digital rectal examination following reduction of the prolapse identified a faeces-filled sac within the ventral wall of the rectum and an orifice in the ventral colonic wall, cranial to the pubic brim. A ventral, communicating tubular colonic duplication was diagnosed by means of a barium enema. Surgical excision of the duplicated colonic tube was performed via a caudal ventral midline laparotomy. At 20 weeks post-operation, there has been no recurrence of rectal prolapse.

  12. Reversion in variants from a duplication strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Menezes, E.M.; Azevedo, J.L.

    1978-01-01

    Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de

  13. Gear bearing drive

    Science.gov (United States)

    Mavroidis, Constantinos (Inventor); Vranish, John M. (Inventor); Weinberg, Brian (Inventor)

    2011-01-01

    A gear bearing drive provides a compact mechanism that operates as an actuator providing torque and as a joint providing support. The drive includes a gear arrangement integrating an external rotor DC motor within a sun gear. Locking surfaces maintain the components of the drive in alignment and provide support for axial loads and moments. The gear bearing drive has a variety of applications, including as a joint in robotic arms and prosthetic limbs.

  14. Duplication of the glans penis manifested at puberty.

    Science.gov (United States)

    Gentileschi, S; Bracaglia, R; Seccia, A; Farallo, E

    2006-01-01

    We report the case of a complete duplication of the glans, with prepuce and a blind end urethra just proximal to the dorsal aspect of the balanopreputial fold. The malformation was not evident at birth and during childhood, and became manifest only at puberty, with the growth of the external genitalia. It was not associated with other urinary malformations. Surgical excision was easy and uneventful.

  15. Delusion of fetal duplication in a Capgras patient.

    Science.gov (United States)

    Silva, J A; Leong, G B; Longhitano, M; Botello, T E

    1991-02-01

    A case of Capgras syndrome in a pregnant patient is described. In addition to perceiving living family members as impostors, she believed that there was a double or twin of her fetus. She conceptualized her "twins" differently than the way she viewed doubles of family members. Her fetus may represent the youngest "person" to have been duplicated. The relationship of Capgras syndrome to misidentification phenomena is discussed.

  16. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    International Nuclear Information System (INIS)

    Rao, Narasimha; Joseph, Benjamin

    2002-01-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  17. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Narasimha; Joseph, Benjamin [Department of Orthopaedics, Kasturba Medical College, Karnataka State (India)

    2002-03-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  18. Efficient image duplicated region detection model using sequential block clustering

    Czech Academy of Sciences Publication Activity Database

    Sekeh, M. A.; Maarof, M. A.; Rohani, M. F.; Mahdian, Babak

    2013-01-01

    Roč. 10, č. 1 (2013), s. 73-84 ISSN 1742-2876 Institutional support: RVO:67985556 Keywords : Image forensic * Copy–paste forgery * Local block matching Subject RIV: IN - Informatics, Computer Science Impact factor: 0.986, year: 2013 http://library.utia.cas.cz/separaty/2013/ZOI/mahdian-efficient image duplicated region detection model using sequential block clustering.pdf

  19. Antihistamines and driving safety.

    Science.gov (United States)

    O'Hanlon, J F

    1988-10-27

    The results of two placebo-controlled driving performance studies confirm laboratory data showing that the nonsedating antihistamine terfenadine does not influence the driving performance of users. The amplitude of vehicle weaving calculated for drivers who received this agent did not differ from control values. Neither terfenadine nor loratadine, another nonsedating antihistamine, potentiated the adverse effects of alcohol on driving performance.

  20. Driving After a Stroke

    Science.gov (United States)

    ... 23,2015 Can I drive after a stroke? Driving is often a major concern after someone has a stroke. It’s not unusual for stroke survivors to want to drive. Being able to get around after a stroke is important. Safety behind the wheel is even more important after ...

  1. Sequential Dependencies in Driving

    Science.gov (United States)

    Doshi, Anup; Tran, Cuong; Wilder, Matthew H.; Mozer, Michael C.; Trivedi, Mohan M.

    2012-01-01

    The effect of recent experience on current behavior has been studied extensively in simple laboratory tasks. We explore the nature of sequential effects in the more naturalistic setting of automobile driving. Driving is a safety-critical task in which delayed response times may have severe consequences. Using a realistic driving simulator, we find…

  2. Simple Driving Techniques

    DEFF Research Database (Denmark)

    Rosendahl, Mads

    2002-01-01

    -like language. Our aim is to extract a simple notion of driving and show that even in this tamed form it has much of the power of more general notions of driving. Our driving technique may be used to simplify functional programs which use function composition and will often be able to remove intermediate data...

  3. Partial craniofacial duplication: a review of the literature and case report.

    Science.gov (United States)

    Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P

    2014-06-01

    Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.

  4. Adenocarcinoma within a rectal duplication cyst: case report and literature review.

    Science.gov (United States)

    Michael, D; Cohen, C R; Northover, J M

    1999-05-01

    Intestinal duplications are uncommon but recognised developmental anomalies. Duplications of the rectum are the most uncommon of these anomalies. They may present with perianal fistulae, bleeding, a pelvic mass or symptoms produced by a mass, or, rarely, malignant change. We present a case of an adenocarcinoma within a rectal duplication cyst which was initially thought to be inoperable but was treated by radical surgery.

  5. JGI Plant Genomics Gene Annotation Pipeline

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

    2014-07-14

    Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

  6. Operative correction and follow-up of craniofacial duplication.

    Science.gov (United States)

    Kotrikova, Bibiana; Hassfeld, Stefan; Steiner, Hans H; Hähnel, Stefan; Krempien, Robert; Mühling, Joachim

    2007-03-01

    Anterior craniofacial duplication (diprosopus) is an extremely rare form of conjoined twins. The children share a single trunk with normal extremities and varying degrees of facial malformation. Duplication of specific structures, such as the nose (diprosopus dirrhinus), eyes (diprosopus tetraophthalmus), and ears, is possible. The authors present a case of partial facial duplication (diprosopus dirrhinus) in a male infant. The clinical and radiographic findings and the surgical correction and follow-up are described. In a single surgical session, the authors were able to achieve not only a functionally but also an aesthetically acceptable result. In the postoperative course, the child showed nearly normal growth and satisfactory psychosocial and motor development. However, 40 months postoperatively, we noticed a tendency of the orbitae to diverge (i.e., toward hypertelorism). The surgical management of complex craniofacial malformations such as diprosopus needs a precise morphologic analysis of the patient's deformity followed by a clear treatment plan. A staged reconstructive approach is carried out to coincide with facial growth patterns and brain and eye function. If the interorbital distance in our patient increases progressively, a second operation for reduction of the interorbital distance may be necessary.

  7. Using sea urchin gametes and zygotes to investigate centrosome duplication.

    Science.gov (United States)

    Sluder, Greenfield

    2016-01-01

    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  8. Williams Syndrome and 15q Duplication: Coincidence versus Association.

    Science.gov (United States)

    Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila

    2017-01-01

    Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

  9. Genomes in turmoil: quantification of genome dynamics in prokaryote supergenomes.

    Science.gov (United States)

    Puigbò, Pere; Lobkovsky, Alexander E; Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

    2014-08-21

    Genomes of bacteria and archaea (collectively, prokaryotes) appear to exist in incessant flux, expanding via horizontal gene transfer and gene duplication, and contracting via gene loss. However, the actual rates of genome dynamics and relative contributions of different types of event across the diversity of prokaryotes are largely unknown, as are the sizes of microbial supergenomes, i.e. pools of genes that are accessible to the given microbial species. We performed a comprehensive analysis of the genome dynamics in 35 groups (34 bacterial and one archaeal) of closely related microbial genomes using a phylogenetic birth-and-death maximum likelihood model to quantify the rates of gene family gain and loss, as well as expansion and reduction. The results show that loss of gene families dominates the evolution of prokaryotes, occurring at approximately three times the rate of gain. The rates of gene family expansion and reduction are typically seven and twenty times less than the gain and loss rates, respectively. Thus, the prevailing mode of evolution in bacteria and archaea is genome contraction, which is partially compensated by the gain of new gene families via horizontal gene transfer. However, the rates of gene family gain, loss, expansion and reduction vary within wide ranges, with the most stable genomes showing rates about 25 times lower than the most dynamic genomes. For many groups, the supergenome estimated from the fraction of repetitive gene family gains includes about tenfold more gene families than the typical genome in the group although some groups appear to have vast, 'open' supergenomes. Reconstruction of evolution for groups of closely related bacteria and archaea reveals an extremely rapid and highly variable flux of genes in evolving microbial genomes, demonstrates that extensive gene loss and horizontal gene transfer leading to innovation are the two dominant evolutionary processes, and yields robust estimates of the supergenome size.

  10. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism.

    Science.gov (United States)

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb

    2013-06-01

    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  11. Pseudohypoparathyroidism type Ib associated with novel duplications in the GNAS locus.

    Directory of Open Access Journals (Sweden)

    Gustavo Perez-Nanclares

    Full Text Available Pseudohypoparathyroidism type 1b (PHP-Ib is characterized by renal resistance to PTH (and, sometimes, a mild resistance to TSH and absence of any features of Albright's hereditary osteodystrophy. Patients with PHP-Ib suffer of defects in the methylation pattern of the complex GNAS locus. PHP-Ib can be either sporadic or inherited in an autosomal dominant pattern. Whereas familial PHP-Ib is well characterized at the molecular level, the genetic cause of sporadic PHP-Ib cases remains elusive, although some molecular mechanisms have been associated with this subtype.The aim of the study was to investigate the molecular and imprinting defects in the GNAS locus in two unrelated patients with PHP-Ib.We have analyzed the GNAS locus by direct sequencing, Methylation-Specific Multiplex Ligation-dependent Probe Amplification, microsatellites, Quantitative Multiplex PCR of Short Fluorescent fragments and array-Comparative Genomic Hybridization studies in order to characterize two unrelated families with clinical features of PHP-Ib.We identified two duplications in the GNAS region in two patients with PHP-Ib: one of them, comprising ∼ 320 kb, occurred 'de novo' in the patient, whereas the other one, of ∼ 179 kb in length, was inherited from the maternal allele. In both cases, no other known genetic cause was observed.In this article, we describe the to-our-knowledge biggest duplications reported so far in the GNAS region. Both are associated to PHP-Ib, one of them occurring 'de novo' and the other one being maternally inherited.

  12. Analysis of the 9p21.3 sequence associated with coronary artery disease reveals a tendency for duplication in a CAD patient

    Science.gov (United States)

    Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir

    2018-01-01

    Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643

  13. The genome of the extremophile crucifer Thellungiella parvula

    KAUST Repository

    Dassanayake, Maheshi

    2011-08-07

    Thellungiella parvula is related to Arabidopsis thaliana and is endemic to saline, resource-poor habitats, making it a model for the evolution of plant adaptation to extreme environments. Here we present the draft genome for this extremophile species. Exclusively by next generation sequencing, we obtained the de novo assembled genome in 1,496 gap-free contigs, closely approximating the estimated genome size of 140 Mb. We anchored these contigs to seven pseudo chromosomes without the use of maps. We show that short reads can be assembled to a near-complete chromosome level for a eukaryotic species lacking prior genetic information. The sequence identifies a number of tandem duplications that, by the nature of the duplicated genes, suggest a possible basis for T. parvula\\'s extremophile lifestyle. Our results provide essential background for developing genomically influenced testable hypotheses for the evolution of environmental stress tolerance. © 2011 Nature America, Inc. All rights reserved.

  14. The genome of the extremophile crucifer Thellungiella parvula

    KAUST Repository

    Dassanayake, Maheshi; Oh, Dongha; Haas, Jeffrey S.; Herná ndez, Á lvaro Gonzalez; Hong, Hyewon; Ali, Shahjahan; Yun, Daejin; Bressan, Ray Anthony; Zhu, Jian-Kang; Bohnert, Hans Jü rgen; Cheeseman, John McP

    2011-01-01

    Thellungiella parvula is related to Arabidopsis thaliana and is endemic to saline, resource-poor habitats, making it a model for the evolution of plant adaptation to extreme environments. Here we present the draft genome for this extremophile species. Exclusively by next generation sequencing, we obtained the de novo assembled genome in 1,496 gap-free contigs, closely approximating the estimated genome size of 140 Mb. We anchored these contigs to seven pseudo chromosomes without the use of maps. We show that short reads can be assembled to a near-complete chromosome level for a eukaryotic species lacking prior genetic information. The sequence identifies a number of tandem duplications that, by the nature of the duplicated genes, suggest a possible basis for T. parvula's extremophile lifestyle. Our results provide essential background for developing genomically influenced testable hypotheses for the evolution of environmental stress tolerance. © 2011 Nature America, Inc. All rights reserved.

  15. A new case of Beckwith-Wiedemann syndrome with an 11p15 duplication of paternal origin [46,XY,-21,+der(21), t(11;21)(p15.2;q22.3)pat].

    Science.gov (United States)

    Krajewska-Walasek, M; Gutkowska, A; Mospinek-Krasnopolska, M; Chrzanowska, K

    1996-01-01

    We present a new case of 11p15 duplication (trisomy 11p15) in a boy (46,XY,-21,+der(21), t(11;21)(p15.2;q22.3)] suffering from Beckwith-Wiedemann syndrome (BWS), whose phenotypically normal father carries a balanced translocation between chromosomes 11 and 21[46,XY, t(11;21)(p15.2;q22.3)]. The paternal grandmother has the same balanced translocation and is also clinically normal. BWS was suspected when the boy was 6 months old because of gigantism, macroglossia, visceromegaly, ear lobe creases and abdominal distention. Apart from the characteristic BWS phenotype, the boy has other features which are almost exclusively observed in 11p trisomy (high forehead with frontal upsweep of hair, wide central nose bridge, slightly beaked nose, chubby cheeks and severe mental retardation). So far, at least eight cases of 11p15 duplication have been described as patients with BWS. In six of these, the duplication was due to inheritance of a translocated or rearranged paternal chromosome. This was also the case in our patient. In the two other previously published cases, the 11p15 duplications were de novo, but in one of these, DNA analysis has subsequently shown that the duplication was of paternal origin. We discuss our observations in relation to the above-mentioned previous cases of 11p15 duplication and the possible role of genomic imprinting in the etiology of BWS.

  16. Global Metabolic Reconstruction and Metabolic Gene Evolution in the Cattle Genome

    Science.gov (United States)

    Kim, Woonsu; Park, Hyesun; Seo, Seongwon

    2016-01-01

    The sequence of cattle genome provided a valuable opportunity to systematically link genetic and metabolic traits of cattle. The objectives of this study were 1) to reconstruct genome-scale cattle-specific metabolic pathways based on the most recent and updated cattle genome build and 2) to identify duplicated metabolic genes in the cattle genome for better understanding of metabolic adaptations in cattle. A bioinformatic pipeline of an organism for amalgamating genomic annotations from multiple sources was updated. Using this, an amalgamated cattle genome database based on UMD_3.1, was created. The amalgamated cattle genome database is composed of a total of 33,292 genes: 19,123 consensus genes between NCBI and Ensembl databases, 8,410 and 5,493 genes only found in NCBI or Ensembl, respectively, and 266 genes from NCBI scaffolds. A metabolic reconstruction of the cattle genome and cattle pathway genome database (PGDB) was also developed using Pathway Tools, followed by an intensive manual curation. The manual curation filled or revised 68 pathway holes, deleted 36 metabolic pathways, and added 23 metabolic pathways. Consequently, the curated cattle PGDB contains 304 metabolic pathways, 2,460 reactions including 2,371 enzymatic reactions, and 4,012 enzymes. Furthermore, this study identified eight duplicated genes in 12 metabolic pathways in the cattle genome compared to human and mouse. Some of these duplicated genes are related with specific hormone biosynthesis and detoxifications. The updated genome-scale metabolic reconstruction is a useful tool for understanding biology and metabolic characteristics in cattle. There has been significant improvements in the quality of cattle genome annotations and the MetaCyc database. The duplicated metabolic genes in the cattle genome compared to human and mouse implies evolutionary changes in the cattle genome and provides a useful information for further research on understanding metabolic adaptations of cattle. PMID

  17. Genome-Wide Identification, Evolution and Functional Divergence of MYB Transcription Factors in Chinese White Pear (Pyrus bretschneideri).

    Science.gov (United States)

    Li, Xiaolong; Xue, Cheng; Li, Jiaming; Qiao, Xin; Li, Leiting; Yu, Li'ang; Huang, Yuhua; Wu, Jun

    2016-04-01

    The MYB superfamily is large and functionally diverse in plants. To date, MYB family genes have not yet been identified in Chinese white pear (Pyrus bretschneideri), and their functions remain unclear. In this study, we identified 231 genes as candidate MYB genes and divided them into four subfamilies. The R2R3-MYB (PbrMYB) family shared an R2R3 domain with 104 amino acid residues, including five conserved tryptophan residues. The Pbr MYB family was divided into 37 functional subgroups including 33 subgroups which contained both MYB genes of Rosaceae plants and AtMYB genes, and four subgroups which included only Rosaceae MYB genes or AtMYB genes. PbrMYB genes with similar functions clustered into the same subgroup, indicating functional conservation. We also found that whole-genome duplication (WGD) and dispersed duplications played critical roles in the expansion of the MYB family. The 87 Pbr MYB duplicated gene pairs dated back to the two WGD events. Purifying selection was the primary force driving Pbr MYB gene evolution. The 15 gene pairs presented 1-7 codon sites under positive selection. A total of 147 expressed genes were identified from RNA-sequencing data of fruit, and six Pbr MYB members in subgroup C1 were identified as important candidate genes in the regulation of lignin synthesis by quantitative real-time PCR analysis. Further correlation analysis revealed that six PbrMYBs were significantly correlated with five structural gene families (F5H, HCT, CCR, POD and C3'H) in the lignin pathway. The phylogenetic, evolution and expression analyses of the MYB gene family in Chinese white pear establish a solid foundation for future comprehensive functional analysis of Pbr MYB genes. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start

  19. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    Full Text Available Abstract Background The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Results Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1 in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a

  20. A case with concurrent duplication, triplication, and uniparental isodisomy at 1q42.12-qter supporting microhomology-mediated break-induced replication model for replicative rearrangements.

    Science.gov (United States)

    Kohmoto, Tomohiro; Okamoto, Nana; Naruto, Takuya; Murata, Chie; Ouchi, Yuya; Fujita, Naoko; Inagaki, Hidehito; Satomura, Shigeko; Okamoto, Nobuhiko; Saito, Masako; Masuda, Kiyoshi; Kurahashi, Hiroki; Imoto, Issei

    2017-01-01

    Complex genomic rearrangements (CGRs) consisting of interstitial triplications in conjunction with uniparental isodisomy (isoUPD) have rarely been reported in patients with multiple congenital anomalies (MCA)/intellectual disability (ID). One-ended DNA break repair coupled with microhomology-mediated break-induced replication (MMBIR) has been recently proposed as a possible mechanism giving rise to interstitial copy number gains and distal isoUPD, although only a few cases providing supportive evidence in human congenital diseases with MCA have been documented. Here, we report on the chromosomal microarray (CMA)-based identification of the first known case with concurrent interstitial duplication at 1q42.12-q42.2 and triplication at 1q42.2-q43 followed by isoUPD for the remainder of chromosome 1q (at 1q43-qter). In distal 1q duplication/triplication overlapping with 1q42.12-q43, variable clinical features have been reported, and our 25-year-old patient with MCA/ID presented with some of these frequently described features. Further analyses including the precise mapping of breakpoint junctions within the CGR in a sequence level suggested that the CGR found in association with isoUPD in our case is a triplication with flanking duplications, characterized as a triplication with a particularly long duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) structure. Because microhomology was observed in both junctions between the triplicated region and the flanking duplicated regions, our case provides supportive evidence for recently proposed replication-based mechanisms, such as MMBIR, underlying the formation of CGRs + isoUPD implicated in chromosomal disorders. To the best of our knowledge, this is the first case of CGRs + isoUPD observed in 1q and having DUP-TRP/INV-DUP structure with a long proximal duplication, which supports MMBIR-based model for genomic rearrangements. Molecular cytogenetic analyses using CMA containing single