WorldWideScience

Sample records for genes regulating gonadal

  1. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    NARCIS (Netherlands)

    C. Orelio; E.A. Dzierzak (Elaine)

    2003-01-01

    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  2. Gonad Transcriptome Analysis of the Pacific Oyster Crassostrea gigas Identifies Potential Genes Regulating the Sex Determination and Differentiation Process.

    Science.gov (United States)

    Yue, Chenyang; Li, Qi; Yu, Hong

    2018-04-01

    The Pacific oyster Crassostrea gigas is a commercially important bivalve in aquaculture worldwide. C. gigas has a fascinating sexual reproduction system consisting of dioecism, sex change, and occasional hermaphroditism, while knowledge of the molecular mechanisms of sex determination and differentiation is still limited. In this study, the transcriptomes of male and female gonads at different gametogenesis stages were characterized by RNA-seq. Hierarchical clustering based on genes differentially expressed revealed that 1269 genes were expressed specifically in female gonads and 817 genes were expressed increasingly over the course of spermatogenesis. Besides, we identified two and one gene modules related to female and male gonad development, respectively, using weighted gene correlation network analysis (WGCNA). Interestingly, GO and KEGG enrichment analysis showed that neurotransmitter-related terms were significantly enriched in genes related to ovary development, suggesting that the neurotransmitters were likely to regulate female sex differentiation. In addition, two hub genes related to testis development, lncRNA LOC105321313 and Cg-Sh3kbp1, and one hub gene related to ovary development, Cg-Malrd1-like, were firstly investigated. This study points out the role of neurotransmitter and non-coding RNA regulation during gonad development and produces lists of novel relevant candidate genes for further studies. All of these provided valuable information to understand the molecular mechanisms of C. gigas sex determination and differentiation.

  3. Transcription of key genes regulating gonadal steroidogenesis in control and ketoconazole- or vinclozolin-exposed fathead minnows

    Energy Technology Data Exchange (ETDEWEB)

    Villeneuve, Daniel L.; Blake, Lindsey S.; Brodin, Jeffrey; Greene, Katie J.; Knoebl, Iris; Miracle, Ann L.; Martinovic, Dalma; Ankley, Gerald T.

    2007-08-01

    This study evaluated changes in the expression of steroidogenesis-related genes in male fathead minnows exposed to ketoconazole (KTC) or vinclozolin (VZ) for 21 days. The aim was to evaluate links between molecular changes and higher level outcomes after exposure to endocrine-active chemicals (EACs) with different modes of action. To aid our analysis and interpretation of EAC-related effects, we first examined variation in the relative abundance of steroidogenesis-related gene transcripts in the gonads of male and female fathead minnows as a function of age, gonad development, and spawning status, independent of EAC exposure. Gonadal expression of several genes varied with age and/or gonadal somatic index in either males or females. However, with the exception of aromatase, steroidogenesis-related gene expression did not vary with spawning status. Following the baseline experiments, expression of the selected genes in male fathead minnows exposed to KTC or VZ was evaluated in the context of effects observed at higher levels of organization. Exposure to KTC elicited changes in gene transcription that were consistent with an apparent compensatory response to the chemical's anticipated direct inhibition of steroidogenic enzyme activity. Exposure to VZ, an antiandrogen expected to indirectly impact steroidogenesis, increased pituitary expression of follicle-stimulating hormone beta-subunit as well as testis expression of 20beta-hydroxysteroid dehydrogenase and luteinizing hormone receptor transcripts. Results of this study contribute to ongoing research aimed at understanding responses of the teleost hypothalamic-pituitary-gonadal axis to different types of EACs and how changes in molecular endpoints translate into apical outcomes reflective of either adverse effect or compensation.

  4. A Novel igf3 Gene in Common Carp (Cyprinus carpio): Evidence for Its Role in Regulating Gonadal Development.

    Science.gov (United States)

    Song, Feibiao; Wang, Lanmei; Zhu, Wenbin; Fu, Jianjun; Dong, Juanjuan; Dong, Zaijie

    2016-01-01

    Since the insulin-like growth factor 3 (igf3) gene was recently discovered in fish ovary, its function in the gonads has received much attention. In this study, we isolated two igf3 subtypes from common carp (Cyprinus carpio), which comprised full-length cDNA of 707 and 1153 nucleotides encoding 205 and 198 amino acids (aa), respectively. The Igf3 aa sequence had the highest gene homology of 72% with the corresponding sequence in zebrafish (Danio rerio). Phylogenetic tree construction revealed that the C. carpio igf3 gene was first clustered with D. rerio and then with other teleost species. Igf3 mRNA was widely expressed, with expression being highest in the gonads and blood. In the gonad development stage, igf3a mRNA expression was highest in the maturity and recession stage of the ovary, and decline phase of the testis, while igf3b was highest in the recession and fully mature periods of the ovaries and testes, respectively. Western blotting of testis protein samples showed two bands of approximately 21 kDa and 34 kDa corresponding to the calculated molecular mass of the two Igf3 subtypes; no signal was detected in the ovary. The Igf3 protein was localized in the ovary granulosa cells and testis spermatogonium and spermatids. 17β-Ethinylestradiol treatment increased both ovary and testis igf3 mRNA expression. These findings suggest that Igf3 may play an important role in C. carpio gonadal development.

  5. Expression profile analysis of aorta-gonad-mesonephros region-derived stromal cells reveals genes that regulate hematopoiesis

    International Nuclear Information System (INIS)

    Nagao, Kenji; Ohta, Takayuki; Hinohara, Atsushi; Tahara, Tomoyuki; Hagiwara, Tetsuya; Maeda, Yoshitake; Yoneya, Takashi; Sohma, Yoshiaki; Heike, Toshio; Nakahata, Tatsutoshi; Inagaki, Yoshimasa; Nishikawa, Mitsuo

    2008-01-01

    The aorta-gonad-mesonephros (AGM) region is involved in the generation and maintenance of the first definitive hematopoietic stem cells (HSCs). A mouse AGM-derived cell line, AGM-S3, was shown to support the development of HSCs. To elucidate the molecular mechanisms regulating early hematopoiesis, we obtained subclones from AGM-S3, one of which was hematopoiesis supportive (S3-A9) and the other one of which was non-supportive (S3-A7), and we analyzed their gene expression profiles by gene chip analysis. In the present study, we found that Glypican-1 (GPC1) was highly expressed in the supportive subclone AGM-S3-A9. Over-expression of GPC1 in non-supportive cells led to the proliferation of progenitor cells in human cord blood when cocultured with the transfected-stromal cells. Thus, GPC1 may have an important role in the establishment of a microenvironment that supports early events in hematopoiesis

  6. A Novel igf3 Gene in Common Carp (Cyprinus carpio: Evidence for Its Role in Regulating Gonadal Development.

    Directory of Open Access Journals (Sweden)

    Feibiao Song

    Full Text Available Since the insulin-like growth factor 3 (igf3 gene was recently discovered in fish ovary, its function in the gonads has received much attention. In this study, we isolated two igf3 subtypes from common carp (Cyprinus carpio, which comprised full-length cDNA of 707 and 1153 nucleotides encoding 205 and 198 amino acids (aa, respectively. The Igf3 aa sequence had the highest gene homology of 72% with the corresponding sequence in zebrafish (Danio rerio. Phylogenetic tree construction revealed that the C. carpio igf3 gene was first clustered with D. rerio and then with other teleost species. Igf3 mRNA was widely expressed, with expression being highest in the gonads and blood. In the gonad development stage, igf3a mRNA expression was highest in the maturity and recession stage of the ovary, and decline phase of the testis, while igf3b was highest in the recession and fully mature periods of the ovaries and testes, respectively. Western blotting of testis protein samples showed two bands of approximately 21 kDa and 34 kDa corresponding to the calculated molecular mass of the two Igf3 subtypes; no signal was detected in the ovary. The Igf3 protein was localized in the ovary granulosa cells and testis spermatogonium and spermatids. 17β-Ethinylestradiol treatment increased both ovary and testis igf3 mRNA expression. These findings suggest that Igf3 may play an important role in C. carpio gonadal development.

  7. Gonadal ecdysteroidogenesis in arthropoda: occurrence and regulation.

    Science.gov (United States)

    Brown, Mark R; Sieglaff, Douglas H; Rees, Huw H

    2009-01-01

    Ecdysteroids are multifunctional hormones in male and female arthropods and are stored in oocytes for use during embryogenesis. Ecdysteroid biosynthesis and its hormonal regulation are demonstrated for insect gonads, but not for the gonads of other arthropods. The Y-organ in the cephalothorax of crustaceans and the integument of ticks are sources of secreted ecdysteroids in adults, as in earlier stages, but the tissue source is not known for adults in many arthropod groups. Ecdysteroid metabolism occurs in several tissues of adult arthropods. This review summarizes the evidence for ecdysteroid biosynthesis by gonads and its metabolism in adult arthropods and considers the apparent uniqueness of ecdysteroid hormones in arthropods, given the predominance of vertebrate-type steroids in sister invertebrate groups and vertebrates.

  8. Members of opposite sex mutually regulate gonadal recrudescence ...

    Indian Academy of Sciences (India)

    Unknown

    site sex mutually regulate gonadal recrudescence in the C. versicolor. [Shanbhag B A, Radder R S and Saidapur S K 2002 Members of opposite sex mutually regulate gonadal recrudescence in the lizard Ca- lotes versicolor (Agamidae); J. Biosci. 27 529–537]. 1. Introduction. Reproduction in vertebrates involves successful ...

  9. Characterization of gonadal transcriptomes from Nile tilapia (Oreochromis niloticus reveals differentially expressed genes.

    Directory of Open Access Journals (Sweden)

    Wenjing Tao

    Full Text Available Four pairs of XX and XY gonads from Nile tilapia were sequenced at four developmental stages, 5, 30, 90, and 180 days after hatching (dah using Illumina Hiseq(TM technology. This produced 28 Gb sequences, which were mapped to 21,334 genes. Of these, 259 genes were found to be specifically expressed in XY gonads, and 69 were found to be specific to XX gonads. Totally, 187 XX- and 1,358 XY-enhanced genes were identified, and 2,978 genes were found to be co-expressed in XX and XY gonads. Almost all steroidogenic enzymes, including cyp19a1a, were up-regulated in XX gonads at 5 dah; but in XY gonads these enzymes, including cyp11b2, were significantly up-regulated at 90 dah, indicating that, at a time critical to sex determination, the XX fish produced estrogen and the XY fish did not produce androgens. The most pronounced expression of steroidogenic enzyme genes was observed at 30 and 90 dah for XX and XY gonads, corresponding to the initiation of germ cell meiosis in the female and male gonads, respectively. Both estrogen and androgen receptors were found to be expressed in XX gonads, but only estrogen receptors were expressed in XY gonads at 5 dah. This could explain why exogenous steroid treatment induced XX and XY sex reversal. The XX-enhanced expression of cyp19a1a and cyp19a1b at all stages suggests an important role for estrogen in female sex determination and maintenance of phenotypic sex. This work is the largest collection of gonadal transcriptome data in tilapia and lays the foundation for future studies into the molecular mechanisms of sex determination and maintenance of phenotypic sex in non-model teleosts.

  10. Analysis of meiosis regulators in human gonads

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Jensen, Martin Blomberg

    2012-01-01

    and to investigate a possible role of DMRT1 in the regulation of meiotic entry. The expression pattern of DMRT1, STRA8, SCP3, DMC1, NANOS3, CYP26B1 and NANOS2 was investigated by RT-PCR and immunohistochemistry in a series of human testis samples from fetal life to adulthood, and in fetal ovaries. DMRT1...... was expressed in testes throughout development but with marked spatio-temporal changes. At the early fetal period of 8-20 gestational weeks (GW) and at infantile mini-puberty, DMRT1 was predominantly expressed in Sertoli cells, whereas at later stages of gestation (22-40 GW), during childhood and in post......The mitosis-meiosis switch is a key event in the differentiation of germ cells. In humans, meiosis is initiated in fetal ovaries, whereas in testes meiotic entry is inhibited until puberty. The purpose of this study was to examine the expression pattern of meiosis regulators in human gonads...

  11. Transcriptome Analysis of Red Swamp Crawfish Procambarus clarkii Reveals Genes Involved in Gonadal Development

    Science.gov (United States)

    Jiang, Hucheng; Xing, Zhijun; Lu, Wei; Qian, Zhaojun; Yu, Hongwei; Li, Jiale

    2014-01-01

    Background The red swamp crawfish, Procambarus clarkii, has become one of the most economically important cultured species in China. Currently, little is known about the gonadal development of this species. Isolation and characterization of genes are an initial step towards understanding gonadal development of P. clarkii. Results Using the 454 pyrosequencing technology, we obtained a total of 1,134,993 high quality sequence reads from the crawfish testis and ovary libraries. We aimed to identify different genes with a potential role in gonad development. The assembly formed into 22,652 isotigs, distributed by GO analysis across 55 categories in the three ontologies, ‘molecular function’, ‘cellular component’, and ‘biological processes’. Comparative transcript analysis showed that 1,720 isotigs in the ovary were up-regulated and 2138 isotigs were down-regulated. Several gonad development related genes, such as vitellogenin, cyclin B, cyclin-dependent kinases 2, Dmc1 and ubiquitin were identified. Quantitative real-time PCR verified the expression profiles of 14 differentially expressed genes, and confirmed the reliability of the 454 pyrosequencing. Conclusions Our findings provide an archive for future research on gonadal development at a molecular level in P. clarkii and other crustacean. This data will be helpful to develop new ideas for artificial regulation of the reproductive process in crawfish aquaculture. PMID:25118947

  12. Expression profiles for six zebrafish genes during gonadal sex differentiation

    Directory of Open Access Journals (Sweden)

    Rasmussen Lene J

    2008-06-01

    Full Text Available Abstract Background The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. Results In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a and high in females (fig alpha and cyp19a1a was segregated in two groups with more than 10 times difference in expression levels. All of the investigated genes showed peaks in expression levels during the time of sex determination and gonadal sex differentiation. Expression of all genes was investigated on cDNA from the same fish allowing comparison of the high and low expressers of genes that are expected to be highest expressed in either males or females. There were 78% high or low expressers of all three "male" genes (ar, sox9a and dmrt1 in the investigated period and 81% were high or low expressers of both "female" genes (fig alpha and cyp19a1a. When comparing all five genes with expected sex related expression 56% show expression expected for either male or female. Furthermore, the expression of all genes was investigated in different tissue of adult male and female zebrafish. Conclusion In zebrafish, the first significant peak in gene expression during the investigated period (2–40 dph was dmrt1 at 10 dph which indicates involvement of this gene

  13. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane E.; Andersen, Ole

    2008-01-01

    the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS......BACKGROUND: The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine......: In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a) and high...

  14. Transcriptomic analyses reveal novel genes with sexually dimorphic expression in the zebrafish gonad and brain.

    Directory of Open Access Journals (Sweden)

    Rajini Sreenivasan

    Full Text Available BACKGROUND: Our knowledge on zebrafish reproduction is very limited. We generated a gonad-derived cDNA microarray from zebrafish and used it to analyze large-scale gene expression profiles in adult gonads and other organs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified 116638 gonad-derived zebrafish expressed sequence tags (ESTs, 21% of which were isolated in our lab. Following in silico normalization, we constructed a gonad-derived microarray comprising 6370 unique, full-length cDNAs from differentiating and adult gonads. Labeled targets from adult gonad, brain, kidney and 'rest-of-body' from both sexes were hybridized onto the microarray. Our analyses revealed 1366, 881 and 656 differentially expressed transcripts (34.7% novel that showed highest expression in ovary, testis and both gonads respectively. Hierarchical clustering showed correlation of the two gonadal transcriptomes and their similarities to those of the brains. In addition, we have identified 276 genes showing sexually dimorphic expression both between the brains and between the gonads. By in situ hybridization, we showed that the gonadal transcripts with the strongest array signal intensities were germline-expressed. We found that five members of the GTP-binding septin gene family, from which only one member (septin 4 has previously been implicated in reproduction in mice, were all strongly expressed in the gonads. CONCLUSIONS/SIGNIFICANCE: We have generated a gonad-derived zebrafish cDNA microarray and demonstrated its usefulness in identifying genes with sexually dimorphic co-expression in both the gonads and the brains. We have also provided the first evidence of large-scale differential gene expression between female and male brains of a teleost. Our microarray would be useful for studying gonad development, differentiation and function not only in zebrafish but also in related teleosts via cross-species hybridizations. Since several genes have been shown to play similar

  15. The Drosophila actin regulator ENABLED regulates cell shape and orientation during gonad morphogenesis.

    Directory of Open Access Journals (Sweden)

    Hiroko Sano

    Full Text Available Organs develop distinctive morphologies to fulfill their unique functions. We used Drosophila embryonic gonads as a model to study how two different cell lineages, primordial germ cells (PGCs and somatic gonadal precursors (SGPs, combine to form one organ. We developed a membrane GFP marker to image SGP behaviors live. These studies show that a combination of SGP cell shape changes and inward movement of anterior and posterior SGPs leads to the compaction of the spherical gonad. This process is disrupted in mutants of the actin regulator, enabled (ena. We show that Ena coordinates these cell shape changes and the inward movement of the SGPs, and Ena affects the intracellular localization of DE-cadherin (DE-cad. Mathematical simulation based on these observations suggests that changes in DE-cad localization can generate the forces needed to compact an elongated structure into a sphere. We propose that Ena regulates force balance in the SGPs by sequestering DE-cad, leading to the morphogenetic movement required for gonad compaction.

  16. Proteomic analysis of three gonad types of swamp eel reveals genes differentially expressed during sex reversal.

    Science.gov (United States)

    Sheng, Yue; Zhao, Wei; Song, Ying; Li, Zhigang; Luo, Majing; Lei, Quan; Cheng, Hanhua; Zhou, Rongjia

    2015-05-18

    A variety of mechanisms are engaged in sex determination in vertebrates. The teleost fish swamp eel undergoes sex reversal naturally and is an ideal model for vertebrate sexual development. However, the importance of proteome-wide scanning for gonad reversal was not previously determined. We report a 2-D electrophoresis analysis of three gonad types of proteomes during sex reversal. MS/MS analysis revealed a group of differentially expressed proteins during ovary to ovotestis to testis transformation. Cbx3 is up-regulated during gonad reversal and is likely to have a role in spermatogenesis. Rab37 is down-regulated during the reversal and is mainly associated with oogenesis. Both Cbx3 and Rab37 are linked up in a protein network. These datasets in gonadal proteomes provide a new resource for further studies in gonadal development.

  17. RNAi-Mediated Gene Silencing in a Gonad Organ Culture to Study Sex Determination Mechanisms in Sea Turtle

    Science.gov (United States)

    Sifuentes-Romero, Itzel; Merchant-Larios, Horacio; Milton, Sarah L.; Moreno-Mendoza, Norma; Díaz-Hernández, Verónica; García-Gasca, Alejandra

    2013-01-01

    The autosomal Sry-related gene, Sox9, encodes a transcription factor, which performs an important role in testis differentiation in mammals. In several reptiles, Sox9 is differentially expressed in gonads, showing a significant upregulation during the thermo-sensitive period (TSP) at the male-promoting temperature, consistent with the idea that SOX9 plays a central role in the male pathway. However, in spite of numerous studies, it remains unclear how SOX9 functions during this event. In the present work, we developed an RNAi-based method for silencing Sox9 in an in vitro gonad culture system for the sea turtle, Lepidochelys olivacea. Gonads were dissected as soon as the embryos entered the TSP and were maintained in organ culture. Transfection of siRNA resulted in the decrease of both Sox9 mRNA and protein. Furthermore, we found coordinated expression patterns for Sox9 and the anti-Müllerian hormone gene, Amh, suggesting that SOX9 could directly or indirectly regulate Amh expression, as it occurs in mammals. These results demonstrate an in vitro method to knockdown endogenous genes in gonads from a sea turtle, which represents a novel approach to investigate the roles of important genes involved in sex determination or differentiation pathways in species with temperature-dependent sex determination. PMID:24705165

  18. RNAi-Mediated Gene Silencing in a Gonad Organ Culture to Study Sex Determination Mechanisms in Sea Turtle.

    Science.gov (United States)

    Sifuentes-Romero, Itzel; Merchant-Larios, Horacio; Milton, Sarah L; Moreno-Mendoza, Norma; Díaz-Hernández, Verónica; García-Gasca, Alejandra

    2013-06-07

    The autosomal Sry-related gene, Sox9, encodes a transcription factor, which performs an important role in testis differentiation in mammals. In several reptiles, Sox9 is differentially expressed in gonads, showing a significant upregulation during the thermo-sensitive period (TSP) at the male-promoting temperature, consistent with the idea that SOX9 plays a central role in the male pathway. However, in spite of numerous studies, it remains unclear how SOX9 functions during this event. In the present work, we developed an RNAi-based method for silencing Sox9 in an in vitro gonad culture system for the sea turtle, Lepidochelys olivacea. Gonads were dissected as soon as the embryos entered the TSP and were maintained in organ culture. Transfection of siRNA resulted in the decrease of both Sox9 mRNA and protein. Furthermore, we found coordinated expression patterns for Sox9 and the anti-Müllerian hormone gene, Amh, suggesting that SOX9 could directly or indirectly regulate Amh expression, as it occurs in mammals. These results demonstrate an in vitro method to knockdown endogenous genes in gonads from a sea turtle, which represents a novel approach to investigate the roles of important genes involved in sex determination or differentiation pathways in species with temperature-dependent sex determination.

  19. RNAi-Mediated Gene Silencing in a Gonad Organ Culture to Study Sex Determination Mechanisms in Sea Turtle

    Directory of Open Access Journals (Sweden)

    Alejandra García-Gasca

    2013-06-01

    Full Text Available The autosomal Sry-related gene, Sox9, encodes a transcription factor, which performs an important role in testis differentiation in mammals. In several reptiles, Sox9 is differentially expressed in gonads, showing a significant upregulation during the thermo-sensitive period (TSP at the male-promoting temperature, consistent with the idea that SOX9 plays a central role in the male pathway. However, in spite of numerous studies, it remains unclear how SOX9 functions during this event. In the present work, we developed an RNAi-based method for silencing Sox9 in an in vitro gonad culture system for the sea turtle, Lepidochelys olivacea. Gonads were dissected as soon as the embryos entered the TSP and were maintained in organ culture. Transfection of siRNA resulted in the decrease of both Sox9 mRNA and protein. Furthermore, we found coordinated expression patterns for Sox9 and the anti-Müllerian hormone gene, Amh, suggesting that SOX9 could directly or indirectly regulate Amh expression, as it occurs in mammals. These results demonstrate an in vitro method to knockdown endogenous genes in gonads from a sea turtle, which represents a novel approach to investigate the roles of important genes involved in sex determination or differentiation pathways in species with temperature-dependent sex determination.

  20. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo.

    Directory of Open Access Journals (Sweden)

    Gwenn-Aël Carré

    Full Text Available BACKGROUND: In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s involved in gonad differentiation is still incomplete. METHODOLOGY/PRINCIPAL FINDINGS: With the aim of improving characterization of the molecular pathway(s involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. CONCLUSION/SIGNIFICANCE: This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors

  1. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    Science.gov (United States)

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  2. AMPK : a master energy regulator for gonadal functions.

    Directory of Open Access Journals (Sweden)

    Michael eBertoldo

    2015-07-01

    Full Text Available From c.elegans to mammals (including humans, nutrition and energy metabolism strongly influence reproduction. At the cellular level, some detectors of energy status indicate whether energy reserves are abundant (obesity, or poor (diet restriction. One of these detectors is AMPK (5 'AMP-activated protein kinase, a protein kinase activated by ATP deficiency but also by several natural substances such as polyphenols or synthetic molecules like metformin, used in the treatment of insulin resistance. AMPK is expressed in muscle and liver, but also in the ovary and testis. This review focuses on the main effects of AMPK identified in gonadal cells. We describe the role of AMPK in gonadal steroidogenesis, in proliferation and survival of somatic gonadal cells and in the maturation of oocytes or spermatozoa. We discuss also the role of AMPK in germ and somatic cell interactions within the cumulus-oocyte complex and in the blood testis barrier. Finally, the interface in the gonad between AMPK and modification of metabolism is reported and discussion about the role of AMPK on fertility, in regards to the treatment of infertility associated with insulin resistance (male obesity, polycystic ovary syndrome.

  3. Identification of Candidate Genes and Physiological Pathways Involved in Gonad Deformation in Whitefish (Coregonus spp. from Lake Thun, Switzerland

    Directory of Open Access Journals (Sweden)

    David Bittner

    2011-06-01

    Full Text Available In 2000, fishermen reported the appearance of deformed reproductive organs in whitefish (Coregonus spp. from Lake Thun, Switzerland. Despite intensive investigations, the causes of these abnormalities remain unknown. Using gene expression profiling, we sought to identify candidate genes and physiological processes possibly associated with the observed gonadal deformations, in order to gain insights into potential causes. Using in situ-synthesized oligonucleotide arrays, we compared the expression levels at 21,492 unique transcript probes in liver and head kidney tissue of male whitefish with deformed and normally developed gonads, respectively. The fish had been collected on spawning sites of two genetically distinct whitefish forms of Lake Thun. We contrasted the gene expression profiles of 56 individuals, i.e., 14 individuals of each phenotype and of each population. Gene-by-gene analysis revealed weak expression differences between normal and deformed fish, and only one gene, ictacalcin, was found to be up-regulated in head kidney tissue of deformed fish from both whitefish forms, However, this difference could not be confirmed with quantitative real-time qPCR. Enrichment analysis on the level of physiological processes revealed (i the involvement of immune response genes in both tissues, particularly those linked to complement activation in the liver, (ii proteolysis in the liver and (iii GTPase activity and Ras protein signal transduction in the head kidney. In comparison with current literature, this gene expression pattern signals a chronic autoimmune disease in the testes. Based on the recent observations that gonad deformations are induced through feeding of zooplankton from Lake Thun we hypothesize that a xenobiotic accumulated in whitefish via the plankton triggering autoimmunity as the likely cause of gonad deformations. We propose several experimental strategies to verify or reject this hypothesis.

  4. Gene Expression Profiling Reveals Potential Players of Left-Right Asymmetry in Female Chicken Gonads.

    Science.gov (United States)

    Wan, Zhiyi; Lu, Yanan; Rui, Lei; Yu, Xiaoxue; Yang, Fang; Tu, Chengfang; Li, Zandong

    2017-06-20

    Most female birds develop only a left ovary, whereas males develop bilateral testes. The mechanism underlying this process is still not completely understood. Here, we provide a comprehensive transcriptional analysis of female chicken gonads and identify novel candidate side-biased genes. RNA-Seq analysis was carried out on total RNA harvested from the left and right gonads on embryonic day 6 (E6), E12, and post-hatching day 1 (D1). By comparing the gene expression profiles between the left and right gonads, 347 differentially expressed genes (DEGs) were obtained on E6, 3730 were obtained on E12, and 2787 were obtained on D1. Side-specific genes were primarily derived from the autosome rather than the sex chromosome. Gene ontology and pathway analysis showed that the DEGs were most enriched in the Piwi-interactiing RNA (piRNA) metabolic process, germ plasm, chromatoid body, P granule, neuroactive ligand-receptor interaction, microbial metabolism in diverse environments, and methane metabolism. A total of 111 DEGs, five gene ontology (GO) terms, and three pathways were significantly different between the left and right gonads among all the development stages. We also present the gene number and the percentage within eight development-dependent expression patterns of DEGs in the left and right gonads of female chicken.

  5. Temperature regulates SOX9 expression in cultured gonads of Lepidochelys olivacea, a species with temperature sex determination.

    Science.gov (United States)

    Moreno-Mendoza, N; Harley, V R; Merchant-Larios, H

    2001-01-15

    Although sex determination starts in the gonads, this may not be the case for species with temperature sex determination (TSD). Since temperature affects the whole embryo, extragonadal thermosensitive cells may produce factors that induce gonadal sex determination as a secondary event. To establish if gonads of a species with TSD respond directly to temperature, pairs of gonads were cultured, one at female-promoting temperature (FPT) and the contralateral at male-promoting temperature (MPT). Histological and immunohistochemical detection of SOX9 revealed that the response to temperature of isolated gonads was similar to that of the gonads of whole embryos. While gonads cultured at MPT maintained SOX9 expression, it was downregulated in gonads at FPT. Downregulation of SOX9 took longer in gonads cultured at stage 23 than in gonads cultured at stage 24, suggesting that a developmental clock was already established at the onset of culture. To find out if sex commitment occurs in vitro, gonads were switched from FPT to MPT at different days. Results showed that the ovarian pathway was established after 4 days of culture. The present demonstration that gonads have an autonomous temperature detector that regulates SOX9 expression provides a useful starting point from which the molecular pathways underlying TSD can be elucidated. Copyright 2001 Academic Press.

  6. Sex Reversal and Comparative Data Undermine the W Chromosome and Support Z-linked DMRT1 as the Regulator of Gonadal Sex Differentiation in Birds.

    Science.gov (United States)

    Hirst, Claire E; Major, Andrew T; Ayers, Katie L; Brown, Rosie J; Mariette, Mylene; Sackton, Timothy B; Smith, Craig A

    2017-09-01

    The exact genetic mechanism regulating avian gonadal sex differentiation has not been completely resolved. The most likely scenario involves a dosage mechanism, whereby the Z-linked DMRT1 gene triggers testis development. However, the possibility still exists that the female-specific W chromosome may harbor an ovarian determining factor. In this study, we provide evidence that the universal gene regulating gonadal sex differentiation in birds is Z-linked DMRT1 and not a W-linked (ovarian) factor. Three candidate W-linked ovarian determinants are HINTW, female-expressed transcript 1 (FET1), and female-associated factor (FAF). To test the association of these genes with ovarian differentiation in the chicken, we examined their expression following experimentally induced female-to-male sex reversal using the aromatase inhibitor fadrozole (FAD). Administration of FAD on day 3 of embryogenesis induced a significant loss of aromatase enzyme activity in female gonads and masculinization. However, expression levels of HINTW, FAF, and FET1 were unaltered after experimental masculinization. Furthermore, comparative analysis showed that FAF and FET1 expression could not be detected in zebra finch gonads. Additionally, an antibody raised against the predicted HINTW protein failed to detect it endogenously. These data do not support a universal role for these genes or for the W sex chromosome in ovarian development in birds. We found that DMRT1 (but not the recently identified Z-linked HEMGN gene) is male upregulated in embryonic zebra finch and emu gonads, as in the chicken. As chicken, zebra finch, and emu exemplify the major evolutionary clades of birds, we propose that Z-linked DMRT1, and not the W sex chromosome, regulates gonadal sex differentiation in birds. Copyright © 2017 Endocrine Society.

  7. Gene expression analysis in gonads and brain of catfish Clarias batrachus after the exposure of malathion.

    Science.gov (United States)

    Prathibha, Y; Murugananthkumar, R; Rajakumar, A; Laldinsangi, C; Sudhakumari, C C; Mamta, S K; Dutta-Gupta, A; Senthilkumaran, B

    2014-04-01

    Pesticides like malathion have the potential to disrupt development and reproduction of aquatic organisms including fishes. To investigate the likely consequences of malathion exposure at low doses in juvenile catfish, Clarias batrachus, we studied the expression pattern of genes encoding certain transcription factors, activin A, sex steroid or orphan nuclear receptors and steroidogenic enzymes which are known to be involved in gonadal development along with histological changes. To compare further, we also analyzed certain brain specific genes related to gonadal axis. Fifty days post hatch catfish fingerlings were exposed continuously to 1 and 10 µg/L of malathion for 21 days. Results from these experiments indicated that transcript levels of various genes were altered by the treatments, which may further affect the gonadal development either directly or indirectly through brain. Histological analysis revealed slow progression of spermatogenesis in testis, while in ovary, the oil droplet oocytes were found to be higher after treatment (10 µg/L). Our findings revealed that the exposure of malathion, even at low doses, hinder or modulate early gonadal development differentially by targeting gene expression pattern of transcription factors, activin A, sex steroid or orphan nuclear receptors and steroidogenic enzymes with an evidence on histological changes. Further, some of the genes showed differential expression at the level of brain in male and female sex after the exposure of malathion. Copyright © 2014. Published by Elsevier Inc.

  8. SOX4 regulates gonad morphogenesis and promotes male germ cell differentiation in mice.

    Science.gov (United States)

    Zhao, Liang; Arsenault, Michel; Ng, Ee Ting; Longmuss, Enya; Chau, Tevin Chui-Ying; Hartwig, Sunny; Koopman, Peter

    2017-03-01

    The group C SOX transcription factors SOX4, -11 and -12 play important and mutually overlapping roles in development of a number of organs. Here, we examined the role of SoxC genes during gonadal development in mice. All three genes were expressed in developing gonads of both sexes, predominantly in somatic cells, with Sox4 being most strongly expressed. Sox4 deficiency resulted in elongation of both ovaries and testes, and an increased number of testis cords. While female germ cells entered meiosis normally, male germ cells showed reduced levels of differentiation markers Nanos2 and Dnmt3l and increased levels of pluripotency genes Cripto and Nanog, suggesting that SOX4 may normally act to restrict the pluripotency period of male germ cells and ensure their proper differentiation. Finally, our data reveal that SOX4 (and, to a lesser extent, SOX11 and -12) repressed transcription of the sex-determining gene Sox9 via an upstream testis-specific enhancer core (TESCO) element in fetal gonads, raising the possibility that SOXC proteins may function as transcriptional repressors in a context-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane Ebsen; Andersen, Ole

    2008-01-01

    BACKGROUND: The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine...

  10. Effects of tamoxifen on the sex determination gene and the activation of sex reversal in the developing gonad of mice.

    Science.gov (United States)

    Yu, Mingxi; Wang, Jingyun; Liu, Wei; Qin, Junwen; Zhou, Quan; Wang, Yongan; Huang, Huihui; Chen, Wenli; Ma, Chao

    2014-07-03

    Tamoxifen, as well as most endocrine-disrupting chemicals, affects the reproductive system and sexual development, but little is known about its disruption of the molecular pathways regulating mammalian sex determination. In fetal mice, the expression levels and pattern of key genes involved in controlling sexually dimorphic balance were analyzed both in vivo and in vitro by using whole-mount in situ hybridization and quantitative-PCR. Developmental tamoxifen exposure induced abnormal up-regulation of the testis differentiation marker Pdfgra in Leydig cells and of Sox9 and Fgf9 in Sertoli cells in XX gonad. Immunohistochemistry analysis confirmed the over-expression of SOX9 protein. Accordingly, the ovary development marker Foxl2 was depressed at both the mRNA and protein levels. The increase in testosterone and the reduction in 17β-estradiol and progesterone were observed by using the in vitro assay with organotypic cultures. Taken together, results indicated that tamoxifen induced the ectopic expression of well-established sex-specific genes during the critical developmental period, thus resulting in abnormal testicular development in the XX gonad of mammals. This study facilitates a better understanding of the molecular mechanisms of antiestrogens and possibly of compounds that interrupt estrogen signaling by other modes of action, and the association with the pathogenesis of human sexual developmental disorders. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Expression of isotocin is male-specifically up-regulated by gonadal androgen in the medaka brain.

    Science.gov (United States)

    Yamashita, J; Kawabata, Y; Okubo, K

    2017-12-01

    Oxytocin, a mammalian neuropeptide primarily synthesised in the supraoptic and paraventricular nuclei of the hypothalamus, mediates a variety of physiological and behavioural processes, ranging from parturition and lactation to affiliation and prosociality. Multiple studies in rodents have shown that the expression of the oxytocin gene (Oxt) is stimulated by oestrogen, whereas androgen has no apparent effect. However, this finding is not consistent across all studies, and no study has examined sex steroid regulation of Oxt or its orthologues in other animals. In the present study, we show that, in the teleost fish, medaka (Oryzias latipes), the expression of the isotocin gene (it), the teleost orthologue of Oxt, in the parvocellular preoptic nuclei (homologous to the mammalian supraoptic nucleus) is male-specifically up-regulated by gonadal androgen, whereas it expression in the magnocellular/gigantocellular preoptic nuclei (homologous to the mammalian paraventricular nucleus) is independent of sex steroids in both sexes. None of the it-expressing neurones appear to co-express androgen receptors, suggesting that the effect of androgen on it expression is indirect. We found that the expression of a kisspeptin gene, kiss2, in the male brain is dependent on gonadal androgen, raising the possibility that the androgen-dependent expression of it may be mediated by kiss2 neurones. Our data also show that the isotocin peptide synthesised in response to androgen is axonally transported to the posterior pituitary to act peripherally. Given that levels of it expression are higher in females than in males, androgen may serve to compensate for the female-biased it expression to ensure a role for isotocin that is equally important for both sexes. These results are unexpectedly quite different from those reported in rodents, indicating that the regulatory role of sex steroids in Oxt/it expression has diverged during evolution, possibly with accompanying changes in the role of

  12. Sex differences in murine myocardium are not exclusively regulated by gonadal hormones.

    Science.gov (United States)

    Theuring, Franz; Neumann, Boris; Scheler, Christian; Jungblut, Peter R; Schwab, Karima

    2017-12-19

    We investigated sex differences in cardiac protein patterns of intact and castrated mice using proteomics and 1D and 2D immunoblotting. To exclude differences concerning developmental aspects gonadectomy was conducted in mature mice at the age of three months. The main sex-related regulation in the protein pattern of the myocardium occurred for proteins involved in metabolic processes whereas only few proteins involved in other pathways underwent a regulation. Many regulated proteins (2/3) displayed a characteristic V form, which means that these proteins are up- or down-regulated in sexually mature compared to young mice and are back-regulated after castration, emphasizing a direct regulation by gonadal hormones. Several other spots (1/3) showed the same male/female regulation or a drastic increase in male/female spot intensity ratio after castration, suggesting either a regulation independent of sex hormones or a removal of an inhibiting feedback mechanism by gonadectomy. Technically, we found that it cannot be expected that a single spot contains only one protein species and that one protein is present in only one spot. We thus propose for proteomic investigations to identify/quantify all spots of a 2-DE pattern to obtain information about protein speciation and its potential importance for function and pathology. Sex related differences in cardiovascular disease, including risk factors, disease manifestation and outcomes, are far from being well understood, and improved biological understanding of these differences in the healthy myocardium is of great importance. We investigated sex related changes of myocardial protein pattern in intact and castrated mice at different ages and found metabolic proteins to be highly regulated, some of which independently from gonadal hormones. Copyright © 2017. Published by Elsevier B.V.

  13. Defining global gene expression changes of the hypothalamic-pituitary-gonadal axis in female sGnRH-antisense transgenic common carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Jing Xu

    Full Text Available BACKGROUND: The hypothalamic-pituitary-gonadal (HPG axis is critical in the development and regulation of reproduction in fish. The inhibition of neuropeptide gonadotropin-releasing hormone (GnRH expression may diminish or severely hamper gonadal development due to it being the key regulator of the axis, and then provide a model for the comprehensive study of the expression patterns of genes with respect to the fish reproductive system. METHODOLOGY/PRINCIPAL FINDINGS: In a previous study we injected 342 fertilized eggs from the common carp (Cyprinus carpio with a gene construct that expressed antisense sGnRH. Four years later, we found a total of 38 transgenic fish with abnormal or missing gonads. From this group we selected the 12 sterile females with abnormal ovaries in which we combined suppression subtractive hybridization (SSH and cDNA microarray analysis to define changes in gene expression of the HPG axis in the present study. As a result, nine, 28, and 212 genes were separately identified as being differentially expressed in hypothalamus, pituitary, and ovary, of which 87 genes were novel. The number of down- and up-regulated genes was five and four (hypothalamus, 16 and 12 (pituitary, 119 and 93 (ovary, respectively. Functional analyses showed that these genes involved in several biological processes, such as biosynthesis, organogenesis, metabolism pathways, immune systems, transport links, and apoptosis. Within these categories, significant genes for neuropeptides, gonadotropins, metabolic, oogenesis and inflammatory factors were identified. CONCLUSIONS/SIGNIFICANCE: This study indicated the progressive scaling-up effect of hypothalamic sGnRH antisense on the pituitary and ovary receptors of female carp and provided comprehensive data with respect to global changes in gene expression throughout the HPG signaling pathway, contributing towards improving our understanding of the molecular mechanisms and regulative pathways in the

  14. Gonadal mosaicism in ARID1B gene causes intellectual disability and dysmorphic features in three siblings.

    Science.gov (United States)

    Ben-Salem, Salma; Sobreira, Nara; Akawi, Nadia A; Al-Shamsi, Aisha M; John, Anne; Pramathan, Thachillath; Valle, David; Ali, Bassam R; Al-Gazali, Lihadh

    2016-01-01

    The gene encoding the AT-rich interaction domain-containing protein 1B (ARID1B) has recently been shown to be one of the most frequently mutated genes in patients with intellectual disability (ID). The phenotypic spectrums associated with variants in this gene vary widely ranging for mild to severe non-specific ID to Coffin-Siris syndrome. In this study, we evaluated three children from a consanguineous Emirati family affected with ID and dysmorphic features. Genomic DNA from all affected siblings was analyzed using CGH array and whole-exome sequencing (WES). Based on a recessive mode of inheritance, homozygous or compound heterozygous variants shared among all three affected children could not be identified. However, further analysis revealed a heterozygous variant (c.4318C>T; p.Q1440*) in the three affected children in an autosomal dominant ID causing gene, ARID1B. This variant was absent in peripheral blood samples obtained from both parents and unaffected siblings. Therefore, we propose that the most likely explanation for this situation is that one of the parents is a gonadal mosaic for the variant. To the best of our knowledge, this is the first report of a gonadal mosaicism inheritance of an ARID1B variant leading to familial ID recurrence. © 2015 Wiley Periodicals, Inc.

  15. Gonadal Transcriptome Analysis of Pacific Abalone Haliotis discus discus: Identification of Genes Involved in Germ Cell Development.

    Science.gov (United States)

    Yu, Lingyun; Xu, Dongdong; Ye, Huan; Yue, Huamei; Ooka, Shioh; Kondo, Hidehiro; Yazawa, Ryosuke; Takeuchi, Yutaka

    2018-04-03

    Little is known about the molecular mechanisms governing gonadal developmental processes in abalones. Here, we conducted transcriptome analysis of Pacific abalone Haliotis discus discus for gene discovery in the brain, ovary, testis, and unfertilized eggs. Among the annotated unigenes, 48.6% of unigenes were identified by Venn diagram analysis as having universal or tissue-specific expression. Twenty-three genes with gonad-biased gene ontology (GO) terms were first obtained. Secondly, 36 genes were found by screening known gene names related to germ cell development. Finally, 17 genes were obtained by querying the annotated unigene database for zygotically expressed gonadal genes (ovary and testis) and maternally expressed gonadal genes (ovary, testis, and unfertilized eggs) using keywords related to reproduction. To further verify tissue distribution pattern and subcellular localization of these genes, RT-PCR and in situ hybridization were performed using a unigene encoding a germ cell marker, vasa, as control. The results showed that vasa was expressed mainly in the early developmental stages of germ cells in both sexes. One of the candidate genes, vitelline envelope zona pellucida domain protein 12 (ZP12), was expressed in the primordial germ cells of immature gonad and early developmental stages of germ cells of the adult female. The results obtained from the present study suggest that vasa and ZP12 are involved in germ cell development of Pacific abalone and that ZP12 is an especially useful germ cell-specific marker in immature adults. The current gonadal transcriptome profile is an extensive resource for future reproductive molecular biology studies of this species.

  16. Hypothalamic-pituitary-adrenal and hypothalamic-pituitary-gonadal axes: sex differences in regulation of stress responsivity.

    Science.gov (United States)

    Oyola, Mario G; Handa, Robert J

    2017-09-01

    Gonadal hormones play a key role in the establishment, activation, and regulation of the hypothalamic-pituitary-adrenal (HPA) axis. By influencing the response and sensitivity to releasing factors, neurotransmitters, and hormones, gonadal steroids help orchestrate the gain of the HPA axis to fine-tune the levels of stress hormones in the general circulation. From early life to adulthood, gonadal steroids can differentially affect the HPA axis, resulting in sex differences in the responsivity of this axis. The HPA axis influences many physiological functions making an organism's response to changes in the environment appropriate for its reproductive status. Although the acute HPA response to stressors is a beneficial response, constant activation of this circuitry by chronic or traumatic stressful episodes may lead to a dysregulation of the HPA axis and cause pathology. Compared to males, female mice and rats show a more robust HPA axis response, as a result of circulating estradiol levels which elevate stress hormone levels during non-threatening situations, and during and after stressors. Fluctuating levels of gonadal steroids in females across the estrous cycle are a major factor contributing to sex differences in the robustness of HPA activity in females compared to males. Moreover, gonadal steroids may also contribute to epigenetic and organizational influences on the HPA axis even before puberty. Correspondingly, crosstalk between the hypothalamic-pituitary-gonadal (HPG) and HPA axes could lead to abnormalities of stress responses. In humans, a dysregulated stress response is one of the most common symptoms seen across many neuropsychiatric disorders, and as a result, such interactions may exacerbate peripheral pathologies. In this review, we discuss the HPA and HPG axes and review how gonadal steroids interact with the HPA axis to regulate the stress circuitry during all stages in life.

  17. Exogenous estradiol alters gonadal growth and timing of temperature sex determination in gonads of sea turtle.

    Science.gov (United States)

    Díaz-Hernández, Verónica; Marmolejo-Valencia, Alejandro; Merchant-Larios, Horacio

    2015-12-01

    Temperature sex determining species offer a model for investigating how environmental cues become integrated to the regulation of patterning genes and growth, among bipotential gonads. Manipulation of steroid hormones has revealed the important role of aromatase in the regulation of the estrogen levels involved in temperature-dependent sex determination. Estradiol treatment counteracts the effect of male-promoting temperature, but the resulting ovarian developmental pattern differs from that manifested with the female-promoting temperature. Hypoplastic gonads have been reported among estradiol-treated turtles; however the estradiol effect on gonadal size has not been examined. Here we focused on the sea turtle Lepidochelys olivacea, which develops hypoplastic gonads with estradiol treatment. We studied the effect of estradiol on cell proliferation and on candidate genes involved in ovarian pattern. We found this effect is organ specific, causing a dramatic reduction in gonadal cell proliferation during the temperature-sensitive period. Although the incipient gonads resembled tiny ovaries, remodeling of the medullary cords and down-regulation of testicular factor Sox9 were considerably delayed. Contrastingly, with ovarian promoting temperature as a cue, exogenous estradiol induced the up-regulation of the ovary factor FoxL2, prior to the expression of aromatase. The strong expression of estrogen receptor alpha at the time of treatment suggests that it mediates estradiol effects. Overall results indicate that estradiol levels required for gonadal growth and to establish the female genetic network are delicately regulated by temperature. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Live imaging of Drosophila gonad formation reveals roles for Six4 in regulating germline and somatic cell migration

    Directory of Open Access Journals (Sweden)

    Jarman Andrew P

    2007-05-01

    Full Text Available Abstract Background Movement of cells, either as amoeboid individuals or in organised groups, is a key feature of organ formation. Both modes of migration occur during Drosophila embryonic gonad development, which therefore provides a paradigm for understanding the contribution of these processes to organ morphogenesis. Gonads of Drosophila are formed from three distinct cell types: primordial germ cells (PGCs, somatic gonadal precursors (SGPs, and in males, male-specific somatic gonadal precursors (msSGPs. These originate in distinct locations and migrate to associate in two intermingled clusters which then compact to form the spherical primitive gonads. PGC movements are well studied, but much less is known of the migratory events and other interactions undergone by their somatic partners. These appear to move in organised groups like, for example, lateral line cells in zebra fish or Drosophila ovarian border cells. Results We have used time-lapse fluorescence imaging to characterise gonadal cell behaviour in wild type and mutant embryos. We show that the homeodomain transcription factor Six4 is required for the migration of the PGCs and the msSGPs towards the SGPs. We have identified a likely cause of this in the case of PGCs as we have found that Six4 is required for expression of Hmgcr which codes for HMGCoA reductase and is necessary for attraction of PGCs by SGPs. Six4 affects msSGP migration by a different pathway as these move normally in Hmgcr mutant embryos. Additionally, embryos lacking fully functional Six4 show a novel phenotype in which the SGPs, which originate in distinct clusters, fail to coalesce to form unified gonads. Conclusion Our work establishes the Drosophila gonad as a model system for the analysis of coordinated cell migrations and morphogenesis using live imaging and demonstrates that Six4 is a key regulator of somatic cell function during gonadogenesis. Our data suggest that the initial association of SGP clusters

  19. Morphology, sex steroid level and gene expression analysis in gonadal sex reversal of triploid female (XXX) rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Xu, Gefeng; Huang, Tianqing; Jin, Xian; Cui, Cunhe; Li, Depeng; Sun, Cong; Han, Ying; Mu, Zhenbo

    2016-02-01

    In non-mammalian vertebrates, estrogens and expressions of cyp19a1 and foxl2 play critical roles in maintaining ovary differentiation and development, while dmrt1 and sox9 are male-specific genes in testicular differentiation and are highly conserved. In order to deeply understand the morphological change, sex steroids level and molecular mechanism of triploid female gonadal reversal in rainbow trout, we studied the ovary morphology, tendency of estradiol-17β (E2) and testosterone (T) levels and the relative expressions of dmrt1, cyp19a1, sox9 and foxl2 in juvenile and adult fish. Our results demonstrated that the development of triploid female gonads in rainbow trout went through arrested development, oocytes dedifferentiation, ovary reconstruction and sex reversal finally. During early gonadal development (154-334 days post-fertilization), the expressions of foxl2 and cyp19a1 increased linearly, while expressions of dmrt1 and sox9 were extremely suppressed, and E2 level was higher, while T level was lower. During the mid-to-late period of triploid female gonadal development (574-964 days post-fertilization), the expressions of dmrt1 and sox9 remained high and were very close to the quantity of diploid male genes, and T levels were even reaching diploid male plasma concentrations, while expressions of cyp19a1 and foxl2 were decreased, leading to decrease in E2 level. We realized that the development model of rainbow trout triploid female gonads was extremely rare, and the regulatory mechanism was very special. Genes involved in gonadal development and endogenous estrogens are pivotal factors in fish natural sex reversal.

  20. Gene expression profiling of the androgen receptor antagonists flutamide and vinclozolin in zebrafish (Danio rerio) gonads

    Energy Technology Data Exchange (ETDEWEB)

    Martinovic-Weigelt, Dalma, E-mail: dalma@stthomas.edu [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); University of St. Thomas, 2115 Summit Ave, Saint Paul, MN 55105 (United States); Wang Ronglin [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Villeneuve, Daniel L. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States); Bencic, David C.; Lazorchak, Jim [US Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Ecological Exposure Research Division, 26W. Martin Luther King Dr., Cincinnati, OH 45268 (United States); Ankley, Gerald T. [US Environmental Protection Agency, Office of Research and Development, National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, 6201 Congdon Blvd., Duluth, MN 55804 (United States)

    2011-01-25

    The studies presented in this manuscript focus on characterization of transcriptomic responses to anti-androgens in zebrafish (Danio rerio). Research on the effects of anti-androgens in fish has been characterized by a heavy reliance on apical endpoints, and molecular mechanisms of action (MOA) of anti-androgens remain poorly elucidated. In the present study, we examined effects of a short term exposure (24-96 h) to the androgen receptor antagonists flutamide (FLU) and vinclozolin (VZ) on gene expression in gonads of sexually mature zebrafish, using commercially available zebrafish oligonucleotide microarrays (4 x 44 K platform). We found that VZ and FLU potentially impact reproductive processes via multiple pathways related to steroidogenesis, spermatogenesis, and fertilization. Observed changes in gene expression often were shared by VZ and FLU, as demonstrated by overlap in differentially-expressed genes and enrichment of several common key pathways including: (1) integrin and actin signaling, (2) nuclear receptor 5A1 signaling, (3) fibroblast growth factor receptor signaling, (4) polyamine synthesis, and (5) androgen synthesis. This information should prove useful to elucidating specific mechanisms of reproductive effects of anti-androgens in fish, as well as developing biomarkers for this important class of endocrine-active chemicals.

  1. Temperature Shift Alters DNA Methylation and Histone Modification Patterns in Gonadal Aromatase (cyp19a1 Gene in Species with Temperature-Dependent Sex Determination.

    Directory of Open Access Journals (Sweden)

    Yuiko Matsumoto

    Full Text Available The environment surrounding the embryos has a profound impact on the developmental process and phenotypic outcomes of the organism. In species with temperature-dependent sex determination, gonadal sex is determined by the incubation temperature of the eggs. A mechanistic link between temperature and transcriptional regulation of developmental genes, however, remains elusive. In this study, we examine the changes in DNA methylation and histone modification patterns of the aromatase (cyp19a1 gene in embryonic gonads of red-eared slider turtles (Trachemys scripta subjected to a temperature shift during development. Shifting embryos from a male-producing temperature (MPT to a female-producing temperature (FPT at the beginning of the temperature-sensitive period (TSP resulted in an increase in aromatase mRNA expression while a shift from FPT to MPT resulted in decreased expression. DNA methylation levels at CpG sites in the promoter of the aromatase gene were high (70-90% at the beginning of TSP, but decreased in embryos that were incubated at constant FPT and those shifted from MPT to the FPT. This decrease in methylation in the promoter inversely correlated with the expected increase in aromatase expression at the FPT. The active demethylation under the FPT was especially prominent at the CpG site upstream of the gonad-specific TATA box at the beginning of TSP and spread downstream of the gene including exon1 as the gonad development progressed. In embryos incubated at FPT, the promoter region was also labeled by canonical transcriptional activation markers, H3K4me3 and RNA polymerase II. A transcriptional repression marker, H3K27me3, was observed in temperature-shifted gonads of both temperature groups, but was not maintained throughout the development in either group. Our findings suggest that DNA hypomethylation and H3K4me3 modification at the aromatase promoter may be a primary mechanism that releases a transcriptional block of aromatase to

  2. Proteomic analysis of three gonad types of swamp eel reveals genes differentially expressed during sex reversal

    OpenAIRE

    Yue Sheng; Wei Zhao; Ying Song; Zhigang Li; Majing Luo; Quan Lei; Hanhua Cheng; Rongjia Zhou

    2015-01-01

    A variety of mechanisms are engaged in sex determination in vertebrates. The teleost fish swamp eel undergoes sex reversal naturally and is an ideal model for vertebrate sexual development. However, the importance of proteome-wide scanning for gonad reversal was not previously determined. We report a 2-D electrophoresis analysis of three gonad types of proteomes during sex reversal. MS/MS analysis revealed a group of differentially expressed proteins during ovary to ovotestis to testis transf...

  3. Regulating gonad inhibition and vitellogenin/vitellin induction in Penaeus monodon using mature GIH fusion protein and polyclonal antisera.

    Science.gov (United States)

    S, Vrinda; C, Jasmin; K C, Sivakumar; Jose, Seena; Jose, Blessy; Philip, Rosamma; I S, Bright Singh

    2017-01-01

    Gonad inhibiting hormone (GIH), type II class of the CHH family neuropeptides, is released by the neurohaemal XO-SG complex of the eyestalk. The inhibitory function of GIH has a pivotal role in gonad development and reproduction. In this study, we report the expression and production of a thioredoxin-fused mature GIH protein (mf-PmGIH) of Penaeus monodon in a bacterial system and its use as antigen to raise polyclonal antiserum (anti-mf-PmGIH). The mature GIH gene of 237bp that codes for 79 amino acids, was cloned into the Escherichia coli thioredoxin gene fusion expression system. The expression vector construct (mf-PmGIH+pEt32a+) upon induction produced 32.16kDa mature GIH fusion protein (mf-PmGIH)·The purified fusion protein was used as exogenous GIH and as antigen to raise polyclonal antisera. The fusion protein when injected into juvenile shrimp significantly reduced vitellogenin/vitellin levels by 31.55% within 72h in comparison to the controls showing the gonad inhibiting property. Vitellogenin/vitellin levels were significantly induced by 74.10% within 6h when polyclonal antiserum (anti-mf-PmGIH - 1:500) was injected in P. monodon. Anti-mf-PmGIH immunolocalized GIH producing neurosecretory cells in the eyestalk of P. monodon. The present manuscript reports an innovative means of gonad inhibition and vitellogenin/vitellin induction with thioredoxin fused GIH and antisera developed. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Is the ICRP-26 weighting factor for gonadal dose appropriate for new federal regulations?

    International Nuclear Information System (INIS)

    Drum, D.E.

    1991-01-01

    In 1977 the ICRP recommended that computation of the occupational whole body effective dose equivalent include individual organ dose weighting factors derived from risk coefficients for stochastic effects. The-preeminent weighting factor of 0.25 was assigned to irradiation of the gonads in order to account for heritable genetic effects manifest in later generations. As of 1990, there exists no positive significant evidence for the occurrence of transmitted genetic effects in humans after radiation of any form, dose, or dose rate. To assign to gonads 25% of the health detriment from radiation has no basis in medical experience. It establishes a policy that may underestimate the proportion of real mortality from other more radiosensitive organs, and the policy could compromise unreasonably the occupational stability of workers whose activities may involve gonadal irradiation

  5. Regulation of meiotic entry and gonadal sex differentiation in the human

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Rajpert-De Meyts, Ewa

    2014-01-01

    Meiosis is a unique type of cell division that is performed only by germ cells to form haploid gametes. The switch from mitosis to meiosis exhibits a distinct sex-specific difference in timing, with female germ cells entering meiosis during fetal development and male germ cells at puberty when...... in the context of fetal gonad development and germ cell differentiation, with emphasis on results obtained in humans. Furthermore, the consequences of dysregulated meiosis signaling in humans are briefly discussed in the context of selected pathologies, including testicular germ cell cancer and some forms...

  6. Dietary-Induced Signals That Activate the Gonadal Longevity Pathway during Development Regulate a Proteostasis Switch in Caenorhabditis elegans Adulthood

    Directory of Open Access Journals (Sweden)

    Netta Shemesh

    2017-08-01

    Full Text Available Cell-non-autonomous signals dictate the functional state of cellular quality control systems, remodeling the ability of cells to cope with stress and maintain protein homeostasis (proteostasis. One highly regulated cell-non-autonomous switch controls proteostatic capacity in Caenorhabditis elegans adulthood. Signals from the reproductive system down-regulate cyto-protective pathways, unless countered by signals reporting on germline proliferation disruption. Here, we utilized dihomo-γ-linolenic acid (DGLA that depletes the C. elegans germline to ask when cell-non-autonomous signals from the reproductive system determine somatic proteostasis and whether such regulation is reversible. We found that diet supplementation of DGLA resulted in the maintenance of somatic proteostasis after the onset of reproduction. DGLA-dependent proteostasis remodeling was only effective if animals were exposed to DGLA during larval development. A short exposure of 16 h during the second to fourth larval stages was sufficient and required to maintain somatic proteostasis in adulthood but not to extend lifespan. The reproductive system was required for DGLA-dependent remodeling of proteostasis in adulthood, likely via DGLA-dependent disruption of germline stem cells. However, arachidonic acid (AA, a somatic regulator of this pathway that does not require the reproductive system, presented similar regulatory timing. Finally, we showed that DGLA- and AA-supplementation led to activation of the gonadal longevity pathway but presented differential regulatory timing. Proteostasis and stress response regulators, including hsf-1 and daf-16, were only activated if exposed to DGLA and AA during development, while other gonadal longevity factors did not show this regulatory timing. We propose that C. elegans determines its proteostatic fate during development and is committed to either reproduction, and thus present restricted proteostasis, or survival, and thus present robust

  7. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: Evidence for masculinization of the transcriptome

    Directory of Open Access Journals (Sweden)

    Mo Qianxing

    2009-12-01

    Full Text Available Abstract Background In many taxa, males and females are very distinct phenotypically, and these differences often reflect divergent selective pressures acting on the sexes. Phenotypic sexual dimorphism almost certainly reflects differing patterns of gene expression between the sexes, and microarray studies have documented widespread sexually dimorphic gene expression. Although the evolutionary significance of sexual dimorphism in gene expression remains unresolved, these studies have led to the formulation of a hypothesis that male-driven evolution has resulted in the masculinization of animal transcriptomes. Here we use a microarray assessment of sex- and gonad-biased gene expression to test this hypothesis in zebrafish. Results By using zebrafish Affymetrix microarrays to compare gene expression patterns in male and female somatic and gonadal tissues, we identified a large number of genes (5899 demonstrating differences in transcript abundance between male and female Danio rerio. Under conservative statistical significance criteria, all sex-biases in gene expression were due to differences between testes and ovaries. Male-enriched genes were more abundant than female-enriched genes, and expression bias for male-enriched genes was greater in magnitude than that for female-enriched genes. We also identified a large number of genes demonstrating elevated transcript abundance in testes and ovaries relative to male body and female body, respectively. Conclusion Overall our results support the hypothesis that male-biased evolutionary pressures have resulted in male-biased patterns of gene expression. Interestingly, our results seem to be at odds with a handful of other microarray-based studies of sex-specific gene expression patterns in zebrafish. However, ours was the only study designed to address this specific hypothesis, and major methodological differences among studies could explain the discrepancies. Regardless, all of these studies agree

  8. A mutation in the nucleoporin-107 gene causes XX gonadal dysgenesis

    Science.gov (United States)

    Weinberg-Shukron, Ariella; Renbaum, Paul; Kalifa, Rachel; Zeligson, Sharon; Ben-Neriah, Ziva; Dreifuss, Amatzia; Abu-Rayyan, Amal; Maatuk, Noa; Fardian, Nilly; Rekler, Dina; Kanaan, Moien; Samson, Abraham O.; Levy-Lahad, Ephrat; Gerlitz, Offer; Zangen, David

    2015-01-01

    Ovarian development and maintenance are poorly understood; however, diseases that affect these processes can offer insights into the underlying mechanisms. XX female gonadal dysgenesis (XX-GD) is a rare, genetically heterogeneous disorder that is characterized by underdeveloped, dysfunctional ovaries, with subsequent lack of spontaneous pubertal development, primary amenorrhea, uterine hypoplasia, and hypergonadotropic hypogonadism. Here, we report an extended consanguineous family of Palestinian origin, in which 4 females exhibited XX-GD. Using homozygosity mapping and whole-exome sequencing, we identified a recessive missense mutation in nucleoporin-107 (NUP107, c.1339G>A, p.D447N). This mutation segregated with the XX-GD phenotype and was not present in available databases or in 150 healthy ethnically matched controls. NUP107 is a component of the nuclear pore complex, and the NUP107-associated protein SEH1 is required for oogenesis in Drosophila. In Drosophila, Nup107 knockdown in somatic gonadal cells resulted in female sterility, whereas males were fully fertile. Transgenic rescue of Drosophila females bearing the Nup107D364N mutation, which corresponds to the human NUP107 (p.D447N), resulted in almost complete sterility, with a marked reduction in progeny, morphologically aberrant eggshells, and disintegrating egg chambers, indicating defective oogenesis. These results indicate a pivotal role for NUP107 in ovarian development and suggest that nucleoporin defects may play a role in milder and more common conditions such as premature ovarian failure. PMID:26485283

  9. Genome-wide analysis of brain and gonad transcripts reveals changes of key sex reversal-related genes expression and signaling pathways in three stages of Monopterus albus.

    Directory of Open Access Journals (Sweden)

    Wei Chi

    Full Text Available The natural sex reversal severely affects the sex ratio and thus decreases the productivity of the rice field eel (Monopterus albus. How to understand and manipulate this process is one of the major issues for the rice field eel stocking. So far the genomics and transcriptomics data available for this species are still scarce. Here we provide a comprehensive study of transcriptomes of brain and gonad tissue in three sex stages (female, intersex and male from the rice field eel to investigate changes in transcriptional level during the sex reversal process.Approximately 195 thousand unigenes were generated and over 44.4 thousand were functionally annotated. Comparative study between stages provided multiple differentially expressed genes in brain and gonad tissue. Overall 4668 genes were found to be of unequal abundance between gonad tissues, far more than that of the brain tissues (59 genes. These genes were enriched in several different signaling pathways. A number of 231 genes were found with different levels in gonad in each stage, with several reproduction-related genes included. A total of 19 candidate genes that could be most related to sex reversal were screened out, part of these genes' expression patterns were validated by RT-qPCR. The expression of spef2, maats1, spag6 and dmc1 were abundant in testis, but was barely detected in females, while the 17β-hsd12, zpsbp3, gal3 and foxn5 were only expressed in ovary.This study investigated the complexity of brain and gonad transcriptomes in three sex stages of the rice field eel. Integrated analysis of different gene expression and changes in signaling pathways, such as PI3K-Akt pathway, provided crucial data for further study of sex transformation mechanisms.

  10. Genome-wide analysis of brain and gonad transcripts reveals changes of key sex reversal-related genes expression and signaling pathways in three stages of Monopterus albus.

    Science.gov (United States)

    Chi, Wei; Gao, Yu; Hu, Qing; Guo, Wei; Li, Dapeng

    2017-01-01

    The natural sex reversal severely affects the sex ratio and thus decreases the productivity of the rice field eel (Monopterus albus). How to understand and manipulate this process is one of the major issues for the rice field eel stocking. So far the genomics and transcriptomics data available for this species are still scarce. Here we provide a comprehensive study of transcriptomes of brain and gonad tissue in three sex stages (female, intersex and male) from the rice field eel to investigate changes in transcriptional level during the sex reversal process. Approximately 195 thousand unigenes were generated and over 44.4 thousand were functionally annotated. Comparative study between stages provided multiple differentially expressed genes in brain and gonad tissue. Overall 4668 genes were found to be of unequal abundance between gonad tissues, far more than that of the brain tissues (59 genes). These genes were enriched in several different signaling pathways. A number of 231 genes were found with different levels in gonad in each stage, with several reproduction-related genes included. A total of 19 candidate genes that could be most related to sex reversal were screened out, part of these genes' expression patterns were validated by RT-qPCR. The expression of spef2, maats1, spag6 and dmc1 were abundant in testis, but was barely detected in females, while the 17β-hsd12, zpsbp3, gal3 and foxn5 were only expressed in ovary. This study investigated the complexity of brain and gonad transcriptomes in three sex stages of the rice field eel. Integrated analysis of different gene expression and changes in signaling pathways, such as PI3K-Akt pathway, provided crucial data for further study of sex transformation mechanisms.

  11. Temporal expression pattern of genes during the period of sex differentiation in human embryonic gonads

    DEFF Research Database (Denmark)

    Mamsen, Linn S.; Ernst, Emil H.; Borup, Rehannah

    2017-01-01

    (IHC). SRY/SOX9 expression initiated in testis around day 40 pc, followed by initiation of AMH and steroidogenic genes required for androgen production at day 53 pc. In ovaries, gene expression of RSPO1, LIN28, FOXL2, WNT2B, and ETV5, were significantly higher than in testis, whereas GLI1...... was significantly higher in testis than ovaries. Gene expression was confirmed by IHC for GAGE, SOX9, AMH, CYP17A1, LIN28, WNT2B, ETV5 and GLI1. Gene expression was not associated with the maternal smoking habits. Collectively, a precise temporal determination of changes in expression of key genes involved in human...

  12. Taurine and pioglitazone attenuate diabetes-induced testicular damage by abrogation of oxidative stress and up-regulation of the pituitary-gonadal axis.

    Science.gov (United States)

    Abd El-Twab, Sanaa M; Mohamed, Hanaa M; Mahmoud, Ayman M

    2016-06-01

    Chronic hyperglycemia is associated with impairment of testicular function. The current study aimed to investigate the protective effects and the possible mechanisms of taurine and pioglitazone against diabetes-induced testicular dysfunction in rats. Diabetes was induced by streptozotocin injection. Both normal and diabetic rats received taurine (100 mg/kg) or pioglitazone (10 mg/kg) orally and daily for 6 weeks. Diabetic rats showed a significant (P Taurine and pioglitazone alleviated hyperglycemia, decreased pro-inflammatory cytokines, and increased circulating levels of insulin, testosterone, LH, and FSH. Gene and protein expression of LH and FSH receptors and cytochrome P450 17α-hydroxylase (CYP17) was significantly (P taurine and pioglitazone. In addition, taurine and pioglitazone significantly decreased lipid peroxidation and DNA damage, and enhanced activity of the antioxidant enzymes in testes of diabetic rats. In conclusion, taurine and pioglitazone exerted protective effects against diabetes-induced testicular damage through attenuation of hyperglycemia, inflammation, oxidative stress and DNA damage, and up-regulation of the pituitary/gonadal axis.

  13. The ter mutation in the rat Dnd1 gene initiates gonadal teratomas and infertility in both genders.

    Science.gov (United States)

    Northrup, Emily; Zschemisch, Nils-Holger; Eisenblätter, Regina; Glage, Silke; Wedekind, Dirk; Cuppen, Edwin; Dorsch, Martina; Hedrich, Hans-Jürgen

    2012-01-01

    A spontaneous mutation leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. The histological evaluation revealed derivatives from all three germ layers, thereby identifying these tumors as teratomas. Teratocarcinogenesis was accompanied by infertility and the underlying mutation was termed ter. Linkage analysis of 58 (WKY-ter×SPRD-Cu3) F2 rats associated the ter mutation with RNO18 (LOD = 3.25). Sequencing of candidate genes detected a point mutation in exon 4 of the dead-end homolog 1 gene (Dnd1), which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. Genotyping of the recessive ter mutation revealed a complete penetrance of teratocarcinogenesis and infertility in homozygous ter rats of both genders. Morphologically non-tumorous testes of homozygous ter males were reduced in both size and weight. This testicular malformation was linked to a lack of spermatogenesis using immunohistochemical and histological staining. Our WKY-Dnd1(ter)/Ztm rat is a novel animal model to investigate gonadal teratocarcinogenesis and the molecular mechanisms involved in germ cell development of both genders.

  14. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  15. Sex-specific gonadal and gene expression changes throughout development in fathead minnow

    Science.gov (United States)

    Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...

  16. Identification of a novel mutation (Ala66Thr) of SRY gene causes XY pure gonadal dysgenesis by affecting DNA binding activity and nuclear import.

    Science.gov (United States)

    Wang, Xiang; Xue, Mei; Zhao, Minggang; He, Fang; Li, Cui; Li, Xu

    2018-04-20

    Sex-determining region of the Y chromosome (SRY) gene plays a crucial role in male sexual differentiation and development. Several mutations in the SRY gene have been reported in the high mobility group (HMG) box domain and can cause gonadal dysgenesis symptoms. In this study, we report that a novel missense mutation in the SRY gene, a G to A transition within the HMG box, causes the Ala66Thr amino acid substitution in a female patient presenting 46,XY karyotype with pure gonadal dysgenesis. The G to A base transition was not found in the SRY sequence after the screening of 100 normal males. Furthermore, Ala66Thr mutation drastically reduced the binding capacity of SRY to DNA sequences, whereas wild-type SRY protein showed the normal binding capacity to DNA sequences in vitro. We also found that the mutant SRY protein was partly localized in cytoplasm, whereas wild-type SRY protein was strictly localized in cell nucleus. In addition, we analyzed the three-dimensional structure of SRY protein by homology modeling methods. In conclusion, we identified a novel SRY mutation in a 46,XY female patient with pure gonadal dysgenesis, demonstrating the importance of the Ala66Thr mutation in DNA binding activity and nuclear transport. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Regulation of gonadal sex ratios and pubertal development by the thyroid endocrine system in zebrafish (Danio rerio).

    Science.gov (United States)

    Sharma, Prakash; Patiño, Reynaldo

    2013-04-01

    We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent. Published by Elsevier Inc.

  18. Regulation of gonadal sex ratios and pubertal development by the thyroid endocrine system in zebrafish (Danio rerio)

    Science.gov (United States)

    Sharma, Prakash; Patino, Reynaldo

    2013-01-01

    We examined associations between thyroid condition, gonadal sex and pubertal development in zebrafish. Seventy-two-hour postfertilization larvae were reared in untreated medium or in the presence of goitrogens (sodium perchlorate, 0.82 mM; methimazole, 0.15 and 0.3 mM) or thyroxine (1 and 10 nM) for 30 days. Thyrocyte height, gonadal sex and gonadal development were histologically determined at 45 and 60 days postfertilization (dpf). Thyrocyte hypertrophy, an index of hypothyroidism, was observed at 45 and 60 dpf in perchlorate-treated but only at 45 dpf in methimazole-treated fish. Similarly, gonadal sex ratios were biased toward ovaries relative to control animals at 45 and 60 dpf in perchlorate-treated fish but only at 45 dpf in methimazole-treated fish. Gonadal sex ratios were biased toward testes at 45 and 60 dpf in thyroxine-treated fish. Spermatogenesis was delayed in testes from goitrogen-treated fish at 60 dpf relative to control values, but was unaffected in testes from thyroxine-treated individuals. Oogenesis seemed to be nonspecifically delayed in all treatments relative to control at 60 dpf. This study confirmed the previously reported association between hypothyroid condition and ovarian-skewed ratios, and hyperthyroid condition and testicular-skewed ratios, and also showed that male pubertal development is specifically delayed by experimental hypothyroidism. The simultaneous recovery from the hypothyroid and ovary-inducing effects of methimazole by 60 dpf (27 days post-treatment) suggests that the ovary-skewing effect of goitrogens is reversible when thyroid conditions return to basal levels before developmental commitment of gonadal sex. Conversely, the masculinizing effect of hyperthyroidism seems to be stable and perhaps permanent.

  19. Genes expressed in Blue Fin Tuna (Thunnus thynnus) liver and gonads.

    Science.gov (United States)

    Chini, Valentina; Cattaneo, Anna Giulia; Rossi, Federica; Bernardini, Giovanni; Terova, Genciana; Saroglia, Marco; Gornati, Rosalba

    2008-02-29

    Blue Fin Tuna (BFT), Thunnus thynnus, has been seriously endangered by global massive overfishing and by the pollution of marine environment. Feeding and fattening of caught tuna in marine cages is a recent resource, but the development of a self-sustained aquaculture activity, being independent from the supply of wild fish, is required from both industrial and conservation perspectives. At this scope, several technical problems have to be solved and the control of reproduction is the cardinal one. Beside the technological developments of farming facilities and protocols, a molecular approach seems promising for the studies of appropriate nutritional strategies, reproduction physiology and animal welfare, as well as lifestyle and response to endocrine disruptor pollutants. In this context, we have started an EST project on this species sequencing 2743, 2907, and 3014 clones from expression libraries of ovary, testis and liver, respectively, and 1499 clones from an ovary normalized library. Thanks to this project, we have identified several sequences with known function in other organisms, but not previously described in this species. Among the new genes, 712 were found only in the expression library of the ovary, 613 in that of the testis and 318 in that of the liver, while 324 additional genes were shared by two or more expression libraries; other 127 genes not found in the expression libraries were obtained from the ovary normalized library. This represents a contribution to the knowledge of the molecular basis of BFT and a necessary step for facilitating further molecular studies on this species. Accession numbers: EC 091633 to EC 093160; EG 629962 to EG 631176; EC 917676 to EC 919417; EG 999340 to EG 999999; EH 000001 to EH 000505; EH 667253 to EH 668984; EL 610526 to EL 611807; EC 42144 to EC 422414; and EH 379568 to EH 380065.

  20. Microarray gene expression profiles from mature gonad tissues of Atlantic bluefin tuna, Thunnus thynnus in the Gulf of Mexico.

    Science.gov (United States)

    Gardner, Luke D; Jayasundara, Nishad; Castilho, Pedro C; Block, Barbara

    2012-10-05

    Bluefin tunas are highly prized pelagic fish species representing a significant economic resource to fisheries throughout the world. Atlantic bluefin tuna (Thunnus thynnus) populations have significantly declined due to overexploitation. As a consequence of their value and population decline, T. thynnus has been the focus of considerable research effort concerning many aspects of their life history. However, in-depth understanding of T. thynnus reproductive biology is still lacking. Knowledge of reproductive physiology is a very important tool for determining effective fisheries and aquaculture management. Transcriptome techniques are proving powerful and provide novel insights into physiological processes. Construction of a microarray from T. thynnus ESTs sourced from reproductive tissues has provided an ideal platform to study the reproductive physiology of bluefin tunas. The aim of this investigation was to compare transcription profiles from the ovaries and testes of mature T. thynnus to establish sex specific variations underlying their reproductive physiology. Male and females T. thynnus gonad tissues were collected from the wild and histologically staged. Sub-samples of sexually mature tissues were also measured for their mRNA differential expression among the sexes using the custom microarray design BFT 4X44K. A total of 7068 ESTs were assessed for differential expression of which 1273 ESTs were significantly different (p2 fold change in expression according to sex. Differential expression for 13 of these ESTs was validated with quantitative PCR. These include genes involved in egg envelope formation, hydration, and lipid transport/accumulation more highly expressed in ovaries compared with testis, while genes involved in meiosis, sperm motility and lipid metabolism were more highly expressed in testis compared with ovaries. This investigation has furthered our knowledge of bluefin tunas reproductive biology by using a contemporary transcriptome approach

  1. Microarray gene expression profiles from mature gonad tissues of Atlantic bluefin tuna, Thunnus thynnus in the Gulf of Mexico

    Directory of Open Access Journals (Sweden)

    Gardner Luke D

    2012-10-01

    Full Text Available Abstract Background Bluefin tunas are highly prized pelagic fish species representing a significant economic resource to fisheries throughout the world. Atlantic bluefin tuna (Thunnus thynnus populations have significantly declined due to overexploitation. As a consequence of their value and population decline, T. thynnus has been the focus of considerable research effort concerning many aspects of their life history. However, in-depth understanding of T. thynnus reproductive biology is still lacking. Knowledge of reproductive physiology is a very important tool for determining effective fisheries and aquaculture management. Transcriptome techniques are proving powerful and provide novel insights into physiological processes. Construction of a microarray from T. thynnus ESTs sourced from reproductive tissues has provided an ideal platform to study the reproductive physiology of bluefin tunas. The aim of this investigation was to compare transcription profiles from the ovaries and testes of mature T. thynnus to establish sex specific variations underlying their reproductive physiology. Results Male and females T. thynnus gonad tissues were collected from the wild and histologically staged. Sub-samples of sexually mature tissues were also measured for their mRNA differential expression among the sexes using the custom microarray design BFT 4X44K. A total of 7068 ESTs were assessed for differential expression of which 1273 ESTs were significantly different (p2 fold change in expression according to sex. Differential expression for 13 of these ESTs was validated with quantitative PCR. These include genes involved in egg envelope formation, hydration, and lipid transport/accumulation more highly expressed in ovaries compared with testis, while genes involved in meiosis, sperm motility and lipid metabolism were more highly expressed in testis compared with ovaries. Conclusions This investigation has furthered our knowledge of bluefin tunas

  2. Effects of Crocin on The Pituitary-Gonadal Axis and Hypothalamic Kiss-1 Gene Expression in Female Wistar Rats

    Directory of Open Access Journals (Sweden)

    Dina Zohrabi

    2018-01-01

    Full Text Available Background Saffron (Crocus sativus L. has been traditionally used as a spice for coloring and flavoring in some countries cuisine. One of the main components of saffron is Crocin. Recent research have shown that crocin has various pharmacological effects. The aim of this study was to assess the effects of crocin on the Pituitary-Gonadal axis and Kiss-1 gene expression in hypothalamus and ovarian tissue organization in female Wistar rats. Materials and Methods In this experimental study, 18 adult female Wistar rats were randomly divided into three groups. Control group received normal saline and experimental groups received two different doses of crocin (100 and 200 mg/kg every two days for 30 days. After the treatment period, blood samples were obtained from the heart and centrifuged. Next, the serum levels of follicle-stimulating hormone (FSH and luteinizing hormone (LH, estrogen and progesterone hormones were measured by ELISA assay. The ovarian tissues were removed and fixed for histological investigation. The hypothalamic Kiss-1 gene expression was measured using real-time polymerase chain reaction (PCR. All data were analyzed using one-way ANOVA. Results A significant reduction (P=0.038 in the number of atretic graafian follicles (0.5 ± 0.31 was observed in rats treated with 200 mg/kg crocin. In addition, estrogen concentration in experimental groups (35.04 ± 0.85 and 36.18 ± 0.69 in crocin 100 and 200 mg/kg groups, respectively compared to control group (38.35 ± 0.64 and progesterone concentration in rats treated with crocin 200 mg/kg (2.06 ± 0.07 compared to control group (2.16 ± 0.04, significantly decreased. Interestingly, relative expressions of Kiss-1 mRNA significantly decreased in experimental groups (0.00053 ± 0.00051 and 0.0011 ± 0.00066 in crocin 100 and 200 mg/kg groups, respectively (P=0.000 compared to control group (1 ± 0. Conclusion Crocin, at hypothalamic level, reduces Kiss-1 gene expression and it can prevent

  3. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  4. Hormonal regulation of the annual pelage color cycle in the Djungarian hamster, Phodopus sungorus. I. Role of the gonads and pituitary.

    Science.gov (United States)

    Duncan, M J; Goldman, B D

    1984-04-01

    The Djungarian hamster exhibits an agouti pelage in the summer and a predominantly white pelage in the winter. This pelage color cycle is known to be regulated by the length of the daily photoperiod probably acting through the pineal gland, as is the seasonal cycle of reproductive function with which it is closely correlated ( Figala et al., '73; Hoffmann, ' 78b ). The possibility of a causal relationship between the decline in gonadal hormone secretion and the coat color change occurring in short photoperiod was examined. Gonadectomized and intact male and female hamsters were exposed to either long (16L:8D) or short ( 10L : 14D ) photoperiod for several months. Gonadectomy neither induced the change to the winter pelage color in long photoperiod-housed animals, nor prevented either the change to the winter pelage or the spontaneous return to summer pelage color in short photoperiod-housed animals. Chronic implants of testosterone in castrated males delayed and attenuated the short photoperiod-induced coat color change. Administration of ovine prolactin (100 micrograms/day) stimulated pigmentation in hamsters with the winter pelage, whereas administration of a alpha MSH (30 micrograms/day) was without effect. These results suggest that changes in pelage color may be regulated largely by changes in pituitary prolactin secretion and modified to some extent by changes in gonadal steroid hormone secretion.

  5. Laser capture microdissection of gonads from juvenile zebrafish

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John; Morthorst, Jane Ebsen

    2009-01-01

    was adjusted and optimised to isolate juvenile zebrafish gonads. Results: The juvenile zebrafish gonad is not morphologically distinguishable when using dehydrated cryosections on membrane slides and a specific staining method is necessary to identify the gonads. The protocol setup in this study allows......Background: Investigating gonadal gene expression is important in attempting to elucidate the molecular mechanism of sex determination and differentiation in the model species zebrafish. However, the small size of juvenile zebrafish and correspondingly their gonads complicates this type...... of investigation. Furthermore, the lack of a genetic sex marker in juvenile zebrafish prevents pooling gonads from several individuals. The aim of this study was to establish a method to isolate the gonads from individual juvenile zebrafish allowing future investigations of gonadal gene expression during sex...

  6. Group-synchronous ovarian development, spawning and spermiation in the European sea bass (Dicentrarchus labrax L. could be regulated by shifts in gonadal steroidogenesis

    Directory of Open Access Journals (Sweden)

    Juan F. Asturiano

    2002-09-01

    Full Text Available European sea bass (Dicentrarchus labrax L. is a species with group-synchronous ovarian development. A mechanism is required which enables maturation to occur in the first clutches of oocytes without inducing maturation in subsequent clutches. The present study examined the individual plasma variations of testosterone (T, 17,20?-dihydroxy-4-pregnen-3-one (17,20?P and 17,20?,21-trihydroxy-4-pregnen-3-one (20?S in both sexes, estradiol (E2 and vitellogenin (VTG in females (n=15 and 11-ketotestosterone (11KT in males (n=21, in an effort to elucidate the hormonal control of the reproductive cycle in this species. A sample of oocytes was obtained at every sampling from each female and the stage of development of the most advanced clutch of oocytes was determined and related to the individual hormone plasma levels. Total expressible milt was collected from males at each sampling during the spawning period and variations in the sperm production were related to hormone plasma levels. Successive elevations of plasma T and E2 levels were observed prior to peaks of progestagens, which resulted from the shift in gonadal steroidogenesis and coincided with the maturation-ovulation of the different clutches of oocytes or with increases in the sperm production. Following each progestagens wave, a new shift in gonadal steroidogenesis, resulting in a new elevation in plasma T and E2, was observed. This hormonal pattern was repeated several times depending on the number of ovulations per female. Results from the present study suggest a mechanism, based on shifts in gonadal steroidogenesis, which may be responsible for regulation of group-synchronous ovarian development, ovulation and spermiation in this species. In addition, evidence is presented which supports a role for both 17,20?P and 20?S as the maturation-inducing steroids (MIS in male and female European sea bass.

  7. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    cells are capable of regulating their gene expression, so that each cell can only express a particular set of genes yielding limited numbers of proteins with specialized functions. Therefore a rigid control of differential gene expression is necessary for cellular diversity. On the other hand, aberrant...... gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis......, genome-wide assays have increased our understanding of gene regulation significantly. This thesis describes the integration and analysis of HTS data across different important aspects of gene regulation. Gene expression can be regulated at different stages when the genetic information is passed from gene...

  8. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  9. Mathematical Models of Gene Regulation

    Science.gov (United States)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  10. Gonadal doses from radiotherapy

    International Nuclear Information System (INIS)

    Solomon, S.B.; Morris, N.D.

    1980-06-01

    The method of calculation of gonadal doses arising from different radiotherapeutic procedures is described. The measurement of scatter factors to the gonads from superficial and deep therapy is detailed and the analytic fits to the experimental data, as a function of field position, field size and beam energy are given. The data used to calculate the gonadal doses from treatments using linear accelerators, teletherapy and sealed sources are described and the analytic fits to the data given

  11. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  12. Effects of BPA and E2 on expression profiles of genes related to hypothalamic-pituitary-gonadal axis of half-smooth tongue sole Cynoglossus semilaevis

    Science.gov (United States)

    Li, Fengling; Li, Zhaoxin; Wang, Qingyin; Zhai, Yuxiu

    2013-05-01

    Endocrine disrupting chemicals (EDCs) are increasingly viewed as persistent pollutants, similar to natural hormones in function. This paper describes the expression profiles of 7 genes ( DMRT, VTG GnRHR FSHR CYP17A CYP19A, and CYP19B) involved in sex steroid synthesis and action as well as sexual development in adult male and female Cynoglossus semilaevis, after exposure to different concentrations of Bisphenol A (BPA) and 17β-estradiol (E2). Both BPA (1, 10, 50, 125, and 250 mg/kg) and E2 (0.5, 5, and 10 mg/kg) induced changes in target gene expression, although the estrogenic effects of E2 as a model estrogen were stronger. Among the 7 genes, VTG CYP17A and CYP19 responded strongly to BPA or E2 exposure and can thus serve as reference biomarkers for estrogenic EDCs exposure in marine teleosts. These data will provide a window to establish a hypothalamic-pituitary-gonadal model in C. semilaevis to better understand the effect pathways of EDCs.

  13. QTLminer: identifying genes regulating quantitative traits

    Directory of Open Access Journals (Sweden)

    Schughart Klaus

    2010-10-01

    Full Text Available Abstract Background Quantitative trait locus (QTL mapping identifies genomic regions that likely contain genes regulating a quantitative trait. However, QTL regions may encompass tens to hundreds of genes. To find the most promising candidate genes that regulate the trait, the biologist typically collects information from multiple resources about the genes in the QTL interval. This process is very laborious and time consuming. Results QTLminer is a bioinformatics tool that automatically performs QTL region analysis. It is available in GeneNetwork and it integrates information such as gene annotation, gene expression and sequence polymorphisms for all the genes within a given genomic interval. Conclusions QTLminer substantially speeds up discovery of the most promising candidate genes within a QTL region.

  14. The role of genetic sex in affect regulation and expression of GABA-related genes across species

    Directory of Open Access Journals (Sweden)

    Marianne eSeney

    2013-09-01

    Full Text Available Although circulating hormones and inhibitory gamma-amino butyric acid (GABA-related factors are known to affect mood, considerable knowledge gaps persist for biological mechanisms underlying the female bias in mood disorders. Here, we combine human and mouse studies to investigate sexual dimorphism in the GABA system in the context of major depressive disorder (MDD and then use a genetic model to dissect the role of sex-related factors in GABA-related gene expression and anxiety-/depressive-like behaviors in mice. First, using meta-analysis of gene array data in human postmortem brain (N = 51 MDD subjects, 50 controls, we show that the previously-reported down-regulation in MDD of somatostatin (SST, a marker of a GABA neuron subtype, is significantly greater in women with MDD. Second, using gene co-expression network analysis in control human subjects (N = 214; 2 frontal cortex regions and expression quantitative trait loci mapping (N = 170 subjects, we show that expression of SST and the GABA-synthesizing enzymes glutamate decarboxylase 67 (GAD67 and GAD65 are tightly co-regulated and influenced by X-chromosome genetic polymorphisms. Third, using a rodent genetic model (Four Core Genotypes (FCG mice, in which genetic and gonadal sex are artificially dissociated (N ≥ 12/group, we show that genetic sex (i.e. X/Y chromosome influences both gene expression (lower Sst, Gad67, Gad65 in XY mice and anxiety-like behaviors (higher in XY mice. This suggests that in an intact male animal, the observed behavior represents the outcomes of male genetic sex increasing and male-like testosterone decreasing anxiety-like behaviors. Gonadal sex was the only factor influencing depressive-like behavior (gonadal males < gonadal females. Collectively, these combined human and mouse studies provide mechanistic insight into sexual dimorphism in mood disorders, and specifically demonstrate an unexpected role for XY genetic sex on GABA-related genes and anxiety

  15. Copy number variation in patients with disorders of sex development due to 46,XY gonadal dysgenesis.

    Directory of Open Access Journals (Sweden)

    Stefan White

    2011-03-01

    Full Text Available Disorders of sex development (DSD, ranging in severity from mild genital abnormalities to complete sex reversal, represent a major concern for patients and their families. DSD are often due to disruption of the genetic programs that regulate gonad development. Although some genes have been identified in these developmental pathways, the causative mutations have not been identified in more than 50% 46,XY DSD cases. We used the Affymetrix Genome-Wide Human SNP Array 6.0 to analyse copy number variation in 23 individuals with unexplained 46,XY DSD due to gonadal dysgenesis (GD. Here we describe three discrete changes in copy number that are the likely cause of the GD. Firstly, we identified a large duplication on the X chromosome that included DAX1 (NR0B1. Secondly, we identified a rearrangement that appears to affect a novel gonad-specific regulatory region in a known testis gene, SOX9. Surprisingly this patient lacked any signs of campomelic dysplasia, suggesting that the deletion affected expression of SOX9 only in the gonad. Functional analysis of potential SRY binding sites within this deleted region identified five putative enhancers, suggesting that sequences additional to the known SRY-binding TES enhancer influence human testis-specific SOX9 expression. Thirdly, we identified a small deletion immediately downstream of GATA4, supporting a role for GATA4 in gonad development in humans. These CNV analyses give new insights into the pathways involved in human gonad development and dysfunction, and suggest that rearrangements of non-coding sequences disturbing gene regulation may account for significant proportion of DSD cases.

  16. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  17. Regulating gonad inhibition and vitellogenin/vitellin induction in Penaeus monodon using mature GIH fusion protein and polyclonal antisera

    Digital Repository Service at National Institute of Oceanography (India)

    Vrinda, S.; Jasmin, C.; Sivakumar, K.C.; Jose, S.; Jose, B.; Philip, R.; BrightSingh, I.S.

    report the expression and production of a thioredoxin-fused mature GIH protein (mf-PmGIH) of Penaeus monodon in a bacterial system and its use as antigen to raise polyclonal antiserum (anti-mf-PmGIH). The mature GIH gene of 237 bp that codes for 79 amino...

  18. Characterisation and expression analysis of UBC9 and UBS27 genes in developing gonads of cicindelids (Coleoptera: Cicindelidae).

    Science.gov (United States)

    Rodríguez-García, María Juliana; García-Reina, Andrés; Machado, Vilmar; Galián, José

    2016-12-01

    Ubiquitin and small ubiquitin-like modifiers (SUMO) are post-translational modifiers essential in a variety of cellular processes, including gametogenesis. SUMO-conjugating enzyme (UBC9) and the ubiquitin ribosomal fusion protein UBS27 have been characterised in several model species. However, their expression in coleopteran remains unstudied. In this study, UBC9 and UBS27 genes have been characterised in the tiger beetle Cicindela campestris for the first time. Bioinformatic analysis showed that the Cc-UBC9 gene encoded a 159 amino acid protein with a predicted molecular weight of 18.18kDa, and the Cc-UBS27 gene encoded a 156 amino acid protein with a predicted molecular weight of 17.71kDa. Selection analyses carried out in several cicindelid species revealed that both genes were affected by purifying selection. Real time quantitative PCR analysis demonstrated that Cc-UBC9 and Cc-UBS27 were expressed in different tissues. The highest expression on both genes was found in the ovary and testis, and there were differential expression levels between immature and mature stages of testis development. The expression patterns of Cc-UBC9 and Cc-UBS27 suggest that these genes play important roles in gametogenesis in C. campestris. This information is relevant to better understand the reproductive process in cicindelids and the function of ubiquitin and small ubiquitin-related modifier genes in the Coleoptera. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Differential regulation of kiss1 expression by melatonin and gonadal hormones in male and female Syrian hamsters

    DEFF Research Database (Denmark)

    Ansel, L; Bolborea, M; Bentsen, A H

    2010-01-01

    In seasonal breeders, reproduction is synchronized to seasons by day length via the pineal hormone melatonin. Recently, we have demonstrated that Kiss1, a key activator of the reproductive function, is down-regulated in sexually inactive hamsters maintained in inhibitory short days (SDs...... differentially regulate Kiss1 expression in the ARC and the AVPV. Kiss1 expression was examined by in situ hybridization in both male and female hamsters kept in various experimental conditions, and we observed that 1) SD exposure markedly reduced Kiss1 expression in the ARC and AVPV of male and female hamsters...... as compared to LD animals, 2) sex steroid treatment in SD-adapted male and female hamsters increased the number of Kiss1 neurons in the AVPV but decreased it in the ARC, 3) melatonin administration to LD-adapted hamsters decreased Kiss1 mRNA level in both the AVPV and the ARC in intact animals, whereas...

  20. Differential regulation of kiss1 expression by melatonin and gonadal hormones in male and female Syrian hamsters

    DEFF Research Database (Denmark)

    Ansel, L; Bolborea, M; Bentsen, A H

    2010-01-01

    In seasonal breeders, reproduction is synchronized to seasons by day length via the pineal hormone melatonin. Recently, we have demonstrated that Kiss1, a key activator of the reproductive function, is down-regulated in sexually inactive hamsters maintained in inhibitory short days (SDs). In rode......In seasonal breeders, reproduction is synchronized to seasons by day length via the pineal hormone melatonin. Recently, we have demonstrated that Kiss1, a key activator of the reproductive function, is down-regulated in sexually inactive hamsters maintained in inhibitory short days (SDs...... differentially regulate Kiss1 expression in the ARC and the AVPV. Kiss1 expression was examined by in situ hybridization in both male and female hamsters kept in various experimental conditions, and we observed that 1) SD exposure markedly reduced Kiss1 expression in the ARC and AVPV of male and female hamsters...... as compared to LD animals, 2) sex steroid treatment in SD-adapted male and female hamsters increased the number of Kiss1 neurons in the AVPV but decreased it in the ARC, 3) melatonin administration to LD-adapted hamsters decreased Kiss1 mRNA level in both the AVPV and the ARC in intact animals, whereas...

  1. The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

    Science.gov (United States)

    Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

    2018-03-01

    Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

  2. The gonadal hormone regulates the plasma lactate levels in type 2 diabetes treated with and without metformin.

    Science.gov (United States)

    Shen, Ying; Liu, Fang; Li, Qing; Tang, Junling; Zheng, Taishan; Lu, Fengdi; Lu, Huijuan; Jia, Weiping

    2012-06-01

    Our previous study showed there was a gender difference in plasma lactate concentrations in subjects with type 2 diabetes. This study investigated the effect of sex hormone levels on plasma lactic acid (LA) levels in type 2 diabetes with and without metformin therapy. Fasting whole blood specimens of 392 type 2 diabetes patients treated with metformin (n=199) or not (n=193) were collected. LA was measured with an enzyme-electrode assay. Levels of sex hormones, including testosterone (T) and estradiol (E(2)), were measured with a chemiluminescence microparticle immunoassay. Spearman's or Pearson's correlation and logistic regression analysis were performed for the factors associated with LA. The LA level in the metformin group was significantly higher than that in the non-metformin group (1.26±0.43 vs. 1.14±0.49 mmol/L, PLA levels of females were significantly higher than those of males (PLA concentrations were positively correlated with E(2) level but negatively correlated with metformin and T levels (Pmetformin, and T were independent factors influencing lactate levels. Analysis of subgroups demonstrated that the LA concentrations increased with the elevation of E(2) level (Pmetformin. E(2) up-regulates but T tend to down-regulate lactate levels.

  3. Transcription of ribogenesis genes in fish gonads: Applications in the identification of stages of oogenesis and in environmental monitoring of intersex condition.

    Science.gov (United States)

    Rojo-Bartolomé, Iratxe; Valencia, Ainara; Cancio, Ibon

    2017-08-15

    One of the best described effects of environmental xenoestrogens in fish is the generation of intersex gonads in males. Considering 5S rRNA a marker of the presence of oocytes, a 5S/18S rRNA index was calculated in 296 thicklip grey mullets (Chelon labrosus) from polluted environments. In addition, qPCR analysis of transcription factors gtf3a and ubtf1, related respectively to 5S and 18S rRNA synthesis, was conducted along female-oogenesis. 5S/18S rRNA index identified sex with a threshold value of 0.4521 separating males from females. Histological analysis identified 38 intersex individuals. Intersex severity and 5S/18S rRNA indexes were correlated. 5S/18S rRNA index identified ovarian developmental stage with high 5S rRNA levels during early oogenesis and 18S rRNA relative values increasing towards maturation. gtf3a and ubtf1 transcription levels followed the pattern of 5S rRNA accumulation. Thus, ribogenesis genes provide easy/quantitative methods to molecularly identify the sex, female gametogenic stage and intersex severity in mullets. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Expression of PITX2 homeodomain transcription factor during rat gonadal development in a sexually dimorphic manner.

    Science.gov (United States)

    Nandi, Shyam Sundar; Ghosh, Pamela; Roy, Sib Sankar

    2011-01-01

    PITX2, a multifunctional Paired-like homeodomain transcription factor, plays obligatory role during development of organs like heart, brain and pituitary. It regulates differentiation of vascular smooth muscle cells and hematopoietic stem cells. Although we earlier reported the Pitx2/PITX2 expression in gonad, but the expression pattern of its different isoforms in mammalian gonads especially during development is still not known. As PITX2 participates in the development of multiple organs and different homeobox genes have been shown to control gonadal functions, we wanted to investigate the role of PITX2 in gonadal development and its function. The objective of our study was to know the expression profile of different Pitx2/PITX2 isoforms and its localization throughout the development of gonads. Here we show the temporal and spatial expression pattern of Pitx2/PITX2 and its localization throughout the embryonic and postnatal stages of rat gonads. Pitx2/PITX2 expression profile reveals the differential and dimorphic expression pattern of its two isoforms PITX2B2 and-Cβ throughout the embryonic development stages and also in the postnatal stages, where it becomes more prominent. This is the first report where PITX2 homeodomain transcription factor shows isoform-specific sexually dimorphic expression. In addition, PITX2 localization was found in the embryonic ovarian primordial germ cell clusters and germ cells inside the testicular cords and also in somatic cells. In adults, ovarian granulosa and theca cells as well as germ cells inside the seminiferous tubules in testis express PITX2. All the evidences suggest that the differential expression of PITX2 might be associated with sex-specific embryonic and postnatal gonadal development and the physiological processes. Copyright © 2011 S. Karger AG, Basel.

  5. Differential regulation of kiss1 expression by melatonin and gonadal hormones in male and female Syrian hamsters

    DEFF Research Database (Denmark)

    Ansel, L; Bolborea, M; Bentsen, A H

    2010-01-01

    ). In rodents, Kiss1 is expressed in the anteroventral periventricular nucleus (AVPV) and in the arcuate nucleus (ARC). Because both the duration of the nocturnal peak of melatonin and circulating sex steroid levels vary with photoperiod, the aim of this study was to determine whether melatonin and sex steroids...... differentially regulate Kiss1 expression in the ARC and the AVPV. Kiss1 expression was examined by in situ hybridization in both male and female hamsters kept in various experimental conditions, and we observed that 1) SD exposure markedly reduced Kiss1 expression in the ARC and AVPV of male and female hamsters...... as compared to LD animals, 2) sex steroid treatment in SD-adapted male and female hamsters increased the number of Kiss1 neurons in the AVPV but decreased it in the ARC, 3) melatonin administration to LD-adapted hamsters decreased Kiss1 mRNA level in both the AVPV and the ARC in intact animals, whereas...

  6. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  7. Laser capture microdissection of gonads from juvenile zebrafish

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Morthorst, Jane Ebsen

    2009-01-01

    Background: Investigating gonadal gene expression is important in attempting to elucidate the molecular mechanism of sex determination and differentiation in the model species zebrafish. However, the small size of juvenile zebrafish and correspondingly their gonads complicates this type of invest......Background: Investigating gonadal gene expression is important in attempting to elucidate the molecular mechanism of sex determination and differentiation in the model species zebrafish. However, the small size of juvenile zebrafish and correspondingly their gonads complicates this type...... of investigation. Furthermore, the lack of a genetic sex marker in juvenile zebrafish prevents pooling gonads from several individuals. The aim of this study was to establish a method to isolate the gonads from individual juvenile zebrafish allowing future investigations of gonadal gene expression during sex...... investigations of gonadal gene expression during the critical period of sex differentiation. Furthermore, the presented staining method is applicable to other species as it is directed towards alkaline phosphatase that is expressed in gonocytes and embryonic stem cells, which is conserved among vertebrate...

  8. Small RNA regulation of rice homeobox genes.

    Science.gov (United States)

    Jain, Mukesh; Khurana, Jitendra P

    2008-11-01

    Recently, we reported the genome-wide identification of 107 homeobox genes in rice and classified them into ten distinct subfamilies based upon their domain composition and phylogenetic analysis. Microarray analysis revealed the tissue-specific and overlapping expression profiles of these genes during various stages of floral transition, panicle development and seed set. Several homeobox genes were also found to be differentially expressed under abiotic stress conditions. Based on massively parallel signature sequencing (MPSS) data analysis, we report here that a large number of small RNA signatures are associated with rice homeobox genes, which may be involved in their tissue-specific/developmental regulation and stress responses. The association of a very large number of small RNA signatures suggested an unusually high degree of regulation of homeobox genes by small RNAs during inflorescence development.

  9. Gonadal transcriptome alterations in response to dietary energy intake: sensing the reproductive environment.

    Directory of Open Access Journals (Sweden)

    Bronwen Martin

    Full Text Available Reproductive capacity and nutritional input are tightly linked and animals' specific responses to alterations in their physical environment and food availability are crucial to ensuring sustainability of that species. We have assessed how alterations in dietary energy intake (both reductions and excess, as well as in food availability, via intermittent fasting (IF, affect the gonadal transcriptome of both male and female rats. Starting at four months of age, male and female rats were subjected to a 20% or 40% caloric restriction (CR dietary regime, every other day feeding (IF or a high fat-high glucose (HFG diet for six months. The transcriptional activity of the gonadal response to these variations in dietary energy intake was assessed at the individual gene level as well as at the parametric functional level. At the individual gene level, the females showed a higher degree of coherency in gonadal gene alterations to CR than the males. The gonadal transcriptional and hormonal response to IF was also significantly different between the male and female rats. The number of genes significantly regulated by IF in male animals was almost 5 times greater than in the females. These IF males also showed the highest testosterone to estrogen ratio in their plasma. Our data show that at the level of gonadal gene responses, the male rats on the IF regime adapt to their environment in a manner that is expected to increase the probability of eventual fertilization of females that the males predict are likely to be sub-fertile due to their perception of a food deficient environment.

  10. Gene regulation by steroid hormones III

    Energy Technology Data Exchange (ETDEWEB)

    Roy, A.K.; Clark, J.H.

    1987-01-01

    In this book, the authors discuss the latest advances in molecular endocrinology: - steroid receptor binding to DNA sequences of hormonally controlled genes, - structure of genes controlled by steroid hormones, - heterogeneity of steroid receptors, - immunochemical approaches to receptor studies, and - the most recent approaches to steroid hormone action and biological response. The Contents discussed are: Biochemical Evidence for the Exclusive Nuclear Localization of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor - Physical and Functional Parameters of Isolated Estrogen Receptor - Type II Binding Sites: Cellular Origin and an Endogeneous Ligand. - The Two Phosphorylation Reactions of the Progesterone Receptor. - Receptor Mediated Action of the Vitamin D Hormone. - Characterization of the Nuclear Binding Sites (Acceptor Sites) for a Steroid Receptor. Antibodies in Estrogen, Progesterone, Glucocorticoid, Vitamin D Receptors and Autoantibodies to Antrogene Receptor. - Isolation and Characterization of cDNA probes for Human CBG and Rat ABP. Ornithine Decarboxy lase mRNAs in Murine Kidney: Structure and Regulation by Androgens - Glucocorticoid Receptors and the Control of Gene Expression. - Activation and Regulation of the Vitellogenin Gene Family. - Intra- and Intercellular Aspects of the Hormonal Regulation of the ..cap alpha..2..mu.. Globulin Gene Expression. - Hormonal Regulation of Sexually Differentiated Isozymes of Cytochrome P-450 in Rat Liver. - Interaction of Thyroid Hormone and Carbohydrates on Hepatic Gene Expression.

  11. Construction and analysis of gonad suppression subtractive hybridization libraries for the rice field eel, Monopterus albus.

    Science.gov (United States)

    Qu, Xiancheng; Jiang, Jiaoyun; Shang, Xiaoli; Cheng, Cui; Feng, Long; Liu, Qigen

    2014-04-25

    The objective of this study was to investigate gene transcription profiles of the stage IV ovary and the ovotestis of the rice field eel (Monopterus albus) in an attempt to uncover genes involved in sex reversal and gonad development. Suppression subtractive hybridization (SSH) libraries were constructed using mRNA from the stage IV ovary and the ovotestis. In total 100 positive clones from the libraries were selected at random and sequenced, and then expressed sequence tags (ESTs) were used to search against sequences in the GenBank database using the BLASTn and BLASTx search algorithms. High quality SSH cDNA libraries and 90 ESTs were obtained. Of these ESTs, 43 showed high homology with genes of known function and these are associated with energy metabolism, signal transduction, transcription regulation and so on. The remaining 47 ESTs shared no homology with any genes in GenBank and are thus considered to be hypothetical genes. Furthermore, the four genes F11, F63, R11, and R47 from the forward and reverse libraries were analyzed in gonad, brain, heart, spleen, liver, kidney and muscle tissues. The results showed that the transcription of the F11 and F63 genes was significantly increased while the expression of the R11 and R47 genes was significantly decreased from IV or V ovary. In addition, the results also indicated that the four genes' expression was not gonad-tissue specific. This results strongly suggested that they may be involved in the rice field eel gonad development and/or sex reversal. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Early gonad development in zebrafish (Danio rerio)

    African Journals Online (AJOL)

    SAM

    2014-08-13

    Aug 13, 2014 ... secondary gonadogenesis. While the mechanisms of this phenomenon in zebrafish ovaries are not well addressed, here it can be seen in the context of an apoptotic regulation. Key words: Danio rerio, gonad, mitotic/meiotic transition, development, sex inversion. INTRODUCTION. Zebrafish (Danio rerio) is ...

  13. HLH-29 regulates ovulation in C. elegans by targeting genes in the inositol triphosphate signaling pathway

    Directory of Open Access Journals (Sweden)

    Ana White

    2012-02-01

    The reproductive cycle in the nematode Caenorhabditis elegans depends in part on the ability of the mature oocyte to ovulate into the spermatheca, fuse with the sperm during fertilization, and then exit the spermatheca as a fertilized egg. This cycle requires the integration of signals between the germ cells and the somatic gonad and relies heavily on the precise control of inositol 1,4,5 triphosphate (IP3levels. The HLH-29 protein, one of five Hairy/Enhancer of Split (HES homologs in C. elegans, was previously shown to affect development of the somatic gonad. Here we show that HLH-29 expression in the adult spermatheca is strongly localized to the distal spermatheca valve and to the spermatheca-uterine valve, and that loss of hlh-29 activity interferes with oocyte entry into and egg exit from the spermatheca. We show that HLH-29 can regulate the transcriptional activity of the IP3 signaling pathway genes ppk-1, ipp-5, and plc-1 and provide evidence that hlh-29 acts in a genetic pathway with each of these genes. We propose that the HES-like protein HLH-29 acts in the spermatheca of larval and adult animals to effectively increase IP3 levels during the reproductive cycle.

  14. Gene regulation by dietary microRNAs.

    Science.gov (United States)

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field.

  15. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  16. Gene expression regulation in roots under drought.

    Science.gov (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I......). Focusing on the same promoter across the cell cycle, we observed that histone modification undergoes very distinct temporal lterations compared to their regulatory functions spatially at different promoters (Papers II). By aggregating different HTS methods including CAGE, 3’end-seq, GRO-seq, RNAPII Ch...

  18. Molecular initiating events of the intersex phenotype: Low-dose exposure to 17α-ethinylestradiol rapidly regulates molecular networks associated with gonad differentiation in the adult fathead minnow testis

    Energy Technology Data Exchange (ETDEWEB)

    Feswick, April; Loughery, Jennifer R.; Isaacs, Meghan A.; Munkittrick, Kelly R.; Martyniuk, Christopher J., E-mail: cmartyni@yahoo.ca

    2016-12-15

    testis, despite the fact that dmrt1 itself was not different in expression from control males. Transcriptional networks involving forkhead box L2 (foxl2) (transcript involved in ovarian follicle development) were increased in expression in the testis. Noteworthy was that a gene network associated to granulosa cell development was increased over 100%, suggesting that this transcriptome network may be important for monitoring estrogenic exposures. Other cell processes rapidly downregulated by EE2 at the transcript level included glucose homeostasis, response to heavy metal, amino acid catabolism, and the cyclooxygenase pathway. Conversely, lymphocyte chemotaxis, intermediate filament polymerization, glucocorticoid metabolism, carbohydrate utilization, and anterior/posterior axis specification were increased. These data provide new insight into the transcriptional responses that are perturbed prior to gonadal remodeling and intersex following exposure to estrogens. These data demonstrate that low concentrations of EE2 (1) rapidly suppresses male hormone production, (2) down-regulate molecular networks related to male sex differentiation, and (3) induce transcriptional networks related to granulosa cell development in the adult testis. These responses are hypothesized to be key molecular initiating events that occur prior to the development of the intersex phenotype following estrogenic exposures.

  19. Regulation of lipogenic genes in obesity

    OpenAIRE

    Mandard, Stéphane; Kersten, Sander

    2006-01-01

    Lipogenesis describes the process of fatty acid and triglyceride synthesis. Lipogenesis mainly occurs in liver and fat tissue and is under the coordinated control of hormonal, nutritional and transcription factors. Several transcription factors have been identified as critical regulators that mediate the effect of hormones and nutrients on gene transcription. This includes the Sterol Regulatory Element Binding Protein-1c “SREBP-1c”, the CCAAT/Enhancer-Binding Protein-alpha “C/EBPalpha”, the n...

  20. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  1. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

    Science.gov (United States)

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-01-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

  2. Regulation of gene expression in human tendinopathy

    Directory of Open Access Journals (Sweden)

    Archambault Joanne M

    2011-05-01

    Full Text Available Abstract Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics.

  3. MicroRNA dynamics at the onset of primordial germ and somatic cell sex differentiation during mouse embryonic gonad development.

    Science.gov (United States)

    Fernández-Pérez, Daniel; Brieño-Enríquez, Miguel A; Isoler-Alcaraz, Javier; Larriba, Eduardo; Del Mazo, Jesús

    2018-03-01

    In mammals, commitment and specification of germ cell lines involves complex programs that include sex differentiation, control of proliferation, and meiotic initiation. Regulation of these processes is genetically controlled by fine-tuned mechanisms of gene regulation in which microRNAs (miRNAs) are involved. We have characterized, by small-RNA-seq and bioinformatics analyses, the miRNA expression patterns of male and female mouse primordial germ cells (PGCs) and gonadal somatic cells at embryonic stages E11.5, E12.5, and E13.5. Differential expression analyses revealed differences in the regulation of key miRNA clusters such as miR-199-214 , miR-182-183-96 , and miR-34c-5p , whose targets have defined roles during gonadal sexual determination in both germ and somatic cells. Extensive analyses of miRNA sequences revealed an increase in noncanonical isoforms on PGCs at E12.5 and dramatic changes of 3' isomiR expression and 3' nontemplate nucleotide additions in female PGCs at E13.5. Additionally, RT-qPCR analyses of genes encoding proteins involved in miRNA biogenesis and 3' nucleotide addition uncovered sexually and developmentally specific expression, characterized by the decay of Drosha , Dgcr8 , and Xpo5 expression along gonadal development. These results demonstrate that miRNAs, their isomiRs, and miRNA machinery are differentially regulated and participate actively in gonadal sexual differentiation in both PGCs and gonadal somatic cells. © 2018 Fernández-Pérez et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. A genomic atlas of human adrenal and gonad development

    Science.gov (United States)

    del Valle, Ignacio; Buonocore, Federica; Duncan, Andrew J.; Lin, Lin; Barenco, Martino; Parnaik, Rahul; Shah, Sonia; Hubank, Mike; Gerrelli, Dianne; Achermann, John C.

    2017-01-01

    Background: In humans, the adrenal glands and gonads undergo distinct biological events between 6-10 weeks post conception (wpc), such as testis determination, the onset of steroidogenesis and primordial germ cell development. However, relatively little is currently known about the genetic mechanisms underlying these processes. We therefore aimed to generate a detailed genomic atlas of adrenal and gonad development across these critical stages of human embryonic and fetal development. Methods: RNA was extracted from 53 tissue samples between 6-10 wpc (adrenal, testis, ovary and control). Affymetrix array analysis was performed and differential gene expression was analysed using Bioconductor. A mathematical model was constructed to investigate time-series changes across the dataset. Pathway analysis was performed using ClueGo and cellular localisation of novel factors confirmed using immunohistochemistry. Results: Using this approach, we have identified novel components of adrenal development (e.g. ASB4, NPR3) and confirmed the role of SRY as the main human testis-determining gene. By mathematical modelling time-series data we have found new genes up-regulated with SOX9 in the testis (e.g. CITED1), which may represent components of the testis development pathway. We have shown that testicular steroidogenesis has a distinct onset at around 8 wpc and identified potential novel components in adrenal and testicular steroidogenesis (e.g. MGARP, FOXO4, MAP3K15, GRAMD1B, RMND2), as well as testis biomarkers (e.g. SCUBE1). We have also shown that the developing human ovary expresses distinct subsets of genes (e.g. OR10G9, OR4D5), but enrichment for established biological pathways is limited. Conclusion: This genomic atlas is revealing important novel aspects of human development and new candidate genes for adrenal and reproductive disorders. PMID:28459107

  5. Tachykinins and the hypothalamo-pituitary-gonadal axis: An update.

    Science.gov (United States)

    Lasaga, Mercedes; Debeljuk, Luciano

    2011-09-01

    Tachykinins play a critical role in neuroendocrine regulation of reproduction. The best known members of the family are substance P (SP), neurokinin A and neurokinin B. Tachykinins mediate their biological actions through three G protein-coupled receptors, named NK1, NK2, and NK3. SP was suggested to play an important role in the ovulatory process in mammals and humans. Recent findings suggest a role of tachykinins in the aging of the hypothalamo-pituitary-gonadal axis. A high presence of SP was found in the sheep pars tuberalis and evidence indicates that it may have some role in the control of prolactin secretion. The presence of SP was confirmed in Leydig cells of the rat testes of animals submitted to constant light or treated with estrogens. Tachykinins were found to increase the motility of human spermatozoa. Tachykinins were also found to be present in the mouse ovary and more specifically, in the granulose cells. It is possible that tachykinins may play an important role in the ovarian function. NKB has been implicated in the steroid feedback control of GnRH release. Human mutations in the gene encoding this peptide or its receptor (TACR3) lead to a defect in the control of GnRH. A specific subset of neurons in the arcuate nucleus of the hypothalamus, colocalized three neuropeptides, kisspeptin, NKB and dynorphin. This subpopulation of neurons mediates the gonadal hormone feedback control of GnRH secretion. NKB/NK3 signaling plays a role in puberty onset and fertility in humans. This minireview summarizes the recent data about the action of tachykinins on the hypothalamo-pituitary-gonadal axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Pod-1/Capsulin shows a sex- and stage-dependent expression pattern in the mouse gonad development and represses expression of Ad4BP/SF-1.

    Science.gov (United States)

    Tamura, M; Kanno, Y; Chuma, S; Saito, T; Nakatsuji, N

    2001-04-01

    Mammalian sex-determination and differentiation are controlled by several genes, such as Sry, Sox-9, Dax-1 and Mullerian inhibiting substance (MIS), but their upstream and downstream genes are largely unknown. Ad4BP/SF-1, encoding a zinc finger transcription factor, plays important roles in gonadogenesis. Disruption of this gene caused disappearance of the urogenital system including the gonad. Ad4BP/SF-1, however, is also involved in the sex differentiation of the gonad at later stages, such as the regulation of steroid hormones and MIS. Pod-1/Capsulin, a member of basic helix-loop-helix transcription factors, is expressed in a pattern closely related but mostly complimentary to that of the Ad4BP/SF-1 expression in the developing gonad. In the co-transfection experiment using cultured cells, overexpression of Pod-1/Capsulin repressed expression of a reporter gene that carried the upstream regulatory region of the Ad4BP/SF-1 gene. Furthermore, forced expression of Pod-1/Capsulin repressed expression of Ad4BP/SF-1 in the Leydig cell-derived I-10 cells. These results suggest that Pod-1/Capsulin may play important roles in the development and sex differentiation of the mammalian gonad via transcriptional regulation of Ad4BP/SF-1.

  7. SOX9 regulates microRNA miR-202-5p/3p expression during mouse testis differentiation

    DEFF Research Database (Denmark)

    Wainwright, Elanor N; Jorgensen, Joan S; Kim, Youngha

    2013-01-01

    MicroRNAs are important regulators of developmental gene expression, but their contribution to fetal gonad development is not well understood. We have identified the evolutionarily conserved gonadal microRNAs miR-202-5p and miR-202-3p as having a potential role in regulating mouse embryonic gonad...... differentiation. These microRNAs are expressed in a sexually dimorphic pattern as the primordial XY gonad differentiates into a testis, with strong expression in Sertoli cells. In vivo, ectopic expression of pri-miR-202 in XX gonads did not result in molecular changes to the ovarian determination pathway...... findings indicate that expression of the conserved gonad microRNA, miR-202-5p/3p, is downstream of the testis-determining factor SOX9, suggesting an early role in testis development....

  8. Dietary Methanol Regulates Human Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  9. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  10. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  11. Ontogeny of gender-specific responsiveness to stress and glucocorticoids in the rat and its determination by the neonatal gonadal steroid environment.

    Science.gov (United States)

    Patchev, V K; Hayashi, S; Orikasa, C; Almeida, O F

    1999-08-01

    expression in the brain, and the changes persist in adulthood independently of gonadal secretions; v) regulation of CRH gene expression by glucocorticoids displays gender-specific patterns which are probably established during the period of sex hormone-dependent brain organization and their manifestation does not require physiological gonadal secretions in adulthood.

  12. Nuclear pore complexes as hubs for gene regulation.

    Science.gov (United States)

    D'Angelo, Maximiliano A

    2018-01-01

    Nuclear pore complexes (NPCs), the channels connecting the nucleus with the cytoplasm, are the largest protein structures of the nuclear envelope. In addition to their role in regulating nucleocytoplasmic transport, increasing evidence shows that these multiprotein structures play central roles in the regulation of gene activity. In light of recent discoveries, NPCs are emerging as scaffolds that mediate the regulation of specific gene sets at the nuclear periphery. The function of NPCs as genome organizers and hubs for transcriptional regulation provides additional evidence that the compartmentalization of genes and transcriptional regulators within the nuclear space is an important mechanism of gene expression regulation.

  13. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  14. Endogenous methanol regulates mammalian gene activity.

    Science.gov (United States)

    Komarova, Tatiana V; Petrunia, Igor V; Shindyapina, Anastasia V; Silachev, Denis N; Sheshukova, Ekaterina V; Kiryanov, Gleb I; Dorokhov, Yuri L

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  15. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  16. Redox regulation of photosynthetic gene expression.

    Science.gov (United States)

    Queval, Guillaume; Foyer, Christine H

    2012-12-19

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability.

  17. Timing of SOX9 downregulation and female sex determination in gonads of the sea turtle Lepidochelys olivacea.

    Science.gov (United States)

    Torres-Maldonado, L; Moreno-Mendoza, N; Landa, A; Merchant-Larios, H

    2001-09-15

    The SRY-related gene SOX9 is involved in the differentiation of Sertoli cells in male gonads of vertebrates with different kinds of sex determination. In the olive ridley Lepidochelys olivacea, a species with temperature sex determination (TSD), the SOX9 protein is expressed at stages 21-24 in medullary cells in gonads of embryos incubated at both male-(MPT) or female-promoting temperatures (FPT). However, at FPT the expression of SOX9 protein decreases at stage 25 and disappears at stage 26, suggesting this as the critical period for SOX9 regulation by temperature. Here, we used reverse transcriptase polymerase chain reaction (RT-PCR) to detect SOX9 transcripts in gonads of embryos switched from MPT to FPT at stage 23 and sampled at days 6-14. Simultaneously, groups of embryos were switched back to MPT and gonadal sex was established. SOX9 transcripts were detected at days 6-12 of switching, when embryos reached stage 25 and were no longer detected at day 14, when the embryos were at stage 26. Embryos switched back to MPT at days 6 or 8 formed testes, whereas embryos switched at days 10 or 14 developed ovaries. Results suggest that at MPT the male sex-determining pathway that maintains SOX9 expression in male gonads is established at stage 24. In contrast, at FPT, the female sex-determining pathway involved in downregulation of SOX9 in female gonads occurs within two days at stage 25. J. Exp. Zool. 290:498-503, 2001. Copyright 2001 Wiley-Liss, Inc.

  18. Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression.

    Science.gov (United States)

    Nian, Min; Gu, Jun; Irwin, David M; Drucker, Daniel J

    2002-01-01

    The glucagon-like peptides (GLPs) are synthesized and secreted in a nutrient-dependent manner in rodents; however, the factors regulating human GLP-1 and GLP-2 biosynthesis remain unclear. To understand how nutrients regulate human proglucagon gene expression, we studied the expression of a human proglucagon promoter-growth hormone (GH) transgene in 1.6 human glucagon-GH transgenic mice. Fasting-refeeding significantly decreased and increased the levels of circulating mouse insulin and transgene-derived hGH (P fasting vs. refeeding) and decreased and upregulated, respectively, the levels of endogenous mouse proglucagon RNA in the ileum but not in the jejunum or colon. High-fiber feeding significantly increased the levels of glucose-stimulated circulating hGH and upregulated levels of mouse intestinal proglucagon gene expression in the jejunum, ileum, and colon (P fasting-refeeding nor a high-fiber diet upregulated the expression of the human proglucagon promoter-hGH transgene. These findings demonstrate that human proglucagon gene regulatory sequences specifying tissue-specific expression in gut endocrine cells are not sufficient for recognition of energy-derived signals regulating murine glucagon gene expression in enteroendocrine cells in vivo.

  19. Sex differences in ischemic stroke sensitivity are influenced by gonadal hormones, not by sex chromosome complement

    OpenAIRE

    Manwani, Bharti; Bentivegna, Kathryn; Benashski, Sharon E; Venna, Venugopal Reddy; Xu, Yan; Arnold, Arthur P; McCullough, Louise D

    2014-01-01

    Epidemiologic studies have shown sex differences in ischemic stroke. The four core genotype (FCG) mouse model, in which the testes determining gene, Sry, has been moved from Y chromosome to an autosome, was used to dissociate the effects of sex hormones from sex chromosome in ischemic stroke outcome. Middle cerebral artery occlusion (MCAO) in gonad intact FCG mice revealed that gonadal males (XXM and XYM) had significantly higher infarct volumes as compared with gonadal females (XXF and XYF)....

  20. Disruption of apoptosis pathways involved in zebrafish gonad differentiation by 17α-ethinylestradiol and fadrozole exposures

    International Nuclear Information System (INIS)

    Luzio, Ana; Matos, Manuela; Santos, Dércia; Fontaínhas-Fernandes, António A.; Monteiro, Sandra M.

    2016-01-01

    Highlights: • Apoptosis in females is avoided by anti-apoptotic pathways and in males is essential to the “juvenile ovary” failure. • BIRC5 is central to the regulation of zebrafish spermatogenesis. • EE2 did not change sex ratios, but Fadrozole induced masculinization with a significant increase in male proportion. • The few females identified after exposure to Fadrozole may have avoided sex reversal by increasing anti-apoptotic proteins. • EE2 increased the pro-apoptotic genes/proteins in males, promoting gonad differentiation. - Abstract: Zebrafish (Danio rerio) sex determination seems to involve genetic factors (GSD) but also environmental factors (ESD), such as endocrine disrupting chemicals (EDCs) that are known to mimic endogenous hormones and disrupt gonad differentiation. Apoptosis has also been proposed to play a crucial role in zebrafish gonad differentiation. Nevertheless, the interactions between EDCs and apoptosis have received little attention. Thus, this study aimed to assess if and which apoptotic pathways are involved in zebrafish gonad differentiation and how EDCs may interfere with this process. With these purposes, zebrafish were exposed to 17α-ethinylestradiol (EE 2 , 4 ng/L) and fadrozole (Fad, 50 μg/L) from 2 h to 35 days post-fertilization (dpf). Afterwards, a gene expression analysis by qRT-PCR and a stereological analysis, based on systematic sampling and protein immunohistochemistry, were performed. The death receptors (FAS; TRADD), anti-apoptotic (BCL-2; MDM2), pro-apoptotic (CASP-2 and −6) and cell proliferation (BIRC5/survivin; JUN) genes and proteins were evaluated. In general, apoptosis was inhibited in females through the involvement of anti-apoptotic pathways, while in males apoptosis seemed to be crucial to the failure of the “juvenile ovary” development and the induction of testes transformation. The JUN protein was shown to be necessary in juvenile ovaries, while the BIRC5 protein seemed to be involved in

  1. Disruption of apoptosis pathways involved in zebrafish gonad differentiation by 17α-ethinylestradiol and fadrozole exposures

    Energy Technology Data Exchange (ETDEWEB)

    Luzio, Ana, E-mail: aluzio@utad.pt [Centre for the Research and Technology of Agro-Environmental and Biological Sciences, CITAB, Departamento de Biologia e Ambiente (DeBA), University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); Life Sciences and Environment School, University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); Matos, Manuela [University of Lisbon, Faculty of Sciences, BioISI– Biosystems & Integrative Sciences Institute, Campo Grande, 1749-016 Lisbon (Portugal); Department of Genetics and Biotechnology, Life Sciences and Environment School (ECVA), University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); Santos, Dércia [Life Sciences and Environment School, University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); Fontaínhas-Fernandes, António A.; Monteiro, Sandra M. [Centre for the Research and Technology of Agro-Environmental and Biological Sciences, CITAB, Departamento de Biologia e Ambiente (DeBA), University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); Life Sciences and Environment School, University of Trás-os-Montes and Alto Douro, UTAD, Quinta de Prados, Vila Real, 5000-801 (Portugal); and others

    2016-08-15

    Highlights: • Apoptosis in females is avoided by anti-apoptotic pathways and in males is essential to the “juvenile ovary” failure. • BIRC5 is central to the regulation of zebrafish spermatogenesis. • EE2 did not change sex ratios, but Fadrozole induced masculinization with a significant increase in male proportion. • The few females identified after exposure to Fadrozole may have avoided sex reversal by increasing anti-apoptotic proteins. • EE2 increased the pro-apoptotic genes/proteins in males, promoting gonad differentiation. - Abstract: Zebrafish (Danio rerio) sex determination seems to involve genetic factors (GSD) but also environmental factors (ESD), such as endocrine disrupting chemicals (EDCs) that are known to mimic endogenous hormones and disrupt gonad differentiation. Apoptosis has also been proposed to play a crucial role in zebrafish gonad differentiation. Nevertheless, the interactions between EDCs and apoptosis have received little attention. Thus, this study aimed to assess if and which apoptotic pathways are involved in zebrafish gonad differentiation and how EDCs may interfere with this process. With these purposes, zebrafish were exposed to 17α-ethinylestradiol (EE{sub 2}, 4 ng/L) and fadrozole (Fad, 50 μg/L) from 2 h to 35 days post-fertilization (dpf). Afterwards, a gene expression analysis by qRT-PCR and a stereological analysis, based on systematic sampling and protein immunohistochemistry, were performed. The death receptors (FAS; TRADD), anti-apoptotic (BCL-2; MDM2), pro-apoptotic (CASP-2 and −6) and cell proliferation (BIRC5/survivin; JUN) genes and proteins were evaluated. In general, apoptosis was inhibited in females through the involvement of anti-apoptotic pathways, while in males apoptosis seemed to be crucial to the failure of the “juvenile ovary” development and the induction of testes transformation. The JUN protein was shown to be necessary in juvenile ovaries, while the BIRC5 protein seemed to be involved

  2. Estrogen-regulated expression of cyp19a1a and cyp19a1b genes in swim-up fry of Labeo rohita.

    Science.gov (United States)

    Gupta, Shreyasi; Moulik, Sujata Roy; Pal, Puja; Majumder, Suravi; Das, Sumana; Guha, Payel; Juin, Subir Kumar; Panigrahi, Ashis Kumar; Mukherjee, Dilip

    2017-09-15

    P450 aromatase is the terminal enzyme in the steroidogenic pathway and catalyzes the conversion of androgens to estrogens. The expression of cyp19a1 genes in brain and gonad of Indian major carp, Labeo rohita swim-up fry was measured by quantitative real-time polymerase chain-reaction. Results demonstrated that cyp19a1b and cyp19a1a predominate in brain and gonad respectively. Treatment of fry with an aromatase inhibitor fadrozole for 6days attenuated brain cyp19a1b expression, but not cyp19a1a of gonad. Fadrozole also attenuated brain aromatase activity. Treatment with 17β-estradiol (E2) for 6days resulted in up-regulation of brain cyp19a1b transcripts in a dose- and time-dependent manner, but not cyp19a1a. Whole-body concentration of vitellogenin also increased in response to E2. Altogether, these results indicate L. rohita swim-up fry can be used to detect environmental estrogens either using vitellogenin induction or cyp19a1b gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Fine mapping of gene regions regulating neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Maria Swanberg

    Full Text Available BACKGROUND: Damage to nerve cells and axons leading to neurodegeneration is a characteristic feature of many neurological diseases. The degree of genetic influence on susceptibility to axotomy-induced neuronal death has so far been unknown. We have examined two gene regions, Vra1 and Vra2, previously linked to nerve cell loss after ventral root avulsion in a rat F2 intercross between the DA and PVG inbred rat strains. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we use two generations (G8 and G10 cohorts of an advanced intercross line between DA and PVG(av1 to reproduce linkage to Vra1 and to fine-map this region. By isolating the effect from Vra1 in congenic strains, we demonstrate that Vra1 significantly regulates the loss of motoneurons after avulsion. The regulatory effect mediated by Vra1 thus resides in a congenic fragment of 9 megabases. Furthermore, we have used the advanced intercross lines to give more support to Vra2, originally detected as a suggestive QTL. CONCLUSIONS/SIGNIFICANCE: The results demonstrated here show that naturally occurring allelic variations affect susceptibility to axotomy-induced nerve cell death. Vra1 and Vra2 represent the first quantitative trait loci regulating this phenotype that are characterized and fine mapped in an advanced intercross line. In addition, congenic strains provide experimental evidence for the Vra1 effect on the extent of injury-induced neurodegeneration. Identification of the underlying genetic variations will increase our understanding of the regulation and mechanisms of neurodegeneration.

  4. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  5. Characterization of Sus scrofa small non-coding RNAs present in both female and male gonads.

    Directory of Open Access Journals (Sweden)

    Dorota Kowalczykiewicz

    Full Text Available Small non-coding RNAs (sncRNAs are indispensable for proper germ cell development, emphasizing the need for greater elucidation of the mechanisms of germline development and regulation of this process by sncRNAs. We used deep sequencing to characterize three families of small non-coding RNAs (piRNAs, miRNAs, and tRFs present in Sus scrofa gonads and focused on the small RNA fraction present in both male and female gonads. Although similar numbers of reads were obtained from both types of gonads, the number of unique RNA sequences in the ovaries was several times lower. Of the sequences detected in the testes, 2.6% of piRNAs, 9% of miRNAs, and 10% of tRFs were also present in the ovaries. Notably, the majority of the shared piRNAs mapped to ribosomal RNAs and were derived from clustered loci. In addition, the most abundant miRNAs present in the ovaries and testes are conserved and are involved in many biological processes such as the regulation of homeobox genes, the control of cell proliferation, and carcinogenesis. Unexpectedly, we detected a novel sncRNA type, the tRFs, which are 30-36-nt RNA fragments derived from tRNA molecules, in gonads. Analysis of S. scrofa piRNAs show that testes specific piRNAs are biased for 5' uracil but both testes and ovaries specific piRNAs are not biased for adenine at the 10th nucleotide position. These observations indicate that adult porcine piRNAs are predominantly produced by a primary processing pathway or other mechanisms and secondary piRNAs generated by ping-pong mechanism are absent.

  6. Effects on circulating steroid hormones and gene expression along the hypothalamus–pituitary–gonadal axis in adult Japanese quail exposed to 17β-trenbolone across multiple generations

    Science.gov (United States)

    Karouna-Renier, Natalie K.; Chen, Yu; Henry, Paula F.; Maddox, Catherine M.; Sprague, Dan

    2017-01-01

    We investigated the effects of the androgenic growth promoter 17β-trenbolone (17βTB) on adult Japanese quail (Coturnix japonica) exposed across three generations. The F0 generation was exposed after sexual maturity to 0, 1, 5, 10, 20, and 40 ppm through feed. The F1 generation was exposed in ovo by maternal transfer and through feed at the same doses as their parents. The F2 generation was exposed in ovo only. Levels of plasma sex steroids, gonadal Cytochrome P450 aromatase (CYP19A1) mRNA and select brain neuroendocrine peptide mRNAs were measured. In males, testosterone levels did not differ in any generation from those in controls. Estradiol was significantly elevated in 17βTB treated F0 and F1 males. In F0 and F1 females, testosterone was suppressed by 17βTB, whereas estradiol was significantly higher at 40 ppm in F0 and at 10 ppm in F1 females. CYP19A1 expression in F1 males and females increased suggesting a compensatory response to the androgenic effects of 17βTB. Few significant effects were observed in the F2 birds indicating that in ovo exposure had limited effects on the monitored endpoints. Overall, our results confirmed endocrine disrupting effects of dietary 17βTB in Japanese quail but the response was dependent on sex, developmental stage at initiation of exposure, and dose.

  7. Involvement of Antizyme Characterized from the Small Abalone Haliotis diversicolor in Gonadal Development.

    Directory of Open Access Journals (Sweden)

    Wei-Dong Li

    Full Text Available The small abalone Haliotis diversicolor is an economically important mollusk that is widely cultivated in Southern China. Gonad precocity may affect the aquaculture of small abalone. Polyamines, which are small cationic molecules essential for cellular proliferation, may affect gonadal development. Ornithine decarboxylase (ODC and antizyme (AZ are essential elements of a feedback circuit that regulates cellular polyamines. This paper presents the molecular cloning and characterization of AZ from small abalone. Sequence analysis showed that the cDNA sequence of H. diversicolor AZ (HdiODCAZ consisted of two overlapping open reading frames (ORFs and conformed to the +1 frameshift property of the frame. Thin Layer chromatography (TLC analysis suggested that the expressed protein encoded by +1 ORF2 was the functional AZ that targets ODC to 26S proteasome degradation. The result demonstrated that the expression level of AZ was higher than that of ODC in the ovary of small abalone. In addition, the expression profiles of ODC and AZ at the different development stages of the ovary indicated that these two genes might be involved in the gonadal development of small abalone.

  8. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  9. Mining significant high utility gene regulation sequential patterns.

    Science.gov (United States)

    Zihayat, Morteza; Davoudi, Heidar; An, Aijun

    2017-12-14

    Mining frequent gene regulation sequential patterns in time course microarray datasets is an important mining task in bioinformatics. Although finding such patterns are of paramount important for studying a disease, most existing work do not consider gene-disease association during gene regulation sequential pattern discovery. Moreover, they consider more absent/existence effects of genes during the mining process than taking the degrees of genes expression into account. Consequently, such techniques discover too many patterns which may not represent important information to biologists to investigate the relationships between the disease and underlying reasons hidden in gene regulation sequences. We propose a utility model by considering both the gene-disease association score and their degrees of expression levels under a biological investigation. We propose an efficient method called Top-HUGS, for discoverying significant high utility gene regulation sequential patterns from a time-course microarray dataset. In this study, the proposed methods were evaluated on a publicly available time course microarray dataset. The experimental results show higher accuracies compared to the baseline methods. Our proposed methods found that several new gene regulation sequential patterns involved in such patterns were useful for biologists and provided further insights into the mechanisms underpinning biological processes. To effectively work with the proposed method, a web interface is developed to our system using Java. To the best of our knowledge, this is the first demonstration for significant high utility gene regulation sequential pattern discovery.

  10. [Gene networks that regulate secondary metabolism in actinomycetes: pleiotropic regulators].

    Science.gov (United States)

    Rabyk, M V; Ostash, B O; Fedorenko, V O

    2014-01-01

    Current advances in the research and practical applications of pleiotropic regulatory genes for antibiotic production in actinomycetes are reviewed. The basic regulatory mechanisms found in these bacteria are outlined. Examples described in the review show the importance of the manipulation of regulatory systems that affect the synthesis of antibiotics for the metabolic engineering of the actinomycetes. Also, the study of these genes is the basis for the development of genetic engineering approaches towards the induction of "cryptic" part of the actinomycetes secondary metabolome, which capacity for production of biologically active compounds is much bigger than the diversity of antibiotics underpinned by traditional microbiological screening. Besides the practical problems, the study of regulatory genes for antibiotic biosynthesis will provide insights into the process of evolution of complex regulatory systems that coordinate the expression of gene operons, clusters and regulons, involved in the control of secondary metabolism and morphogenesis of actinomycetes.

  11. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...... efficacy. Consequently, differences in the miRNA expression among individuals could be an important factor contributing to differential drug response. Pharmacogenomics genes can be divided into drug target genes termed as pharmacodynamics genes (PD) and genes involved in drug transport and metabolism...

  12. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  13. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.

    Science.gov (United States)

    Chen, Sijie; Zhang, Hefei; Wang, Fenghua; Zhang, Wei; Peng, Gang

    2016-09-15

    Sex determinations are diverse in vertebrates. Although many sex-determining genes and pathways are conserved, the mechanistic roles of these genes and pathways in the genetic sex determination are not well understood. DAX1 (encoded by the NR0B1 gene) is a vertebrate specific orphan nuclear receptor that regulates gonadal development and sexual determination. In human, duplication of the NR0B1 gene leads to male-to-female sex reversal. In mice, Nr0b1 shows both pro-testis and anti-testis functions. We generated inheritable nr0b1 mutation in the zebrafish and found the nr0b1 mutation caused homozygous mutants to develop as fertile males due to female-to-male sex reversal. The nr0b1 mutation did not increase Caspase-3 labeling nor tp53 expression in the developing gonads. Introduction of a tp53 mutation into the nr0b1 mutant did not rescue the sex-reversal phenotype. Further examination revealed reduction in cell proliferation and abnormal somatic cell differentiation in the nr0b1 mutant gonads at the undifferentiated and bi-potential ovary stages. Together, our results suggest nr0b1 regulates somatic cell differentiation and cell proliferation to ensure normal sex development in the zebrafish. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  15. Sequencing and De Novo Assembly of the Gonadal Transcriptome of the Endangered Chinese Sturgeon (Acipenser sinensis.

    Directory of Open Access Journals (Sweden)

    Huamei Yue

    Full Text Available The Chinese sturgeon (Acipenser sinensis is endangered through anthropogenic activities including over-fishing, damming, shipping, and pollution. Controlled reproduction has been adopted and successfully conducted for conservation. However, little information is available on the reproductive regulation of the species. In this study, we conducted de novo transcriptome assembly of the gonad tissue to create a comprehensive dataset for A. sinensis.The Illumina sequencing platform was adopted to obtain 47,333,701 and 47,229,705 high quality reads from testis and ovary cDNA libraries generated from three-year-old A. sinensis. We identified 86,027 unigenes of which 30,268 were annotated in the NCBI non-redundant protein database and 28,281 were annotated in the Swiss-prot database. Among the annotated unigenes, 26,152 and 7,734 unigenes, respectively, were assigned to gene ontology categories and clusters of orthologous groups. In addition, 12,557 unigenes were mapped to 231 pathways in the Kyoto Encyclopedia of Genes and Genomes Pathway database. A total of 1,896 unigenes, potentially differentially expressed between the two gonad types, were found, with 1,894 predicted to be up-regulated in ovary and only two in testis. Fifty-five potential gametogenesis-related genes were screened in the transcriptome and 34 genes with significant matches were found. Besides, more paralogs of 11 genes in three gene families (sox, apolipoprotein and cyclin were found in A. sinensis compared to their orthologs in the diploid Danio rerio. In addition, 12,151 putative simple sequence repeats (SSRs were detected.This study provides the first de novo transcriptome analysis currently available for A. sinensis. The transcriptomic data represents the fundamental resource for future research on the mechanism of early gametogenesis in sturgeons. The SSRs identified in this work will be valuable for assessment of genetic diversity of wild fish and genealogy management of

  16. Epigenetic Regulation of Higher Order Chromatin Conformations and Gene Transcription

    OpenAIRE

    Göndör, Anita

    2007-01-01

    Epigenetic states constitute heritable features of the chromatin to regulate when, where and how genes are expressed in the developing conceptus. A special case of epigenetic regulation, genomic imprinting, is defined as parent of origin-dependent monoallelic expression. The Igf2-H19 locus is considered as paradigm of genomic imprinting with a growth-promoting gene, Igf2, expressed paternally and a growth antagonist, H19 encoding a non-coding transcript, expressed only from the maternal allel...

  17. Unraveling the complex epigenetic mechanisms that regulate gene activity

    NARCIS (Netherlands)

    Bemer, Marian

    2018-01-01

    Our understanding of the epigenetic mechanisms that regulate gene expression has been largely increased in recent years by the development and refinement of different techniques. This has revealed that gene transcription is highly influenced by epigenetic mechanisms, i.e., those that do not involve

  18. Regulation of gene expression in entomopathogenic fungi in three ...

    African Journals Online (AJOL)

    The entomopathogenic fungi are subject to regulation system known as signal transduction that regulates the expression of the different genes required for each life stage, first comprising cuticle adhesion and degradation, later the survival in the hemolymph, and finally the fungal growth in soils. There are two ...

  19. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    S., Bertucci, F., Birnbaum, D., Nguyen, C., Harousseau, J.L., Bataille , R., Houlgatte, R., and Minvielle, S. 2003. Gene expression profiling of...role of Rho in cell transformation by oncogenic Ras. Oncogene 10:2289-2296. 182. Pykett, M.J., Murphy, M., Harnish, P.R., and George , D.L. 1994. The

  20. Regulation of Clock Genes by Adrenergic Receptor Signaling in Osteoblasts.

    Science.gov (United States)

    Hirai, Takao

    2018-01-01

    The clock system has been identified as one of the major mechanisms controlling cellular functions. Circadian clock gene oscillations also actively participate in the functions of various cell types including bone-related cells. Previous studies demonstrated that clock genes were expressed in bone tissue and also that their expression exhibited circadian rhythmicity. Recent findings have shown that sympathetic tone plays a central role in biological oscillations in bone. Adrenergic receptor (AR) signaling regulates the expression of clock genes in cancellous bone. Furthermore, α 1 -AR signaling in osteoblasts is known to negatively regulate the expression of bone morphogenetic protein-4 (Bmp4) by up-regulating nuclear factor IL-3 (Nfil3)/e4 promoter-binding protein 4 (E4BP4). The ablation of α 1B -AR signaling also increases the expression of the Bmp4 gene in bone. The findings of transient overexpression and siRNA experiments have supported the involvement of the transcription factor CCAAT/enhancer-binding protein delta (C/EBPδ, Cebpd) in Nfil3 and Bmp4 expression in MC3T3-E1 cells. These findings suggest that the effects of Cebpd are due to the circadian regulation of Bmp4 expression, at least in part, by the up-regulated expression of the clock gene Nfil3 in response to α 1B -AR signaling in osteoblasts. Therefore, AR signaling appears to modulate cellular functionality through the expression of clock genes that are circadian rhythm regulators in osteoblasts. The expression of clock genes regulated by the sympathetic nervous system and clock-controlled genes that affect bone metabolism are described herein.

  1. Plant defense genes are regulated by ethylene

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  2. Regulation of bacterial gene expression by ribosome stalling and rescuing.

    Science.gov (United States)

    Jin, Yongxin; Jin, Shouguang; Wu, Weihui

    2016-05-01

    Ribosome is responsible for protein synthesis and is able to monitor the sequence and structure of the nascent peptide. Such ability plays an important role in determining overall gene expression profile of the bacteria through ribosome stalling and rescuing. In this review, we briefly summarize our current understanding of the regulation of gene expression through ribosome stalling and rescuing in bacteria, as well as mechanisms that modulate ribosome activity. Understanding the mechanisms of how bacteria modulate ribosome activity will provide not only fundamental insights into bacterial gene regulation, but also new candidate targets for the development of novel antimicrobial agents.

  3. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  4. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  5. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  6. Y Chromosome Regulation of Autism Susceptibility Genes

    Science.gov (United States)

    2009-06-01

    autistic children. Such distorted ratio could be as high as 8:1 in some populations [12, 13]. Sexual dimorphism in autism is a key and consistent... autism [18-24]. Recent studies in our laboratory suggest that genes on the Y chromosome could contribute to such sexual dimorphisms, thereby raising the...contribute to autism susceptibility, have provided a critical clue that the male-only chromosome is potentially a key player in the sexual dimorphism

  7. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  8. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  9. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  10. Divergence of gene regulation through chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Messing Joachim

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity

  11. Effects of Microcystis on Hypothalamic-Pituitary-Gonadal-Liver Axis in Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Chen, Jiazhang; Meng, Shunlong; Xu, Hai; Zhang, Zhen; Wu, Xiangyang

    2017-04-01

    In the present study, Nile tilapia (Oreochromis niloticus) were used to assess the endocrine disruption potential of Microcytis aeruginosa. Male Nile tilapia were exposed to lyophilized M. aeruginosa or purified microcystin-LR (8.3 μg/L) for 28 days. The levels of serum hormones (17β-estradiol and testosterone) and transcripts of selected genes in the hypothalamus-pituitary-gonadal-liver axis were analyzed. The results showed that serum hormones were significantly up-regulated, and transcripts of 13 genes (GHRH, PACAP, GH, GHR1, GHR2, IGF1, IGF2, CYP19a, CYP19b, 3β-HSD1, 20β-HSD, 17β-HSD1 and 17β-HSD8) were significantly altered after Microcytis exposure. These results indicate that fish reproduction can be altered in a Microcystis bloom-contaminated aquatic environment.

  12. Early stress causes sex-specific, life-long changes in behaviour, levels of gonadal hormones, and gene expression in chickens.

    Directory of Open Access Journals (Sweden)

    Magnus Elfwing

    Full Text Available Early stress can have long-lasting phenotypic effects. Previous research shows that male and female chickens differ in many behavioural aspects, and respond differently to chronic stress. The present experiment aimed to broadly characterize long-term sex differences in responses to brief events of stress experienced during the first weeks of life. Chicks from a commercial egg-laying hybrid were exposed to stress by inducing periods of social isolation during their first three weeks of life, followed by a broad behavioural, physiological and genomic characterization throughout life. Early stressed males, but not females, where more anxious in an open field-test, stayed shorter in tonic immobility and tended to have delayed sexual maturity, as shown by a tendency for lower levels of testosterone compared to controls. While early stressed females did not differ from non-stressed in fear and sexual maturation, they were more socially dominant than controls. The differential gene expression profile in hypothalamus was significantly correlated from 28 to 213 days of age in males, but not in females. In conclusion, early stress had a more pronounced long-term effect on male than on female chickens, as evidenced by behavioral, endocrine and genomic responses. This may either be attributed to inherent sex differences due to evolutionary causes, or possibly to different stress related selection pressures on the two sexes during commercial chicken breeding.

  13. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  14. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  15. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  16. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  17. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  18. Cloning of genomic sequences of three crustacean hyperglycemic hormone superfamily genes and elucidation of their roles of regulating insulin-like androgenic gland hormone gene.

    Science.gov (United States)

    Li, Fajun; Bai, Hongkun; Zhang, Wenyi; Fu, Hongtuo; Jiang, Fengwei; Liang, Guoxia; Jin, Shubo; Sun, Shengming; Qiao, Hui

    2015-04-25

    The insulin-like androgenic gland hormone (IAG) gene in crustaceans plays an important role in male sexual differentiation, metabolism, and growth. However, the upstream regulation of IAG signaling schemes remains poorly studied. In the present study, we cloned the 5' flanking sequence of IAG and full-length genomic sequences of gonad-inhibiting hormone (Mn-GIH), molt-inhibiting hormone (Mn-MIH) and crustacean hyperglycemic hormone (Mn-CHH) in Macrobrachium nipponense. We identified the transcription factor-binding sites in the 5' flanking sequence of IAG and investigated the exon-intron patterns of the three CHH superfamily genes. Each CHH superfamily gene consisted of two introns separating three exons. Mn-GIH and Mn-MIH shared the same intron insertion sites, which differed from Mn-CHH. We provided DNA-level evidence for the type definition. We also identified two cAMP response elements in the 5' untranslated region. We further investigated the regulatory relationships between Mn-GIH, Mn-MIH, and Mn-CHH and IAG at the transcriptional level by injection of double-stranded RNA (dsRNA). IAG transcription levels were significantly increased to 660.2%, 472.9%, and 112.4% of control levels in the Mn-GIH dsRNA, Mn-MIH dsRNA, and Mn-CHH dsRNA groups, respectively. The results clearly demonstrated that Mn-GIH and Mn-MIH, but not Mn-CHH, negatively regulate the expression of the IAG gene. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. [Regulation of extramitochondrial malic enzyme gene expression in lipogenic tissues].

    Science.gov (United States)

    Stelmańska, Ewa

    2007-11-06

    Extramitochondrial malic enzyme is widely distributed in mammalian tissues, including humans. The major role of this protein in the liver and white adipose tissue is the production of NADPH required for fatty-acid synthesis. Malic enzyme thus belongs to the family of lipogenic enzymes. Malic enzyme activity is regulated both by gene transcription and mRNA stability. Malic enzyme gene expression is tightly controlled by hormonal (i.e. insulin, glucagon, triiodothyronine) and nutritional conditions. There are many transcription factors which recognize special response elements present in the malic enzyme gene promoter. In this paper some important information about the structure and regulation of malic enzyme gene expression in mammalian lipogenic tissues is presented.

  20. Development of retroviral vectors for tissue-restricted expression in chicken embryonic gonads.

    Directory of Open Access Journals (Sweden)

    Luke S Lambeth

    Full Text Available The chicken embryo has long been a useful model organism for studying development, including sex determination and gonadal differentiation. However, manipulating gene expression specifically in the embryonic avian gonad has been difficult. The viral vector RCASBP can be readily used for embryo-wide transgene expression; however global mis-expression using this method can cause deleterious off-target effects and embryo-lethality. In an attempt to develop vectors for the over-expression of sequences in chicken embryonic urogenital tissues, the viral vector RCANBP was engineered to contain predicted promoter sequences of gonadal-expressed genes. Several promoters were analysed and it was found that although the SF1 promoter produced a tissue-restricted expression pattern that was highest in the mesonephros and liver, it was also higher in the gonads compared to the rest of the body. The location of EGFP expression from the SF1 promoter overlapped with several key gonad-expressed sex development genes; however expression was generally low-level and was not seen in all gonadal cells. To further validate this sequence the key testis determinant DMRT1 was over-expressed in female embryos, which due to insufficient levels had no effect on gonad development. The female gene aromatase was then over-expressed in male embryos, which disrupted the testis pathway as demonstrated by a reduction in AMH protein. Taken together, although these data showed that the SF1 promoter can be used for functional studies in ovo, a stronger promoter sequence would likely be required for the functional analysis of gonad genes that require high-level expression.

  1. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  2. PARP-1 and gene regulation: progress and puzzles.

    Science.gov (United States)

    Kraus, W Lee; Hottiger, Michael O

    2013-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1), also referred to as ADP-ribosyltransferase Diphtheria toxin-like 1 (ARTD1), is an abundant nuclear protein that plays key roles in a variety of nuclear processes, including the regulation of transcription. PARP-1 possesses an intrinsic enzymatic activity that catalyzes the transfer of ADP-ribose (ADPR) units from nicotinamide adenine dinucleotide (NAD(+)) onto target gene regulatory proteins, thereby modulating their activities. Although great strides have been made in the past decade in deciphering the seemingly opposing and varied roles of PARP-1 in gene regulation, many puzzles remain. In this review, we discuss the current state of understanding in this area, especially how PARP-1 interfaces with various components of gene regulatory pathways (e.g., the basal transcription machinery, DNA-binding transcription factors, coregulators, chromatin remodeling, histone modifications, and DNA methylation). In addition, we discuss some gene-specific, cell type-specific, and cell state-specific effects of PARP-1 on gene regulation, which might contribute to its biological functions. Finally, we review some of the recent progress targeting PARPs using chemical inhibitors, some of which may alter PARP-1-dependent gene regulatory programs to promote therapeutic outcomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Decapping of long noncoding RNAs regulates inducible genes.

    Science.gov (United States)

    Geisler, Sarah; Lojek, Lisa; Khalil, Ahmad M; Baker, Kristian E; Coller, Jeff

    2012-02-10

    Decapping represents a critical control point in regulating expression of protein coding genes. Here, we demonstrate that decapping also modulates expression of long noncoding RNAs (lncRNAs). Specifically, levels of >100 lncRNAs in yeast are controlled by decapping and are degraded by a pathway that occurs independent of decapping regulators. We find many lncRNAs degraded by DCP2 are expressed proximal to inducible genes. Of these, we show several genes required for galactose utilization are associated with lncRNAs that have expression patterns inversely correlated with their mRNA counterpart. Moreover, decapping of these lncRNAs is critical for rapid and robust induction of GAL gene expression. Failure to destabilize a lncRNA known to exert repressive histone modifications results in perpetuation of a repressive chromatin state that contributes to reduced plasticity of gene activation. We propose that decapping and lncRNA degradation serve a vital role in transcriptional regulation specifically at inducible genes. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. A genomic atlas of human adrenal and gonad development [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Ignacio del Valle

    2017-04-01

    Full Text Available Background: In humans, the adrenal glands and gonads undergo distinct biological events between 6-10 weeks post conception (wpc, such as testis determination, the onset of steroidogenesis and primordial germ cell development. However, relatively little is currently known about the genetic mechanisms underlying these processes. We therefore aimed to generate a detailed genomic atlas of adrenal and gonad development across these critical stages of human embryonic and fetal development. Methods: RNA was extracted from 53 tissue samples between 6-10 wpc (adrenal, testis, ovary and control. Affymetrix array analysis was performed and differential gene expression was analysed using Bioconductor. A mathematical model was constructed to investigate time-series changes across the dataset. Pathway analysis was performed using ClueGo and cellular localisation of novel factors confirmed using immunohistochemistry. Results: Using this approach, we have identified novel components of adrenal development (e.g. ASB4, NPR3 and confirmed the role of SRY as the main human testis-determining gene. By mathematical modelling time-series data we have found new genes up-regulated with SOX9 in the testis (e.g. CITED1, which may represent components of the testis development pathway. We have shown that testicular steroidogenesis has a distinct onset at around 8 wpc and identified potential novel components in adrenal and testicular steroidogenesis (e.g. MGARP, FOXO4, MAP3K15, GRAMD1B, RMND2, as well as testis biomarkers (e.g. SCUBE1. We have also shown that the developing human ovary expresses distinct subsets of genes (e.g. OR10G9, OR4D5, but enrichment for established biological pathways is limited. Conclusion: This genomic atlas is revealing important novel aspects of human development and new candidate genes for adrenal and reproductive disorders.

  5. A genomic atlas of human adrenal and gonad development [version 2; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Ignacio del Valle

    2017-10-01

    Full Text Available Background: In humans, the adrenal glands and gonads undergo distinct biological events between 6-10 weeks post conception (wpc, such as testis determination, the onset of steroidogenesis and primordial germ cell development. However, relatively little is currently known about the genetic mechanisms underlying these processes. We therefore aimed to generate a detailed genomic atlas of adrenal and gonad development across these critical stages of human embryonic and fetal development. Methods: RNA was extracted from 53 tissue samples between 6-10 wpc (adrenal, testis, ovary and control. Affymetrix array analysis was performed and differential gene expression was analysed using Bioconductor. A mathematical model was constructed to investigate time-series changes across the dataset. Pathway analysis was performed using ClueGo and cellular localisation of novel factors confirmed using immunohistochemistry. Results: Using this approach, we have identified novel components of adrenal development (e.g. ASB4, NPR3 and confirmed the role of SRY as the main human testis-determining gene. By mathematical modelling time-series data we have found new genes up-regulated with SOX9 in the testis (e.g. CITED1, which may represent components of the testis development pathway. We have shown that testicular steroidogenesis has a distinct onset at around 8 wpc and identified potential novel components in adrenal and testicular steroidogenesis (e.g. MGARP, FOXO4, MAP3K15, GRAMD1B, RMND2, as well as testis biomarkers (e.g. SCUBE1. We have also shown that the developing human ovary expresses distinct subsets of genes (e.g. OR10G9, OR4D5, but enrichment for established biological pathways is limited. Conclusion: This genomic atlas is revealing important novel aspects of human development and new candidate genes for adrenal and reproductive disorders.

  6. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  7. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  8. Epigenetic regulation of inducible gene expression in the immune system.

    Science.gov (United States)

    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha

    2013-07-01

    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation. © 2013 John Wiley & Sons Ltd.

  9. Regulation of human autoimmune regulator (AIRE) gene translation by miR-220b.

    Science.gov (United States)

    Matsuo, Tomohito; Noguchi, Yukiko; Shindo, Mieko; Morita, Yoshifumi; Oda, Yoshie; Yoshida, Eiko; Hamada, Hiroko; Harada, Mine; Shiokawa, Yuichi; Nishida, Takahiro; Tominaga, Ryuji; Kikushige, Yoshikane; Akashi, Koichi; Kudoh, Jun; Shimizu, Nobuyoshi; Tanaka, Yuka; Umemura, Tsukuru; Taniguchi, Taketoshi; Yoshimura, Akihiko; Kobayashi, Takashi; Mitsuyama, Masao; Kurisaki, Hironori; Katsuta, Hitoshi; Nagafuchi, Seiho

    2013-11-01

    Although mutations of autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), presenting a wide spectrum of many characteristic and non-characteristic clinical features, some patients lack AIRE gene mutations. Therefore, something other than a mutation, such as dysregulation of AIRE gene, may be a causal factor for APECED or its related diseases. However, regulatory mechanisms for AIRE gene expression and/or translation have still remained elusive. We found that IL-2-stimulated CD4(+) T (IL-2T) cells showed a high expression of AIRE gene, but very low AIRE protein production, while Epstein-Barr virus-transformed B (EBV-B) cells express both AIRE gene and AIRE protein. By using microarray analysis, we could identify miR-220b as a possible regulatory mechanism for AIRE gene translation in IL-2T cells. Here we report that miR-220b significantly reduced the expression of AIRE protein in AIRE gene with 3'UTR region transfected 293T cells, whereas no alteration of AIRE protein production was observed in the open reading frame of AIRE gene alone transfected cells. In addition, anti-miR-220b reversed the inhibitory function of miR-220b for the expression of AIRE protein in AIRE gene with 3'UTR region transfected cells. Moreover, when AIRE gene transfected cells with mutated 3'UTR were transfected with miR-220b, no reduction of AIRE protein production was observed. Taken together, it was concluded that miR-220b inhibited the AIRE gene translation through the 3'UTR region of AIRE gene, indicating that miR-220b could serve as a regulator for human AIRE gene translation. © 2013.

  10. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  11. Ontogenic and morphological study of gonadal formation in genetically-modified sex reversal XY(POS) mice.

    Science.gov (United States)

    Umemura, Yuria; Miyamoto, Ryosuke; Hashimoto, Rie; Kinoshita, Kyoko; Omotehara, Takuya; Nagahara, Daichi; Hirano, Tetsushi; Kubota, Naoto; Minami, Kiichi; Yanai, Shogo; Masuda, Natsumi; Yuasa, Hideto; Mantani, Youhei; Matsuo, Eiko; Yokoyama, Toshifumi; Kitagawa, Hiroshi; Hoshi, Nobuhiko

    2016-01-01

    Mammalian sexual fate is determined by the presence or absence of sex determining region of the Y chromosome (Sry) in the "bipotential" gonads. Recent studies have demonstrated that both male and female sexual development are induced by distinct and active genetic pathways. Breeding the Y chromosome from Mus m. domesticus poschiavinus (POS) strains into C57BL/6J (B6J) mice (B6J-XY(POS)) has been shown to induce sex reversal (75%: bilateral ovary, 25%: true hermaphrodites). However, our B6N-XY(POS) mice, which were generated by backcrossing of B6J-XY(POS) on an inbred B6N-XX, develop as males (36%: bilateral testis with fertility as well as bilateral ovary (34%), and the remainder develop as true hermaphrodites. Here, we investigated in detail the expressions of essential sex-related genes and histological features in B6N-XY(POS) mice from the fetal period to adulthood. The onsets of both Sry and SRY-box 9 (Sox9) expressions as determined spatiotemporally by whole-mount immunohistochemistry in the B6N-XY(POS) gonads occurred 2-3 tail somites later than those in B6N-XY(B6) gonads, but earlier than those in B6J-XY(POS), respectively. It is possible that such a small difference in timing of the Sry expression underlies testicular development in our B6N-XY(POS). Our study is the first to histologically show the expression and ectopic localization of a female-related gene in the XY(POS) testes and a male-related gene in the XY(POS) ovaries. The results from these and previous experiments indicate that the interplay between genome variants, epigenetics and developmental gene regulation is crucial for testis development.

  12. Genes, epigenetics and miRNA regulation in the placenta.

    Science.gov (United States)

    Vaiman, Daniel

    2017-04-01

    This text reviews briefly the context in which epigenetics regulate gene expression in trophoblast development and function. It is an attempt to focus on a limited number of recent papers that, according to the author, shed new light on placental development, and constitute possible trails for improving knowledge and women follow-up in pathological pregnancies. Copyright © 2016. Published by Elsevier Ltd.

  13. What DNA sequence tells us about gene regulation - The ...

    Indian Academy of Sciences (India)

    Rahul Siddharthan

    2007-11-03

    Nov 3, 2007 ... Predicting cis-regulatory modules: eve enhancers. Performance, even without prior WMs, comparable to dedicated CRM prediction programs like Stubb. Rahul Siddharthan. (The Institute of Mathematical Sciences, Chennai 600 113. What DNA sequence tells us about gene regulation. 03/11/2007. 27 / 34 ...

  14. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    Introduction. The genetic regulation of adult brain development has re- mained enigmatic to developmental biologists since long. The practical difficulty in understanding the adult brain de- velopment is that most of the mutational searches done for genes in different model systems yield mutations inducing embryonic ...

  15. Gene Expression Profiling of Apoptosis Regulators in Patients with Sepsis

    NARCIS (Netherlands)

    Hoogerwerf, Jacobien J.; van Zoelen, Marieke A.; Wiersinga, W. Joost; van 't Veer, Cornelis; de Vos, Alex F.; de Boer, Anita; Schultz, Marcus J.; Hooibrink, Berend; de Jonge, Evert; van der Poll, Tom

    2010-01-01

    Introduction: Sepsis is associated with a dysregulation of apoptosis in immune cells, which has been implicated in both immunosuppression and multiple organ failure. We describe the expression profiles of genes encoding key regulators of apoptosis in highly purified monocytes, granulocytes and CD4+

  16. ApoM: gene regulation and effects on HDL metabolism

    DEFF Research Database (Denmark)

    Nielsen, Lars B; Christoffersen, Christina; Ahnström, Josefin

    2009-01-01

    The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid and gluc...

  17. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    2Flinders Centre for Innovation in Cancer, School of Medicine, Flinders University, Flinders Medical Centre,. Adelaide 5042, Australia .... gene regulation mechanisms, lncRNAs have distinct features from other regulatory ncRNAs ...... blastoma (RB) in human colorectal cancer (Tsang et al. 2010; Hauptman and Glavac 2013) ...

  18. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-08-01

    Full Text Available Abstract Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in

  19. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Science.gov (United States)

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  20. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  1. Identification of Master Regulator Genes in Human Periodontitis.

    Science.gov (United States)

    Sawle, A D; Kebschull, M; Demmer, R T; Papapanou, P N

    2016-08-01

    Analytic approaches confined to fold-change comparisons of gene expression patterns between states of health and disease are unable to distinguish between primary causal disease drivers and secondary noncausal events. Genome-wide reverse engineering approaches can facilitate the identification of candidate genes that may distinguish between causal and associative interactions and may account for the emergence or maintenance of pathologic phenotypes. In this work, we used the algorithm for the reconstruction of accurate cellular networks (ARACNE) to analyze a large gene expression profile data set (313 gingival tissue samples from a cross-sectional study of 120 periodontitis patients) obtained from clinically healthy (n = 70) or periodontitis-affected (n = 243) gingival sites. The generated transcriptional regulatory network of the gingival interactome was subsequently interrogated with the master regulator inference algorithm (MARINA) and gene expression signature data from healthy and periodontitis-affected gingiva. Our analyses identified 41 consensus master regulator genes (MRs), the regulons of which comprised between 25 and 833 genes. Regulons of 7 MRs (HCLS1, ZNF823, XBP1, ZNF750, RORA, TFAP2C, and ZNF57) included >500 genes each. Gene set enrichment analysis indicated differential expression of these regulons in gingival health versus disease with a type 1 error between 2% and 0.5% and with >80% of the regulon genes in the leading edge. Ingenuity pathway analysis showed significant enrichment of 36 regulons for several pathways, while 6 regulons (those of MRs HCLS1, IKZF3, ETS1, NHLH2, POU2F2, and VAV1) were enriched for >10 pathways. Pathways related to immune system signaling and development were the ones most frequently enriched across all regulons. The unbiased analysis of genome-wide regulatory networks can enhance our understanding of the pathobiology of human periodontitis and, after appropriate validation, ultimately identify target molecules of

  2. Sperm Production Rate, Gonadal and Extragonadal Sperm ...

    African Journals Online (AJOL)

    Five healthy West African Dwarf (WAD) rams, 1.5 to 2.5 years of age and weighing between 15 kg to 20 kg were used to determine daily sperm production, gonadal and exragonadal sperm reserves. Gonadal and extragonadal sperm reserves were estimated by the haemocytometric method, while the daily sperm production ...

  3. Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes.

    Science.gov (United States)

    McKeon, J; Slade, E; Sinclair, D A; Cheng, N; Couling, M; Brock, H W

    1994-09-01

    Mutations in several Polycomb (Pc) group genes cause maternal-effect or zygotic segmentation defects, suggesting that Pc group genes may regulate the segmentation genes of Drosophila. We show that individuals doubly heterozygous for mutations in polyhomeotic and six other Pc group genes show gap, pair rule, and segment polarity segmentation defects. We examined double heterozygous combinations of Pc group and segmentation mutations for enhancement of adult and embryonic segmentation defects. Posterior sex combs and polyhomeotic interact with Krüppel and enhance embryonic phenotypes of hunchback and knirps, and polyhomeotic enhances even-skipped. Surprisingly, flies carrying duplications of extra sex combs (esc), that were heterozygous for mutations of even-skipped (eve), were extremely subvital. Embryos and surviving adults of this genotype showed strong segmentation defects in even-numbered segments. Antibody studies confirm that expression of eve is suppressed by duplications of esc. However, esc duplications have no effect on other gap or pair rule genes tested. To our knowledge, this is only the second triplo-abnormal phenotype associated with Pc group genes. Duplications of nine other Pc group genes have no detectable effect on eve. Expression of engrailed (en) was abnormal in the central nervous systems of most Pc group mutants. These results support a role for Pc genes in regulation of some segmentation genes, and suggest that esc may act differently from other Pc group genes.

  4. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  5. Sox9 gene regulation and the loss of the XY/XX sex-determining mechanism in the mole vole Ellobius lutescens.

    Science.gov (United States)

    Bagheri-Fam, Stefan; Sreenivasan, Rajini; Bernard, Pascal; Knower, Kevin C; Sekido, Ryohei; Lovell-Badge, Robin; Just, Walter; Harley, Vincent R

    2012-01-01

    In most mammals, the Y chromosomal Sry gene initiates testis formation within the bipotential gonad, resulting in male development. SRY is a transcription factor and together with SF1 it directly up-regulates the expression of the pivotal sex-determining gene Sox9 via a 1.3-kb cis-regulatory element (TESCO) which contains an evolutionarily conserved region (ECR) of 180 bp. Remarkably, several rodent species appear to determine sex in the absence of Sry and a Y chromosome, including the mole voles Ellobius lutescens and Ellobius tancrei, whereas Ellobius fuscocapillus of the same genus retained Sry. The sex-determining mechanisms in the Sry-negative species remain elusive. We have cloned and sequenced 1.1 kb of E. lutescens TESCO which shares 75% sequence identity with mouse TESCO indicating that testicular Sox9 expression in E. lutescens might still be regulated via TESCO. We have also cloned and sequenced the ECRs of E. tancrei and E. fuscocapillus. While the three Ellobius ECRs are highly similar (94-97% sequence identity), they all display a 14-bp deletion (Δ14) removing a highly conserved SOX/TCF site. Introducing Δ14 into mouse TESCO increased both basal activity and SF1-mediated activation of TESCO in HEK293T cells. We propose a model whereby Δ14 may have triggered up-regulation of Sox9 in XX gonads leading to destabilization of the XY/XX sex-determining mechanism in Ellobius. E. lutescens/E. tancrei and E. fuscocapillus could have independently stabilized their sex determination mechanisms by Sry-independent and Sry-dependent approaches, respectively.

  6. Functional Enhancers As Master Regulators of Tissue-Specific Gene Regulation and Cancer Development

    Science.gov (United States)

    Ko, Je Yeong; Oh, Sumin; Yoo, Kyung Hyun

    2017-01-01

    Tissue-specific transcription is critical for normal development, and abnormalities causing undesirable gene expression may lead to diseases such as cancer. Such highly organized transcription is controlled by enhancers with specific DNA sequences recognized by transcription factors. Enhancers are associated with chromatin modifications that are distinct epigenetic features in a tissue-specific manner. Recently, super-enhancers comprising enhancer clusters co-occupied by lineage-specific factors have been identified in diverse cell types such as adipocytes, hair follicle stem cells, and mammary epithelial cells. In addition, noncoding RNAs, named eRNAs, are synthesized at super-enhancer regions before their target genes are transcribed. Many functional studies revealed that super-enhancers and eRNAs are essential for the regulation of tissue-specific gene expression. In this review, we summarize recent findings concerning enhancer function in tissue-specific gene regulation and cancer development. PMID:28359147

  7. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  8. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  9. Sexually dimorphic gene regulation in brain as a target for endocrine disrupters: Developmental exposure of rats to 4-methylbenzylidene camphor

    International Nuclear Information System (INIS)

    Maerkel, Kirsten; Durrer, Stefan; Henseler, Manuel; Schlumpf, Margret; Lichtensteiger, Walter

    2007-01-01

    The developing neuroendocrine brain represents a potential target for endocrine active chemicals. The UV filter 4-methylbenzylidene camphor (4-MBC) exhibits estrogenic activity, but also interferes with the thyroid axis. We investigated effects of pre- and postnatal exposure to 4-MBC in the same rat offspring at brain and reproductive organ levels. 4-MBC (7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to the offspring until adulthood. mRNA of estrogen target genes involved in control of sexual behavior and gonadal functions was measured by real-time RT-PCR in ventromedial hypothalamic nucleus (VMH) and medial preoptic area (MPO) of adult offspring. 4-MBC exposure affected mRNA levels of ER alpha, progesterone receptor (PR), preproenkephalin (PPE) and insulin-like growth factor-I (IGF-I) in a sex- and region-specific manner. In order to assess possible changes in sensitivity of target genes to estrogens, offspring were gonadectomized on day 70, injected with estradiol (E2, 10 or 50 μg/kg s.c.) or vehicle on day 84, and sacrificed 6 h later. The acute induction of PR mRNA, and repression (at 6 h) of PPE mRNA by E2 was enhanced by 4-MBC in male and female VMH and female MPO, whereas male MPO exhibited reduced responsiveness of both genes. Steroid receptor coactivator SRC-1 mRNA levels were increased in female VMH and MPO. The data indicate profound sex- and region-specific alterations in the regulation of estrogen target genes at brain level. Effect patterns in baseline and E2-induced gene expression differ from those in uterus and prostate

  10. Gene Regulation System of Vasopressin and Corticotoropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Masanori Yoshida

    2008-01-01

    Full Text Available The neurohypophyseal hormones, arginine vasopressin and corticotropin-releasing hormone (CRH, play a crucial role in the physiological and behavioral response to various kinds of stresses. Both neuropeptides activate the hypophysialpituitary-adrenal (HPA axis, which is a central mediator of the stress response in the body. Conversely, they receive the negative regulation by glucocorticoid, which is an end product of the HPA axis. Vasopressin and CRH are closely linked to immune response; they also interact with pro-inflammatory cytokines. Moreover, as for vasopressin, it has another important role, which is the regulation of water balance through its potent antidiuretic effect. Hence, it is conceivable that vasopressin and CRH mediate the homeostatic responses for survival and protect organisms from the external world. A tight and elaborate regulation system of the vasopressin and CRH gene is required for the rapid and flexible response to the alteration of the surrounding environments. Several important regulatory elements have been identified in the proximal promoter region in the vasopressin and CRH gene. Many transcription factors and intracellular signaling cascades are involved in the complicated gene regulation system. This review focuses on the current status of the basic research of vasopressin and CRH. In addition to the numerous known facts about their divergent physiological roles, the recent topics of promoter analyses will be discussed.

  11. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  12. Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction

    Directory of Open Access Journals (Sweden)

    Olivier Humbert

    2012-01-01

    Full Text Available Optimizing design of vectors is critical to effective gene therapy. In targeted gene correction (TGC, cleavage of chromosomal DNA near a mutation stimulates homology-directed repair of a target gene using a donor provided in trans. We have systematically addressed epigenetic parameters of donor design, using a flow-based assay to quantify correction frequencies and expression levels of a green fluorescent protein (GFP reporter gene in a human cell line. We show that active transcription of the donor increased correction frequency by threefold, establishing that a proximal promoter enhances donor use. Conversely, CpG methylation of the donor diminished correction frequency and reduced expression of the repaired gene. However, bisulfite sequencing of the target revealed no transfer of methylation marks during repair with a methylated donor. Treatment with histone deacetylase (HDAC inhibitors can partially compensate for epigenetic inactivation, suggesting a role for class I and II HDACs in regulation of donor use. These results establish that epigenetic status of a trans-donor determines both the efficiency and outcome of gene correction, and identify and clarify parameters that should guide donor design for targeted gene therapy.

  13. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    Science.gov (United States)

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  14. Proposed Regulation of Gene Expression by Glucose in Rodent Heart

    Directory of Open Access Journals (Sweden)

    Martin E. Young

    2007-01-01

    Full Text Available Background: During pressure overload-induced hypertrophy, unloading-induced atrophy, and diabetes mellitus, the heart induces ‘fetal’ genes (e.g. myosin heavy chain β; mhcβ.Hypothesis: We propose that altered glucose homeostasis within the cardiomyocyte acts as a central mechanism for the regulation of gene expression in response to environmental stresses. The evidence is as follows. Methods and Results: Forced glucose uptake both ex vivo and in vivo results in mhc isoform switching. Restricting dietary glucose prevents mhc isoform switching in hearts of both GLUT1-Tg mice and rats subjected to pressure overload-induced hypertrophy. Thus, glucose availability correlates with mhc isoform switching under all conditions investigated. A potential mechanism by which glucose affects gene expression is through O-linked glycosylation of specific transcription factors. Glutamine:fructose-6-phosphate amidotransferase (GFAT catalyzes the flux generating step in UDP-N-acetylglucosamine biosynthesis, the rate determining metabolite in protein glycosylation. Ascending aortic constriction increased intracellular levels of UDP-N-acetylglucosamine, and the expression of gfat2, but not gfat1, in the rat heart.Conclusions: Collectively, the results strongly suggest glucose-regulated gene expression in the heart, and the involvement of glucose metabolites in isoform switching of sarcomeric proteins characteristic for the fetal gene program.

  15. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  16. Nutrient restriction induces failure of reproductive function and molecular changes in hypothalamus-pituitary-gonadal axis in postpubertal gilts.

    Science.gov (United States)

    Zhou, Dongsheng; Zhuo, Yong; Che, Lianqiang; Lin, Yan; Fang, Zhengfeng; Wu, De

    2014-07-01

    People on a diet to lose weight may be at risk of reproductive failure. To investigate the effects of nutrient restriction on reproductive function and the underlying mechanism, changes of reproductive traits, hormone secretions and gene expressions in hypothalamus-pituitary-gonadal axis were examined in postpubertal gilts at anestrus induced by nutrient restriction. Gilts having experienced two estrus cycles were fed a normal (CON, 2.86 kg/d) or nutrient restricted (NR, 1 kg/d) food regimens to expect anestrus. NR gilts experienced another three estrus cycles, but did not express estrus symptoms at the anticipated fourth estrus. Blood samples were collected at 5 days' interval for consecutive three times for measurement of hormone concentrations at the 23th day of the fourth estrus cycle. Individual progesterone concentrations of NR gilts from three consecutive blood samples were below 1.0 ng/mL versus 2.0 ng/mL in CON gilts, which was considered anestrus. NR gilts had impaired development of reproductive tract characterized by absence of large follicles (diameter ≥ 6 mm), decreased number of corepus lutea and atrophy of uterus and ovary tissues. Circulating concentrations of IGF-I, kisspeptin, estradiol, progesterone and leptin were significantly lower in NR gilts than that in CON gilts. Nutrient restriction down-regulated gene expressions of kiss-1, G-protein coupled protein 54, gonadotropin-releasing hormone, estrogen receptor α, progesterone receptor, leptin receptor, follicle-stimulating hormone and luteinizing hormone and insulin-like growth factor I in hypothalamus-pituitary-gonadal axis of gilts. Collectively, nutrient restriction resulted in impairment of reproductive function and changes of hormone secretions and gene expressions in hypothalamus-pituitary-gonadal axis, which shed light on the underlying mechanism by which nutrient restriction influenced reproductive function.

  17. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  18. Differential regulation of NAB corepressor genes in Schwann cells

    Directory of Open Access Journals (Sweden)

    Sachdev Shrikesh

    2007-12-01

    Full Text Available Abstract Background Myelination of peripheral nerves by Schwann cells requires not only the Egr2/Krox-20 transactivator, but also the NGFI-A/Egr-binding (NAB corepressors, which modulate activity of Egr2. Previous work has shown that axon-dependent expression of Egr2 is mediated by neuregulin stimulation, and NAB corepressors are co-regulated with Egr2 expression in peripheral nerve development. NAB corepressors have also been implicated in macrophage development, cardiac hypertrophy, prostate carcinogenesis, and feedback regulation involved in hindbrain development. Results To test the mechanism of NAB regulation in Schwann cells, transfection assays revealed that both Nab1 and Nab2 promoters are activated by Egr2 expression. Furthermore, direct binding of Egr2 at these promoters was demonstrated in vivo by chromatin immunoprecipitation analysis of myelinating sciatic nerve, and binding of Egr2 to the Nab2 promoter was stimulated by neuregulin in primary Schwann cells. Although Egr2 expression activates the Nab2 promoter more highly than Nab1, we surprisingly found that only Nab1 – but not Nab2 – expression levels were reduced in sciatic nerve from Egr2 null mice. Analysis of the Nab2 promoter showed that it is also activated by ETS proteins (Ets2 and Etv1/ER81 and is bound by Ets2 in vivo. Conclusion Overall, these results indicate that induction of Nab2 expression in Schwann cells involves not only Egr2, but also ETS proteins that are activated by neuregulin stimulation. Although Nab1 and Nab2 play partially redundant roles, regulation of Nab2 expression by ETS factors explains several observations regarding regulation of NAB genes. Finally, these data suggest that NAB proteins are not only feedback inhibitors of Egr2, but rather that co-induction of Egr2 and NAB genes is involved in forming an Egr2/NAB complex that is crucial for regulation of gene expression.

  19. Mechanisms of biotin-regulated gene expression in microbes

    Directory of Open Access Journals (Sweden)

    J. Satiaputra

    2016-03-01

    Full Text Available Biotin is an essential micronutrient that acts as a co-factor for biotin-dependent metabolic enzymes. In bacteria, the supply of biotin can be achieved by de novo synthesis or import from exogenous sources. Certain bacteria are able to obtain biotin through both mechanisms while others can only fulfill their biotin requirement through de novo synthesis. Inability to fulfill their cellular demand for biotin can have detrimental consequences on cell viability and virulence. Therefore understanding the transcriptional mechanisms that regulate biotin biosynthesis and transport will extend our knowledge about bacterial survival and metabolic adaptation during pathogenesis when the supply of biotin is limited. The most extensively characterized protein that regulates biotin synthesis and uptake is BirA. In certain bacteria, such as Escherichia coli and Staphylococcus aureus, BirA is a bi-functional protein that serves as a transcriptional repressor to regulate biotin biosynthesis genes, as well as acting as a ligase to catalyze the biotinylation of biotin-dependent enzymes. Recent studies have identified two other proteins that also regulate biotin synthesis and transport, namely BioQ and BioR. This review summarizes the different transcriptional repressors and their mechanism of action. Moreover, the ability to regulate the expression of target genes through the activity of a vitamin, such as biotin, may have biotechnological applications in synthetic biology.

  20. GPCRs Direct Germline Development and Somatic Gonad Function in Planarians.

    Directory of Open Access Journals (Sweden)

    Amir Saberi

    2016-05-01

    Full Text Available Planarians display remarkable plasticity in maintenance of their germline, with the ability to develop or dismantle reproductive tissues in response to systemic and environmental cues. Here, we investigated the role of G protein-coupled receptors (GPCRs in this dynamic germline regulation. By genome-enabled receptor mining, we identified 566 putative planarian GPCRs and classified them into conserved and phylum-specific subfamilies. We performed a functional screen to identify NPYR-1 as the cognate receptor for NPY-8, a neuropeptide required for sexual maturation and germ cell differentiation. Similar to NPY-8, knockdown of this receptor results in loss of differentiated germ cells and sexual maturity. NPYR-1 is expressed in neuroendocrine cells of the central nervous system and can be activated specifically by NPY-8 in cell-based assays. Additionally, we screened the complement of GPCRs with expression enriched in sexually reproducing planarians, and identified an orphan chemoreceptor family member, ophis, that controls differentiation of germline stem cells (GSCs. ophis is expressed in somatic cells of male and female gonads, as well as in accessory reproductive tissues. We have previously shown that somatic gonadal cells are required for male GSC specification and maintenance in planarians. However, ophis is not essential for GSC specification or maintenance and, therefore, defines a secondary role for planarian gonadal niche cells in promoting GSC differentiation. Our studies uncover the complement of planarian GPCRs and reveal previously unappreciated roles for these receptors in systemic and local (i.e., niche regulation of germ cell development.

  1. GPCRs Direct Germline Development and Somatic Gonad Function in Planarians.

    Science.gov (United States)

    Saberi, Amir; Jamal, Ayana; Beets, Isabel; Schoofs, Liliane; Newmark, Phillip A

    2016-05-01

    Planarians display remarkable plasticity in maintenance of their germline, with the ability to develop or dismantle reproductive tissues in response to systemic and environmental cues. Here, we investigated the role of G protein-coupled receptors (GPCRs) in this dynamic germline regulation. By genome-enabled receptor mining, we identified 566 putative planarian GPCRs and classified them into conserved and phylum-specific subfamilies. We performed a functional screen to identify NPYR-1 as the cognate receptor for NPY-8, a neuropeptide required for sexual maturation and germ cell differentiation. Similar to NPY-8, knockdown of this receptor results in loss of differentiated germ cells and sexual maturity. NPYR-1 is expressed in neuroendocrine cells of the central nervous system and can be activated specifically by NPY-8 in cell-based assays. Additionally, we screened the complement of GPCRs with expression enriched in sexually reproducing planarians, and identified an orphan chemoreceptor family member, ophis, that controls differentiation of germline stem cells (GSCs). ophis is expressed in somatic cells of male and female gonads, as well as in accessory reproductive tissues. We have previously shown that somatic gonadal cells are required for male GSC specification and maintenance in planarians. However, ophis is not essential for GSC specification or maintenance and, therefore, defines a secondary role for planarian gonadal niche cells in promoting GSC differentiation. Our studies uncover the complement of planarian GPCRs and reveal previously unappreciated roles for these receptors in systemic and local (i.e., niche) regulation of germ cell development.

  2. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  3. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  4. Gene regulation in the immune system by long noncoding RNAs.

    Science.gov (United States)

    Chen, Y Grace; Satpathy, Ansuman T; Chang, Howard Y

    2017-08-22

    Long noncoding RNAs (lncRNAs) are emerging as critical regulators of gene expression in the immune system. Studies have shown that lncRNAs are expressed in a highly lineage-specific manner and control the differentiation and function of innate and adaptive cell types. In this Review, we focus on mechanisms used by lncRNAs to regulate genes encoding products involved in the immune response, including direct interactions with chromatin, RNA and proteins. In addition, we address new areas of lncRNA biology, such as the functions of enhancer RNAs, circular RNAs and chemical modifications to RNA in cellular processes. We emphasize critical gaps in knowledge and future prospects for the roles of lncRNAs in the immune system and autoimmune disease.

  5. Regulation of clock-controlled genes in mammals.

    Directory of Open Access Journals (Sweden)

    Katarzyna Bozek

    Full Text Available The complexity of tissue- and day time-specific regulation of thousands of clock-controlled genes (CCGs suggests that many regulatory mechanisms contribute to the transcriptional output of the circadian clock. We aim to predict these mechanisms using a large scale promoter analysis of CCGs.Our study is based on a meta-analysis of DNA-array data from rodent tissues. We searched in the promoter regions of 2065 CCGs for highly overrepresented transcription factor binding sites. In order to compensate the relatively high GC-content of CCG promoters, a novel background model to avoid a bias towards GC-rich motifs was employed. We found that many of the transcription factors with overrepresented binding sites in CCG promoters exhibit themselves circadian rhythms. Among the predicted factors are known regulators such as CLOCKratioBMAL1, DBP, HLF, E4BP4, CREB, RORalpha and the recently described regulators HSF1, STAT3, SP1 and HNF-4alpha. As additional promising candidates of circadian transcriptional regulators PAX-4, C/EBP, EVI-1, IRF, E2F, AP-1, HIF-1 and NF-Y were identified. Moreover, GC-rich motifs (SP1, EGR, ZF5, AP-2, WT1, NRF-1 and AT-rich motifs (MEF-2, HMGIY, HNF-1, OCT-1 are significantly overrepresented in promoter regions of CCGs. Putative tissue-specific binding sites such as HNF-3 for liver, NKX2.5 for heart or Myogenin for skeletal muscle were found. The regulation of the erythropoietin (Epo gene was analysed, which exhibits many binding sites for circadian regulators. We provide experimental evidence for its circadian regulated expression in the adult murine kidney. Basing on a comprehensive literature search we integrate our predictions into a regulatory network of core clock and clock-controlled genes. Our large scale analysis of the CCG promoters reveals the complexity and extensiveness of the circadian regulation in mammals. Results of this study point to connections of the circadian clock to other functional systems including

  6. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  7. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  8. The C. elegans evl-20 gene is a homolog of the small GTPase ARL2 and regulates cytoskeleton dynamics during cytokinesis and morphogenesis.

    Science.gov (United States)

    Antoshechkin, Igor; Han, Min

    2002-05-01

    The in vivo functions of ARF-like members of the Ras superfamily of GTPases are relatively unexplored. Here we describe the analysis of C. elegans evl-20 gene that encodes a functional homolog of human ARL2. Elimination of evl-20 function results in abnormal vulval, gonad, and male tail development and disrupts embryonic proliferation, hypodermal enclosure, and elongation. Loss of evl-20 function causes specific defects in the microtubule cytoskeleton, which is the likely molecular basis for the observed defects. EVL-20 is closely associated with both the cell cortex and astral microtubules, suggesting that it may directly interact with microtubule structures at those locations. Our data indicate that EVL-20 functions in the cytoplasm and at the plasma membrane to regulate cytoskeletal dynamics during cytokinesis and morphogenesis.

  9. Alternative RNA Structure-Coupled Gene Regulations in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Feng-Chi Chen

    2014-12-01

    Full Text Available Alternative RNA structures (ARSs, or alternative transcript isoforms, are critical for regulating cellular phenotypes in humans. In addition to generating functionally diverse protein isoforms from a single gene, ARS can alter the sequence contents of 5'/3' untranslated regions (UTRs and intronic regions, thus also affecting the regulatory effects of these regions. ARS may introduce premature stop codon(s into a transcript, and render the transcript susceptible to nonsense-mediated decay, which in turn can influence the overall gene expression level. Meanwhile, ARS can regulate the presence/absence of upstream open reading frames and microRNA targeting sites in 5'UTRs and 3'UTRs, respectively, thus affecting translational efficiencies and protein expression levels. Furthermore, since ARS may alter exon-intron structures, it can influence the biogenesis of intronic microRNAs and indirectly affect the expression of the target genes of these microRNAs. The connections between ARS and multiple regulatory mechanisms underline the importance of ARS in determining cell fate. Accumulating evidence indicates that ARS-coupled regulations play important roles in tumorigenesis. Here I will review our current knowledge in this field, and discuss potential future directions.

  10. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  11. Regulation of vesicular trafficking by Parkinson's disease-associated genes

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    2015-10-01

    Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.

  12. Methods and compositions for regulating gene expression in plant cells

    Science.gov (United States)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  13. LEF-1 Regulates Tyrosinase Gene Transcription In Vitro.

    Directory of Open Access Journals (Sweden)

    Xueping Wang

    Full Text Available TYR, DCT and MITF are three important genes involved in maintaining the mature phenotype and producing melanin; they therefore participate in neural crest cell development into melanocytes. Previous studies have revealed that the Wnt signaling factor lymphoid enhancer-binding factor (LEF-1 can enhance DCT and MITF gene expression. However, whether LEF-1 also affects TYR gene expression remains unclear. In the present study, we found that LEF-1 regulated TYR transcription in vitro. LEF-1 overexpression increased TYR gene promoter activity, whereas LEF-1 knockdown by RNA interference significantly decreased TYR expression. Moreover, the core GTTTGAT sequence (-56 to -50 within the TYR promoter is essential for the effect of LEF-1 on TYR expression, and chromatin immunoprecipitation (ChIP assay indicated that endogenous LEF-1 interacts with the TYR promoter. In addition, we observed a synergistic transactivation of the TYR promoter by LEF-1 and MITF. These data suggest that Wnt signaling plays an important role in regulating melanocyte development and differentiation.

  14. Gene regulation networks generate diverse pigmentation patterns in plants.

    Science.gov (United States)

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  15. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  16. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  17. Decorin gene expression and its regulation in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. → Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. → Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. → Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  18. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  19. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  20. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  1. Gonadal sex chromosome complement in individuals with sex chromosomal and/or gonadal disorders

    Energy Technology Data Exchange (ETDEWEB)

    Bridge, J.A.; Sanger, W.G.; Seemayer, T. [Univ. of Nebraska Medical Center, Omaha, NE (United States)] [and others

    1994-09-01

    Gonadal abnormalities are characteristically seen in patients with sex chromosomal aneuploidy. Morphologically these abnormalities can be variable and are hypothesized to be dependent on the sex chromosomal consititution of the gonad (independent of the chromosomal complement of other tissues, such as peripheral blood lymphocytes). In this study, the gonadal sex chromosome complement was evaluated for potential mosaicism and correlated with the histopathology from 5 patients with known sex chromosomal and/or gonadal disorders. FISH techniques using X and Y chromosome specific probes were performed on nuclei extracted from paraffin embedded tissue. Gonadal tissue obtained from case 1 (a true hemaphroditic newborn) consisted of ovotestes and epididymis (left side) and ovary with fallopian tube (right side). Cytogenetic and FISH studies performed on blood, ovotestes and ovary revealed an XX complement. Cytogenetic analysis of blood from case 2, a 4-year-old with suspected Turner syndrome revealed 45,X/46,X,del(Y)(q11.21). FISH analysis of the resected gonads (histologically = immature testes) confirmed an X/XY mosaic complement. Histologically, the gonadal tissue was testicular. Severe autolysis prohibited successful analysis in the 2 remaining cases. In summary, molecular cytogenetic evaluation of gonadal tissue from individuals with sex chromosomal and/or gonadal disorders did not reveal tissue-specific anomalies which could account for differences observed pathologically.

  2. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  3. The Prolactin Gene: A Paradigm of Tissue-Specific Gene Regulation with Complex Temporal Transcription Dynamics

    Science.gov (United States)

    Featherstone, K; White, M R H; Davis, J R E

    2012-01-01

    Transcription of numerous mammalian genes is highly pulsatile, with bursts of expression occurring with variable duration and frequency. The presence of this stochastic or ‘noisy’ expression pattern has been relatively unexplored in tissue systems. The prolactin gene provides a model of tissue-specific gene regulation resulting in pulsatile transcription dynamics in both cell lines and endocrine tissues. In most cell culture models, prolactin transcription appears to be highly variable between cells, with differences in transcription pulse duration and frequency. This apparently stochastic transcription is constrained by a transcriptional refractory period, which may be related to cycles of chromatin remodelling. We propose that prolactin transcription dynamics result from the summation of oscillatory cellular inputs and by regulation through chromatin remodelling cycles. Observations of transcription dynamics in cells within pituitary tissue show reduced transcriptional heterogeneity and can be grouped into a small number of distinct patterns. Thus, it appears that the tissue environment is able to reduce transcriptional noise to enable coordinated tissue responses to environmental change. We review the current knowledge on the complex tissue-specific regulation of the prolactin gene in pituitary and extra-pituitary sites, highlighting differences between humans and rodent experimental animal models. Within this context, we describe the transcription dynamics of prolactin gene expression and how this may relate to specific processes occurring within the cell. PMID:22420298

  4. Fenotip Pada Kelainan Gonadal Disgenesis 46, Xy

    OpenAIRE

    Ananda, Prima Chaerunisa; Faradz, Sultana MH; Ariani, Mahayu Dewi

    2016-01-01

    Latar belakang: Fenotip pada pasien Gonadal Dysgenesis 46, XY bervariasi dari wanita normal sampai ambigus genitalia hingga pria dengan undervirilisasi. Berdasarkan variasi fenotip ini, beberapa pasien dapat diidentifikasi sejak bayi, namun diagnosis juga dapat terlambat hingga usia pubertas.Tujuan: Untuk mengetahui fenotip pada penderita Gonadal Dysgenesis 46,XY di CEBIOR Semarang.Metode: Penelitian ini menggunakan desain deskriptif retrospektif untuk mengetahui hasil gambaran fenotip pada p...

  5. A Testis-Specific Long Non-Coding RNA, lncRNA-Tcam1, Regulates Immune-Related Genes in Mouse Male Germ Cells

    Directory of Open Access Journals (Sweden)

    Misuzu Kurihara

    2017-11-01

    Full Text Available Spermatogenesis is precisely controlled by hormones from the hypothalamus–pituitary–gonadal axis and testis-specific genes, but the regulatory mechanism is not fully understood. Recently, a large number of long non-coding RNAs (lncRNAs are found to be transcribed at each stage of meiosis of male germ cells, and their functions in spermatogenesis have yet to be fully investigated. lncRNA-testicular cell adhesion molecule 1 (lncRNA-Tcam1 is a nuclear lncRNA which is specifically expressed in mouse male germ cells and presumed to play a role in gene regulation during meiosis. Here, we present the identification of potential target genes of lncRNA-Tcam1 using spermatocyte-derived GC-2spd(ts cells. Initially, 55 target gene candidates were detected by RNA-sequencing of two GC-2spd(ts cell clones that were stably transfected with transgenes to express lncRNA-Tcam1 at different levels. Expression of 21 genes of the candidates was found to be correlated with lncRNA-Tcam1 at 7–14 postnatal days, when lncRNA-Tcam1 expression was elevated. Subsequently, we examined expression levels of the 21 genes in other two GC-2spd(ts clones, and 11 genes exhibited the correlation with lncRNA-Tcam1. Induction of lncRNA-Tcam1 transcription using the Tet-off system verified that six genes, Trim30a, Ifit3, Tgtp2, Ifi47, Oas1g, and Gbp3, were upregulated in GC-2spd(ts cells, indicating that lncRNA-Tcam1 is responsible for the regulation of gene expression of the six genes. In addition, five of the six genes, namely, Ifit3, Tgtp2, Ifi47, Oas1g, and Gbp3, are immune response genes, and Trim30a is a negative regulator of immune response. Altogether, the present study suggests that lncRNA-Tcam1 is responsible for gene regulation for the immune response during spermatogenesis.

  6. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads lead... to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  7. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  8. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  9. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  10. Intron retention as a component of regulated gene expression programs.

    Science.gov (United States)

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-09-01

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  11. Feedback regulation of DNA methyltransferase gene expression by methylation.

    Science.gov (United States)

    Slack, A; Cervoni, N; Pinard, M; Szyf, M

    1999-08-01

    This paper tests the hypothesis that expression of the DNA methyltransferase, dnmt1, gene is regulated by a methylation-sensitive DNA element. Methylation of DNA is an attractive system for feedback regulation of DNA methyltransferase as the final product of the reaction, methylated DNA, can regulate gene expression in cis. We show that an AP-1-dependent regulatory element of dnmt1 is heavily methylated in most somatic tissues and in the mouse embryonal cell line, P19, and completely unmethylated in a mouse adrenal carcinoma cell line, Y1. dnmt1 is highly over expressed in Y1 relative to P19 cell lines. Global inhibition of DNA methylation in P19 cells by 5-azadeoxycytidine results in demethylation of the AP-1 regulatory region and induction of dnmt1 expression in P19cells, but not Y1 cells. We propose that this regulatory region of dnmt1 acts as a sensor of the DNA methylation capacity of the cell. These results provide an explanation for the documented coexistence of global hypomethylation and high levels of DNA methyltransferase activity in many cancer cells and for the carcinogenic effect of hypomethylating diets.

  12. The union of somatic gonad precursors and primordial germ cells during C. elegans embryogenesis

    Science.gov (United States)

    Rohrschneider, Monica R.; Nance, Jeremy

    2013-01-01

    Somatic gonadal niche cells control the survival, differentiation, and proliferation of germline stem cells. The establishment of this niche-stem cell relationship is critical, and yet the precursors to these two cell types are often born at a distance from one another. The simple C. elegans gonadal primordium, which contains two somatic gonad precursors (SGPs) and two primordial germ cells (PGCs), provides an accessible model for determining how stem cell and niche cell precursors first assemble during development. To visualize the morphogenetic events that lead to formation of the gonadal primordium, we generated transgenic strains to label the cell membranes of the SGPs and PGCs and captured time-lapse movies as the gonadal primordium formed. We identify three distinct phases of SGP behavior: posterior migration along the endoderm towards the PGCs, extension of a single long projection around the adjacent PGC, and a dramatic wrapping over the PGC surfaces. We show that the endoderm and PGCs are dispensable for SGP posterior migration and initiation of projections. However, both tissues are required for the final positioning of the SGPs and the morphology of their projections, and PGCs are absolutely required for SGP wrapping behaviors. Finally, we demonstrate that the basement membrane component laminin, which localizes adjacent to the developing gonadal primordium, is required to prevent the SGPs from over-extending past the PGCs. Our findings provide a foundation for understanding the cellular and molecular regulation of the establishment of a niche-stem cell relationship. PMID:23562590

  13. Hedgehog signaling regulates gene expression in planarian glia.

    Science.gov (United States)

    Wang, Irving E; Lapan, Sylvain W; Scimone, M Lucila; Clandinin, Thomas R; Reddien, Peter W

    2016-09-09

    Hedgehog signaling is critical for vertebrate central nervous system (CNS) development, but its role in CNS biology in other organisms is poorly characterized. In the planarian Schmidtea mediterranea, hedgehog (hh ) is expressed in medial cephalic ganglia neurons, suggesting a possible role in CNS maintenance or regeneration. We performed RNA sequencing of planarian brain tissue following RNAi of hh and patched (ptc) , which encodes the Hh receptor. Two misregulated genes, intermediate filament-1 (if-1 ) and calamari (cali ), were expressed in a previously unidentified non-neural CNS cell type. These cells expressed orthologs of astrocyte-associated genes involved in neurotransmitter uptake and metabolism, and extended processes enveloping regions of high synapse concentration. We propose that these cells are planarian glia. Planarian glia were distributed broadly, but only expressed if-1 and cali in the neuropil near hh + neurons. Planarian glia and their regulation by Hedgehog signaling present a novel tractable system for dissection of glia biology.

  14. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  15. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either......Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  16. Gene regulation and noise reduction by coupling of stochastic processes.

    Science.gov (United States)

    Ramos, Alexandre F; Hornos, José Eduardo M; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  17. Gene networks and the neuroendocrine regulation of puberty.

    Science.gov (United States)

    Ojeda, Sergio R; Dubay, Christopher; Lomniczi, Alejandro; Kaidar, Gabi; Matagne, Valerie; Sandau, Ursula S; Dissen, Gregory A

    2010-08-05

    A sustained increase in pulsatile release of gonadotrophin releasing hormone (GnRH) from the hypothalamus is an essential, final event that defines the initiation of mammalian puberty. This increase depends on coordinated changes in transsynaptic and glial-neuronal communication, consisting of activating neuronal and glial excitatory inputs to the GnRH neuronal network and the loss of transsynaptic inhibitory tone. It is now clear that the prevalent excitatory systems stimulating GnRH secretion involve a neuronal component consisting of excitatory amino acids (glutamate) and at least one peptide (kisspeptin), and a glial component that uses growth factors and small molecules for cell-cell signaling. GABAergic and opiatergic neurons provide transsynaptic inhibitory control to the system, but GABA neurons also exert direct excitatory effects on GnRH neurons. The molecular mechanisms that provide encompassing coordination to this cellular network are not known, but they appear to involve a host of functionally related genes hierarchically arranged. We envision that, as observed in other gene networks, the highest level of control in this network is provided by transcriptional regulators that, by directing expression of key subordinate genes, impose an integrative level of coordination to the neuronal and glial subsets involved in initiating the pubertal process. The use of high-throughput and gene manipulation approaches coupled to systems biology strategies should provide not only the experimental bases supporting this concept, but also unveil the existence of crucial components of network control not yet identified. Copyright (c) 2009 Elsevier Ireland Ltd. All rights reserved.

  18. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis.

    Science.gov (United States)

    Bowman, J L; Sakai, H; Jack, T; Weigel, D; Mayer, U; Meyerowitz, E M

    1992-03-01

    We describe a locus, SUPERMAN, mutations in which result in extra stamens developing at the expense of the central carpels in the Arabidopsis thaliana flower. The development of superman flowers, from initial primordium to mature flower, is described by scanning electron microscopy. The development of doubly and triply mutant strains, constructed with superman alleles and previously identified homeotic mutations that cause alterations in floral organ identity, is also described. Essentially additive phenotypes are observed in superman agamous and superman apetala2 double mutants. The epistatic relationships observed between either apetala3 or pistillata and superman alleles suggest that the SUPERMAN gene product could be a regulator of these floral homeotic genes. To test this, the expression patterns of AGAMOUS and APETALA3 were examined in superman flowers. In wild-type flowers, APETALA3 expression is restricted to the second and third whorls where it is required for the specification of petals and stamens. In contrast, in superman flowers, APETALA3 expression expands to include most of the cells that would normally constitute the fourth whorl. This ectopic APETALA3 expression is proposed to be one of the causes of the development of the extra stamens in superman flowers. The spatial pattern of AGAMOUS expression remains unaltered in superman flowers as compared to wild-type flowers. Taken together these data indicate that one of the functions of the wild-type SUPERMAN gene product is to negatively regulate APETALA3 in the fourth whorl of the flower. In addition, superman mutants exhibit a loss of determinacy of the floral meristem, an effect that appears to be mediated by the APETALA3 and PISTILLATA gene products.

  19. Up-regulation of SNCA gene expression: implications to synucleinopathies.

    Science.gov (United States)

    Tagliafierro, L; Chiba-Falek, O

    2016-07-01

    Synucleinopathies are a group of neurodegenerative diseases that share a common pathological lesion of intracellular protein inclusions largely composed by aggregates of alpha-synuclein protein. Accumulating evidence, including genome wide association studies, has implicated alpha-synuclein (SNCA) gene in the etiology of synucleinopathies. However, the precise variants within SNCA gene that contribute to the sporadic forms of Parkinson's disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), and other synucleinopathies and their molecular mechanisms of action remain elusive. It has been suggested that SNCA expression levels are critical for the development of these diseases. Here, we review several model systems that have been developed to advance the understanding of the role of SNCA expression levels in the etiology of synucleinopathies. We also describe different molecular mechanisms that regulate SNCA gene expression and discuss possible strategies for SNCA down-regulation as means for therapeutic approaches. Finally, we highlight some examples that underscore the relationships between the genetic association findings and the regulatory mechanisms of SNCA expression, which suggest that genetic variability in SNCA locus is directly responsible, at least in part, to the changes in gene expression and explain the reported associations of SNCA with synucleinopathies. Future studies utilizing induced pluripotent stem cells (iPSCs)-derived neuronal lines and genome editing by CRISPR/Cas9, will allow us to validate, characterize, and manipulate the effects of particular cis-genetic variants on SNCA expression. Moreover, this model system will enable us to compare different neuronal and glial lineages involved in synucleinopathies representing an attractive strategy to elucidate-common and specific-SNCA-genetic variants, regulatory mechanisms, and vulnerable expression levels underlying synucleinopathy spectrum disorders. This forthcoming

  20. Dynamic model of gene regulation for the lac operon

    Science.gov (United States)

    Angelova, Maia; Ben-Halim, Asma

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  1. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  2. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...... is that unstable activation and stable repression is a requirement for the motif to produce oscillations. The last part of this thesis studies the emergence of communication networks. In this study we constructed a simple e-mail game. E-mails from two session with 16 players, who had never met before, showed how...

  3. Gene Regulation and Quality Control in Murine Polyomavirus Infection

    Directory of Open Access Journals (Sweden)

    Gordon G. Carmichael

    2016-10-01

    Full Text Available Murine polyomavirus (MPyV infects mouse cells and is highly oncogenic in immunocompromised hosts and in other rodents. Its genome is a small, circular DNA molecule of just over 5000 base pairs and it encodes only seven polypeptides. While seemingly simply organized, this virus has adopted an unusual genome structure and some unusual uses of cellular quality control pathways that, together, allow an amazingly complex and varied pattern of gene regulation. In this review we discuss how MPyV leverages these various pathways to control its life cycle.

  4. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    My thesis consists of three parts. The first part covers ageing phenomena. In the first project I measured the mobility of two DNA repair proteins. Contrasting diffusion coefficients from literature I was able to classify DNA repair protein into either "scanners" or "responders". In a second...... project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...

  5. Shh regulates chick Ebf1 gene expression in somite development.

    Science.gov (United States)

    El-Magd, Mohammed Abu; Allen, Steve; McGonnell, Imelda; Mansour, Ali A; Otto, Anthony; Patel, Ketan

    2015-01-01

    The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Discovering Genes Essential to the Hypothalamic Regulation of Human Reproduction Using a Human Disease Model: Adjusting to Life in the "-Omics" Era.

    Science.gov (United States)

    Stamou, M I; Cox, K H; Crowley, William F

    2016-02-01

    The neuroendocrine regulation of reproduction is an intricate process requiring the exquisite coordination of an assortment of cellular networks, all converging on the GnRH neurons. These neurons have a complex life history, migrating mainly from the olfactory placode into the hypothalamus, where GnRH is secreted and acts as the master regulator of the hypothalamic-pituitary-gonadal axis. Much of what we know about the biology of the GnRH neurons has been aided by discoveries made using the human disease model of isolated GnRH deficiency (IGD), a family of rare Mendelian disorders that share a common failure of secretion and/or action of GnRH causing hypogonadotropic hypogonadism. Over the last 30 years, research groups around the world have been investigating the genetic basis of IGD using different strategies based on complex cases that harbor structural abnormalities or single pleiotropic genes, endogamous pedigrees, candidate gene approaches as well as pathway gene analyses. Although such traditional approaches, based on well-validated tools, have been critical to establish the field, new strategies, such as next-generation sequencing, are now providing speed and robustness, but also revealing a surprising number of variants in known IGD genes in both patients and healthy controls. Thus, before the field moves forward with new genetic tools and continues discovery efforts, we must reassess what we know about IGD genetics and prepare to hold our work to a different standard. The purpose of this review is to: 1) look back at the strategies used to discover the "known" genes implicated in the rare forms of IGD; 2) examine the strengths and weaknesses of the methodologies used to validate genetic variation; 3)substantiate the role of known genes in the pathophysiology of the disease; and 4) project forward as we embark upon a widening use of these new and powerful technologies for gene discovery. (Endocrine Reviews 36: 603-621, 2015).

  7. Discovering Genes Essential to the Hypothalamic Regulation of Human Reproduction Using a Human Disease Model: Adjusting to Life in the “-Omics” Era

    Science.gov (United States)

    Stamou, M. I.; Cox, K. H.

    2015-01-01

    The neuroendocrine regulation of reproduction is an intricate process requiring the exquisite coordination of an assortment of cellular networks, all converging on the GnRH neurons. These neurons have a complex life history, migrating mainly from the olfactory placode into the hypothalamus, where GnRH is secreted and acts as the master regulator of the hypothalamic-pituitary-gonadal axis. Much of what we know about the biology of the GnRH neurons has been aided by discoveries made using the human disease model of isolated GnRH deficiency (IGD), a family of rare Mendelian disorders that share a common failure of secretion and/or action of GnRH causing hypogonadotropic hypogonadism. Over the last 30 years, research groups around the world have been investigating the genetic basis of IGD using different strategies based on complex cases that harbor structural abnormalities or single pleiotropic genes, endogamous pedigrees, candidate gene approaches as well as pathway gene analyses. Although such traditional approaches, based on well-validated tools, have been critical to establish the field, new strategies, such as next-generation sequencing, are now providing speed and robustness, but also revealing a surprising number of variants in known IGD genes in both patients and healthy controls. Thus, before the field moves forward with new genetic tools and continues discovery efforts, we must reassess what we know about IGD genetics and prepare to hold our work to a different standard. The purpose of this review is to: 1) look back at the strategies used to discover the “known” genes implicated in the rare forms of IGD; 2) examine the strengths and weaknesses of the methodologies used to validate genetic variation; 3) substantiate the role of known genes in the pathophysiology of the disease; and 4) project forward as we embark upon a widening use of these new and powerful technologies for gene discovery. PMID:26394276

  8. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    Directory of Open Access Journals (Sweden)

    Deborah C Mash

    2007-11-01

    Full Text Available The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05. RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4. The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  9. Retinoic Acid signalling and the control of meiotic entry in the human fetal gonad.

    Directory of Open Access Journals (Sweden)

    Andrew J Childs

    Full Text Available The development of mammalian fetal germ cells along oogenic or spermatogenic fate trajectories is dictated by signals from the surrounding gonadal environment. Germ cells in the fetal testis enter mitotic arrest, whilst those in the fetal ovary undergo sex-specific entry into meiosis, the initiation of which is thought to be mediated by selective exposure of fetal ovarian germ cells to mesonephros-derived retinoic acid (RA. Aspects of this model are hard to reconcile with the spatiotemporal pattern of germ cell differentiation in the human fetal ovary, however. We have therefore examined the expression of components of the RA synthesis, metabolism and signalling pathways, and their downstream effectors and inhibitors in germ cells around the time of the initiation of meiosis in the human fetal gonad. Expression of the three RA-synthesising enzymes, ALDH1A1, 2 and 3 in the fetal ovary and testis was equal to or greater than that in the mesonephros at 8-9 weeks gestation, indicating an intrinsic capacity within the gonad to synthesise RA. Using immunohistochemistry to detect RA receptors RARα, β and RXRα, we find germ cells to be the predominant target of RA signalling in the fetal human ovary, but also reveal widespread receptor nuclear localization indicative of signalling in the testis, suggesting that human fetal testicular germ cells are not efficiently shielded from RA by the action of the RA-metabolising enzyme CYP26B1. Consistent with this, expression of CYP26B1 was greater in the human fetal ovary than testis, although the sexually-dimorphic expression patterns of the germ cell-intrinsic regulators of meiotic initiation, STRA8 and NANOS2, appear conserved. Finally, we demonstrate that RA induces a two-fold increase in STRA8 expression in cultures of human fetal testis, but is not sufficient to cause widespread meiosis-associated gene expression. Together, these data indicate that while local production of RA within the fetal ovary may

  10. Quorum Sensing Gene Regulation by LuxR/HapR Master Regulators in Vibrios.

    Science.gov (United States)

    Ball, Alyssa S; Chaparian, Ryan R; van Kessel, Julia C

    2017-10-01

    The coordination of group behaviors in bacteria is accomplished via the cell-cell signaling process called quorum sensing. Vibrios have historically been models for studying bacterial communication due to the diverse and remarkable behaviors controlled by quorum sensing in these bacteria, including bioluminescence, type III and type VI secretion, biofilm formation, and motility. Here, we discuss the Vibrio LuxR/HapR family of proteins, the master global transcription factors that direct downstream gene expression in response to changes in cell density. These proteins are structurally similar to TetR transcription factors but exhibit distinct biochemical and genetic features from TetR that determine their regulatory influence on the quorum sensing gene network. We review here the gene groups regulated by LuxR/HapR and quorum sensing and explore the targets that are common and unique among Vibrio species. Copyright © 2017 American Society for Microbiology.

  11. Neuronal identity genes regulated by super-enhancers are preferentially down-regulated in the striatum of Huntington's disease mice.

    Science.gov (United States)

    Achour, Mayada; Le Gras, Stéphanie; Keime, Céline; Parmentier, Frédéric; Lejeune, François-Xavier; Boutillier, Anne-Laurence; Néri, Christian; Davidson, Irwin; Merienne, Karine

    2015-06-15

    Huntington's disease (HD) is a neurodegenerative disease associated with extensive down-regulation of genes controlling neuronal function, particularly in the striatum. Whether altered epigenetic regulation underlies transcriptional defects in HD is unclear. Integrating RNA-sequencing (RNA-seq) and chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq), we show that down-regulated genes in HD mouse striatum associate with selective decrease in H3K27ac, a mark of active enhancers, and RNA Polymerase II (RNAPII). In addition, we reveal that decreased genes in HD mouse striatum display a specific epigenetic signature, characterized by high levels and broad patterns of H3K27ac and RNAPII. Our results indicate that this signature is that of super-enhancers, a category of broad enhancers regulating genes defining tissue identity and function. Specifically, we reveal that striatal super-enhancers display extensive H3K27 acetylation within gene bodies, drive transcription characterized by low levels of paused RNAPII, regulate neuronal function genes and are enriched in binding motifs for Gata transcription factors, such as Gata2 regulating striatal identity genes. Together, our results provide evidence for preferential down-regulation of genes controlled by super-enhancers in HD striatum and indicate that enhancer topography is a major parameter determining the propensity of a gene to be deregulated in a neurodegenerative disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes.

    Directory of Open Access Journals (Sweden)

    Tulika Prakash

    Full Text Available From the ENCODE project, it is realized that almost every base of the entire human genome is transcribed. One class of transcripts resulting from this arises from the conjoined gene, which is formed by combining the exons of two or more distinct (parent genes lying on the same strand of a chromosome. Only a very limited number of such genes are known, and the definition and terminologies used for them are highly variable in the public databases. In this work, we have computationally identified and manually curated 751 conjoined genes (CGs in the human genome that are supported by at least one mRNA or EST sequence available in the NCBI database. 353 representative CGs, of which 291 (82% could be confirmed, were subjected to experimental validation using RT-PCR and sequencing methods. We speculate that these genes are arising out of novel functional requirements and are not merely artifacts of transcription, since more than 70% of them are conserved in other vertebrate genomes. The unique splicing patterns exhibited by CGs reveal their possible roles in protein evolution or gene regulation. Novel CGs, for which no transcript is available, could be identified in 80% of randomly selected potential CG forming regions, indicating that their formation is a routine process. Formation of CGs is not only limited to human, as we have also identified 270 CGs in mouse and 227 in drosophila using our approach. Additionally, we propose a novel mechanism for the formation of CGs. Finally, we developed a database, ConjoinG, which contains detailed information about all the CGs (800 in total identified in the human genome. In summary, our findings reveal new insights about the functionality of CGs in terms of another possible mechanism for gene regulation and genomic evolution and the mechanism leading to their formation.

  13. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  14. Regulation of Corticosteroidogenic Genes by MicroRNAs

    Directory of Open Access Journals (Sweden)

    Stacy Robertson

    2017-01-01

    Full Text Available The loss of normal regulation of corticosteroid secretion is important in the development of cardiovascular disease. We previously showed that microRNAs regulate the terminal stages of corticosteroid biosynthesis. Here, we assess microRNA regulation across the whole corticosteroid pathway. Knockdown of microRNA using Dicer1 siRNA in H295R adrenocortical cells increased levels of CYP11A1, CYP21A1, and CYP17A1 mRNA and the secretion of cortisol, corticosterone, 11-deoxycorticosterone, 18-hydroxycorticosterone, and aldosterone. Bioinformatic analysis of genes involved in corticosteroid biosynthesis or metabolism identified many putative microRNA-binding sites, and some were selected for further study. Manipulation of individual microRNA levels demonstrated a direct effect of miR-125a-5p and miR-125b-5p on CYP11B2 and of miR-320a-3p levels on CYP11A1 and CYP17A1 mRNA. Finally, comparison of microRNA expression profiles from human aldosterone-producing adenoma and normal adrenal tissue showed levels of various microRNAs, including miR-125a-5p to be significantly different. This study demonstrates that corticosteroidogenesis is regulated at multiple points by several microRNAs and that certain of these microRNAs are differentially expressed in tumorous adrenal tissue, which may contribute to dysregulation of corticosteroid secretion. These findings provide new insights into the regulation of corticosteroid production and have implications for understanding the pathology of disease states where abnormal hormone secretion is a feature.

  15. Loss of p300 and CBP disrupts histone acetylation at the mouse Sry promoter and causes XY gonadal sex reversal.

    Science.gov (United States)

    Carré, Gwenn-Aël; Siggers, Pam; Xipolita, Marilena; Brindle, Paul; Lutz, Beat; Wells, Sara; Greenfield, Andy

    2018-01-01

    CREB-binding protein (CBP, CREBBP, KAT3A) and its closely related paralogue p300 (EP300, KAT3B), together termed p300/CBP, are histone/lysine acetyl-transferases that control gene expression by modifying chromatin-associated proteins. Here, we report roles for both of these chromatin-modifying enzymes in mouse sex determination, the process by which the embryonic gonad develops into a testis or an ovary. By targeting gene ablation to embryonic gonadal somatic cells using an inducible Cre line, we show that gonads lacking either gene exhibit major abnormalities of XY gonad development at 14.5 dpc, including partial sex reversal. Embryos lacking three out of four functional copies of p300/Cbp exhibit complete XY gonadal sex reversal and have greatly reduced expression of the key testis-determining genes Sry and Sox9. An analysis of histone acetylation at the Sry promoter in mutant gonads at 11.5 dpc shows a reduction in levels of the positive histone mark H3K27Ac. Our data suggest a role for CBP/p300 in testis determination mediated by control of histone acetylation at the Sry locus and reveal a novel element in the epigenetic control of Sry and mammalian sex determination. They also suggest possible novel causes of human disorders of sex development (DSD). © The Author 2017. Published by Oxford University Press.

  16. Feeding Regulates the Expression of Pancreatic Genes in Gastric Mucosa

    Directory of Open Access Journals (Sweden)

    Maria Rita De Giorgio

    2010-01-01

    Full Text Available The ineffective short-term control of feeding behavior compromises energy homeostasis and can lead to obesity. The gastrointestinal tract secretes several regulatory peptides. However, little is known about the stomach peptide contribution to the acute regulation of intake. In an attempt to identify new gastric signals, the serial analysis of gene expression (SAGE method was used for the transcription profiling of stomach mucosa in 7 groups of mice: fasting and sacrificed 30 minutes, 1 hour, 3 hours after a low-fat (LF or high-fat (HF ad libitum meal. In total, 35 genes were differentially modulated by LF and HF meals compared to fasting, including 15 mRNAs coding for digestive enzymes/secretory proteins, and 10 novel transcripts. Although the basic expression profile did not undergo substantial variations, both LF and HF meals influenced the transcription. This study represents the first global analysis of stomach transcriptome as induced by different nutritional stimuli. Further studies including the characterization of novel genes may help to identify new targets for the therapy and prevention of obesity.

  17. The Evolution of gene regulation research in Lactococcus lactis.

    Science.gov (United States)

    Kok, Jan; van Gijtenbeek, Lieke A; de Jong, Anne; van der Meulen, Sjoerd B; Solopova, Ana; Kuipers, Oscar P

    2017-08-01

    Lactococcus lactis is a major microbe. This lactic acid bacterium (LAB) is used worldwide in the production of safe, healthy, tasteful and nutritious milk fermentation products. Its huge industrial importance has led to an explosion of research on the organism, particularly since the early 1970s. The upsurge in the research on L. lactis coincided not accidentally with the advent of recombinant DNA technology in these years. The development of methods to take out and re-introduce DNA in L. lactis, to clone genes and to mutate the chromosome in a targeted way, to control (over)expression of proteins and, ultimately, the availability of the nucleotide sequence of its genome and the use of that information in transcriptomics and proteomics research have enabled to peek deep into the functioning of the organism. Among many other things, this has provided an unprecedented view of the major gene regulatory pathways involved in nitrogen and carbon metabolism and their overlap, and has led to the blossoming of the field of L. lactis systems biology. All of these advances have made L. lactis the paradigm of the LAB. This review will deal with the exciting path along which the research on the genetics of and gene regulation in L. lactis has trodden. © FEMS 2017.

  18. Fgf9 and Wnt4 act as antagonistic signals to regulate mammalian sex determination.

    Directory of Open Access Journals (Sweden)

    Yuna Kim

    2006-06-01

    Full Text Available The genes encoding members of the wingless-related MMTV integration site (WNT and fibroblast growth factor (FGF families coordinate growth, morphogenesis, and differentiation in many fields of cells during development. In the mouse, Fgf9 and Wnt4 are expressed in gonads of both sexes prior to sex determination. Loss of Fgf9 leads to XY sex reversal, whereas loss of Wnt4 results in partial testis development in XX gonads. However, the relationship between these signals and the male sex-determining gene, Sry, was unknown. We show through gain- and loss-of-function experiments that fibroblast growth factor 9 (FGF9 and WNT4 act as opposing signals to regulate sex determination. In the mouse XY gonad, Sry normally initiates a feed-forward loop between Sox9 and Fgf9, which up-regulates Fgf9 and represses Wnt4 to establish the testis pathway. Surprisingly, loss of Wnt4 in XX gonads is sufficient to up-regulate Fgf9 and Sox9 in the absence of Sry. These data suggest that the fate of the gonad is controlled by antagonism between Fgf9 and Wnt4. The role of the male sex-determining switch--Sry in the case of mammals--is to tip the balance between these underlying patterning signals. In principle, sex determination in other vertebrates may operate through any switch that introduces an imbalance between these two signaling pathways.

  19. Pitx2, an atrial fibrillation predisposition gene, directly regulates ion transport and intercalated disc genes.

    Science.gov (United States)

    Tao, Ye; Zhang, Min; Li, Lele; Bai, Yan; Zhou, Yuefang; Moon, Anne M; Kaminski, Henry J; Martin, James F

    2014-02-01

    Pitx2 is the homeobox gene located in proximity to the human 4q25 familial atrial fibrillation (AF) locus. When deleted in the mouse germline, Pitx2 haploinsufficiency predisposes to pacing-induced AF, indicating that reduced Pitx2 promotes an arrhythmogenic substrate. Previous work focused on Pitx2 developmental functions that predispose to AF. Although Pitx2 is expressed in postnatal left atrium, it is unknown whether Pitx2 has distinct postnatal and developmental functions. To investigate Pitx2 postnatal function, we conditionally inactivated Pitx2 in the postnatal atrium while leaving its developmental function intact. Unstressed adult Pitx2 homozygous mutant mice display variable R-R interval with diminished P-wave amplitude characteristic of sinus node dysfunction, an AF risk factor in human patients. An integrated genomics approach in the adult heart revealed Pitx2 target genes encoding cell junction proteins, ion channels, and critical transcriptional regulators. Importantly, many Pitx2 target genes have been implicated in human AF by genome-wide association studies. Immunofluorescence and transmission electron microscopy studies in adult Pitx2 mutant mice revealed structural remodeling of the intercalated disc characteristic of human patients with AF. Our findings, revealing that Pitx2 has genetically separable postnatal and developmental functions, unveil direct Pitx2 target genes that include channel and calcium handling genes, as well as genes that stabilize the intercalated disc in postnatal atrium.

  20. The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

    Science.gov (United States)

    Acosta, Nicole; Pukatzki, Stefan

    2015-01-01

    Bacteria possess signal transduction pathways capable of sensing and responding to a wide variety of signals. The Cpx envelope stress response, composed of the sensor histidine kinase CpxA and the response regulator CpxR, senses and mediates adaptation to insults to the bacterial envelope. The Cpx response has been implicated in the regulation of a number of envelope-localized virulence determinants across bacterial species. Here, we show that activation of the Cpx pathway in Vibrio cholerae El Tor strain C6706 leads to a decrease in expression of the major virulence factors in this organism, cholera toxin (CT) and the toxin-coregulated pilus (TCP). Our results indicate that this occurs through the repression of production of the ToxT regulator and an additional upstream transcription factor, TcpP. The effect of the Cpx response on CT and TCP expression is mostly abrogated in a cyclic AMP receptor protein (CRP) mutant, although expression of the crp gene is unaltered. Since TcpP production is controlled by CRP, our data suggest a model whereby the Cpx response affects CRP function, which leads to diminished TcpP, ToxT, CT, and TCP production. PMID:25824837

  1. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  2. [Prediction and bioinformatics analysis of human gene expression profiling regulated by amifostine].

    Science.gov (United States)

    Yang, Bo; Cai, Li-Li; Chi, Xiao-Hua; Lu, Xue-Chun; Zhang, Feng; Tuo, Shuai; Zhu, Hong-Li; Liu, Li-Hong; Yan, Jiang-Wei; Tuo, Chao-Wei

    2011-06-01

    Objective of this study was to perform bioinformatics analysis of the characteristics of gene expression profiling regulated by amifostine and predict its novel potential biological function to provide a direction for further exploring pharmacological actions of amifostine and study methods. Amifostine was used as a key word to search internet-based free gene expression database including GEO, affymetrix gene chip database, GenBank, SAGE, GeneCard, InterPro, ProtoNet, UniProt and BLOCKS and the sifted amifostine-regulated gene expression profiling data was subjected to validity testing, gene expression difference analysis and functional clustering and gene annotation. The results showed that only one data of gene expression profiling regulated by amifostine was sifted from GEO database (accession: GSE3212). Through validity testing and gene expression difference analysis, significant difference (p < 0.01) was only found in 2.14% of the whole genome (460/192000). Gene annotation analysis showed that 139 out of 460 genes were known genes, in which 77 genes were up-regulated and 62 genes were down-regulated. 13 out of 139 genes were newly expressed following amifostine treatment of K562 cells, however expression of 5 genes was completely inhibited. Functional clustering displayed that 139 genes were divided into 11 categories and their biological function was involved in hematopoietic and immunologic regulation, apoptosis and cell cycle. It is concluded that bioinformatics method can be applied to analysis of gene expression profiling regulated by amifostine. Amifostine has a regulatory effect on human gene expression profiling and this action is mainly presented in biological processes including hematopoiesis, immunologic regulation, apoptosis and cell cycle and so on. The effect of amifostine on human gene expression need to be further testified in experimental condition.

  3. Gene expression dosage regulation in an allopolyploid fish.

    Directory of Open Access Journals (Sweden)

    I Matos

    Full Text Available How allopolyploids are able not only to cope but profit from their condition is a question that remains elusive, but is of great importance within the context of successful allopolyploid evolution. One outstanding example of successful allopolyploidy is the endemic Iberian cyprinid Squalius alburnoides. Previously, based on the evaluation of a few genes, it was reported that the transcription levels between diploid and triploid S. alburnoides were similar. If this phenomenon occurs on a full genomic scale, a wide functional ''diploidization'' could be related to the success of these polyploids. We generated RNA-seq data from whole juvenile fish and from adult livers, to perform the first comparative quantitative transcriptomic analysis between diploid and triploid individuals of a vertebrate allopolyploid. Together with an assay to estimate relative expression per cell, it was possible to infer the relative sizes of transcriptomes. This showed that diploid and triploid S. alburnoides hybrids have similar liver transcriptome sizes. This in turn made it valid to directly compare the S. alburnoides RNA-seq transcript data sets and obtain a profile of dosage responses across the S. alburnoides transcriptome. We found that 64% of transcripts in juveniles' samples and 44% in liver samples differed less than twofold between diploid and triploid hybrids (similar expression. Yet, respectively 29% and 15% of transcripts presented accurate dosage compensation (PAA/PA expression ratio of 1 instead of 1.5. Therefore, an exact functional diploidization of the triploid genome does not occur, but a significant down regulation of gene expression in triploids was observed. However, for those genes with similar expression levels between diploids and triploids, expression is not globally strictly proportional to gene dosage nor is it set to a perfect diploid level. This quantitative expression flexibility may be a strong contributor to overcome the genomic shock

  4. Androgen insensitivity syndrome: gonadal androgen receptor activity

    International Nuclear Information System (INIS)

    Coulam, C.B.; Graham, M.L.; Spelsberg, T.C.

    1984-01-01

    To determine whether abnormalities of the androgen receptor previously observed in skin fibroblasts from patients with androgen insensitivity syndrome also occur in the gonads of affected individuals, androgen receptor activity in the gonads of a patient with testicular feminization syndrome was investigated. Using conditions for optimal recovery of androgen receptor from human testes established by previous studies, we detected the presence of a high-affinity (dissociation constant . 3.2 X 10(-10) mol/L), low-capacity (4.2 X 10(-12) mol/mg DNA), androgen-binding protein when tritium-labeled R1881 was incubated at 4 degrees C with nuclear extracts from the gonads of control patients or from a patient with testicular feminization syndrome but not when incubated at 37 degrees C. Thus this patient has an androgen receptor with a temperature lability similar to that of receptors from normal persons

  5. Regulation of Plastid Gene Expression during Photooxidative Stress.

    Science.gov (United States)

    Tonkyn, J C; Deng, X W; Gruissem, W

    1992-08-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a "plastid factor" in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  6. Regulation of Plastid Gene Expression during Photooxidative Stress 1

    Science.gov (United States)

    Tonkyn, John C.; Deng, Xing-Wang; Gruissem, Wilhelm

    1992-01-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a “plastid factor” in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  7. Substrate availability and transcriptional regulation of metabolic genes in human skeletal muscle during recovery from exercise

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Osada, Takuya; Andersen, Lisbeth Tingsted

    2005-01-01

    In skeletal muscle of humans, transcription of several metabolic genes is transiently induced during recovery from exercise when no food is consumed. To determine the potential influence of substrate availability on the transcriptional regulation of metabolic genes during recovery from exercise, 9...... the transcriptional regulation of metabolic genes in skeletal muscle of humans during recovery from exercise....

  8. Transgenic Mouse Studies to Understand the Regulation, Expression and Function of the Testis-Specific Protein Y-Encoded (TSPY Gene

    Directory of Open Access Journals (Sweden)

    Stephanie Schubert

    2010-08-01

    Full Text Available The TSPY gene, which encodes the testis-specific protein, Y-encoded, was first discovered and characterized in humans, but orthologous genes were subsequently identified on the Y chromosome of many other placental mammals. TSPY is expressed in the testis and to a much lesser extent in the prostate gland, and it is assumed that TSPY serves function in spermatogonial proliferation and/or differentiation. It is further supposed that TSPY is involved in male infertility and exerts oncogenic effects in gonadal and prostate tumor formation. As a member of the TSPY/SET/NAP protein family, TSPY is able to bind cyclin B types, and stimulates the cyclin B1-CDK1 kinase activity, thereby accelerating the G2/M phase transition of the cell cycle of target cells. Because the laboratory mouse carries only a nonfunctional Y-chromosomal Tspy-ps pseudogene, a knockout mouse model for functional research analyses is not a feasible approach. In the last decade, three classical transgenic mouse models have been developed to contribute to our understanding of TSPY regulation, expression and function. The different transgenic mouse approaches and their relevance for studying TSPY regulation, expression and function are discussed in this review.

  9. Regulation and Function of Adult Neurogenesis: From Genes to Cognition

    Science.gov (United States)

    Aimone, James B.; Li, Yan; Lee, Star W.; Clemenson, Gregory D.; Deng, Wei; Gage, Fred H.

    2014-01-01

    Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. This review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages of maturation, ultimately integrating into the adult dentate gyrus network. The increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders. PMID:25287858

  10. ROG, repressor of GATA, regulates the expression of cytokine genes.

    Science.gov (United States)

    Miaw, S C; Choi, A; Yu, E; Kishikawa, H; Ho, I C

    2000-03-01

    GATA-3 is a T cell-specific transcription factor and is essential for the development of the T cell lineage. Recently, it was shown that the expression of GATA-3 is further induced in CD4+ helper T cells upon differentiation into type 2 but not type 1 effector cells. Here, we report the molecular cloning of a GATA-3 interacting protein, repressor of GATA (ROG). ROG is a lymphoid-specific gene and is rapidly induced in Th cells upon stimulation with anti-CD3. In in vitro assays, ROG represses the GATA-3-induced transactivation. Furthermore, overexpression of ROG in Th clones inhibits the production of Th cytokines. Taken together, our results suggest that ROG might play a critical role in regulating the differentiation and activation of Th cells.

  11. Competition between target sites of regulators shapes post-transcriptional gene regulation.

    Science.gov (United States)

    Jens, Marvin; Rajewsky, Nikolaus

    2015-02-01

    Post-transcriptional gene regulation (PTGR) of mRNA turnover, localization and translation is mediated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). These regulators exert their effects by binding to specific sequences within their target mRNAs. Increasing evidence suggests that competition for binding is a fundamental principle of PTGR. Not only can miRNAs be sequestered and neutralized by the targets with which they interact through a process termed 'sponging', but competition between binding sites on different RNAs may also lead to regulatory crosstalk between transcripts. Here, we quantitatively model competition effects under physiological conditions and review the role of endogenous sponges for PTGR in light of the key features that emerge.

  12. GPR54 regulates ERK1/2 activity and hypothalamic gene expression in a Gα(q/11 and β-arrestin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Jacob M Szereszewski

    Full Text Available G protein-coupled receptor 54 (GPR54 is a G(q/11-coupled 7 transmembrane-spanning receptor (7TMR. Activation of GPR54 by kisspeptin (Kp stimulates PIP(2 hydrolysis, Ca(2+ mobilization and ERK1/2 MAPK phosphorylation. Kp and GPR54 are established regulators of the hypothalamic-pituitary-gonadal (HPG axis and loss-of-function mutations in GPR54 are associated with an absence of puberty and hypogonadotropic hypogonadism, thus defining an important role of the Kp/GPR54 signaling system in reproductive function. Given the tremendous physiological and clinical importance of the Kp/GPR54 signaling system, we explored the contributions of the GPR54-coupled G(q/11 and β-arrestin pathways on the activation of a major downstream signaling molecule, ERK, using G(q/11 and β-arrestin knockout mouse embryonic fibroblasts. Our study revealed that GPR54 employs the G(q/11 and β-arrestin-2 pathways in a co-dependent and temporally overlapping manner to positively regulate ERK activity and pERK nuclear localization. We also show that while β-arrestin-2 potentiates GPR54 signaling to ERK, β-arrestin-1 inhibits it. Our data also revealed that diminished β-arrestin-1 and -2 expression in the GT1-7 GnRH hypothalamic neuronal cell line triggered distinct patterns of gene expression following Kp-10 treatment. Thus, β-arrestin-1 and -2 also regulate distinct downstream responses in gene expression. Finally, we showed that GPR54, when uncoupled from the G(q/11 pathway, as is the case for several naturally occurring GPR54 mutants associated with hypogonadotropic hypogonadism, continues to regulate gene expression in a G protein-independent manner. These new and exciting findings add significantly to our mechanistic understanding of how this important receptor signals intracellularly in response to kisspeptin stimulation.

  13. Stimuli-Regulated Smart Polymeric Systems for Gene Therapy

    Directory of Open Access Journals (Sweden)

    Ansuja Pulickal Mathew

    2017-04-01

    Full Text Available The physiological condition of the human body is a composite of different environments, each with its own parameters that may differ under normal, as well as diseased conditions. These environmental conditions include factors, such as pH, temperature and enzymes that are specific to a type of cell, tissue or organ or a pathological state, such as inflammation, cancer or infection. These conditions can act as specific triggers or stimuli for the efficient release of therapeutics at their destination by overcoming many physiological and biological barriers. The efficacy of conventional treatment modalities can be enhanced, side effects decreased and patient compliance improved by using stimuli-responsive material that respond to these triggers at the target site. These stimuli or triggers can be physical, chemical or biological and can be internal or external in nature. Many smart/intelligent stimuli-responsive therapeutic gene carriers have been developed that can respond to either internal stimuli, which may be normally present, overexpressed or present in decreased levels, owing to a disease, or to stimuli that are applied externally, such as magnetic fields. This review focuses on the effects of various internal stimuli, such as temperature, pH, redox potential, enzymes, osmotic activity and other biomolecules that are present in the body, on modulating gene expression by using stimuli-regulated smart polymeric carriers.

  14. Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

    Energy Technology Data Exchange (ETDEWEB)

    Serganov, A.; Huang, L; Patel, D

    2009-01-01

    The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains. FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.

  15. Flg22-triggered immunity negatively regulates key BR biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Tamara eJiménez-Góngora

    2015-11-01

    Full Text Available In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR have emerged as negative regulators of pathogen-associated molecular pattern (PAMP-triggered immunity (PTI, promoting growth at the expense of defence. The crosstalk between BR and PTI signalling was described as negative and unidirectional, since activation of PTI does not affect several analysed steps in the BR signalling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signalling, and occurs within 15 minutes of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  16. Reconstructing nonlinear dynamic models of gene regulation using stochastic sampling

    Directory of Open Access Journals (Sweden)

    Reinelt Gerhard

    2009-12-01

    Full Text Available Abstract Background The reconstruction of gene regulatory networks from time series gene expression data is one of the most difficult problems in systems biology. This is due to several reasons, among them the combinatorial explosion of possible network topologies, limited information content of the experimental data with high levels of noise, and the complexity of gene regulation at the transcriptional, translational and post-translational levels. At the same time, quantitative, dynamic models, ideally with probability distributions over model topologies and parameters, are highly desirable. Results We present a novel approach to infer such models from data, based on nonlinear differential equations, which we embed into a stochastic Bayesian framework. We thus address both the stochasticity of experimental data and the need for quantitative dynamic models. Furthermore, the Bayesian framework allows it to easily integrate prior knowledge into the inference process. Using stochastic sampling from the Bayes' posterior distribution, our approach can infer different likely network topologies and model parameters along with their respective probabilities from given data. We evaluate our approach on simulated data and the challenge #3 data from the DREAM 2 initiative. On the simulated data, we study effects of different levels of noise and dataset sizes. Results on real data show that the dynamics and main regulatory interactions are correctly reconstructed. Conclusions Our approach combines dynamic modeling using differential equations with a stochastic learning framework, thus bridging the gap between biophysical modeling and stochastic inference approaches. Results show that the method can reap the advantages of both worlds, and allows the reconstruction of biophysically accurate dynamic models from noisy data. In addition, the stochastic learning framework used permits the computation of probability distributions over models and model parameters

  17. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  18. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  19. Localization and distribution of gonadal proteins in the oviparous lizard Sceloporus aeneus (Squamata: Phrynosomatidae).

    Science.gov (United States)

    Nivia Rocio, Antonio-Rubio; Maricela, Villagrán-SantaCruz; Norma, Moreno-Mendoza

    2017-06-01

    Among vertebrates, several specific proteins are involved in the function and development of gonads. Several genes such as SOX9, FOXL2, DDX4, IFITM3, and DPPA3, are active during embryonic differentiation and maintain their expression in adult tissues, playing important roles in the function and development of the line cell, where these are produced. Among reptiles, molecular mechanisms for sex differentiation have been analyzed in turtles, crocodiles, and some lizards, while in adult stages such studies are scarce. The aim of this study was to locate and analyze the distribution of important gonadal proteins in adult and embryonic ovaries and testes of the oviparous lizard Sceloporus aeneus (Squamata: Phrynosomatidae). Adult specimens and embryos of the lizard S. aeneus were collected in Milpa Alta, a suburb located Southwest of Mexico City. Expression of gonadal proteins was analyzed using immunofluorescent staining and confocal microscopy. Our results showed that SOX9 is located in Sertoli cells of embryonic and adult testes. FOXL2 is expressed in follicular cells of adult ovaries. DDX4 and IFITM3 are located in germ line cells as well as in follicular cells of adult ovaries. DPPA3 was observed in somatic and germ line cells of adult and embryonic gonads. Our observations show that important molecules of vertebrate ovaries and testes are conserved in S. aeneus and it is suggested that these may have a similar role during gonadal development and function. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  1. The large Maf factor Traffic Jam controls gonad morphogenesis in Drosophila.

    Science.gov (United States)

    Li, Michelle A; Alls, Jeffrey D; Avancini, Rita M; Koo, Karen; Godt, Dorothea

    2003-11-01

    Interactions between somatic and germline cells are critical for the normal development of egg and sperm. Here we show that the gene traffic jam (tj) produces a soma-specific factor that controls gonad morphogenesis and is required for female and male fertility. tj encodes the only large Maf factor in Drosophila melanogaster, an orthologue of the atypical basic Leu zipper transcription factors c-Maf and MafB/Kreisler in vertebrates. Expression of tj occurs in somatic gonadal cells that are in direct contact with germline cells throughout development. In tj mutant gonads, somatic cells fail to inter-mingle and properly envelop germline cells, causing an early block in germ cell differentiation. In addition, tj mutant somatic cells show an increase in the level of expression for several adhesion molecules. We propose that tj is a critical modulator of the adhesive properties of somatic cells, facilitating germline-soma interactions that are essential for germ cell differentiation.

  2. Gonadal vein tumor thrombosis due to renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Hamidreza Haghighatkhah

    2015-01-01

    Full Text Available Renal cell carcinoma (RCC had a tendency to extend into the renal vein and inferior vena cava, while extension into the gonadal vein has been rarely reported. Gonadal vein tumor thrombosis appears as an enhancing filling defect within the dilated gonadal vein anterior to the psoas muscle and shows an enhancement pattern identical to that of the original tumor. The possibility of gonadal vein thrombosis should be kept in mind when looking at an imaging study of patients with RCC

  3. Quasi-Genes: The Many-Body Theory of Gene Regulation in the Presence of Decoys

    Science.gov (United States)

    Burger, Anat

    During transcriptional regulation, transcription factor proteins bind to particular sites in the genome in order to switch genes on or off. The regulatory binding site intended for a transcription factor is just one out of millions of potential sites where the transcription factor can bind. Specificity of a binding motif determines whether less than one or up to tens of thousands of strong affinity binding sites can be expected by pure chance. The roles that these additional "decoy" binding sites play in the functioning of a cell are currently unknown. We incorporate decoys into traditional mass action and stochastic models of a simple gene network-the self-regulated gene-and use numerical and analytical techniques to quantify the effects that these extra sites have on altering gene expression properties. Counter-intuitively, we find that if bound transcription factors are protected from degradation, the mean steady state concentration of unbound transcription factors, , is insensitive to the addition of decoys. Many other gene expression properties do change as decoys are added. Decoys linearly increase the time necessary to reach steady state. Noise buffering by decoys occurs because of a coupling between the unbound proteomic environment and the reservoir of sites that can be very large, but the noise reduction is limited Poisson statistics because of the inherent noise resulting from binding and unbinding of transcription factors to DNA. This noise buffering is optimized for a given protein concentration when decoys have a 1/2 probability of being occupied. Decoys are able to preferentially stabilize one state of a bimodal system over the other, and exponentially increase the time to epigenetically switch between these states. In the limit that binding and unbinding rates are fast compared to the fluctuations in transcription factor copy number, we exploit timescale differences to collapse the model and derive analytical expressions that explain our numerical

  4. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  5. gonads of Cheimerius nufar (Ehrenberg, 1820)

    African Journals Online (AJOL)

    P.S. Coetzee. Zoology Department, University of Port Elizabeth. Seasonal histological and macroscopic changes in the gonads of the hermaphroditic fish, Cheimerius .... 1983, 18(2). Table 1 Classification of oogonia and oocyte stages based on both nuclear and cytoplasmic changes with special reference to vitellogenesis.

  6. Gene regulation and genetics in neurochemistry, past to future.

    Science.gov (United States)

    Barger, Steven W

    2016-10-01

    Ask any neuroscientist to name the most profound discoveries in the field in the past 60 years, and at or near the top of the list will be a phenomenon or technique related to genes and their expression. Indeed, our understanding of genetics and gene regulation has ushered in whole new systems of knowledge and new empirical approaches, many of which could not have even been imagined prior to the molecular biology boon of recent decades. Neurochemistry, in the classic sense, intersects with these concepts in the manifestation of neuropeptides, obviously dependent upon the central dogma (the established rules by which DNA sequence is eventually converted into protein primary structure) not only for their conformation but also for their levels and locales of expression. But, expanding these considerations to non-peptide neurotransmitters illustrates how gene regulatory events impact neurochemistry in a much broader sense, extending beyond the neurochemicals that translate electrical signals into chemical ones in the synapse, to also include every aspect of neural development, structure, function, and pathology. From the beginning, the mutability - yet relative stability - of genes and their expression patterns were recognized as potential substrates for some of the most intriguing phenomena in neurobiology - those instances of plasticity required for learning and memory. Near-heretical speculation was offered in the idea that perhaps the very sequence of the genome was altered to encode memories. A fascinating component of the intervening progress includes evidence that the central dogma is not nearly as rigid and consistent as we once thought. And this mutability extends to the potential to manipulate that code for both experimental and clinical purposes. Astonishing progress has been made in the molecular biology of neurochemistry during the 60 years since this journal debuted. Many of the gains in conceptual understanding have been driven by methodological

  7. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  8. Expression and chromatin structures of cellulolytic enzyme gene regulated by heterochromatin protein 1

    OpenAIRE

    Zhang, Xiujun; Qu, Yinbo; Qin, Yuqi

    2016-01-01

    Background Heterochromatin protein 1 (HP1, homologue HepA in Penicillium oxalicum) binding is associated with a highly compact chromatin state accompanied by gene silencing or repression. HP1 loss leads to the derepression of gene expression. We investigated HepA roles in regulating cellulolytic enzyme gene expression, as an increasingly number of studies have suggested that cellulolytic enzyme gene expression is not only regulated by transcription factors, but is also affected by the chromat...

  9. Gene expression profiling of chicken primordial germ cell ESTs

    Directory of Open Access Journals (Sweden)

    Lim Dajeong

    2006-08-01

    Full Text Available Abstract Background Germ cells are the only cell type that can penetrate from one generation to next generation. At the early embryonic developmental stages, germ cells originally stem from primordial germ cells, and finally differentiate into functional gametes, sperm in male or oocyte in female, after sexual maturity. This study was conducted to investigate a large-scale expressed sequence tag (EST analysis in chicken PGCs and compare the expression of the PGC ESTs with that of embryonic gonad. Results We constructed 10,851 ESTs from a chicken cDNA library of a collection of highly separated embryonic PGCs. After chimeric and problematic sequences were filtered out using the chicken genomic sequences, there were 5,093 resulting unique sequences consisting of 156 contigs and 4,937 singlets. Pearson chi-square tests of gene ontology terms in the 2nd level between PGC and embryonic gonad set showed no significance. However, digital gene expression profiling using the Audic's test showed that there were 2 genes expressed significantly with higher number of transcripts in PGCs compared with the embryonic gonads set. On the other hand, 17 genes in embryonic gonads were up-regulated higher than those in the PGC set. Conclusion Our results in this study contribute to knowledge of mining novel transcripts and genes involved in germline cell proliferation and differentiation at the early embryonic stages.

  10. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  11. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  12. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Science.gov (United States)

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  13. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Directory of Open Access Journals (Sweden)

    Erick C. Castelli

    2014-01-01

    Full Text Available HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii the proximal promoter region (within 200 bases from the first translated ATG does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region.

  14. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    Science.gov (United States)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  15. Distinct pathways of insulin-regulated versus diabetes-regulated gene expression: an in vivo analysis in MIRKO mice.

    Science.gov (United States)

    Yechoor, Vijay K; Patti, Mary-Elizabeth; Ueki, Kohjiro; Laustsen, Palle G; Saccone, Robert; Rauniyar, Ravi; Kahn, C Ronald

    2004-11-23

    Diabetes mellitus is a complex metabolic disorder accompanied by alterations in cellular physiology, metabolism, and gene expression. These alterations can be primary (due to loss of direct insulin action) or secondary (due to the metabolic perturbations associated with the disease). To dissect and quantitate these two separate effects, we compared the skeletal muscle gene-expression profiles of muscle insulin receptor knockout (MIRKO) mice and their Lox controls in the basal, streptozotocin-induced diabetic, and insulin-treated diabetic states. Pure deficiency of insulin action as present in the MIRKO mouse results in regulation of 130 genes, with down-regulation of NSF (N-ethylmaleimide-sensitive fusion protein) and VAMP-2 (vesicle-associated membrane protein 2), stearoyl CoA desaturase 1, and cAMP-specific phosphodiesterase 4B, as well as up-regulation of some signaling-related genes, such as Akt2, and the fatty-acid transporter CD36. In diabetes, additional transcriptional mechanisms are activated, resulting in alterations in expression of approximately 500 genes, including a highly coordinated down-regulation of genes of the mitochondrial electron-transport chain and one of the mammalian homologues of the histone deacetylase Sir2, which has been implicated in the link between nutrition and longevity. These distinct pathways of direct and indirect regulation of gene expression provide insights into the complex mechanisms of transcriptional control in diabetes and areas of potential therapeutic targeting.

  16. Effects of chronic testosterone administration on body weight and food intake differ among pre-pubertal, gonadal-intact, and ovariectomized female rats.

    Science.gov (United States)

    Iwasa, Takeshi; Matsuzaki, Toshiya; Tungalagsuvd, Altankhuu; Munkhzaya, Munkhsaikhan; Yiliyasi, Mayila; Kato, Takeshi; Kuwahara, Akira; Irahara, Minoru

    2016-08-01

    In females, estrogens play pivotal roles in preventing excessive body weight gain. On the other hand, the roles of androgen in female appetite and body weight regulation have not been fully studied. In this study, whether the roles of androgen in the regulation of body weight and appetite were different among ages and/or the estrogen milieu in females was evaluated. Body weight gain and food intake were increased by chronic testosterone administration in pre-pubertal and gonadal-intact female rats, but not in ovariectomized female rats. Testosterone administration also affected the serum leptin level and adipose leptin gene expression levels differently in each experimental condition. Hypothalamic mRNA levels of ERα, which plays pivotal roles in regulation of body weight and metabolism, were decreased by chronic testosterone administration in pre-pubertal and gonadal-intact female rats, but not in ovariectomized female rats. These results indicate that the effects of testosterone on body weight and appetite differed among ages and/or estrogen milieu in female rats, and that attenuation of estrogens' actions on the hypothalamus might be partly involved in the androgen-induced increases of body weight gain and food intake in females. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Coordinate gene regulation by fimbriae-induced signal transduction

    DEFF Research Database (Denmark)

    Schembri, Mark; Klemm, Per

    2001-01-01

    whether fimbriae expression can affect expression of other genes, Analysis of gene expression in two E.coli strains, differing in the fim locus, indicated the flu gene to be affected. The flu gene encodes the antigen 43 (Ag43) surface protein, specifically involved in bacterial aggregation...

  18. Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis.

    Science.gov (United States)

    Mellin, J R; McClure, Ryan; Lopez, Delia; Green, Olivia; Reinhard, Bjorn; Genco, Caroline

    2010-08-01

    In Neisseria meningitidis, iron-responsive gene regulation is mediated primarily by the ferric uptake regulator (Fur) protein. When complexed with iron, Fur represses gene expression by preventing transcription initiation. Fur can also indirectly activate gene expression via the repression of regulatory small RNAs (sRNA). One such Fur- and iron-regulated sRNA, NrrF, was previously identified in N. meningitidis and shown to repress expression of the sdhA and sdhC genes encoding subunits of the succinate dehydrogenase complex. In the majority of Gram-negative bacteria, sRNA-mediated regulation requires a cofactor RNA-binding protein (Hfq) for proper gene regulation and stabilization. In this study, we examined the role of Hfq in NrrF-mediated regulation of the succinate dehydrogenase genes in N. meningitidis and the effect of an hfq mutation on iron-responsive gene regulation more broadly. We first demonstrated that the stability of NrrF, as well as the regulation of sdhC and sdhA in vivo, was unaltered in the hfq mutant. Secondly, we established that iron-responsive gene regulation of the Fur-regulated sodB gene was dependent on Hfq. Finally, we demonstrated that in N. meningitidis, Hfq functions in a global manner to control expression of many ORFs and intergenic regions via iron-independent mechanisms. Collectively these studies demonstrate that in N. meningitidis, iron- and NrrF-mediated regulation of sdhC and sdhA can occur independently of Hfq, although Hfq functions more globally to control regulation of other N. meningitidis genes primarily by iron-independent mechanisms.

  19. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori*

    Science.gov (United States)

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-01-01

    Hox genes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hox genes can also function in terminally differentiated tissue of the lepidopteran Bombyx mori. In this species, Antennapedia (Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antp can regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antp in the posterior silk gland induced ectopic expression of major silk protein genes such as sericin-3, fhxh4, and fhxh5. These genes are normally expressed specifically in the middle silk gland as is Antp. Therefore, the evidence strongly suggests that Antp activates these silk protein genes in the middle silk gland. The putative sericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antp directly activates their expression. We also found that the pattern of gene expression was well conserved between B. mori and the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori. We suggest that Hox genes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. PMID:26814126

  20. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  1. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures...... containing different ammonium concentrations (NH4+; 0, 9.5 or 191 mM) and with different nitrogen sources (N-acetylglucosamine (GlcNAc) or glutamate (glt)). S91 chiA expression was found to depend on both the NH4+ concentration and source of nitrogen in marine minimal medium (MMM). Pseudoalteromonas sp. S91...... and S91CX can use either GlcNAc or glt as a sole source of carbon in MMM containing a standard concentration of 9.5 mM NH4+. Adding excess NH4+, 20 times the standard concentration, to MMM significantly reduced chiA activity below that found in the presence of either GlcNAc or glt. When no NH4...

  2. Gonadotropin-releasing hormone analogues inhibit leiomyoma extracellular matrix despite presence of gonadal hormones.

    Science.gov (United States)

    Malik, Minnie; Britten, Joy; Cox, Jeris; Patel, Amrita; Catherino, William H

    2016-01-01

    To determine the effect of GnRH analogues (GnRH-a) leuprolide acetate (LA) and cetrorelix acetate on gonadal hormone-regulated expression of extracellular matrix in uterine leiomyoma three-dimensional (3D) cultures. Laboratory study. University research laboratory. Women undergoing hysterectomy for symptomatic leiomyomas. The 3D cell cultures, protein analysis, Western blot, immunohistochemistry. Expression of extracellular matrix proteins, collagen 1, fibronectin, and versican in leiomyoma cells 3D cultures exposed to E2, P, LA, cetrorelix acetate, and combinations for 24- and 72-hour time points. The 3D leiomyoma cultures exposed to E2 for 24 hours demonstrated an increased expression of collagen-1 and fibronectin, which was maintained for up to 72 hours, a time point at which versican was up-regulated significantly. Although P up-regulated collagen-1 protein (1.29 ± 0.04) within 24 hours of exposure, significant increase in all extracellular matrix (ECM) proteins was observed when the gonadal hormones were used concomitantly. Significant decrease in the amount of ECM proteins was observed on use of GnRH-a, LA and cetrorelix, with 24-hour exposure. Both the compounds also significantly decreased ECM protein concentration despite the presence of E2 or both gonadal hormones. This study demonstrates that GnRH-a directly affect the gonadal hormone-regulated collagen-1, fibronectin, and versican production in their presence. These findings suggest that localized therapy with GnRH-a may inhibit leiomyoma growth even in the presence of endogenous gonadal hormone exposure, thereby providing a mechanism to eliminate the hypoestrogenic side effects associated with GnRH-a therapy. Published by Elsevier Inc.

  3. Salicin regulates the expression of functional 'youth gene clusters' to reflect a more youthful gene expression profile.

    Science.gov (United States)

    Gopaul, R; Knaggs, H E; Lephart, J

    2011-10-01

    There are a variety of biological mechanisms that contribute to specific characteristics of ageing skin; for example, the loss of skin structure proteins, increased susceptibility to UV-induced pigmentation and/or loss of hydration. Each of these biological processes is influenced by specific groups of genes. In this research, we have identified groups of genes associated with specific clinical signs of skin ageing and refer to these as functional 'youth gene clusters'. In this study, quantitative real-time polymerase chain reaction (qPCR) was used to investigate the effects of topical application of salicin in regulating the expression of functional 'youth gene clusters' to reflect a more youthful skin profile and reduce the appearance of attributes associated with skin ageing. Results showed that salicin significantly influences the gene expression profiles of treated human equivalent full-thickness skin, by regulating the expression of genes associated with various biological processes involving skin structure, skin hydration, pigmentation and cellular differentiation. Based on the findings from this experiment, salicin was identified as a key ingredient that may regulate functional 'youth gene clusters' to reflect a more youthful gene expression profile by increasing the expression of genes responsible for youthful skin and decreasing the expression of genes responsible for the appearance of aged skin. © 2011 The Authors. ICS © 2011 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  4. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

    1997-01-01

    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  5. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  6. Epigenetic control of gonadal aromatase (cyp19a1 in temperature-dependent sex determination of red-eared slider turtles.

    Directory of Open Access Journals (Sweden)

    Yuiko Matsumoto

    Full Text Available In the red-eared slider turtle (Trachemys scripta, a species with temperature-dependent sex determination (TSD, the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5'-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5'-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX and vertebrate steroidogenic factor 1 (SF1 and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development.

  7. Angiographic investigation of the male gonadal vein

    International Nuclear Information System (INIS)

    Vajda, J.; Boehm, K.; Horvath, L.; Molnar, Z.

    1980-01-01

    Retrograde angiography of the gonadal vein was carried out in 110 cases. Because of valve-insufficience the left vena spermatica interna filled spontaneously from the vena renalis in the majority (88%) of the cases. In the cases of well functioning valves superselective angiography was carried out. The examination is advised in cases of the following syndromes: varicokele, abdominal tumours, determination of the place of non-palpable testes, Klinefelter syndrome. (L.E.)

  8. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  9. CsACO4, an ACC oxidase gene regulating male differentiation in ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    Arabidopsis ethylene-response gene ETR1: similarity of product to two- component regulators. Science, 262: 539-544. Chen YH, Zhang JH, Ouyang B, Li HX, Ye ZB (2005). Cloning of ACC oxidase gene and inhibition of endogenous gene expression with. RNAi in cauliflower. Acta Genetica Sinica, 32: 764-769. (in chinese).

  10. Genome-wide gene expression regulation as a function of genotype and age in C. elegans

    NARCIS (Netherlands)

    Viñuela Rodriguez, A.; Snoek, L.B.; Riksen, J.A.G.; Kammenga, J.E.

    2010-01-01

    Gene expression becomes more variable with age, and it is widely assumed that this is due to a decrease in expression regulation. But currently there is no understanding how gene expression regulatory patterns progress with age. Here we explored genome-wide gene expression variation and regulatory

  11. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Science.gov (United States)

    Wang, Erming; Aslanzadeh, Vahid; Papa, Filomena; Zhu, Haiyan; de la Grange, Pierre; Cambi, Franca

    2012-01-01

    In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP) H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  12. [Peripheral precocious puberty: 46, XY complete gonadal dysgenesis].

    Science.gov (United States)

    Santalha, M; Amaral, B; Pereira, J; Ribeiro, L; João Oliveira, M; Figueiredo, S; Cardoso, H; Peixoto, C; Borges, T; Cidade-Rodrigues, J A

    2014-10-01

    Despite standard clinical definitions and availability of diagnostic tests for precocious puberty, an intensive and structured investigation is needed in order to diagnose the aetiology in particular cases. A 4-year-old, phenotypically female child was referred to paediatric endocrinology consultation for premature pubarche and thelarche. There was an acceleration of growth velocity with high levels of estradiol and testosterone, and prepubertal FSH and LH measurements. Investigation showed bilateral gonadoblastoma as the cause of the peripheral precocious puberty. Genetic studies revealed 46 XY karyotype with mutation c.89G> T (p.Arg30Ile) in exon 1 of the SRY gene, confirming the diagnosis of complete gonadal dysgenesis. Disorders of sexual differentiation must be considered in the approach and investigation of peripheral precocious puberty, especially in the presence of ovarian tumours, such as gonadoblastoma and dysgerminoma. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  13. A Bayesian model for pooling gene expression studies that incorporates co-regulation information.

    Directory of Open Access Journals (Sweden)

    Erin M Conlon

    Full Text Available Current Bayesian microarray models that pool multiple studies assume gene expression is independent of other genes. However, in prokaryotic organisms, genes are arranged in units that are co-regulated (called operons. Here, we introduce a new Bayesian model for pooling gene expression studies that incorporates operon information into the model. Our Bayesian model borrows information from other genes within the same operon to improve estimation of gene expression. The model produces the gene-specific posterior probability of differential expression, which is the basis for inference. We found in simulations and in biological studies that incorporating co-regulation information improves upon the independence model. We assume that each study contains two experimental conditions: a treatment and control. We note that there exist environmental conditions for which genes that are supposed to be transcribed together lose their operon structure, and that our model is best carried out for known operon structures.

  14. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  15. Gene therapy: Regulations, ethics and its practicalities in liver disease

    OpenAIRE

    Jin, Xi; Yang, Yi-Da; Li, You-Ming

    2008-01-01

    Gene therapy is a new and promising approach which opens a new door to the treatment of human diseases. By direct transfer of genetic materials to the target cells, it could exert functions on the level of genes and molecules. It is hoped to be widely used in the treatment of liver disease, especially hepatic tumors by using different vectors encoding the aim gene for anti-tumor activity by activating primary and adaptive immunity, inhibiting oncogene and angiogenesis. Despite the huge curati...

  16. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  17. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  18. Molecular Evolution of Two Distinct dmrt1 Promoters for Germ and Somatic Cells in Vertebrate Gonads.

    Science.gov (United States)

    Mawaribuchi, Shuuji; Musashijima, Masato; Wada, Mikako; Izutsu, Yumi; Kurakata, Erina; Park, Min Kyun; Takamatsu, Nobuhiko; Ito, Michihiko

    2017-03-01

    The transcription factor DMRT1 has important functions in two distinct processes, somatic-cell masculinization and germ-cell development in mammals. However, it is unknown whether the functions are conserved during evolution, and what mechanism underlies its expression in the two cell lineages. Our analysis of the Xenopus laevis and Silurana tropicalis dmrt1 genes indicated the presence of two distinct promoters: one upstream of the noncoding first exon (ncEx1), and one within the first intron. In contrast, only the ncEx1-upstream promoter was detected in the dmrt1 gene of the agnathan sand lamprey, which expressed dmrt1 exclusively in the germ cells. In X. laevis, the ncEx1- and exon 2-upstream promoters were predominantly used for germ-cell and somatic-cell transcription, respectively. Importantly, knockdown of the ncEx1-containing transcript led to reduced germ-cell numbers in X. laevis gonads. Intriguingly, two genetically female individuals carrying the knockdown construct developed testicles. Analysis of the reptilian leopard gecko dmrt1 revealed the absence of ncEx1. We propose that dmrt1 regulated germ-cell development in the vertebrate ancestor, then acquired another promoter in its first intron to regulate somatic-cell masculinization during gnathostome evolution. In the common ancestor of reptiles and mammals, only one promoter got function for both the two cell lineages, accompanied with the loss of ncEx1. In addition, we found a conserved noncoding sequence (CNS) in the dmrt1 5'-flanking regions only among amniote species, and two CNSs in the introns among most vertebrates except for agnathans. Finally, we discuss relationships between these CNSs and the promoters of dmrt1 during vertebrate evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Regulation of mitochondrial gene expression, the epigenetic enigma

    NARCIS (Netherlands)

    Mposhi, Archibold; van der Wijst, Monique G. P.; Faber, Klaas Nico; Rots, Marianne G.

    2017-01-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether

  20. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    . 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  1. Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation

    African Journals Online (AJOL)

    The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...

  2. Promotion of oogenesis and embryogenesis in the C. elegans gonad by EFL-1/DPL-1 (E2F) does not require LIN-35 (pRB).

    Science.gov (United States)

    Chi, Woo; Reinke, Valerie

    2006-08-01

    In Caenorhabditis elegans, EFL-1 (E2F), DPL-1 (DP) and LIN-35 (pRb) act coordinately in somatic tissues to inhibit ectopic cell division, probably by repressing the expression of target genes. EFL-1, DPL-1 and LIN-35 are also present in the germline, but do not always act together. Strong loss-of-function mutations in either efl-1 or dpl-1 cause defects in oogenesis that result in sterility, while lin-35 mutants are fertile with reduced broods. Microarray-based expression profiling of dissected gonads from efl-1, dpl-1 and lin-35 mutants reveals that EFL-1 and DPL-1 promote expression of an extensively overlapping set of target genes, consistent with the expectation that these two proteins function as a heterodimer. Regulatory regions upstream of many of these target genes have a canonical E2F-binding site, suggesting that their regulation by EFL-1/DPL-1 is direct. Many EFL-1/DPL-1 responsive genes encode proteins required for oogenesis and early embryogenesis, rather than cell cycle components. By contrast, LIN-35 appears to function primarily as a repressor of gene expression in the germline, and the genes that it acts on are for the most part distinct from those regulated by EFL-1 and/or DPL-1. Thus, in vivo, C. elegans E2F directly promotes oogenesis and embryogenesis through the activation of a tissue-specific transcriptional program that does not require LIN-35.

  3. Stability and flexibility of epigenetic gene regulation in mammalian development.

    Science.gov (United States)

    Reik, Wolf

    2007-05-24

    During development, cells start in a pluripotent state, from which they can differentiate into many cell types, and progressively develop a narrower potential. Their gene-expression programmes become more defined, restricted and, potentially, 'locked in'. Pluripotent stem cells express genes that encode a set of core transcription factors, while genes that are required later in development are repressed by histone marks, which confer short-term, and therefore flexible, epigenetic silencing. By contrast, the methylation of DNA confers long-term epigenetic silencing of particular sequences--transposons, imprinted genes and pluripotency-associated genes--in somatic cells. Long-term silencing can be reprogrammed by demethylation of DNA, and this process might involve DNA repair. It is not known whether any of the epigenetic marks has a primary role in determining cell and lineage commitment during development.

  4. Highly sensitive inference of time-delayed gene regulation by network deconvolution.

    Science.gov (United States)

    Chen, Haifen; Mundra, Piyushkumar A; Zhao, Li Na; Lin, Feng; Zheng, Jie

    2014-01-01

    Gene regulatory network (GRN) is a fundamental topic in systems biology. The dynamics of GRN can shed light on the cellular processes, which facilitates the understanding of the mechanisms of diseases when the processes are dysregulated. Accurate reconstruction of GRN could also provide guidelines for experimental biologists. Therefore, inferring gene regulatory networks from high-throughput gene expression data is a central problem in systems biology. However, due to the inherent complexity of gene regulation, noise in measuring the data and the short length of time-series data, it is very challenging to reconstruct accurate GRNs. On the other hand, a better understanding into gene regulation could help to improve the performance of GRN inference. Time delay is one of the most important characteristics of gene regulation. By incorporating the information of time delays, we can achieve more accurate inference of GRN. In this paper, we propose a method to infer time-delayed gene regulation based on cross-correlation and network deconvolution (ND). First, we employ cross-correlation to obtain the probable time delays for the interactions between each target gene and its potential regulators. Then based on the inferred delays, the technique of ND is applied to identify direct interactions between the target gene and its regulators. Experiments on real-life gene expression datasets show that our method achieves overall better performance than existing methods for inferring time-delayed GRNs. By taking into account the time delays among gene interactions, our method is able to infer GRN more accurately. The effectiveness of our method has been shown by the experiments on three real-life gene expression datasets of yeast. Compared with other existing methods which were designed for learning time-delayed GRN, our method has significantly higher sensitivity without much reduction of specificity.

  5. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  6. Plasticity and regeneration of gonads in the annelid Pristina leidyi

    Directory of Open Access Journals (Sweden)

    B. Duygu Özpolat

    2016-10-01

    Full Text Available Abstract Background Gonads are specialized gamete-producing structures that, despite their functional importance, are generated by diverse mechanisms across groups of animals and can be among the most plastic organs of the body. Annelids, the segmented worms, are a group in which gonads have been documented to be plastic and to be able to regenerate, but little is known about what factors influence gonad development or how these structures regenerate. In this study, we aimed to identify factors that influence the presence and size of gonads and to investigate gonad regeneration in the small asexually reproducing annelid, Pristina leidyi. Results We found that gonad presence and size in asexual adult P. leidyi are highly variable across individuals and identified several factors that influence these structures. An extrinsic factor, food availability, and two intrinsic factors, individual age and parental age, strongly influence the presence and size of gonads in P. leidyi. We also found that following head amputation in this species, gonads can develop by morphallactic regeneration in previously non-gonadal segments. We also identified a sexually mature individual from our laboratory culture that demonstrates that, although our laboratory strain reproduces only asexually, it retains the potential to become fully sexual. Conclusions Our findings demonstrate that gonads in P. leidyi display high phenotypic plasticity and flexibility with respect to their presence, their size, and the segments in which they can form. Considering our findings along with relevant data from other species, we find that, as a group, clitellate annelids can form gonads in at least four different contexts: post-starvation refeeding, fission, morphallactic regeneration, and epimorphic regeneration. This group is thus particularly useful for investigating the mechanisms involved in gonad formation and the evolution of post-embryonic phenotypic plasticity.

  7. Overexpression and Down-Regulation of Barley Lipoxygenase LOX2.2 Affects Jasmonate-Regulated Genes and Aphid Fecundity

    Directory of Open Access Journals (Sweden)

    Aleksandra Losvik

    2017-12-01

    Full Text Available Aphids are pests on many crops and depend on plant phloem sap as their food source. In an attempt to find factors improving plant resistance against aphids, we studied the effects of overexpression and down-regulation of the lipoxygenase gene LOX2.2 in barley (Hordeum vulgare L. on the performance of two aphid species. A specialist, bird cherry-oat aphid (Rhopalosiphum padi L. and a generalist, green peach aphid (Myzus persicae Sulzer were studied. LOX2.2 overexpressing lines showed up-regulation of some other jasmonic acid (JA-regulated genes, and antisense lines showed down-regulation of such genes. Overexpression or suppression of LOX2.2 did not affect aphid settling or the life span on the plants, but in short term fecundity tests, overexpressing plants supported lower aphid numbers and antisense plants higher aphid numbers. The amounts and composition of released volatile organic compounds did not differ between control and LOX2.2 overexpressing lines. Up-regulation of genes was similar for both aphid species. The results suggest that LOX2.2 plays a role in the activation of JA-mediated responses and indicates the involvement of LOX2.2 in basic defense responses.

  8. The direct response of the gonads to cues of stress in a temperate songbird species is season-dependent

    Directory of Open Access Journals (Sweden)

    Nicolette L. McGuire

    2013-08-01

    Full Text Available The gonadotropin releasing hormone (GnRH system in the hypothalamus is often considered the final point in integration of environmental cues as they pertain to the reproductive axis. However, cues such as stress and food availability are detectable in the plasma (as glucocorticoid and metabolic fuel fluctuations. Vertebrate gonads express glucocorticoid receptor, therefore we hypothesized that the gonads can detect and respond directly to cues of stress. We provide evidence here that, in addition to regulation by the brain, the gonads of European starlings (Sturnus vulgaris respond directly to fluctuations in corticosterone and metabolic fuels by modulating sex steroid secretion. Using a 4-h gonad culture, we show that physiologically-relevant concentrations of corticosterone and metabolic stress (via use of the glucose utilization inhibitor 2-deoxy-D-glucose and the fatty acid oxidation inhibitor ethyl 2-mercaptoacetate (2DG/MA can directly decrease testosterone and estradiol secretion from luteinizing hormone and follicle-stimulating hormone (LH/FSH-stimulated testes and ovaries. This effect is regulated seasonally. Prior to the breeding season, testes and ovaries respond to corticosterone and 2DG/MA by significantly decreasing gonadal steroid release. Within the breeding season, the testes do not respond to these cues of stress, while the ovaries respond only to corticosterone. This seasonal difference in response may be due in part to the influence of these cues of stress on gonadal neuropeptide expression: corticosterone upregulates GnIH expression in the testes while metabolic stress upregulates GnIH in the ovaries. Thus the gonads can directly respond to fluctuations in corticosterone and metabolic fuels during a time of critical importance to the onset of breeding.

  9. From Biophysics to Evolutionary Genetics: Statistical Aspects of Gene Regulation

    Science.gov (United States)

    Lässig, Michael

    Genomic functions often cannot be understood at the level of single genes but require the study of gene networks. This systems biology credo is nearly commonplace by now. Evidence comes from the comparative analysis of entire genomes: current estimates put, for example, the number of human genes at around 22,000, hardly more than the 14,000 of the fruit fly, and not even an order of magnitude higher than the 6,000 of baker's yeast. The complexity and diversity of higher animals, therefore, cannot be explained in terms of their gene numbers. If, however, a biological function requires the concerted action of several genes, and conversely, a gene takes part in several functional contexts, an organism may be defined less by its individual genes but by their interactions. The emerging picture of the genome as a strongly interacting system with many degrees of freedom brings new challenges for experiment and theory, many of which are of a statistical nature. And indeed, this picture continues to make the subject attractive to a growing number of statistical physicists.

  10. Effects of centrifugation on gonadal and adrenocortical steroids in rats

    Science.gov (United States)

    Kakihana, R.; Butte, J. C.

    1980-01-01

    Many endocrine systems are sensitive to external changes in the environment. Both the pituitary adrenal and pituitary gonadal systems are affected by stress including centrifugation stress. The effect of centrifugation on the pituitary gonadal and pituitary adrenocortical systems was examined by measuring the gonadal and adrenal steroids in the plasma and brain following different duration and intensity of centrifugation stress in rats. Two studies were completed and the results are presented. The second study was carried out to describe the developmental changes of brain, plasma and testicular testosterone and dihydrotestosterone in Sprague Dawley rats so that the effect of centrifugation stress on the pituitary gonadal syatem could be better evaluated in future studies.

  11. The precise regulation of different COR genes by individual CBF transcription factors in Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Yihao; Huang, Jiaying; Sun, Tianshu; Wang, Xuefei; Zhu, Chenqi; Ai, Yuxi; Gu, Hongya

    2017-02-01

    The transcription factors CBF1/2/3 are reported to play a dominant role in the cold responsive network of Arabidopsis by directly regulating the expression levels of cold responsive (COR) genes. In this study, we obtained CRISPR/Cas9-mediated loss-of-function mutants of cbf1∼3. Over 3,000 COR genes identified by RNA-seq analysis showed a slight but significant change in their expression levels in the mutants compared to the wild-type plants after being treated at 4 °C for 12 h. The C-repeat (CRT) motif (5'-CCGAC-3') was enriched in promoters of genes that were up-regulated by CBF2 and CBF3 but not in promoters of genes up-regulated by CBF1. These data suggest that CBF2 and CBF3 play a more important role in directing the cold response by regulating different sets of downstream COR genes. More than 2/3 of COR genes were co-regulated by two or three CBFs and were involved mainly in cellular signal transduction and metabolic processes; less than 1/3 of the genes were regulated by one CBF, and those genes up-regulated were enriched in cold-related abiotic stress responses. Our results indicate that CBFs play an important role in the trade-off between cold tolerance and plant growth through the precise regulation of COR genes in the complicated transcriptional network. © 2016 The Authors. Journal of Integrative Plant Biology Published by John Wiley & Sons Australia, Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  12. Gonadal Transcriptome Analysis of Male and Female Olive Flounder (Paralichthys olivaceus

    Directory of Open Access Journals (Sweden)

    Zhaofei Fan

    2014-01-01

    Full Text Available Olive flounder (Paralichthys olivaceus is an important commercially cultured marine flatfish in China, Korea, and Japan, of which female grows faster than male. In order to explore the molecular mechanism of flounder sex determination and development, we used RNA-seq technology to investigate transcriptomes of flounder gonads. This produced 22,253,217 and 19,777,841 qualified reads from ovary and testes, which were jointly assembled into 97,233 contigs. Among them, 23,223 contigs were mapped to known genes, of which 2,193 were predicted to be differentially expressed in ovary and 887 in testes. According to annotation information, several sex-related biological pathways including ovarian steroidogenesis and estrogen signaling pathways were firstly found in flounder. The dimorphic expression of overall sex-related genes provides further insights into sex determination and gonadal development. Our study also provides an archive for further studies of molecular mechanism of fish sex determination.

  13. Lipopolysaccharide triggers nuclear import of Lpcat1 to regulate inducible gene expression in lung epithelia.

    Science.gov (United States)

    Ellis, Bryon; Kaercher, Leah; Snavely, Courtney; Zhao, Yutong; Zou, Chunbin

    2012-07-26

    To report that Lpcat1 plays an important role in regulating lipopolysaccharide (LPS) inducible gene transcription. Gene expression in Murine Lung Epithelial MLE-12 cells with LPS treatment or Haemophilus influenza and Escherichia coli infection was analyzed by employing quantitative Reverse Transcription Polymerase Chain Reaction techniques. Nucleofection was used to deliver Lenti-viral system to express or knock down Lpcat1 in MLE cells. Subcellular protein fractionation and Western blotting were utilized to study Lpcat1 nuclear relocation. Lpcat1 translocates into the nucleus from the cytoplasm in murine lung epithelia (MLE) after LPS treatment. Haemophilus influenza and Escherichia coli, two LPS-containing pathogens that cause pneumonia, triggered Lpcat1 nuclear translocation from the cytoplasm. The LPS inducible gene expression profile was determined by quantitative reverse transcription polymerase chain reaction after silencing Lpcat1 or overexpression of the enzyme in MLE cells. We detected that 17 out of a total 38 screened genes were upregulated, 14 genes were suppressed, and 7 genes remained unchanged in LPS treated cells in comparison to controls. Knockdown of Lpcat1 by shRNA dramatically changed the spectrum of the LPS inducible gene transcription, as 18 genes out of 38 genes were upregulated, of which 20 genes were suppressed or unchanged. Notably, in Lpcat1 overexpressed cells, 25 genes out of 38 genes were reduced in the setting of LPS treatment. These observations suggest that Lpcat1 relocates into the nucleus in response to bacterial infection to differentially regulate gene transcriptional repression.

  14. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Prakash

    PEPCK) and glucose-6-phosphatase. (G6Pase), respectively. PEPCK gene expression is increased not only in diabetes but also in hyperthyroidism and in various nutritional states such as high protein diets and fasting (Hanson and Reshef 1997).

  15. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    that some of the ribosome-associated lncRNAs modulate the translation of protein-coding genes (Yoon et al. 2012). Genomic and cellular location of lncRNAs. LncRNAs can be located in either DNA strands or in both. (Wang et al. 2011a). Based on genomic distribution with respect to protein-coding genes, lncRNAs can be ...

  16. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  17. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    2011-02-01

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  18. Stripy Ftz target genes are coordinately regulated by Ftz-F1.

    Science.gov (United States)

    Hou, Hui Ying; Heffer, Alison; Anderson, W Ray; Liu, Jingnan; Bowler, Timothy; Pick, Leslie

    2009-11-15

    During development, cascades of regulatory genes act in a hierarchical fashion to subdivide the embryo into increasingly specified body regions. This has been best characterized in Drosophila, where genes encoding regulatory transcription factors form a network to direct the development of the basic segmented body plan. The pair-rule genes are pivotal in this process as they are responsible for the first subdivision of the embryo into repeated metameric units. The Drosophila pair-rule gene fushi tarazu (ftz) is a derived Hox gene expressed in and required for the development of alternate parasegments. Previous studies suggested that Ftz achieves its distinct regulatory specificity as a segmentation protein by interacting with a ubiquitously expressed cofactor, the nuclear receptor Ftz-F1. However, the downstream target genes regulated by Ftz and other pair-rule genes to direct segment formation are not known. In this study, we selected candidate Ftz targets by virtue of their early expression in Ftz-like stripes. This identified two new Ftz target genes, drumstick (drm) and no ocelli (noc), and confirmed that Ftz regulates a serotonin receptor (5-HT2). These are the earliest Ftz targets identified to date and all are coordinately regulated by Ftz-F1. Engrailed (En), the best-characterized Ftz/Ftz-F1 downstream target, is not an intermediate in regulation. The drm genomic region harbors two separate seven-stripe enhancers, identified by virtue of predicted Ftz-F1 binding sites, and these sites are necessary for stripe expression in vivo. We propose that pair-rule genes, exemplified by Ftz/Ftz-F1, promote segmentation by acting at different hierarchical levels, regulating first, other segmentation genes; second, other regulatory genes that in turn control specific cellular processes such as tissue differentiation; and, third, 'segmentation realizator genes' that are directly involved in morphogenesis.

  19. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factorsin flower development

    NARCIS (Netherlands)

    Pajoro, A.; Madrigal, P.; Muiño, J.M.; Tomas Matus, J.; Jin, J.; Mecchia, M.A.; Debernardi, J.M.; Palatnik, J.F.; Balazadeh, S.; Arif, M.; Ó’Maoiléidigh, D.S.; Wellmer, F.; Krajewski, P.; Riechmann, J.L.; Angenent, G.C.

    2014-01-01

    Background: Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the

  20. Beijerinck Centennial Microbial Physiology and Gene Regulation : Emerging Principles and Applications

    NARCIS (Netherlands)

    Scheffers, W.A.; Van Dijken, J.P.

    1995-01-01

    Book of abstracts of Beijerinck Centennial Microbial Physiology and Gene Regulation: Emerging Principles and Applications, 10-14 December 1995 The Hague, The Netherlands. Under the auspices of the Netherlands Foundation for Biotechnology.

  1. PREFACE: Physics approaches to protein interactions and gene regulation Physics approaches to protein interactions and gene regulation

    Science.gov (United States)

    Nussinov, Ruth; Panchenko, Anna R.; Przytycka, Teresa

    2011-06-01

    networks have been identified, including scale free distribution of the vertex degree, network motifs, and modularity, to name a few. These studies of network organization require the network to be as complete as possible, which given the limitations of experimental techniques is not currently the case. Therefore, experimental procedures for detecting biomolecular interactions should be complemented by computational approaches. The paper by Lees et al provides a review of computational methods, integrating multiple independent sources of data to infer physical and functional protein-protein interaction networks. One of the important aspects of protein interactions that should be accounted for in the prediction of protein interaction networks is that many proteins are composed of distinct domains. Protein domains may mediate protein interactions while proteins and their interaction networks may gain complexity through gene duplication and expansion of existing domain architectures via domain rearrangements. The latter mechanisms have been explored in detail in the paper by Cohen-Gihon et al. Protein-protein interactions are not the only component of the cell's interactome. Regulation of cell activity can be achieved at the level of transcription and involve a transcription factor—DNA binding which typically requires recognition of a specific DNA sequence motif. Chip-Chip and the more recent Chip-Seq technologies allow in vivo identification of DNA binding sites and, together with novel in vitro approaches, provide data necessary for deciphering the corresponding binding motifs. Such information, complemented by structures of protein-DNA complexes and knowledge of the differences in binding sites among homologs, opens the door to constructing predictive binding models. The paper by Persikov and Singh provides an example of such a model in the Cys2His2 zinc finger family. Recent studies have indicated that the presence of such binding motifs is, however, neither necessary

  2. Integration of Genome Scale Metabolic Networks and Gene Regulation of Metabolic Enzymes With Physiologically Based Pharmacokinetics

    Science.gov (United States)

    Maldonado, Elaina M.; Leoncikas, Vytautas; Fisher, Ciarán P.; Moore, J. Bernadette; Plant, Nick J.

    2017-01-01

    The scope of physiologically based pharmacokinetic (PBPK) modeling can be expanded by assimilation of the mechanistic models of intracellular processes from systems biology field. The genome scale metabolic networks (GSMNs) represent a whole set of metabolic enzymes expressed in human tissues. Dynamic models of the gene regulation of key drug metabolism enzymes are available. Here, we introduce GSMNs and review ongoing work on integration of PBPK, GSMNs, and metabolic gene regulation. We demonstrate example models. PMID:28782239

  3. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  4. Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker's yeast

    NARCIS (Netherlands)

    van Eunen, Karen; Bouwman, Jildau; Lindenbergh, Alexander; Westerhoff, Hans V.; Bakker, Barbara M.

    2009-01-01

    Time-dependent regulation analysis is a new methodology that allows us to unravel, both quantitatively and dynamically, how and when functional changes in the cell are brought about by the interplay of gene expression and metabolism. In this first experimental implementation, we dissect the initial

  5. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Science.gov (United States)

    Falcon, Edgardo; Ozburn, Angela; Mukherjee, Shibani; Roybal, Kole; McClung, Colleen A

    2013-01-01

    Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc) and Caudate Putamen (CP), regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per) genes and Neuronal PAS Domain Protein 2 (Npas2) are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput)) protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  6. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Directory of Open Access Journals (Sweden)

    Edgardo Falcon

    Full Text Available Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc and Caudate Putamen (CP, regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per genes and Neuronal PAS Domain Protein 2 (Npas2 are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  7. Transcriptome analysis revealed the possible regulatory pathways initiating female geese broodiness within the hypothalamic-pituitary-gonadal axis.

    Directory of Open Access Journals (Sweden)

    Hehe Liu

    Full Text Available Geese have the strongest tendency toward broodiness among all poultry. The mechanisms initiating broodiness within the goose hypothalamic-pituitary-gonadal axis (HPGA are still unclear. Here, we reported the transcriptome differences between laying and initial nesting within the HPGA tissues of geese. We constructed a unigene database based on HPGA tissues and identified 128,148 unigenes, 100% of which have been annotated. By using Digital Gene Expression (DGE sequencing, we screened 19, 110, 289, and 211 differentially expressed genes (DEGs in the hypothalamus, pituitary gland, stroma ovarii, and follicles, respectively, between laying and nesting geese. Expression changes of hypocretin (HCRT and pro-opiomelanocortin (POMC in the hypothalamus of nesting geese may cause appetite reduction, which is possibly the first step and a prerequisite to initiate broodiness. In addition to prolactin (PRL, follicle-stimulating hormone (FSH and luteinizing hormone (LH, genes including oxytocin-neurophysin (OXT, chordin-like protein 1 (CHRDL1 and growth hormone (GH, expressed in the pituitary gland, are new candidate molecules that may be involved in broodiness in geese. Heme oxygenase 1 (HMOX1 in the pituitary gland, the proto-oncogene c-Fos (FOS, heat shock protein 90-alpha (HSP90AA, and cyclin-dependent kinase 1 (CDK1 in the ovary that may consolidate and transduce signals regulating the HPGA during broodiness in geese.

  8. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  9. Co-regulation of metabolic genes is better explained by flux coupling than by network distance.

    Directory of Open Access Journals (Sweden)

    Richard A Notebaart

    2008-01-01

    Full Text Available To what extent can modes of gene regulation be explained by systems-level properties of metabolic networks? Prior studies on co-regulation of metabolic genes have mainly focused on graph-theoretical features of metabolic networks and demonstrated a decreasing level of co-expression with increasing network distance, a naïve, but widely used, topological index. Others have suggested that static graph representations can poorly capture dynamic functional associations, e.g., in the form of dependence of metabolic fluxes across genes in the network. Here, we systematically tested the relative importance of metabolic flux coupling and network position on gene co-regulation, using a genome-scale metabolic model of Escherichia coli. After validating the computational method with empirical data on flux correlations, we confirm that genes coupled by their enzymatic fluxes not only show similar expression patterns, but also share transcriptional regulators and frequently reside in the same operon. In contrast, we demonstrate that network distance per se has relatively minor influence on gene co-regulation. Moreover, the type of flux coupling can explain refined properties of the regulatory network that are ignored by simple graph-theoretical indices. Our results underline the importance of studying functional states of cellular networks to define physiologically relevant associations between genes and should stimulate future developments of novel functional genomic tools.

  10. Transcriptional regulation of cardiac genes balance pro- and anti-hypertrophic mechanisms in hypertrophic cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Nina Gennebäck

    2012-06-01

    Full Text Available Hypertrophic cardiomyopathy (HCM is characterized by unexplained left ventricular hypertrophy. HCM is often hereditary, but our knowledge of the mechanisms leading from mutation to phenotype is incomplete. The transcriptional expression patterns in the myocar - dium of HCM patients may contribute to understanding the mechanisms that drive and stabilize the hypertrophy. Cardiac myectomies/biopsies from 8 patients with hypertrophic obstructive cardiomyopathy (HOCM and 5 controls were studied with whole genome Illumina microarray gene expression (detecting 18 189 mRNA. When comparing HOCM myocardium to controls, there was significant transcriptional down-regulation of the MYH6, EGR1, APOB and FOS genes, and significant transcriptional up-regulation of the ACE2, JAK2, NPPA (ANP, APOA1 and HDAC5 genes. The transcriptional regulation revealed both pro- and anti-hypertrophic mechanisms. The pro-hypertrophic response was explained by the transcriptional down-regulation of MYH6, indicating that the switch to the fetal gene program is maintained, and the transcriptional up-regulation of JAK2 in the JAK-STAT pathway. The anti-hypertrophic response was seen as a transcriptional down-regulation of the immediate early genes (IEGs, FOS and EGR1, and a transcriptional up-regulation of ACE2 and HDAC5. This can be interpreted as a transcriptional endogenous protection system in the heart of the HOCM patients, neither growing nor suppressing the already hypertrophic myocardium.

  11. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    Science.gov (United States)

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-02-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  12. The importance of topoisomerases for chromatin regulated genes

    DEFF Research Database (Denmark)

    Fredsøe, Jacob Christian; Pedersen, Jakob Madsen; Rødgaard, Morten Terpager

    2013-01-01

    DNA topoisomerases are enzymes, which function to relieve torsional stress in the DNA helix by introducing transient breaks into the DNA molecule. By use of Saccharomyces cerevisiae and microarray technology we have previously shown that topoisomerases are required for the activation of chromatin...... topoisomerases for optimal activation, but in contrast to the PHO5 gene, topoisomerases are not required for chromatin remodeling of the GAL1/10 promoter region, indicating a different role of the enzymes. We are currently performing a detailed investigation of the GAL genes to elucidate the precise role...

  13. In Silico analysis of perturbed steroidogenesis and gonad growth in fathead minnows (P. promelas) exposed to 17α-ethynylestradiol.

    Science.gov (United States)

    Hala, David; Petersen, Lene H; Martinović, Dalma; Huggett, Duane B

    2015-06-01

    The multi-factorial nature of adverse reproductive effects mediated by endocrine disrupting compounds (or EDCs) makes understanding the mechanistic basis of reproductive dysfunction a highly pertinent area of research. As a consequence, a main motivator for continued research is to integrate 'multi-leveled' complexity (i.e., from genes to phenotype) using mathematical methods capable of encapsulating properties of physiological relevance. In this study, an in silico stoichiometric model of piscine steroidogenesis was augmented with a 'biomass' reaction associating the underlying stoichiometry of steroidogenesis with a reaction representative of gonad growth. The ability of the in silico model to predict perturbed steroidogenesis and subsequent effects on gonad growth was tested by exposing reproductively active male and female fathead minnows (Pimephales promelas) to 88 ng/L of the synthetic estrogen, 17α-ethynylestradiol (EE2). The in silico model was parameterized (or constrained) with experimentally quantified concentrations of selected steroid hormones (using mass spectrometry) and fold changes in gene expression (using RT-qPCR) for selected steroidogenic enzyme genes, in gonads of male and female fish. Once constrained, the optimization framework of flux balance analysis (FBA) was used to calculate an optimal flux through the biomass reaction (analogous to gonad growth) and associated steroidogenic flux distributions required to generate biomass. FBA successfully predicted effects of EE2 exposure on fathead minnow gonad growth (%gonadosomatic index or %GSI) and perturbed production of steroid hormones. Specifically, FBA accurately predicted no effects of exposure on male %GSI and a significant reduction for female %GSI. Furthermore, in silico simulations accurately identified disrupted reaction fluxes catalyzing productions of androgens (in male fish) and progestogens (in female fish), an observation which agreed with in vivo experimentation. The analyses

  14. Steroid sex hormone dynamics during estradiol-17β induced gonadal differentiation in Paralichthys olivaceus (Teleostei)

    Science.gov (United States)

    Sun, Peng; You, Feng; Liu, Mengxia; Wu, Zhihao; Wen, Aiyun; Li, Jun; Xu, Yongli; Zhang, Peijun

    2010-03-01

    Steroid sex hormones, such as estradiol-17β (E2) and testosterone (T), are important regulators of sex change in fish. In this study, we examined the effects of E2 treatment on the dynamics of E2 and T during gonadal differentiation in the olive flounder Paralichthys olivaceus using histology and radioimmunoassay (RIA). Flounder larvae were divided into five groups (G0-G4), and fed with 0 (control), 0.2, 2, 20 and 100 mg E2/kg feed from 35 to 110 day post hatching (dph). Fish growth in the G1 and G2 groups was not significantly different from that of the control group ( P>0.05), while fish in the G3 and G4 groups were less active and showed growth depression and high mortality. The gonads of fish in the G3 and G4 groups were smaller and surrounded by hyperplastic connective tissue. The frequency of females in the G0-G4 groups was 54.5%, 75.0%, 100%, 100% and 93.3%, respectively. The RIA analyses of E2 and T showed that T levels decreased during gonadal differentiation, and increased slightly at the onset of ovarian differentiation, while E2 levels increased gradually and peaked at the onset of ovarian differentiation in the control group. In the E2-treated groups, T levels decreased before the onset of ovarian differentiation. E2 levels were high on the 48 dph, but declined to a lower level on the 54 dph, and then increased gradually during gonadal differentiation. And a sharp increase of E2 levels were observed in all E2-treated groups at the onset of ovarian differentiation. The data suggest that T and E2 play important roles during gonadal differentiation, and an E2 dose of 2 mg/kg feed could induce sex reversal in P. olivaceus.

  15. Major genes regulating total serum immunoglobulin E levels in families with asthma

    NARCIS (Netherlands)

    Postma, DS; Howard, TD; Koppelman, GH; Zheng, SL; Stine, OC; Bleecker, ER; Meyers, DA

    2000-01-01

    Immunoglobulin E (IgE) has a major role in the pathogenesis of allergic disorders and asthma. Previous data from 92 families, each identified through a proband with asthma, showed evidence for two major genes regulating total serum IgE levels. One of these genes mapped to 5q31-33. In the current

  16. Estrogen regulates the expression of cathepsin E-A-like gene via ...

    Indian Academy of Sciences (India)

    徐春林

    by estrogen, and the regulative effect was predominantly mediated via ER-β in chicken liver. Keywords: Estrogen ... the RNA-seq technique to investigate the mechanism of hepatic lipid metabolism (Li et al. 2015). ... To clone the cathepsin E-A-like gene and investigate the effect of estrogen on expression of the gene, a total ...

  17. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    Science.gov (United States)

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  18. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  19. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer

    Science.gov (United States)

    Chapman, Christopher G.; Mariani, Christopher J.; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B.; Kwon, John H.; Godley, Lucy A.

    2015-01-01

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer. PMID:26631571

  20. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer.

    Science.gov (United States)

    Chapman, Christopher G; Mariani, Christopher J; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B; Kwon, John H; Godley, Lucy A

    2015-12-03

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer.

  1. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-01-01

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  2. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  3. The vertebrate RCAN gene family: novel insights into evolution, structure and regulation.

    Directory of Open Access Journals (Sweden)

    Eva Serrano-Candelas

    Full Text Available Recently there has been much interest in the Regulators of Calcineurin (RCAN proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1. How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5' region of the genes, the existence of antisense transcripts (NAT associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies.

  4. Correlation among thermosensitive period, estradiol response, and gonad differentiation in the sea turtle Lepidochelys olivacea.

    Science.gov (United States)

    Merchant-Larios, H; Ruiz-Ramirez, S; Moreno-Mendoza, N; Marmolejo-Valencia, A

    1997-09-01

    Reptile embryos with temperature sex determination have a thermosensitive period (TSP). The finding that exogenous estradiol (E2) overcomes the effect of male-promoting temperature led to the idea that temperature may regulate estrogen concentration in the gonad during TSP. Since interspecific variations in TSP and in the effect of exogenous E2 exist, we undertook a study in the olive ridley Lepidochelys olivacea. Four parameters were correlated: the TSP (time dimension), the thermosensitive stages (rate of development), gonad development (histological aspect), and the estradiol response. Two kinds of experiments were performed: (1) Eggs were shifted once, at different stages of development, from a male-promoting temperature to a female-temperature (or vice versa) for the remainder of development. (2) Eggs at male-promoting temperature were treated once with 6 or 12 microg of estradiol (E2) at various times of incubation. Sex ratio was established around hatching in each experimental series. We found that the temporal dimension of the TSP was around 7 days (Days 20-27 of incubation) at a male-promoting or a female-promoting temperature. The rate of development of the whole embryo and gonadal growth was faster at female-promoting temperature than at male-promoting temperature. Formation of the genital ridge began at stage 21-22 and histological differentiation of the gonads occurred around stage 26-27. Although these stages coincided with the TSP, at male-promoting temperature the thermosensitive stages occurred earlier (from stages 20-21 to stages 23-24) than at female-promoting temperature (from stages 23-24 to stages 26-27). Thus, at male promoting-temperature, sex was determined in embryos with incipient or undifferentiated gonads. In contrast, E2 treatment continued to feminize the gonads of embryos at a male-promoting temperature beyond the TSP up to stage 25-26, but the E2-induced ovaries were significantly smaller than temperature-induced ovaries. It is

  5. Transcriptional regulation of the Drosophila catalase gene by the DRE/DREF system

    OpenAIRE

    Park, So Young; Kim, Young-Shin; Yang, Dong-Jin; Yoo, Mi-Ae

    2004-01-01

    Reactive oxygen species (ROS) cause oxidative stress and aging. The catalase gene is a key component of the cellular antioxidant defense network. However, the molecular mechanisms that regulate catalase gene expression are poorly understood. In this study, we have identified a DNA replication-related element (DRE; 5′-TATCGATA) in the 5′-flanking region of the Drosophila catalase gene. Gel mobility shift assays revealed that a previously identified factor called DREF (DRE- binding factor) bind...

  6. Nup98 regulation of histone methylation promotes normal gene expression and may drive leukemogenesis.

    Science.gov (United States)

    Sump, Bethany; Brickner, Jason H

    2017-11-15

    Nuclear pore proteins (Nups) interact with chromosomes to regulate gene expression and chromatin structure. A new study by Franks and colleagues (pp. 2222-2234) provides new mechanistic insight into the molecular basis by which Nup98 promotes gene activation in normal hematopoietic cells and how that process is altered by translocations to cause excess expression of developmental genes in leukemia. © 2017 Sump and Brickner; Published by Cold Spring Harbor Laboratory Press.

  7. An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

    Directory of Open Access Journals (Sweden)

    Ao Li

    2009-04-01

    Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

  8. Mendelian and non-Mendelian regulation of gene expression in maize.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available Transcriptome variation plays an important role in affecting the phenotype of an organism. However, an understanding of the underlying mechanisms regulating transcriptome variation in segregating populations is still largely unknown. We sought to assess and map variation in transcript abundance in maize shoot apices in the intermated B73 × Mo17 recombinant inbred line population. RNA-based sequencing (RNA-seq allowed for the detection and quantification of the transcript abundance derived from 28,603 genes. For a majority of these genes, the population mean, coefficient of variation, and segregation patterns could be predicted by the parental expression levels. Expression quantitative trait loci (eQTL mapping identified 30,774 eQTL including 96 trans-eQTL "hotspots," each of which regulates the expression of a large number of genes. Interestingly, genes regulated by a trans-eQTL hotspot tend to be enriched for a specific function or act in the same genetic pathway. Also, genomic structural variation appeared to contribute to cis-regulation of gene expression. Besides genes showing Mendelian inheritance in the RIL population, we also found genes whose expression level and variation in the progeny could not be predicted based on parental difference, indicating that non-Mendelian factors also contribute to expression variation. Specifically, we found 145 genes that show patterns of expression reminiscent of paramutation such that all the progeny had expression levels similar to one of the two parents. Furthermore, we identified another 210 genes that exhibited unexpected patterns of transcript presence/absence. Many of these genes are likely to be gene fragments resulting from transposition, and the presence/absence of their transcripts could influence expression levels of their ancestral syntenic genes. Overall, our results contribute to the identification of novel expression patterns and broaden the understanding of transcriptional variation in

  9. Identification of Plagl1/Zac1 binding sites and target genes establishes its role in the regulation of extracellular matrix genes and the imprinted gene network.

    Science.gov (United States)

    Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent

    2017-10-13

    PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Tight regulation of the intS gene of the KplE1 prophage: a new paradigm for integrase gene regulation.

    Directory of Open Access Journals (Sweden)

    Gaël Panis

    2010-10-01

    Full Text Available Temperate phages have the ability to maintain their genome in their host, a process called lysogeny. For most, passive replication of the phage genome relies on integration into the host's chromosome and becoming a prophage. Prophages remain silent in the absence of stress and replicate passively within their host genome. However, when stressful conditions occur, a prophage excises itself and resumes the viral cycle. Integration and excision of phage genomes are mediated by regulated site-specific recombination catalyzed by tyrosine and serine recombinases. In the KplE1 prophage, site-specific recombination is mediated by the IntS integrase and the TorI recombination directionality factor (RDF. We previously described a sub-family of temperate phages that is characterized by an unusual organization of the recombination module. Consequently, the attL recombination region overlaps with the integrase promoter, and the integrase and RDF genes do not share a common activated promoter upon lytic induction as in the lambda prophage. In this study, we show that the intS gene is tightly regulated by its own product as well as by the TorI RDF protein. In silico analysis revealed that overlap of the attL region with the integrase promoter is widely encountered in prophages present in prokaryotic genomes, suggesting a general occurrence of negatively autoregulated integrase genes. The prediction that these integrase genes are negatively autoregulated was biologically assessed by studying the regulation of several integrase genes from two different Escherichia coli strains. Our results suggest that the majority of tRNA-associated integrase genes in prokaryotic genomes could be autoregulated and that this might be correlated with the recombination efficiency as in KplE1. The consequences of this unprecedented regulation for excessive recombination are discussed.

  11. LCGbase: A Comprehensive Database for Lineage-Based Co-regulated Genes.

    Science.gov (United States)

    Wang, Dapeng; Zhang, Yubin; Fan, Zhonghua; Liu, Guiming; Yu, Jun

    2012-01-01

    Animal genes of different lineages, such as vertebrates and arthropods, are well-organized and blended into dynamic chromosomal structures that represent a primary regulatory mechanism for body development and cellular differentiation. The majority of genes in a genome are actually clustered, which are evolutionarily stable to different extents and biologically meaningful when evaluated among genomes within and across lineages. Until now, many questions concerning gene organization, such as what is the minimal number of genes in a cluster and what is the driving force leading to gene co-regulation, remain to be addressed. Here, we provide a user-friendly database-LCGbase (a comprehensive database for lineage-based co-regulated genes)-hosting information on evolutionary dynamics of gene clustering and ordering within animal kingdoms in two different lineages: vertebrates and arthropods. The database is constructed on a web-based Linux-Apache-MySQL-PHP framework and effective interactive user-inquiry service. Compared to other gene annotation databases with similar purposes, our database has three comprehensible advantages. First, our database is inclusive, including all high-quality genome assemblies of vertebrates and representative arthropod species. Second, it is human-centric since we map all gene clusters from other genomes in an order of lineage-ranks (such as primates, mammals, warm-blooded, and reptiles) onto human genome and start the database from well-defined gene pairs (a minimal cluster where the two adjacent genes are oriented as co-directional, convergent, and divergent pairs) to large gene clusters. Furthermore, users can search for any adjacent genes and their detailed annotations. Third, the database provides flexible parameter definitions, such as the distance of transcription start sites between two adjacent genes, which is extendable to genes that flanking the cluster across species. We also provide useful tools for sequence alignment, gene

  12. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    International Nuclear Information System (INIS)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-01-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  13. Jarid1b targets genes regulating development and is involved in neural differentiation

    DEFF Research Database (Denmark)

    Schmitz, Sandra U; Albert, Mareike; Malatesta, Martina

    2011-01-01

    H3K4 methylation is associated with active transcription and in combination with H3K27me3 thought to keep genes regulating development in a poised state. The contribution of enzymes regulating trimethylation of lysine 4 at histone 3 (H3K4me3) levels to embryonic stem cell (ESC) self-renewal and d...

  14. E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis

    DEFF Research Database (Denmark)

    Müller, H; Bracken, A P; Vernell, R

    2001-01-01

    The retinoblastoma protein (pRB) and its two relatives, p107 and p130, regulate development and cell proliferation in part by inhibiting the activity of E2F-regulated promoters. We have used high-density oligonucleotide arrays to identify genes in which expression changed in response to activation...

  15. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    Energy Technology Data Exchange (ETDEWEB)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-10-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  16. Human nutrigenomics of gene regulation by dietary fatty acids

    NARCIS (Netherlands)

    Afman, L.A.; Muller, M.R.

    2012-01-01

    Nutrigenomics employs high-throughput genomics technologies to unravel how nutrients modulate gene and protein expression and ultimately influence cellular and organism metabolism. The most often-applied genomics technique so far is transcriptomics, which allows quantifying genome-wide changes in

  17. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Here, we report the identification of a novel submergence response (RS1) gene that is specifically induced in the Sub1A-mediated submergence tolerance response. Under submergence, RS1 was upregulated in M202 (Sub1A) but downregulated in M202 in RNA-seq and microarray assays. Expression analyses of various ...

  18. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)

    2016-01-01

    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  19. Early gene regulation of osteogenesis in embryonic stem cells

    KAUST Repository

    Kirkham, Glen R.

    2012-01-01

    The early gene regulatory networks (GRNs) that mediate stem cell differentiation are complex, and the underlying regulatory associations can be difficult to map accurately. In this study, the expression profiles of the genes Dlx5, Msx2 and Runx2 in mouse embryonic stem cells were monitored over a 48 hour period after exposure to the growth factors BMP2 and TGFβ1. Candidate GRNs of early osteogenesis were constructed based on published experimental findings and simulation results of Boolean and ordinary differential equation models were compared with our experimental data in order to test the validity of these models. Three gene regulatory networks were found to be consistent with the data, one of these networks exhibited sustained oscillation, a behaviour which is consistent with the general view of embryonic stem cell plasticity. The work cycle presented in this paper illustrates how mathematical modelling can be used to elucidate from gene expression profiles GRNs that are consistent with experimental data. © 2012 The Royal Society of Chemistry.

  20. Maturity Gonad Sea Cucumber Holothuria scabra Under The Month Cycle

    Science.gov (United States)

    Penina Tua Rahantoknam, Santi

    2017-10-01

    Gonad maturity level of the sea cucumber Holothuria scabra is important to note for selection of parent ready spawn. Sea cucumbers are giving a reaction to the treatment of excitatory spawn mature individuals only. For the determination of the level of maturity of gonads of sea cucumbers, the necessary observation of the gonads are microscopic, macroscopic and gonad maturity gonado somatic indeks (GSI). GSI value is important to know the changes that occur in the gonads quantitatively, so that time can be presumed spawning (Effendie, 1997). Reproductive cycle can be determined by observing the evolution of GSI. The study of sea cucumbers Holothuria scabra gonad maturity conducted in Langgur, Southeast Maluku. Observations were made at every cycle of the moon is the full moon phase (BP) and new moon (BB) in the period January 29, 2017 until July 23, 2017. Observations H. scabra gonad maturity level is done with surgery, observation and calculation GSI gonad histology. GSI highest value obtained in May that full moon cycle at 90% of individuals that are in the spawning stage (phase 5), then 70% of the individuals that are in the spawning stage (phase 5) in March that the full moon cycle. The results obtained show that the peak spawning H. scabra period January 2017 to July 2017 occurred on the full moon cycle in May.

  1. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Directory of Open Access Journals (Sweden)

    Erming Wang

    Full Text Available In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  2. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  3. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  4. The DAF-7 TGF-β signaling pathway regulates chemosensory receptor gene expression in C. elegans

    OpenAIRE

    Nolan, Katherine M.; Sarafi-Reinach, Trina R.; Horne, Jennifer G.; Saffer, Adam M.; Sengupta, Piali

    2002-01-01

    Regulation of chemoreceptor gene expression in response to environmental or developmental cues provides a mechanism by which animals can alter their sensory responses. Here we demonstrate a role for the daf-7 TGF-β pathway in the regulation of expression of a subset of chemoreceptor genes in Caenorhabditis elegans. We describe a novel role of this pathway in maintaining receptor gene expression in the adult and show that the DAF-4 type II TGF-β receptor functions cell-autonomously to modulate...

  5. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-12-07

    -regulation of RS1 in M202(Sub1A)×Kitaake lead to weaken submergence tolerance. We hypothesize that RS1 may ..... Each data point represents the mean±SD of 3 independent biological replicates. The student's t-test was ...

  6. Unsaturated fatty acid: Metabolism, synthesis and gene regulation ...

    African Journals Online (AJOL)

    In both plants and animals, unsaturated fatty acids are considered to be essential membrane components. Also they play key roles in many cellular events. The synthesis and metabolism of unsaturated fatty acid are very complex processes, involving a variety of enzymes and regulated pathways. Most recently, research has ...

  7. Mechanisms for the environmental regulation of gene expression ...

    Indian Academy of Sciences (India)

    Unknown

    The environment can play a significant role in the production of phenotypes. However, the ... phenotype production by the environment should be considered a normal component of development and devel- opmental biology. .... Hormonal regulation mediates the environmentally controlled pigmentation of Araschnia. In the.

  8. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Glucose homeostasis in mammals is achieved by the actions of counterregulatory hormones, namely insulin, glucagon and glucocorticoids. Glucose levels in the circulation are regulated by the liver, the metabolic centre which produces glucose when it is scarce in the blood. This process is catalysed by two rate-limiting ...

  9. Effects of in ovo exposure of Imazalil and Atrazine on sexual differentiation in chick gonads

    Energy Technology Data Exchange (ETDEWEB)

    Yamashita, J.; Ikeda, M. [Univ. of Shizuoka, Shizuoka (Japan); Matsushita, S.; Iwasawa, T.; Ikeya, M. [Shizuoka Swine and Poultry Experiment Station, Kikugawa (Japan)

    2004-09-15

    In contrast to mammals, the heterogametic sex (sex chromosome: ZW) in avian species is the genetic female whereas the homogametic (sex chromosome: ZZ) is the genetic male. The W chromosome positively controls early aromatase synthesis and consequently estrogen production. The presence of estrogens and their receptors plays a crucial role in female sexual differentiation. Chicken embryonic gonads are bipotential at an early stage. During development of the female, the left gonad differentiates to a single ovary/oviduct, and the right gonad regresses, developing a permanent female phenotype. This sexual differentiation occurs as a result of aromatase expression in the left gonad at day 6.5 and the production of estrogen from testosterone. In the male genotype, both gonads develop into two testes. The time- and sex-dependent expression of enzymes involved in steroidogenesis, which determine the ratio of androgens/estrogens produced by the gonads, has been extensively investigated during the last 5-6 year. These results show that the lack of estrogen synthesis in the male appears to be due to the extremely low levels of P450 aromatase expression. In female, extensive expression of the aromatase gene (around day 5-6 incubation), leading to estrogen synthesis, and specific expression of the estrogen receptor-mRNA in the left gonad result in the development of a functional left ovary. Experimental sex reversal has been performed using anti-estrogens, androgens, aromatase inhibitors and synthetic steroid. Differences between male and female gonadal differentiation and development are depended on the absence of aromatase and estrogen. On the one hand, differences between left and right ovarian development are depended on the specific expression of the estrogen receptor in the left gonad. Persistent chlorine-containing pesticide, imazalil is structurally similar to various imidazolecontaining chemicals used clinically such as the potent aromatase inhibitor, fadrozole and

  10. The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

    Science.gov (United States)

    Zhao, D; Yu, Q; Chen, M; Ma, H

    2001-07-01

    The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

  11. Intramacrophage Mycobacterium tuberculosis efflux pump gene regulation after rifampicin and verapamil exposure.

    Science.gov (United States)

    Canezin, Pedro Henrique; Caleffi-Ferracioli, Katiany Rizzieri; Scodro, Regiane Bertin de Lima; Siqueira, Vera Lúcia Dias; Pavan, Fernando Rogério; Barros, Isabella Letícia Esteves; Cardoso, Rosilene Fressatti

    2018-03-22

    Since resistance of Mycobacterium tuberculosis (Mtb) partially derives from efflux pumps (EPs) in the plasma membrane, the current study evaluates EPs in Mtb exposed to rifampicin in the presence of the EP inhibitor verapamil, within a macrophage environment. Human acute monocytic leukaemia cell line THP-1 was infected with Mtb H37Rv and exposed to rifampicin and verapamil alone and in combination for 24 and 72 h. After RNA extraction, quantitative PCR was carried out for 11 EP genes using SYBR green PCR master mix in the StepOne™ Real-Time PCR System. After 24 h of exposure to rifampicin, Mtb H37Rv showed that 10 EP genes were up-regulated when compared with the control. The rifampicin/verapamil combination induced down-regulation of 54.5% (6/11) of the EP genes. At 72 h, rifampicin exposure induced up-regulation of 10 EP genes and rifampicin/verapamil induced down-regulation of 8 EP genes, which suggests effective EP-inhibitory activity of verapamil against Mtb H37Rv in an intramacrophage environment. The current study demonstrated that rifampicin/verapamil caused down-regulation of several EP genes in Mtb inside the macrophage environment. In vivo trials may show that rifampicin/verapamil therapy could be of value in enhancing anti-TB treatment.

  12. Hormonal regulation of platypus Beta-lactoglobulin and monotreme lactation protein genes.

    Science.gov (United States)

    Enjapoori, Ashwantha Kumar; Lefèvre, Christophe M; Nicholas, Kevin R; Sharp, Julie A

    2017-02-01

    Endocrine regulation of milk protein gene expression in marsupials and eutherians is well studied. However, the evolution of this complex regulation that began with monotremes is unknown. Monotremes represent the oldest lineage of extant mammals and the endocrine regulation of lactation in these mammals has not been investigated. Here we characterised the proximal promoter and hormonal regulation of two platypus milk protein genes, Beta-lactoglobulin (BLG), a whey protein and monotreme lactation protein (MLP), a monotreme specific milk protein, using in vitro reporter assays and a bovine mammary epithelial cell line (BME-UV1). Insulin and dexamethasone alone provided partial induction of MLP, while the combination of insulin, dexamethasone and prolactin was required for maximal induction. Partial induction of BLG was achieved by insulin, dexamethasone and prolactin alone, with maximal induction using all three hormones. Platypus MLP and BLG core promoter regions comprised transcription factor binding sites (e.g. STAT5, NF-1 and C/EBPα) that were conserved in marsupial and eutherian lineages that regulate caseins and whey protein gene expression. Our analysis suggests that insulin, dexamethasone and/or prolactin alone can regulate the platypus MLP and BLG gene expression, unlike those of therian lineage. The induction of platypus milk protein genes by lactogenic hormones suggests they originated before the divergence of marsupial and eutherians. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Inter-chromosomal gene regulation in the mammalian cell nucleus.

    Science.gov (United States)

    de Laat, Wouter; Grosveld, Frank

    2007-10-01

    Cellular phenotypes can critically rely on mono-allelic gene expression. Recent studies suggest that in mammalian cells inter-chromosomal DNA interactions may mediate the decision which allele to activate and which to silence. Here, these findings are discussed in the context of knowledge on gene competition, chromatin dynamics, and nuclear organization. We argue that data obtained by 4C technology strongly support the idea that chromatin folds according to self-organizing principles. In this concept, the nuclear positioning of a given locus is probabilistic as it also depends on the properties of neighbouring DNA segments and, by extrapolation, the whole chromosome. The linear distribution of repetitive DNA sequences and of active and inactive DNA regions is important for the folding and relative positioning of chromosomes. This stochastic concept of nuclear organization predicts that tissue-specific interactions between two selected loci present on different chromosomes will be rare.

  14. An alternative pathway for gene regulation by Myc

    DEFF Research Database (Denmark)

    Peukert, K; Staller, P; Schneider, A

    1997-01-01

    The c-Myc protein activates transcription as part of a heteromeric complex with Max. However, Myc-transformed cells are characterized by loss of expression of several genes, suggesting that Myc may also repress gene expression. Two-hybrid cloning identifies a novel POZ domain Zn finger protein (Miz......-1; Myc-interacting Zn finger protein-1) that specifically interacts with Myc, but not with Max or USF. Miz-1 binds to start sites of the adenovirus major late and cyclin D1 promoters and activates transcription from both promoters. Miz-1 has a potent growth arrest function. Binding of Myc to Miz-1...... requires the helix-loop-helix domain of Myc and a short amphipathic helix located in the carboxy-terminus of Miz-1. Expression of Myc inhibits transactivation, overcomes Miz-1-induced growth arrest and renders Miz-1 insoluble in vivo. These processes depend on Myc and Miz-1 association and on the integrity...

  15. Uncovering transcriptional regulation of glycerol metabolism in Aspergilli through genome-wide gene expression data anlysis

    DEFF Research Database (Denmark)

    Salazar, Margarita Pena; Vongsangnak, Wanwipa; Panagiotou, Gianni

    2009-01-01

    Glycerol is catabolized by a wide range of microorganisms including Aspergillus species. To identify the transcriptional regulation of glycerol metabolism in Aspergillus, we analyzed data from triplicate batch fermentations of three different Aspergilli (Aspergillus nidulans, Aspergillus oryzae...... and Aspergillus niger) with glucose and glycerol as carbon sources. Protein comparisons and cross-analysis with gene expression data of all three species resulted in the identification of 88 genes having a conserved response across the three Aspergilli. A promoter analysis of the up-regulated genes led....... niger. Our transcriptome analysis indicated that genes involved in ethanol, glycerol, fatty acid, amino acids and formate utilization are putatively regulated by Adr1 in Aspergilli as in Saccharomyces cerevisiae and this transcription factor therefore is likely to be cross-species conserved among...

  16. An integrated machine learning approach for predicting DosR-regulated genes in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Bacon Joanna

    2010-03-01

    Full Text Available Abstract Background DosR is an important regulator of the response to stress such as limited oxygen availability in Mycobacterium tuberculosis. Time course gene expression data enable us to dissect this response on the gene regulatory level. The mRNA expression profile of a regulator, however, is not necessarily a direct reflection of its activity. Knowing the transcription factor activity (TFA can be exploited to predict novel target genes regulated by the same transcription factor. Various approaches have been proposed to reconstruct TFAs from gene expression data. Most of them capture only a first-order approximation to the complex transcriptional processes by assuming linear gene responses and linear dynamics in TFA, or ignore the temporal information in data from such systems. Results In this paper, we approach the problem of inferring dynamic hidden TFAs using Gaussian processes (GP. We are able to model dynamic TFAs and to account for both linear and nonlinear gene responses. To test the validity of the proposed approach, we reconstruct the hidden TFA of p53, a tumour suppressor activated by DNA damage, using published time course gene expression data. Our reconstructed TFA is closer to the experimentally determined profile of p53 concentration than that from the original study. We then apply the model to time course gene expression data obtained from chemostat cultures of M. tuberculosis under reduced oxygen availability. After estimation of the TFA of DosR based on a number of known target genes using the GP model, we predict novel DosR-regulated genes: the parameters of the model are interpreted as relevance parameters indicating an existing functional relationship between TFA and gene expression. We further improve the prediction by integrating promoter sequence information in a logistic regression model. Apart from the documented DosR-regulated genes, our prediction yields ten novel genes under direct control of DosR. Conclusions

  17. Transcriptional regulation of the prolactin gene in turkeys

    OpenAIRE

    Kurima, Kiyoto

    1996-01-01

    Poor reproductive performance by turkey hens compared with chickens is partially due to the early cessation of egg production associated with the onset of incubation behavior. Prolactin (Prl) is involved in the induction and maintenance of incubation behavior in birds, and understanding the regulatory mechanism(s) of Prl gene expression will provide fundamental information to manipulate Prl production for better reproductive performance in turkey hens.

  18. Transcriptional regulation of the Kluyveromyces lactis beta-galactosidase gene.

    OpenAIRE

    Lacy, L R; Dickson, R C

    1981-01-01

    We examined the molecular basis for beta-D-galactosidase (EC 3.2.1.23) induction in the yeast Kluyveromyces lactis. The protein synthesis inhibitor anisomycin effectively blocked both protein synthesis and enzyme induction by lactose. Further, hybridization analysis with the cloned beta-galactosidase gene indicated coordinate increases in the concentration of beta-galactosidase messenger ribonucleic acid and enzyme activity. The half-life of beta-galactosidase messenger ribonucleic acid was t...

  19. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    Science.gov (United States)

    2004-04-01

    subclones used the Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific...a P-element inserted in the first intron of the Nf1 gene. Both mutations abolish NF1 protein production (The et al., 1997). The k33 wild type...injections. The location of the six point mutations that were generated and successfully introduced into transgenic flies is diagrammed in Figure 1A

  20. Regulation of inflammatory gene expression in PBMCs by immunostimulatory botanicals.

    Directory of Open Access Journals (Sweden)

    Karen L Denzler

    Full Text Available Many hundreds of botanicals are used in complementary and alternative medicine for therapeutic use as antimicrobials and immune stimulators. While there exists many centuries of anecdotal evidence and few clinical studies on the activity and efficacy of these botanicals, limited scientific evidence exists on the ability of these botanicals to modulate the immune and inflammatory responses. Using botanogenomics (or herbogenomics, this study provides novel insight into inflammatory genes which are induced in peripheral blood mononuclear cells following treatment with immunomodulatory botanical extracts. These results may suggest putative genes involved in the physiological responses thought to occur following administration of these botanical extracts. Using extracts from immunostimulatory herbs (Astragalus membranaceus, Sambucus cerulea, Andrographis paniculata and an immunosuppressive herb (Urtica dioica, the data presented supports previous cytokine studies on these herbs as well as identifying additional genes which may be involved in immune cell activation and migration and various inflammatory responses, including wound healing, angiogenesis, and blood pressure modulation. Additionally, we report the presence of lipopolysaccharide in medicinally prepared extracts of these herbs which is theorized to be a natural and active component of the immunostimulatory herbal extracts. The data presented provides a more extensive picture on how these herbs may be mediating their biological effects on the immune and inflammatory responses.

  1. Trans gene regulation in adaptive evolution: a genetic algorithm model.

    Science.gov (United States)

    Behera, N; Nanjundiah, V

    1997-09-21

    This is a continuation of earlier studies on the evolution of infinite populations of haploid genotypes within a genetic algorithm framework. We had previously explored the evolutionary consequences of the existence of indeterminate-"plastic"-loci, where a plastic locus had a finite probability in each generation of functioning (being switched "on") or not functioning (being switched "off"). The relative probabilities of the two outcomes were assigned on a stochastic basis. The present paper examines what happens when the transition probabilities are biased by the presence of regulatory genes. We find that under certain conditions regulatory genes can improve the adaptation of the population and speed up the rate of evolution (on occasion at the cost of lowering the degree of adaptation). Also, the existence of regulatory loci potentiates selection in favour of plasticity. There is a synergistic effect of regulatory genes on plastic alleles: the frequency of such alleles increases when regulatory loci are present. Thus, phenotypic selection alone can be a potentiating factor in a favour of better adaptation. Copyright 1997 Academic Press Limited.

  2. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    2009-12-01

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  3. Link between the causative genes of holoprosencephaly: Zic2 directly regulates Tgif1 expression.

    Science.gov (United States)

    Ishiguro, Akira; Hatayama, Minoru; Otsuka, Maky I; Aruga, Jun

    2018-02-01

    One of the causal genes for holoprosencephaly (HPE) is ZIC2 (HPE5). It belongs to the zinc finger protein of the cerebellum (Zic) family of genes that share a C2H2-type zinc finger domain, similar to the GLI family of genes. In order to clarify the role of Zic2 in gene regulation, we searched for its direct target genes using chromatin immunoprecipitation (ChIP). We identified TGIF1 (HPE4), another holoprosencephaly-causative gene in humans. We identified Zic2-binding sites (ZBS) on the 5' flanking region of Tgif1 by in vitro DNA binding assays. ZBS were essential for Zic2-dependent transcriptional activation in reporter gene assays. Zic2 showed a higher affinity to ZBS than GLI-binding sequences. Zic2-binding to the cis-regulatory element near the Tgif1 promoter may be involved in the mechanism underlying forebrain development and incidences of HPE.

  4. Investigation of epigenetic gene regulation in Arabidopsis modulated by gamma radiation

    International Nuclear Information System (INIS)

    Woo, Hye Ryun; Kim, Jae Sung; Lee, Myung Jin; Lee, Dong Joon; Kim, Young Min; Jung, Joon Yong; Han, Wan Keun; Kang, Soo Jin

    2011-12-01

    To investigate epigenetic gene regulation in Arabidopsis modulated by gamma radiation, we examined the changes in DNA methylation and histone modification after gamma radiation and investigated the effects of gamma radiation on epigenetic information and gene expression. We have selected 14 genes with changes in DNA methylation by gamma radiation, analyzed the changes of histone modification in the selected genes to reveal the relationship between DNA methylation and histone modification by gamma radiation. We have also analyzed the effects of gamma radiation on gene expression to investigate the relationship between epigenetic information and gene expression by gamma radiation. The results will be useful to reveal the effects of gamma radiation on DNA methylation, histone modification and gene expression. We anticipate that the information generated in this proposal will help to find out the mechanism underlying the changes in epigenetic information by gamma radiation

  5. RNA Binding Proteins Posttranscriptionally Regulate Genes Involved In Oncogenesis

    Science.gov (United States)

    2010-06-01

    lysed in triple- detergent RIPA buffer with protease inhibitor cocktail (Roche, Pleasanton, CA). For nuclear and cytoplasmic fractionation, the NE-PER kit...Posttranscriptional regulation of IL-13 in T cells: role of the RNA-binding protein HuR. The Journal of allergy and clinical immunology 2008, 121(4):853-859...and western blot analysis. Western analysis was performed as described previously.12 For detection of VEGFα and TSP1 from tumors, triple- detergent

  6. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factors in flower development.

    Science.gov (United States)

    Pajoro, Alice; Madrigal, Pedro; Muiño, Jose M; Matus, José Tomás; Jin, Jian; Mecchia, Martin A; Debernardi, Juan M; Palatnik, Javier F; Balazadeh, Salma; Arif, Muhammad; Ó'Maoiléidigh, Diarmuid S; Wellmer, Frank; Krajewski, Pawel; Riechmann, José-Luis; Angenent, Gerco C; Kaufmann, Kerstin

    2014-03-03

    Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the mechanisms by which these factors dynamically regulate the expression of their target genes at different developmental stages are still poorly understood. We characterized the relationship of chromatin accessibility, gene expression, and DNA binding of two MADS-domain proteins at different stages of Arabidopsis flower development. Dynamic changes in APETALA1 and SEPALLATA3 DNA binding correlated with changes in gene expression, and many of the target genes could be associated with the developmental stage in which they are transcriptionally controlled. We also observe dynamic changes in chromatin accessibility during flower development. Remarkably, DNA binding of APETALA1 and SEPALLATA3 is largely independent of the accessibility status of their binding regions and it can precede increases in DNA accessibility. These results suggest that APETALA1 and SEPALLATA3 may modulate chromatin accessibility, thereby facilitating access of other transcriptional regulators to their target genes. Our findings indicate that different homeotic factors regulate partly overlapping, yet also distinctive sets of target genes in a partly stage-specific fashion. By combining the information from DNA-binding and gene expression data, we are able to propose models of stage-specific regulatory interactions, thereby addressing dynamics of regulatory networks throughout flower development. Furthermore, MADS-domain TFs may regulate gene expression by alternative strategies, one of which is modulation of chromatin accessibility.

  7. Reverse-engineering of gene networks for regulating early blood development from single-cell measurements.

    Science.gov (United States)

    Wei, Jiangyong; Hu, Xiaohua; Zou, Xiufen; Tian, Tianhai

    2017-12-28

    Recent advances in omics technologies have raised great opportunities to study large-scale regulatory networks inside the cell. In addition, single-cell experiments have measured the gene and protein activities in a large number of cells under the same experimental conditions. However, a significant challenge in computational biology and bioinformatics is how to derive quantitative information from the single-cell observations and how to develop sophisticated mathematical models to describe the dynamic properties of regulatory networks using the derived quantitative information. This work designs an integrated approach to reverse-engineer gene networks for regulating early blood development based on singel-cell experimental observations. The wanderlust algorithm is initially used to develop the pseudo-trajectory for the activities of a number of genes. Since the gene expression data in the developed pseudo-trajectory show large fluctuations, we then use Gaussian process regression methods to smooth the gene express data in order to obtain pseudo-trajectories with much less fluctuations. The proposed integrated framework consists of both bioinformatics algorithms to reconstruct the regulatory network and mathematical models using differential equations to describe the dynamics of gene expression. The developed approach is applied to study the network regulating early blood cell development. A graphic model is constructed for a regulatory network with forty genes and a dynamic model using differential equations is developed for a network of nine genes. Numerical results suggests that the proposed model is able to match experimental data very well. We also examine the networks with more regulatory relations and numerical results show that more regulations may exist. We test the possibility of auto-regulation but numerical simulations do not support the positive auto-regulation. In addition, robustness is used as an importantly additional criterion to select candidate

  8. Growth hormone regulation of rat liver gene expression assessed by SSH and microarray.

    Science.gov (United States)

    Gardmo, Cissi; Swerdlow, Harold; Mode, Agneta

    2002-04-25

    The sexually dimorphic secretion of growth hormone (GH) that prevails in the rat leads to a sex-differentiated expression of GH target genes, particularly in the liver. We have used subtractive suppressive hybridization (SSH) to search for new target genes induced by the female-characteristic, near continuous, pattern of GH secretion. Microarrays and dot-blot hybridizations were used in an attempt to confirm differential ratios of expression of obtained SSH clones. Out of 173 unique SSH clones, 41 could be verified as differentially expressed. Among these, we identified 17 known genes not previously recognized as differentially regulated by the sex-specific GH pattern. Additional SSH clones may also represent genes subjected to sex-specific GH regulation since only transcripts abundantly expressed could be verified. Optimized analyses, specific for each gene, are required to fully characterize the degree of differential expression.

  9. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  10. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    their duplicate were found to be under less purifying selection. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to macromolecular complexes, whereas paralogs with different expression levels were enriched in terms associated...... new functions, or their gene products are in a dosage balance. Regulatory DNA elements - some of which are conserved across species and hence called conserved non-coding sequences (CNSs) - that control expression of duplicated genes are thus under similar purifying selection. In the present study, I...... have performed in-depth analyses of paralogous genes in Arabidopsis thaliana, their expression profile, their sequence conservation, and their functions, in order to investigate the relationship between gene expression and retention of paralogous genes. Paralogs with lower expression than...

  11. Gonadal Hormones and Retinal Disorders: A Review

    Directory of Open Access Journals (Sweden)

    Raffaele Nuzzi

    2018-03-01

    Full Text Available AimGonadal hormones are essential for reproductive function, but can act on neural and other organ systems, and are probably the cause of the large majority of known sex differences in function and disease. The aim of this review is to provide evidence for this hypothesis in relation to eye disorders and to retinopathies in particular.MethodsEpidemiological studies and research articles were reviewed.ResultsAnalysis of the biological basis for a relationship between eye diseases and hormones showed that estrogen, androgen, and progesterone receptors are present throughout the eye and that these steroids are locally produced in ocular tissues. Sex hormones can have a neuroprotective action on the retina and modulate ocular blood flow. There are differences between the male and the female retina; moreover, sex hormones can influence the development (or not of certain disorders. For example, exposure to endogenous estrogens, depending on age at menarche and menopause and number of pregnancies, and exposure to exogenous estrogens, as in hormone replacement therapy and use of oral contraceptives, appear to protect against age-related macular degeneration (both drusenoid and neurovascular types, whereas exogenous testosterone therapy is a risk factor for central serous chorioretinopathy. Macular hole is more common among women than men, particularly in postmenopausal women probably owing to the sudden drop in estrogen production in later middle age. Progestin therapy appears to ameliorate the course of retinitis pigmentosa. Diabetic retinopathy, a complication of diabetes, may be more common among men than women.ConclusionWe observed a correlation between many retinopathies and sex, probably as a result of the protective effect some gonadal hormones may exert against the development of certain disorders. This may have ramifications for the use of hormone therapy in the treatment of eye disease and of retinal disorders in particular.

  12. Lineage-specific Evolutionary Histories and Regulation of Major Starch Metabolism Genes during Banana Ripening

    Directory of Open Access Journals (Sweden)

    Cyril Jourda

    2016-12-01

    Full Text Available Starch is the most widespread and abundant storage carbohydrate in plants. It is also a major feature of cultivated bananas as it accumulates to large amounts during banana fruit development before almost complete conversion to soluble sugars during ripening. Little is known about the structure of major gene families involved in banana starch metabolism and their evolution compared to other species. To identify genes involved in banana starch metabolism and investigate their evolutionary history, we analyzed six gene families playing a crucial role in plant starch biosynthesis and degradation: the ADP-glucose pyrophosphorylases (AGPases, starch synthases (SS, starch branching enzymes (SBE, debranching enzymes (DBE, -amylases (AMY and -amylases (BAM. Using comparative genomics and phylogenetic approaches, these genes were classified into families and sub-families and orthology relationships with functional genes in Eudicots and in grasses were identified. In addition to known ancestral duplications shaping starch metabolism gene families, independent evolution in banana and grasses also occurred through lineage-specific whole genome duplications for specific sub-families of AGPases, SS, SBE and BAM genes; and through gene-scale duplications for AMY genes. In particular, banana lineage duplications yielded a set of AGPases, SBE and BAM genes that were highly or specifically expressed in banana fruits. Gene expression analysis highlighted a complex transcriptional reprogramming of starch metabolism genes during ripening of banana fruits. A differential regulation of expression between banana gene duplicates was identified for SBE and BAM genes, suggesting that part of starch metabolism regulation in the fruit evolved in the banana lineage

  13. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    DEFF Research Database (Denmark)

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate...... genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value

  14. Estradiol and progesterone exhibit similar patterns of hepatic gene expression regulation in the bovine model.

    Directory of Open Access Journals (Sweden)

    Carla A Piccinato

    Full Text Available Female sex steroid hormones, estradiol-17β (E2-17β and progesterone (P4 regulate reproductive function and gene expression in a broad range of tissues. Given the central role of the liver in regulating homeostasis including steroid hormone metabolism, we sought to understand how E2-17β and P4 interact to affect global gene expression in liver. Ovariectomized cows (n = 8 were randomly assigned to 4 treatment groups applied in a replicated Latin Square design: 1 No hormone supplementation, 2 E2-17β treatment (ear implant, 3 P4 treatment (intravaginal inserts, and 4 E2-17β combined with P4. After 14 d of treatment, liver biopsies were collected, allowing 28 d intervals between periods. Changes in gene expression in the liver biopsies were monitored using bovine-specific arrays. Treatment with E2-17β altered expression of 479 genes, P4 472 genes, and combined treatment significantly altered expression of 468 genes. In total, 578 genes exhibited altered expression including a remarkable number (346 genes that responded similarly to E2-17β, P4, or combined treatment. Additional evidence for similar gene expression actions of E2-17ß and/or P4 were: principal component analysis placed almost every treatment array at a substantial distance from controls; Venn diagrams indicated overall treatment effects for most regulated genes; clustering analysis indicated the two major clusters had all treatments up-regulating (172 genes or down-regulating (173 genes expression. Thus, unexpectedly, common biological pathways were regulated by E2-17β and/or P4 in liver. This indicates that the mechanism of action of these steroid hormones in the liver might be either indirect or might occur through non-genomic pathways. This unusual pattern of gene expression in response to steroid hormones is consistent with the idea that there are classical and non-classical tissue-specific responses to steroid hormone actions. Future studies are needed to elucidate

  15. Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin

    2012-01-01

    Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment

  16. Profiling of Hepatocellular Carcinoma Cell Cycle Regulating Genes Targeted by Calycosin

    OpenAIRE

    Zhang, Dongqing; Wang, Shufang; Zhu, Liguo; Tian, Yaping; Wang, Haibao; Zhuang, Yuan; Li, Yu; Wang, Deqing

    2013-01-01

    We cocultured calycosin with human hepatocellular carcinoma cell line (BEL-7402) to investigate the effect on cell proliferation. Calycosin can markedly block the cell growth in G1 phase (P < 0.01) on the IC50 concentration. There were seventeen genes involved in cell-cycle regulation showing differentially expressed in treated cells detected by gene chip. Eight genes were upregulated and nine genes were downregulated. Downregulated TFDP-1, CDKN2D, and SPK2 and upregulated CDC2 and CCNB1 migh...

  17. Gametogenesis in the Pacific Oyster Crassostrea gigas: A Microarrays-Based Analysis Identifies Sex and Stage Specific Genes

    Science.gov (United States)

    Dheilly, Nolwenn M.; Lelong, Christophe; Huvet, Arnaud; Kellner, Kristell; Dubos, Marie-Pierre; Riviere, Guillaume; Boudry, Pierre; Favrel, Pascal

    2012-01-01

    Background The Pacific oyster Crassostrea gigas (Mollusca, Lophotrochozoa) is an alternative and irregular protandrous hermaphrodite: most individuals mature first as males and then change sex several times. Little is known about genetic and phenotypic basis of sex differentiation in oysters, and little more about the molecular pathways regulating reproduction. We have recently developed and validated a microarray containing 31,918 oligomers (Dheilly et al., 2011) representing the oyster transcriptome. The application of this microarray to the study of mollusk gametogenesis should provide a better understanding of the key factors involved in sex differentiation and the regulation of oyster reproduction. Methodology/Principal Findings Gene expression was studied in gonads of oysters cultured over a yearly reproductive cycle. Principal component analysis and hierarchical clustering showed a significant divergence in gene expression patterns of males and females coinciding with the start of gonial mitosis. ANOVA analysis of the data revealed 2,482 genes differentially expressed during the course of males and/or females gametogenesis. The expression of 434 genes could be localized in either germ cells or somatic cells of the gonad by comparing the transcriptome of female gonads to the transcriptome of stripped oocytes and somatic tissues. Analysis of the annotated genes revealed conserved molecular mechanisms between mollusks and mammals: genes involved in chromatin condensation, DNA replication and repair, mitosis and meiosis regulation, transcription, translation and apoptosis were expressed in both male and female gonads. Most interestingly, early expressed male-specific genes included bindin and a dpy-30 homolog and female-specific genes included foxL2, nanos homolog 3, a pancreatic lipase related protein, cd63 and vitellogenin. Further functional analyses are now required in order to investigate their role in sex differentiation in oysters. Conclusions

  18. Differential regulation of the foraging gene associated with task behaviors in harvester ants

    Directory of Open Access Journals (Sweden)

    Kleeman Lindsay

    2011-08-01

    Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among

  19. Hox gene expression in the embryonic genital system of the sea turtle Lepidochelys olivacea (Eschscholt, 1829), a species with temperature-dependent sex determination.

    Science.gov (United States)

    Sifuentes-Romero, Itzel; Merchant-Larios, Horacio; García-Gasca, Alejandra

    2010-09-01

    Hox genes are conserved transcription factors which regulate embryonic morphogenesis and differentiation. For the first time, we examined the quantitative and spatial expression of two Hox 5' genes, HoxD11 and HoxA13, in the developing genital system of the olive ridley Lepidochelys olivacea, a species with temperature-dependent sex determination. Quantitative and spatial expression patterns of both genes suggest a role in the female pathway rather than the male pathway. For instance, both genes, especially HoxA13, were expressed in the undifferentiated gonad during the thermosensitive period at a female promoting temperature, and downregulated in the differentiated gonad. By contrast, expression of both genes was low in gonads incubated at a male promoting temperature and did not change significantly in the differentiated gonad. Furthermore, we found high expression levels of HoxA13 in the paramesonephric duct at the male promoting temperature but not at the female promoting temperature, suggesting a role for this Hox gene in the partial regression of the Müllerian duct in males. Copyright 2010 Elsevier B.V. All rights reserved.

  20. A role for the clock period circadian regulator 2 gene in regulating the clock gene network in human oral squamous cell carcinoma cells.

    Science.gov (United States)

    Ao, Yiran; Zhao, Qin; Yang, Kai; Zheng, Gang; Lv, Xiaoqing; Su, Xiaoli

    2018-04-01

    Clock genes are the core of the circadian rhythms in the human body and are important in regulating normal physiological functions. To date, research has indicated that the clock gene, period circadian clock 2 ( PER2 ), is downregulated in numerous types of cancer, and that it is associated with cancer occurrence and progression via the regulation of various downstream cell cycle genes. However, it remains unclear whether the decreased expression of PER2 influences the expression of other clock genes in cancer cells. In the present study, short hairpin RNA interference was used to knockdown PER2 effectively in human oral squamous cell carcinoma SCC15 cells. Quantitative polymerase chain reaction was used to assess the mRNA expression levels of various clock genes and revealed that, following the knockdown of PER2 in SCC15 cells, the mRNA expression levels of PER3 , brain and muscle ARNT-like 1, deleted in esophageal cancer (DEC)1, DEC2 , cryptochrome circadian clock ( CRY )2, timeless circadian clock, retinoic acid receptor-related orphan receptor-alpha and neuronal PAS domain protein 2 were significantly downregulated, while the mRNA expression levels of PER1 and nuclear receptor subfamily 1 group D member 1 were significantly upregulated. In addition, flow cytometric analysis demonstrated that proliferation was enhanced and apoptosis was reduced following PER2 knockdown in SCC15 cells (Pclock genes of the clock gene network in cancer cells. This is of great significance in elucidating the molecular function and tumor suppression mechanism of PER2 .

  1. Mouse ribosomal RNA genes contain multiple differentially regulated variants.

    Directory of Open Access Journals (Sweden)

    Hung Tseng

    2008-03-01

    Full Text Available Previous cytogenetic studies suggest that various rDNA chromosomal loci are not equally active in different cell types. Consistent with this variability, rDNA polymorphism is well documented in human and mouse. However, attempts to identify molecularly rDNA variant types, which are regulated individually (i.e., independent of other rDNA variants and tissue-specifically, have not been successful. We report here the molecular cloning and characterization of seven mouse rDNA variants (v-rDNA. The identification of these v-rDNAs was based on restriction fragment length polymorphisms (RFLPs, which are conserved among individuals and mouse strains. The total copy number of the identified variants is less than 100 and the copy number of each individual variant ranges from 4 to 15. Sequence analysis of the cloned v-rDNA identified variant-specific single nucleotide polymorphisms (SNPs in the transcribed region. These SNPs were used to develop a set of variant-specific PCR assays, which permitted analysis of the v-rDNAs' expression profiles in various tissues. These profiles show that three v-rDNAs are expressed in all tissues (constitutively active, two are expressed in some tissues (selectively active, and two are not expressed (silent. These expression profiles were observed in six individuals from three mouse strains, suggesting the pattern is not randomly determined. Thus, the mouse rDNA array likely consists of genetically distinct variants, and some are regulated tissue-specifically. Our results provide the first molecular evidence for cell-type-specific regulation of a subset of rDNA.

  2. Desmin-regulated lentiviral vectors for skeletal muscle gene transfer.

    Science.gov (United States)

    Talbot, Gillian E; Waddington, Simon N; Bales, Olivia; Tchen, Rose C; Antoniou, Michael N

    2010-03-01

    Lentiviral vectors (LVs) are highly attractive as a gene therapy agent as they are able to stably integrate their genomes in both dividing and nondividing cells and, in principle, provide long-term therapeutic benefit. However, their performance in skeletal muscle in adult animals has, to date, been disappointing. In order to gain clearer insight into their utility in this tissue type, we have conducted an extensive quantitative comparison of constitutive and muscle-specific promoter activities in skeletal muscle and nonmuscle systems following LV delivery in cell lines and neonatal mice. Our data show that LV delivery to hind leg skeletal muscle of neonatal mouse results in long-term transgene expression in adulthood. We find that the human desmin (DES) promoter/enhancer is the first muscle-specific control region to match the activity of the highly active constitutive human cytomegalovirus (hCMV) promoter/enhancer in skeletal muscle within a LV context both in vitro and in vivo. Furthermore, the DES promoter/enhancer provides six- to eightfold greater expression per viral copy than the muscle-specific human muscle creatine kinase (CKM) promoter/enhancer. DES also confers a more reproducible and tissue-specific transgene expression profile compared to CKM and is therefore a highly attractive regulatory element for use in muscle gene therapy vectors.

  3. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    Science.gov (United States)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  4. Co-ordinate regulation of lactate metabolism genes in yeast: the role of the lactate permease gene JEN1.

    Science.gov (United States)

    Lodi, T; Fontanesi, F; Guiard, B

    2002-01-01

    In the yeast Saccharomyces cerevisiae, the first step in lactate metabolism is its transport across the plasma membrane, a proton symport process mediated by the product of the gene JEN1. Under aerobic conditions, the expression of JEN1 is regulated by the carbon source: the gene is repressed by glucose and induced by non-fermentable substrates. JEN1 expression is also controlled by oxygen availability, but is unaffected by the absence of haem biosynthesis. JEN1 is negatively regulated by the repressors Mig1p and Mig2p, and requires Cat8p for full derepression. In this report we demonstrate that, in addition to these regulators, the Hap2/3/4/5 complex interacts specifically with a CAAT-box element in the JEN1 promoter, and acts to derepress JEN1 expression. We also provide evidence for transcriptional stimulation of JEN1 by the protein kinase Snf1p. Data are presented which provide a better understanding of the molecular mechanisms implicated in the co-regulation of genes involved in the metabolism of lactate.

  5. Orthologous transcription factors in bacteria have different functions and regulate different genes.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    2007-09-01

    Full Text Available Transcription factors (TFs form large paralogous gene families and have complex evolutionary histories. Here, we ask whether putative orthologs of TFs, from bidirectional best BLAST hits (BBHs, are evolutionary orthologs with conserved functions. We show that BBHs of TFs from distantly related bacteria are usually not evolutionary orthologs. Furthermore, the false orthologs usually respond to different signals and regulate distinct pathways, while the few BBHs that are evolutionary orthologs do have conserved functions. To test the conservation of regulatory interactions, we analyze expression patterns. We find that regulatory relationships between TFs and their regulated genes are usually not conserved for BBHs in Escherichia coli K12 and Bacillus subtilis. Even in the much more closely related bacteria Vibrio cholerae and Shewanella oneidensis MR-1, predicting regulation from E. coli BBHs has high error rates. Using gene-regulon correlations, we identify genes whose expression pattern differs between E. coli and S. oneidensis. Using literature searches and sequence analysis, we show that these changes in expression patterns reflect changes in gene regulation, even for evolutionary orthologs. We conclude that the evolution of bacterial regulation should be analyzed with phylogenetic trees, rather than BBHs, and that bacterial regulatory networks evolve more rapidly than previously thought.

  6. Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

    2015-12-08

    This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

  7. Inducible gene expression and environmentally regulated genes in lactic acid bacteria

    NARCIS (Netherlands)

    Kok, Jan

    1996-01-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their

  8. Transcriptional regulation of the Hansenula polymorpha GSH2 gene in the response to cadmium ion treatment

    Directory of Open Access Journals (Sweden)

    O. V. Blazhenko

    2014-02-01

    Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring­ a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.

  9. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  10. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.

    Science.gov (United States)

    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander

    2015-02-26

    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  11. Lateral Thinking: How Histone Modifications Regulate Gene Expression.

    Science.gov (United States)

    Lawrence, Moyra; Daujat, Sylvain; Schneider, Robert

    2016-01-01

    The DNA of each cell is wrapped around histone octamers, forming so-called 'nucleosomal core particles'. These histone proteins have tails that project from the nucleosome and many residues in these tails can be post-translationally modified, influencing all DNA-based processes, including chromatin compaction, nucleosome dynamics, and transcription. In contrast to those present in histone tails, modifications in the core regions of the histones had remained largely uncharacterised until recently, when some of these modifications began to be analysed in detail. Overall, recent work has shown that histone core modifications can not only directly regulate transcription, but also influence processes such as DNA repair, replication, stemness, and changes in cell state. In this review, we focus on the most recent developments in our understanding of histone modifications, particularly those on the lateral surface of the nucleosome. This region is in direct contact with the DNA and is formed by the histone cores. We suggest that these lateral surface modifications represent a key insight into chromatin regulation in the cell. Therefore, lateral surface modifications form a key area of interest and a focal point of ongoing study in epigenetics. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. A compendium of antibiotic-induced transcription profiles reveals broad regulation of Pasteurella multocida virulence genes.

    Science.gov (United States)

    Melnikow, E; Schoenfeld, C; Spehr, V; Warrass, R; Gunkel, N; Duszenko, M; Selzer, P M; Ullrich, H J

    2008-10-15

    The transcriptional responses of Pasteurella multocida to eight antibiotics with known mode of actions (MoAs) and one novel antibiotic compound with an unknown MoA were collected to create a compendium of transcriptional profiles for MoA studies. At minimal inhibitory concentration the three bactericidal compounds enrofloxacin, cefquinome and the novel compound had a minor impact on gene regulation with approximately 1% of the P. multocida genome affected, whilst the bacteriostatic compounds florfenicol, tilmicosin, rifampin, trimethoprim and brodimoprim regulated 20% of the genome. Novobiocin was special in that it regulated 40% of all P. multocida genes. Regulation of target genes was observed for novobiocin, rifampin, florfenicol and tilmicosin and signature genes were identified for most antibiotics. The transcriptional profile induced by the novel compound was unrelated to the compendium profiles suggesting a new MoA. The transcription of many P. multocida virulence factors, particularly genes involved in capsule synthesis and export, LPS synthesis, competence, adherence and iron transport were altered in the presence of antibiotics. Virulence gene transcription was mainly negatively affected, however the opposite effect was also observed in the case of rifampin where the up-regulation of the tad locus involved in tight adherence was seen. Novobiocin and trimethoprim caused a marked reduction in the transcription of capsule genes, which correlated with a concomitant reduction of the capsular layer on the surface of P. multocida. The broad negative impact on virulence gene transcription supports the notion that the therapeutic effect of some antibiotics could be a combination of growth and virulence inhibition.

  13. Expression Profiles of Fsh-Regulated Ovarian Genes during Oogenesis in Coho Salmon

    Science.gov (United States)

    Guzmán, José M.; Luckenbach, J. Adam; Yamamoto, Yoji; Swanson, Penny

    2014-01-01

    The function of follicle-stimulating hormone (Fsh) during oogenesis in fishes is poorly understood. Using coho salmon as a fish model, we recently identified a suite of genes regulated by Fsh in vitro and involved in ovarian processes mostly unexplored in fishes, like cell proliferation, differentiation, survival or extracellular matrix (ECM) remodeling. To better understand the role of these Fsh-regulated genes during oocyte growth in fishes, we characterized their mRNA levels at discrete stages of the ovarian development in coho salmon. While most of the transcripts were expressed at low levels during primary growth (perinucleolus stage), high expression of genes associated with cell proliferation (pim1, pcna, and mcm4) and survival (ddit4l) was found in follicles at this stage. The transition to secondary oocyte growth (cortical alveolus and lipid droplet stage ovarian follicles) was characterized by a marked increase in the expression of genes related to cell survival (clu1, clu2 and ivns1abpa). Expression of genes associated with cell differentiation and growth (wt2l and adh8l), growth factor signaling (inha), steroidogenesis (cyp19a1a) and the ECM (col1a1, col1a2 and dcn) peaked in vitellogenic follicles, showing a strong and positive correlation with transcripts for fshr. Other genes regulated by Fsh and associated with ECM function (ctgf, wapl and fn1) and growth factor signaling (bmp16 and smad5l) peaked in maturing follicles, along with increases in steroidogenesis-related gene transcripts. In conclusion, ovarian genes regulated by Fsh showed marked differences in their expression patterns during oogenesis in coho salmon. Our results suggest that Fsh regulates different ovarian processes at specific stages of development, likely through interaction with other intra- or extra-ovarian factors. PMID:25485989

  14. Identification of genes differentially regulated in rat alveolar bone wound healing by subtractive hybridization.

    Science.gov (United States)

    Ohira, T; Myokai, F; Shiomi, N; Yamashiro, K; Yamamoto, T; Murayama, Y; Arai, H; Nishimura, F; Takashiba, S

    2004-07-01

    Periodontal healing requires the participation of regulatory molecules, cells, and scaffold or matrix. Here, we hypothesized that a certain set of genes is expressed in alveolar bone wound healing. Reciprocal subtraction gave 400 clones from the injured alveolar bone of Wistar rats. Identification of 34 genes and analysis of their expression in injured tissue revealed several clusters of unique gene regulation patterns, including the up-regulation at 1 wk of cytochrome c oxidase regulating electron transfer and energy metabolism, presumably occurring at the site of inflammation; up-regulation at 2.5 wks of pro-alpha-2 type I collagen involving the formation of a connective tissue structure; and up-regulation at 1 and 2 wks and down-regulation at 2.5 and 4 wks of ubiquitin carboxyl-terminal hydrolase l3 involving cell cycle, DNA repair, and stress response. The differential expression of genes may be associated with the processes of inflammation, wound contraction, and formation of a connective tissue structure.

  15. Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

    Science.gov (United States)

    Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

    2016-05-01

    On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

  16. Candida albicans response regulator gene SSK1 regulates a subset of genes whose functions are associated with cell wall biosynthesis and adaptation to oxidative stress.

    Science.gov (United States)

    Chauhan, Neeraj; Inglis, Diane; Roman, Elvira; Pla, Jesus; Li, Dongmei; Calera, Jose A; Calderone, Richard

    2003-10-01

    Ssk1p of Candida albicans is a putative response regulator protein of the Hog1 two-component signal transduction system. In Saccharomyces cerevisiae, the phosphorylation state of Ssk1p determines whether genes that promote the adaptation of cells to osmotic stress are activated. We have previously shown that C. albicans SSK1 does not complement the ssk1 mutant of S. cerevisiae and that the ssk1 mutant of C. albicans is not sensitive to sorbitol. In this study, we show that the C. albicans ssk1 mutant is sensitive to several oxidants, including hydrogen peroxide, t-butyl hydroperoxide, menadione, and potassium superoxide when each is incorporated in yeast extract-peptone-dextrose (YPD) agar medium. We used DNA microarrays to identify genes whose regulation is affected by the ssk1 mutation. RNA from mutant cells (strain CSSK21) grown in YPD medium for 3 h at 30 degrees C was reverse transcribed and then compared with similarly prepared RNA from wild-type cells (CAF2). We observed seven genes from mutant cells that were consistently up regulated (three-fold or greater compared to CAF2). In S. cerevisiae, three (AHP1, HSP12, and PYC2) of the seven genes that were up regulated provide cells with an adaptation function in response to oxidative stress; another gene (GPH1) is regulated under stress conditions by Hog1p. Three other genes that are up regulated encode a cell surface protein (FLO1), a mannosyl transferase (MNN4-4), and a putative two-component histidine kinase (CHK1) that regulates cell wall biosynthesis in C. albicans. Of the down-regulated genes, ALS1 is a known cell adhesin in C. albicans. Verification of the microarray data was obtained by reverse transcription-PCR for HSP12, AHP1, CHK1, PYC2, GPH1, ALS1, MNN4-4, and FLO1. To further determine the function of Ssk1p in the Hog1p signal transduction pathway in C. albicans, we used Western blot analysis to measure phosphorylation of Hog1p in the ssk1 mutant of C. albicans when grown under either osmotic or

  17. Control of intestinal promoter activity of the cellular migratory regulator gene ELMO3 by CDX2 and SP1

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Boyd, Mette; Olsen, Jørgen

    2010-01-01

    in the differentiated human intestinal cancer cell line Caco-2 in order to identify CDX2-regulated genes involved in cellular migration. The engulfment and cell motility 3 (ELMO3) gene was identified as a potential CDX2 target gene. ELMO3 is an essential upstream regulator of the GTP-binding protein RAC during cell...

  18. Integrative analysis of a cross-loci regulation network identifies App as a gene regulating insulin secretion from pancreatic islets.

    Directory of Open Access Journals (Sweden)

    Zhidong Tu

    Full Text Available Complex diseases result from molecular changes induced by multiple genetic factors and the environment. To derive a systems view of how genetic loci interact in the context of tissue-specific molecular networks, we constructed an F2 intercross comprised of >500 mice from diabetes-resistant (B6 and diabetes-susceptible (BTBR mouse strains made genetically obese by the Leptin(ob/ob mutation (Lep(ob. High-density genotypes, diabetes-related clinical traits, and whole-transcriptome expression profiling in five tissues (white adipose, liver, pancreatic islets, hypothalamus, and gastrocnemius muscle were determined for all mice. We performed an integrative analysis to investigate the inter-relationship among genetic factors, expression traits, and plasma insulin, a hallmark diabetes trait. Among five tissues under study, there are extensive protein-protein interactions between genes responding to different loci in adipose and pancreatic islets that potentially jointly participated in the regulation of plasma insulin. We developed a novel ranking scheme based on cross-loci protein-protein network topology and gene expression to assess each gene's potential to regulate plasma insulin. Unique candidate genes were identified in adipose tissue and islets. In islets, the Alzheimer's gene App was identified as a top candidate regulator. Islets from 17-week-old, but not 10-week-old, App knockout mice showed increased insulin secretion in response to glucose or a membrane-permeant cAMP analog, in agreement with the predictions of the network model. Our result provides a novel hypothesis on the mechanism for the connection between two aging-related diseases: Alzheimer's disease and type 2 diabetes.

  19. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    Science.gov (United States)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  20. Organization and regulation of the neurotoxin genes in Clostridium botulinum and Clostridium tetani.

    Science.gov (United States)

    Raffestin, Stéphanie; Marvaud, Jean Christophe; Cerrato, Rosario; Dupuy, Bruno; Popoff, Michel R

    2004-04-01

    Botulinum and tetanus neurotoxins are structurally and functionally related 150 kDa proteins that are potent inhibitors of neuroexocytosis. Botulinum neurotoxin associates with non-toxic proteins to form complexes of various sizes. The botulinum neurotoxin and non-toxic protein genes are clustered in a DNA segment called the botulinum locus. This locus is probably located on a mobile or degenerate mobile element, which accounts for the various genomic localizations (chromosome, plasmid, phage) in different Clostridium botulinum types. The botulinum neurotoxin and non-toxic protein genes are organized in two polycistronic operons (ntnh-bont and ha operons) transcribed in opposite orientations. The gene that separates the two operons of the botulinum locus in C. botulinum A encodes a 21 kDa protein BotR/A, which is a positive regulator of the expression of the botulinum locus genes. Similarly, in Clostridium tetani, the gene located immediately upstream of the tetanus toxin gene, encodes a positive regulatory protein, TetR. BotR and TetR are possibly alternative sigma factors related to TxeR and UviA, which regulate C. difficile toxin and C. perfringens bacteriocin production, respectively. TxeR and UviA define a new sub-group of the sigma(70) family of RNA polymerase initiation factors. In addition, the C. botulinum genome contains predicted two-component system genes, some of which are possibly involved in regulation of toxinogenesis.

  1. Expression Regulation of Polycistronic lee3 Genes of Enterohaemorrhagic Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Wei-Sheng W Sun

    Full Text Available Enterohaemorrhagic Escherichia coli O157:H7 (EHEC carries a pathogenic island LEE that is consisted mainly of five polycistronic operons. In the lee3 operon, mpc is the first gene and has been reported to down regulate the type-3 secretion system of EHEC when its gene product is over-expressed. Furthermore, mpc has been suggested to have a regulation function via translation but the mechanism remains unclear. To clarify this hypothesis, we dissected the polycistron and examined the translated products. We conclude that translation of mpc detrimentally governs the translation of the second gene, escV, which in turn affects the translation of the third gene, escN. Then sequentially, escN affects the expression of the downstream genes. Furthermore, we located a critical cis element within the mpc open-reading frame that plays a negative role in the translation-dependent regulation of lee3. Using qRT-PCR, we found that the amount of mpc RNA transcript present in EHEC was relatively limited when compared to any other genes within lee3. Taken together, when the transcription of LEE is activated, expression of mpc is tightly controlled by a restriction of the RNA transcript of mpc, translation of which is then critical for the efficient production of the operon's downstream gene products.

  2. Chromosome-biased binding and gene regulation by the Caenorhabditis elegans DRM complex.

    Science.gov (United States)

    Tabuchi, Tomoko M; Deplancke, Bart; Osato, Naoki; Zhu, Lihua J; Barrasa, M Inmaculada; Harrison, Melissa M; Horvitz, H Robert; Walhout, Albertha J M; Hagstrom, Kirsten A

    2011-05-01

    DRM is a conserved transcription factor complex that includes E2F/DP and pRB family proteins and plays important roles in development and cancer. Here we describe new aspects of DRM binding and function revealed through genome-wide analyses of the Caenorhabditis elegans DRM subunit LIN-54. We show that LIN-54 DNA-binding activity recruits DRM to promoters enriched for adjacent putative E2F/DP and LIN-54 binding sites, suggesting that these two DNA-binding moieties together direct DRM to its target genes. Chromatin immunoprecipitation and gene expression profiling reveals conserved roles for DRM in regulating genes involved in cell division, development, and reproduction. We find that LIN-54 promotes expression of reproduction genes in the germline, but prevents ectopic activation of germline-specific genes in embryonic soma. Strikingly, C. elegans DRM does not act uniformly throughout the genome: the DRM recruitment motif, DRM binding, and DRM-regulated embryonic genes are all under-represented on the X chromosome. However, germline genes down-regulated in lin-54 mutants are over-represented on the X chromosome. We discuss models for how loss of autosome-bound DRM may enhance germline X chromosome silencing. We propose that autosome-enriched binding of DRM arose in C. elegans as a consequence of germline X chromosome silencing and the evolutionary redistribution of germline-expressed and essential target genes to autosomes. Sex chromosome gene regulation may thus have profound evolutionary effects on genome organization and transcriptional regulatory networks.

  3. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    Directory of Open Access Journals (Sweden)

    Hai-Chuan Yu

    Full Text Available BACKGROUND: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4, a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. METHODOLOGY/PRINCIPAL FINDINGS: Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs. DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3 of the β-globin locus control region (LCR, the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  4. MDM2 negatively regulates the human telomerase RNA gene promoter

    Directory of Open Access Journals (Sweden)

    Keith W Nicol

    2005-01-01

    Full Text Available Abstract Background We have previously demonstrated that NF-Y and Sp1 interact with the human telomerase RNA (hTR promoter and play a central role in its regulation. We have also shown that pRB activates the hTR promoter, but the mechanism of pRb directed activation is unknown. It has recently been reported that pRB induces Sp1 activity by relieving inhibition mediated by mdm2. The aim was to investigate possible roles for mdm2 in hTR promoter regulation. Methods Chromatin immunoprecipitation was used to determine binding of mdm2 to the hTR promoter. Transfection and luciferase assays were used to investigate mdm2 repression of the promoter activity and interaction with known transcriptional modulators. Results Here we show using chromatin immunoprecipitation that mdm2 specifically binds the hTR promoter in vivo. Transient co-transfection experiments using an hTR promoter luciferase reporter construct show that hTR promoter activity is inhibited by over-expression of mdm2 in 5637 bladder carcinoma cells (p53 and pRB negative, low mdm2. Titration of mdm2 was able to antagonise activation of hTR promoter activity mediated by pRB or Sp1 over-expression, although in the presence of pRB, mdm2 could not repress promoter activity below basal levels. Using an Sp1 binding site mutation construct we showed that mdm2 repression did not absolutely require Sp1 binding sites in the hTR promoter, suggesting the possibility of pRB/Sp1 independent mechanisms of repression. Finally, we show that NF-Y mediated transactivation of the hTR promoter was also suppressed by mdm2 in a dose-dependent manner. Conclusions These studies suggest that mdm2 may inhibit the hTR promoter by multiple mechanisms. Mdm2 may directly repress activation by both pRB and Sp1, or activation by NF-Y. Furthermore, the ability of mdm2 to interact and interfere with components of the general transcription machinery might partly explain the general repressive effect seen here. Elucidation of

  5. DMPD: Genetic regulation of macrophage priming/activation: the Lsh gene story. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 1757110 Genetic regulation of macrophage priming/activation: the Lsh gene story. Bl... (.svg) (.html) (.csml) Show Genetic regulation of macrophage priming/activation: the Lsh gene story. Pubmed...ID 1757110 Title Genetic regulation of macrophage priming/activation: the Lsh gen

  6. Computational characterization of modes of transcriptional regulation of nuclear receptor genes.

    Directory of Open Access Journals (Sweden)

    Yogita Sharma

    Full Text Available Nuclear receptors are a large structural class of transcription factors that act with their co-regulators and repressors to maintain a variety of biological and physiological processes such as metabolism, development and reproduction. They are activated through the binding of small ligands, which can be replaced by drug molecules, making nuclear receptors promising drug targets. Transcriptional regulation of the genes that encode them is central to gaining a deeper understanding of the diversity of their biochemical and biophysical roles and their role in disease and therapy. Even though they share evolutionary history, nuclear receptor genes have fundamentally different expression patterns, ranging from ubiquitously expressed to tissue-specific and spatiotemporally complex. However, current understanding of regulation in nuclear receptor gene family is still nascent.In this study, we investigate the relationship between long-range regulation of nuclear receptor family and their known functionality. Towards this goal, we identify the nuclear receptor genes that are potential targets based on counts of highly conserved non-coding elements. We validate our results using publicly available expression (RNA-seq and histone modification (ChIP-seq data from the ENCODE project. We find that nuclear receptor genes involved in developmental roles show strong evidence of long-range mechanism of transcription regulation with distinct cis-regulatory content they feature clusters of highly conserved non-coding elements distributed in regions spanning several Megabases, long and multiple CpG islands, bivalent promoter marks and statistically significant higher enrichment of enhancer mark around their gene loci. On the other hand nuclear receptor genes that are involved in tissue-specific roles lack these features, having simple transcriptional controls and a greater variety of mechanisms for producing paralogs. We further examine the combinatorial patterns of

  7. Differential regulation of an auxin-producing nitrilase gene family in Arabidopsis thaliana.

    Science.gov (United States)

    Bartel, B; Fink, G R

    1994-01-01

    Nitrilases (nitrile aminohydrolase, EC 3.5.5.1) convert nitriles to carboxylic acids. We report the cloning, characterization, and expression patterns of four Arabidopsis thaliana nitrilase genes (NIT1-4), one of which was previously described [Bartling, D., Seedorf, M., Mithöfer, A. & Weiler, E. W. (1992) Eur. J. Biochem. 205, 417-424]. The nitrilase genes encode very similar proteins that hydrolyze indole-3-acetonitrile to the phytohormone indole-3-acetic acid in vitro, and three of the four genes are tandemly arranged on chromosome III. Northern analysis using gene-specific probes and analysis of transgenic plants containing promoter-reporter gene fusions indicate that the four genes are differentially regulated. NIT2 expression is specifically induced around lesions caused by bacterial pathogen infiltration. The sites of nitrilase expression may represent sites of auxin biosynthesis in A. thaliana. Images PMID:8022831

  8. Regulation of gene expression with thyroid hormone in rats with myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Yue-Feng Chen

    Full Text Available The expression of hundreds of genes is altered in response to left ventricular (LV remodeling following large transmural myocardial infarction (MI. Thyroid hormone (TH improves LV remodeling and cardiac performance after MI. However, the molecular basis is unknown.MI was produced by ligation of the left anterior descending coronary artery in female SD rats. Rats were divided into the following groups: (1 Sham MI, (2 MI, and (3 MI+T4 treatment (T4 pellet 3.3 mg, 60 days release, implanted subcutaneously immediately following MI. Four weeks after surgery, total RNA was isolated from LV non-infarcted areas for microarray analysis using the Illumina RatRef-12 Expression BeadChip Platform.Signals were detected in 13,188 genes (out of 22,523, of which the expression of 154 genes were decreased and the expression of 200 genes were increased in MI rats compared with Sham MI rats (false discovery rate (FDR <0.05. Compared to MI rats, T4 treatment decreased expression of 27 genes and increased expression of 28 genes. In particular, 6 genes down-regulated by MI and 12 genes up-regulated by MI were reversed by T4. Most of the 55 genes altered by T4 treatment are in the category of molecular function under binding (24 and biological processes which includes immune system process (9, multi-organism process (5 and biological regulation (19 nonexclusively.These results suggest that altered expression of genes for molecular function and biological process may be involved in the beneficial effects of thyroid hormone treatment following MI in rats.

  9. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds.

    Directory of Open Access Journals (Sweden)

    Xiaoduo Lu

    Full Text Available Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it's a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively.The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis.In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs.

  10. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    Science.gov (United States)

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  11. Low pH induces co-ordinate regulation of gene expression in oesophageal cells.

    Science.gov (United States)

    Duggan, Shane P; Gallagher, William M; Fox, Edward J P; Abdel-Latif, Mohammed M; Reynolds, John V; Kelleher, Dermot

    2006-02-01

    The development of gastro-oesophageal reflux disease (GORD) is known to be a causative risk factor in the evolution of adenocarcinoma of the oesophagus. The major component of this reflux is gastric acid. However, the impact of low pH on gene expression has not been extensively studied in oesophageal cells. This study utilizes a transcriptomic and bioinformatic approach to assess regulation of gene expression in response to low pH. In more detail, oesophageal adenocarcinoma cell lines were exposed to a range of pH environments. Affymetrix microarrays were used for gene-expression analysis and results were validated using cycle limitation and real-time RT-PCR analysis, as well as northern and western blotting. Comparative promoter transcription factor binding site (TFBS) analysis (MatInspector) of hierarchically clustered gene-expression data was employed to identify the elements which may co-ordinately regulate individual gene clusters. Initial experiments demonstrated maximal induction of EGR1 gene expression at pH 6.5. Subsequent array experimentation revealed significant induction of gene expression from such functional categories as DNA damage response (EGR1-4, ATF3) and cell-cycle control (GADD34, GADD45, p57). Changes in expression of EGR1, EGR3, ATF3, MKP-1, FOSB, CTGF and CYR61 were verified in separate experiments and in a variety of oesophageal cell lines. TFBS analysis of promoters identified transcription factors that may co-ordinately regulate gene-expression clusters, Cluster 1: Oct-1, AP4R; Cluster 2: NF-kB, EGRF; Cluster 3: IKRS, AP-1F. Low pH has the ability to induce genes and pathways which can provide an environment suitable for the progression of malignancy. Further functional analysis of the genes and clusters identified in this low pH study is likely to lead to new insights into the pathogenesis and therapeutics of GORD and oesophageal cancer.

  12. Genes with high penetrance for syndromic and non-syndromic autism typically function within the nucleus and regulate gene expression.

    Science.gov (United States)

    Casanova, Emily L; Sharp, Julia L; Chakraborty, Hrishikesh; Sumi, Nahid Sultana; Casanova, Manuel F

    2016-01-01

    Intellectual disability (ID), autism, and epilepsy share frequent yet variable comorbidities with one another. In order to better understand potential genetic divergence underlying this variable risk, we studied genes responsible for monogenic IDs, grouped according to their autism and epilepsy comorbidities. Utilizing 465 different forms of ID with known molecular origins, we accessed available genetic databases in conjunction with gene ontology (GO) to determine whether the genetics underlying ID diverge according to its comorbidities with autism and epilepsy and if genes highly penetrant for autism or epilepsy share distinctive features that set them apart from genes that confer comparatively variable or no apparent risk. The genetics of ID with autism are relatively enriched in terms associated with nervous system-specific processes and structural morphogenesis. In contrast, we find that ID with highly comorbid epilepsy (HCE) is modestly associated with lipid metabolic processes while ID without autism or epilepsy comorbidity (ID only) is enriched at the Golgi membrane. Highly comorbid autism (HCA) genes, on the other hand, are strongly enriched within the nucleus, are typically involved in regulation of gene expression, and, along with IDs with more variable autism, share strong ties with a core protein-protein interaction (PPI) network integral to basic patterning of the CNS. According to GO terminology, autism-related gene products are integral to neural development. While it is difficult to draw firm conclusions regarding IDs unassociated with autism, it is clear that the majority of HCA genes are tightly linked with general dysregulation of gene expression, suggesting that disturbances to the chronology of neural maturation and patterning may be key in conferring susceptibility to autism spectrum conditions.

  13. PENGARUH RANGSANGAN HORMON AROMATASE INHIBITOR DAN OODEV TERHADAP PERUBAHAN KELAMIN DAN PERKEMBANGAN GONAD IKAN KERAPU SUNU, Plectropomus leopardus

    Directory of Open Access Journals (Sweden)

    Hirmawan Tirta Yudha

    2018-01-01

    study aimed to determine an effective dose of aromatase inhibitor and oodev on sex reversal and gonadal development of coral trout grouper. There were 35 F-1 fish with an average weight of 2.3 ± 0.28 kg. This research was conducted for two months. The fish were injected with four different dosages of aromatase inhibitor and oodev every two weeks: A (aromatase inhibitor 1 mg kg-1 fish, O (1 mL oodev, AO1 (aromatase inhibitor 0.1 mg kg-1 fish + oodev 1 mL kg-1 fish, AO2 (aromatase inhibitor 1 mg kg-1 fish + oodev 1 mL kg-1 fish, and K (placebo. The results showed that the combination of aromatase inhibitor 1 mg kg-1 fish and oodev 1 mL kg-1 fish was effective to induce the sex change. It could increase the concentration of testosterone in the blood (2.819 ng/mL after eight weeks of culture. Based on the results of gonadal histology and reproductive-related genes expression observations using DMRT1 and SOX3 target genes, the hormonal treatment of AO2 (aromatase inhibitor 1 mg kg-1 fish + oodev 1 mL kg-1 fish was able to accelerate sex reversal from female to male and gonadal maturation in coral trout grouper Plectropomus leopardus.

  14. Microarray Analysis on Gene Regulation by Estrogen, Progesterone and Tamoxifen in Human Endometrial Stromal Cells

    Science.gov (United States)

    Ren, Chun-E; Zhu, Xueqiong; Li, Jinping; Lyle, Christian; Dowdy, Sean; Podratz, Karl C.; Byck, David; Chen, Hai-Bin; Jiang, Shi-Wen

    2015-01-01

    Epithelial stromal cells represent a major cellular component of human uterine endometrium that is subject to tight hormonal regulation. Through cell-cell contacts and/or paracrine mechanisms, stromal cells play a significant role in the malignant transformation of epithelial cells. We isolated stromal cells from normal human endometrium and investigated the morphological and transcriptional changes induced by estrogen, progesterone and tamoxifen. We demonstrated that stromal cells express appreciable levels of estrogen and progesterone receptors and undergo different morphological changes upon hormonal stimulation. Microarray analysis indicated that both estrogen and progesterone induced dramatic alterations in a variety of genes associated with cell structure, transcription, cell cycle, and signaling. However, divergent patterns of changes, and in some genes opposite effects, were observed for the two hormones. A large number of genes are identified as novel targets for hormonal regulation. These hormone-responsive genes may be involved in normal uterine function and the development of endometrial malignancies. PMID:25782154

  15. Chromatin-bound nuclear pore components regulate gene expression in higher eukaryotes

    Science.gov (United States)

    Capelson, Maya; Liang, Yun; Schulte, Roberta; Mair, William; Wagner, Ulrich; Hetzer, Martin W.

    2010-01-01

    Nuclear pore complexes have recently been shown to play roles in gene activation, however their potential involvement in metazoan transcription remains unclear. Here we show that the nucleoporins Sec13, Nup98 and Nup88, as well as a group of FG-repeat nucleoporins, bind to the Drosophila genome at functionally distinct loci that often do not represent NE contact sites. While Nup88 localizes to silent loci, Sec13, Nup98 and a subset of FG-repeat nucleoporins bind to developmentally regulated genes undergoing transcription induction. Strikingly, RNAi-mediated knockdown of intranuclear Sec13 and Nup98 specifically inhibits transcription of their target genes and prevents efficient reactivation of transcription after heat shock, suggesting an essential role of NPC components in regulating complex gene expression programs of multicellular organisms. PMID:20144761

  16. Microarray Analysis on Gene Regulation by Estrogen, Progesterone and Tamoxifen in Human Endometrial Stromal Cells

    Directory of Open Access Journals (Sweden)

    Chun-E Ren

    2015-03-01

    Full Text Available Epithelial stromal cells represent a major cellular component of human uterine endometrium that is subject to tight hormonal regulation. Through cell-cell contacts and/or paracrine mechanisms, stromal cells play a significant role in the malignant transformation of epithelial cells. We isolated stromal cells from normal human endometrium and investigated the morphological and transcriptional changes induced by estrogen, progesterone and tamoxifen. We demonstrated that stromal cells express appreciable levels of estrogen and progesterone receptors and undergo different morphological changes upon hormonal stimulation. Microarray analysis indicated that both estrogen and progesterone induced dramatic alterations in a variety of genes associated with cell structure, transcription, cell cycle, and signaling. However, divergent patterns of changes, and in some genes opposite effects, were observed for the two hormones. A large number of genes are identified as novel targets for hormonal regulation. These hormone-responsive genes may be involved in normal uterine function and the development of endometrial malignancies.

  17. Discovery and characterization of nutritionally regulated genes associated with muscle growth in Atlantic salmon.

    Science.gov (United States)

    Bower, Neil I; Johnston, Ian A

    2010-10-01

    A genomics approach was used to identify nutritionally regulated genes involved in growth of fast skeletal muscle in Atlantic salmon (Salmo salar L.). Forward and reverse subtractive cDNA libraries were prepared comparing fish with zero growth rates to fish growing rapidly. We produced 7,420 ESTs and assembled them into nonredundant clusters prior to annotation. Contigs representing 40 potentially unrecognized nutritionally responsive candidate genes were identified. Twenty-three of the subtractive library candidates were also differentially regulated by nutritional state in an independent fasting-refeeding experiment and their expression placed in the context of 26 genes with established roles in muscle growth regulation. The expression of these genes was also determined during the maturation of a primary myocyte culture, identifying 13 candidates from the subtractive cDNA libraries with putative roles in the myogenic program. During early stages of refeeding DNAJA4, HSPA1B, HSP90A, and CHAC1 expression increased, indicating activation of unfolded protein response pathways. Four genes were considered inhibitory to myogenesis based on their in vivo and in vitro expression profiles (CEBPD, ASB2, HSP30, novel transcript GE623928). Other genes showed increased expression with feeding and highest in vitro expression during the proliferative phase of the culture (FOXD1, DRG1) or as cells differentiated (SMYD1, RTN1, MID1IP1, HSP90A, novel transcript GE617747). The genes identified were associated with chromatin modification (SMYD1, RTN1), microtubule stabilization (MID1IP1), cell cycle regulation (FOXD1, CEBPD, DRG1), and negative regulation of signaling (ASB2) and may play a role in the stimulation of myogenesis during the transition from a catabolic to anabolic state in skeletal muscle.

  18. In vitro selection of mutants: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.; Bastola, D.R.; Deutch, C.E.; Pethe, V.V.; Petrusa, L.

    2001-01-01

    Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)

  19. Histone deacetylase regulation of immune gene expression in tumor cells

    Science.gov (United States)

    Tomasi, Thomas B.

    2011-01-01

    Epigenetic modifications of chromatin, such as histone acetylation, are involved in repression of tumor antigens and multiple immune genes that are thought to facilitate tumor escape. The status of acetylation in a cell is determined by the balance of the activities of histone acetyltransferases and histone deacetylases. Inhibitors of histone deacetylase (HDACi) can enhance the expression of immunologically important molecules in tumor cells and HDACi treated tumor cells are able to induce immune responses in vitro and in vivo. Systemic HDACi are in clinical trails in cancer and also being used in several autoimmune disease models. To date, 18 HDACs have been reported in human cells and more than thirty HDACi identified, although only a few immune targets of these inhibitors have been identified. Here, we discuss the molecular pathways employed by HDACi and their potential role in inducing immune responses against tumors. We review data suggesting that selection of target specific HDACi and combinations with other agents and modalities, including those that activate stress pathways, may further enhance the efficacy of epigenetic therapies. PMID:18213528

  20. Transmembrane channel-like (tmc) gene regulates Drosophila larval locomotion.

    Science.gov (United States)

    Guo, Yanmeng; Wang, Yuping; Zhang, Wei; Meltzer, Shan; Zanini, Damiano; Yu, Yue; Li, Jiefu; Cheng, Tong; Guo, Zhenhao; Wang, Qingxiu; Jacobs, Julie S; Sharma, Yashoda; Eberl, Daniel F; Göpfert, Martin C; Jan, Lily Yeh; Jan, Yuh Nung; Wang, Zuoren

    2016-06-28

    Drosophila larval locomotion, which entails rhythmic body contractions, is controlled by sensory feedback from proprioceptors. The molecular mechanisms mediating this feedback are little understood. By using genetic knock-in and immunostaining, we found that the Drosophila melanogaster transmembrane channel-like (tmc) gene is expressed in the larval class I and class II dendritic arborization (da) neurons and bipolar dendrite (bd) neurons, both of which are known to provide sensory feedback for larval locomotion. Larvae with knockdown or loss of tmc function displayed reduced crawling speeds, increased head cast frequencies, and enhanced backward locomotion. Expressing Drosophila TMC or mammalian TMC1 and/or TMC2 in the tmc-positive neurons rescued these mutant phenotypes. Bending of the larval body activated the tmc-positive neurons, and in tmc mutants this bending response was impaired. This implicates TMC's roles in Drosophila proprioception and the sensory control of larval locomotion. It also provides evidence for a functional conservation between Drosophila and mammalian TMCs.