WorldWideScience

Sample records for genes gene duplication

  1. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  2. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  3. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  4. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  5. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  6. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  7. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  8. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  9. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  10. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  12. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  13. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  14. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  15. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  16. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  17. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  18. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  19. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  20. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  1. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  2. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  3. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  4. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  5. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  6. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  7. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  8. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  9. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  10. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  11. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  12. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  13. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  14. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  15. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  17. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  18. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  19. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  20. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  3. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  4. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  6. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  7. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  8. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  9. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  10. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  12. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  13. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  14. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  15. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  17. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  18. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  19. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  20. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  2. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  3. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  4. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  5. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  6. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  7. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  8. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  9. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  10. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  11. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  12. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  13. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  14. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  15. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  16. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  17. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  18. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  19. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  20. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  1. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  3. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  4. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  5. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  6. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  7. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  8. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  9. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  10. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  11. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  12. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  13. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  14. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  15. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  16. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  17. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  18. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  19. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  20. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  1. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  2. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  5. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  7. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  8. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  9. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  10. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  11. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  12. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  13. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  14. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  17. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  18. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  19. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  20. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  1. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  2. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  3. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  4. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  5. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  6. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  7. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  8. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  9. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  10. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  11. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  12. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  13. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  14. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  15. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  16. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  17. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  19. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  20. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  2. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  4. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  5. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  6. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  7. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  8. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  10. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  11. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  12. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  13. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  14. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  15. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  16. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  17. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  18. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  19. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  20. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  1. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  2. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  3. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  4. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  5. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  6. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  8. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  10. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  11. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  12. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  13. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  14. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  15. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  16. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  17. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  18. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  19. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  20. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  1. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  2. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  3. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  4. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  5. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  6. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  7. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  8. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  9. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  10. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  11. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  12. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  14. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    Science.gov (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  17. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  18. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  19. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  20. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  1. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  2. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).

    Science.gov (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N

    2011-09-01

    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  4. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  5. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  6. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  8. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  9. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  10. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  11. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  12. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  13. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  14. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  15. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  16. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  17. Evolution of homeobox genes.

    Science.gov (United States)

    Holland, Peter W H

    2013-01-01

    Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.

  18. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  19. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  20. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  1. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  2. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  3. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  4. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  5. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene.

    Science.gov (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio

    2015-01-01

    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  6. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  7. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  8. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  9. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  10. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  11. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders.

    Science.gov (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A

    2017-03-14

    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  12. Refining discordant gene trees.

    Science.gov (United States)

    Górecki, Pawel; Eulenstein, Oliver

    2014-01-01

    Evolutionary studies are complicated by discordance between gene trees and the species tree in which they evolved. Dealing with discordant trees often relies on comparison costs between gene and species trees, including the well-established Robinson-Foulds, gene duplication, and deep coalescence costs. While these costs have provided credible results for binary rooted gene trees, corresponding cost definitions for non-binary unrooted gene trees, which are frequently occurring in practice, are challenged by biological realism. We propose a natural extension of the well-established costs for comparing unrooted and non-binary gene trees with rooted binary species trees using a binary refinement model. For the duplication cost we describe an efficient algorithm that is based on a linear time reduction and also computes an optimal rooted binary refinement of the given gene tree. Finally, we show that similar reductions lead to solutions for computing the deep coalescence and the Robinson-Foulds costs. Our binary refinement of Robinson-Foulds, gene duplication, and deep coalescence costs for unrooted and non-binary gene trees together with the linear time reductions provided here for computing these costs significantly extends the range of trees that can be incorporated into approaches dealing with discordance.

  13. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  14. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  15. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  16. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

    Science.gov (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

    2016-04-01

    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  19. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  20. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  1. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  2. Ageing genes

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2018-01-01

    The idea of gerontogenes is in line with the evolutionary explanation of ageing as being an emergent phenomenon as a result of the imperfect maintenance and repair systems. Although evolutionary processes did not select for any specific ageing genes that restrict and determine the lifespan...... of an individual, the term ‘gerontogenes’ primarily refers to any genes that may seem to influence ageing and longevity, without being specifically selected for that role. Such genes can also be called ‘virtual gerontogenes’ by virtue of their indirect influence on the rate and process of ageing. More than 1000...... virtual gerontogenes have been associated with ageing and longevity in model organisms and humans. The ‘real’ genes, which do influence the essential lifespan of a species, and have been selected for in accordance with the evolutionary life history of the species, are known as the longevity assurance...

  3. Gene doping.

    Science.gov (United States)

    Haisma, H J; de Hon, O

    2006-04-01

    Together with the rapidly increasing knowledge on genetic therapies as a promising new branch of regular medicine, the issue has arisen whether these techniques might be abused in the field of sports. Previous experiences have shown that drugs that are still in the experimental phases of research may find their way into the athletic world. Both the World Anti-Doping Agency (WADA) and the International Olympic Committee (IOC) have expressed concerns about this possibility. As a result, the method of gene doping has been included in the list of prohibited classes of substances and prohibited methods. This review addresses the possible ways in which knowledge gained in the field of genetic therapies may be misused in elite sports. Many genes are readily available which may potentially have an effect on athletic performance. The sporting world will eventually be faced with the phenomena of gene doping to improve athletic performance. A combination of developing detection methods based on gene arrays or proteomics and a clear education program on the associated risks seems to be the most promising preventive method to counteract the possible application of gene doping.

  4. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  5. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  6. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Gene Locater

    DEFF Research Database (Denmark)

    Anwar, Muhammad Zohaib; Sehar, Anoosha; Rehman, Inayat-Ur

    2012-01-01

    software's for calculating recombination frequency is mostly limited to the range and flexibility of this type of analysis. GENE LOCATER is a fully customizable program for calculating recombination frequency, written in JAVA. Through an easy-to-use interface, GENE LOCATOR allows users a high degree...... of flexibility in calculating genetic linkage and displaying linkage group. Among other features, this software enables user to identify linkage groups with output visualized graphically. The program calculates interference and coefficient of coincidence with elevated accuracy in sample datasets. AVAILABILITY...

  8. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  9. Tandemly Arrayed Genes in Vertebrate Genomes

    Directory of Open Access Journals (Sweden)

    Deng Pan

    2008-01-01

    Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.

  10. Evolution of trappin genes in mammals

    Directory of Open Access Journals (Sweden)

    Furutani Yutaka

    2010-01-01

    Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.

  11. Gene conversion in the rice genome

    DEFF Research Database (Denmark)

    Xu, Shuqing; Clark, Terry; Zheng, Hongkun

    2008-01-01

    -chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....

  12. Gene Ontology

    Directory of Open Access Journals (Sweden)

    Gaston K. Mazandu

    2012-01-01

    Full Text Available The wide coverage and biological relevance of the Gene Ontology (GO, confirmed through its successful use in protein function prediction, have led to the growth in its popularity. In order to exploit the extent of biological knowledge that GO offers in describing genes or groups of genes, there is a need for an efficient, scalable similarity measure for GO terms and GO-annotated proteins. While several GO similarity measures exist, none adequately addresses all issues surrounding the design and usage of the ontology. We introduce a new metric for measuring the distance between two GO terms using the intrinsic topology of the GO-DAG, thus enabling the measurement of functional similarities between proteins based on their GO annotations. We assess the performance of this metric using a ROC analysis on human protein-protein interaction datasets and correlation coefficient analysis on the selected set of protein pairs from the CESSM online tool. This metric achieves good performance compared to the existing annotation-based GO measures. We used this new metric to assess functional similarity between orthologues, and show that it is effective at determining whether orthologues are annotated with similar functions and identifying cases where annotation is inconsistent between orthologues.

  13. The relationship among gene expression, the evolution of gene dosage, and the rate of protein evolution.

    Directory of Open Access Journals (Sweden)

    Jean-François Gout

    2010-05-01

    Full Text Available The understanding of selective constraints affecting genes is a major issue in biology. It is well established that gene expression level is a major determinant of the rate of protein evolution, but the reasons for this relationship remain highly debated. Here we demonstrate that gene expression is also a major determinant of the evolution of gene dosage: the rate of gene losses after whole genome duplications in the Paramecium lineage is negatively correlated to the level of gene expression, and this relationship is not a byproduct of other factors known to affect the fate of gene duplicates. This indicates that changes in gene dosage are generally more deleterious for highly expressed genes. This rule also holds for other taxa: in yeast, we find a clear relationship between gene expression level and the fitness impact of reduction in gene dosage. To explain these observations, we propose a model based on the fact that the optimal expression level of a gene corresponds to a trade-off between the benefit and cost of its expression. This COSTEX model predicts that selective pressure against mutations changing gene expression level or affecting the encoded protein should on average be stronger in highly expressed genes and hence that both the frequency of gene loss and the rate of protein evolution should correlate negatively with gene expression. Thus, the COSTEX model provides a simple and common explanation for the general relationship observed between the level of gene expression and the different facets of gene evolution.

  14. Gene doping: gene delivery for olympic victory

    OpenAIRE

    Gould, David

    2012-01-01

    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called ‘gene doping’. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted...

  15. Genes and Hearing Loss

    Science.gov (United States)

    ... ENTCareers Marketplace Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  16. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  17. Imaging reporter gene for monitoring gene therapy

    International Nuclear Information System (INIS)

    Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

    2002-01-01

    Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

  18. beta. -Amyloid gene dosage in Alzheimer's disease

    Energy Technology Data Exchange (ETDEWEB)

    Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E

    1988-01-11

    The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.

  19. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  20. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  1. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  2. Gene doping: gene delivery for olympic victory.

    Science.gov (United States)

    Gould, David

    2013-08-01

    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called 'gene doping'. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted from the engineered cells or is retained locally to, or inside engineered cells will, to some extent, determine the likelihood of detection. It is clear that effective gene delivery technologies now exist and it is important that detection and prevention plans are in place. © 2012 The Author. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  3. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  4. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  5. Carboxylesterase 1 genes

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk

    2018-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase that metabolizes commonly used drugs. The CES1-related pseudogene, carboxylesterase 1 pseudogene 1 (CES1P1), has been implicated in gene exchange with CES1 and in the formation of hybrid genes including the carboxylesterase 1A2 gene (CES1A2...

  6. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...

  7. Gene doping in sports.

    Science.gov (United States)

    Unal, Mehmet; Ozer Unal, Durisehvar

    2004-01-01

    Gene or cell doping is defined by the World Anti-Doping Agency (WADA) as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". New research in genetics and genomics will be used not only to diagnose and treat disease, but also to attempt to enhance human performance. In recent years, gene therapy has shown progress and positive results that have highlighted the potential misuse of this technology and the debate of 'gene doping'. Gene therapies developed for the treatment of diseases such as anaemia (the gene for erythropoietin), muscular dystrophy (the gene for insulin-like growth factor-1) and peripheral vascular diseases (the gene for vascular endothelial growth factor) are potential doping methods. With progress in gene technology, many other genes with this potential will be discovered. For this reason, it is important to develop timely legal regulations and to research the field of gene doping in order to develop methods of detection. To protect the health of athletes and to ensure equal competitive conditions, the International Olympic Committee, WADA and International Sports Federations have accepted performance-enhancing substances and methods as being doping, and have forbidden them. Nevertheless, the desire to win causes athletes to misuse these drugs and methods. This paper reviews the current status of gene doping and candidate performance enhancement genes, and also the use of gene therapy in sports medicine and ethics of genetic enhancement. Copyright 2004 Adis Data Information BV

  8. G-NEST: a gene neighborhood scoring tool to identify co-conserved, co-expressed genes

    Directory of Open Access Journals (Sweden)

    Lemay Danielle G

    2012-09-01

    Full Text Available Abstract Background In previous studies, gene neighborhoods—spatial clusters of co-expressed genes in the genome—have been defined using arbitrary rules such as requiring adjacency, a minimum number of genes, a fixed window size, or a minimum expression level. In the current study, we developed a Gene Neighborhood Scoring Tool (G-NEST which combines genomic location, gene expression, and evolutionary sequence conservation data to score putative gene neighborhoods across all possible window sizes simultaneously. Results Using G-NEST on atlases of mouse and human tissue expression data, we found that large neighborhoods of ten or more genes are extremely rare in mammalian genomes. When they do occur, neighborhoods are typically composed of families of related genes. Both the highest scoring and the largest neighborhoods in mammalian genomes are formed by tandem gene duplication. Mammalian gene neighborhoods contain highly and variably expressed genes. Co-localized noisy gene pairs exhibit lower evolutionary conservation of their adjacent genome locations, suggesting that their shared transcriptional background may be disadvantageous. Genes that are essential to mammalian survival and reproduction are less likely to occur in neighborhoods, although neighborhoods are enriched with genes that function in mitosis. We also found that gene orientation and protein-protein interactions are partially responsible for maintenance of gene neighborhoods. Conclusions Our experiments using G-NEST confirm that tandem gene duplication is the primary driver of non-random gene order in mammalian genomes. Non-essentiality, co-functionality, gene orientation, and protein-protein interactions are additional forces that maintain gene neighborhoods, especially those formed by tandem duplicates. We expect G-NEST to be useful for other applications such as the identification of core regulatory modules, common transcriptional backgrounds, and chromatin domains. The

  9. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  10. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  11. Tumor targeted gene therapy

    International Nuclear Information System (INIS)

    Kang, Joo Hyun

    2006-01-01

    Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner

  12. Essential Bacillus subtilis genes

    DEFF Research Database (Denmark)

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related...... to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...

  13. Radiotechnologies and gene therapy

    International Nuclear Information System (INIS)

    Xia Jinsong

    2001-01-01

    Gene therapy is an exciting frontier in medicine today. Radiologist will make an uniquely contribution to these exciting new technologies at every level by choosing sites for targeting therapy, perfecting and establishing routes of delivery, developing imaging strategies to monitor therapy and assess gene expression, developing radiotherapeutic used of gene therapy

  14. Discovering genes underlying QTL

    Energy Technology Data Exchange (ETDEWEB)

    Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

    2002-02-01

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  15. Candidate Gene Identification of Flowering Time Genes in Cotton

    Directory of Open Access Journals (Sweden)

    Corrinne E. Grover

    2015-07-01

    Full Text Available Flowering time control is critically important to all sexually reproducing angiosperms in both natural ecological and agronomic settings. Accordingly, there is much interest in defining the genes involved in the complex flowering-time network and how these respond to natural and artificial selection, the latter often entailing transitions in day-length responses. Here we describe a candidate gene analysis in the cotton genus , which uses homologs from the well-described flowering network to bioinformatically and phylogenetically identify orthologs in the published genome sequence from Ulbr., one of the two model diploid progenitors of the commercially important allopolyploid cottons, L. and L. Presence and patterns of expression were evaluated from 13 aboveground tissues related to flowering for each of the candidate genes using allopolyploid as a model. Furthermore, we use a comparative context to determine copy number variability of each key gene family across 10 published angiosperm genomes. Data suggest a pattern of repeated loss of duplicates following ancient whole-genome doubling events in diverse lineages. The data presented here provide a foundation for understanding both the parallel evolution of day-length neutrality in domesticated cottons and the flowering-time network, in general, in this important crop plant.

  16. Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Rachel Lockridge; Boore, Jeffrey L.

    2005-06-01

    Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

  17. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  18. JGI Plant Genomics Gene Annotation Pipeline

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

    2014-07-14

    Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

  19. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  20. Gene therapy: An overview

    Directory of Open Access Journals (Sweden)

    Sudip Indu

    2013-01-01

    Full Text Available Gene therapy "the use of genes as medicine" involves the transfer of a therapeutic or working copy of a gene into specific cells of an individual in order to repair a faulty gene copy. The technique may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. The objective of gene therapy is to introduce new genetic material into target cells while causing no damage to the surrounding healthy cells and tissues, hence the treatment related morbidity is decreased. The delivery system includes a vector that delivers a therapeutic gene into the patient′s target cell. Functional proteins are created from the therapeutic gene causing the cell to return to a normal stage. The vectors used in gene therapy can be viral and non-viral. Gene therapy, an emerging field of biomedicine, is still at infancy and much research remains to be done before this approach to the treatment of condition will realize its full potential.

  1. Gene therapy in periodontics.

    Science.gov (United States)

    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini

    2013-03-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  2. New progress in snake mitochondrial gene rearrangement.

    Science.gov (United States)

    Chen, Nian; Zhao, Shujin

    2009-08-01

    To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.

  3. Chromosomal organization of adrenergic receptor genes

    International Nuclear Information System (INIS)

    Yang-Feng, T.L.; Xue, Feiyu; Zhong, Wuwei; Cotecchia, S.; Frielle, T.; Caron, M.G.; Lefkowitz, R.J.; Francke, U.

    1990-01-01

    The adrenergic receptors (ARs) (subtypes α 1 , α 2 , β 1 , and β 2 ) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. The authors have previously assigned the genes for β 2 -and α 2 -AR to human chromosomes 5 and 10, respectively. By Southern analysis of somatic cell hybrids and in situ chromosomal hybridization, they have now mapped the α 1 -AR gene to chromosome 5q32→q34, the same position as β 2 -AR, and the β 1 -AR gene to chromosome 10q24→q26, the region where α 2 -AR, is located. In mouse, both α 2 -and β 1 -AR genes were assigned to chromosome 19, and the α 1 -AR locus was localized to chromosome 11. Pulsed field gel electrophoresis has shown that the α 1 -and β 2 -AR genes in humans are within 300 kilobases (kb) and the distance between the α 2 - and β 1 -AR genes is <225 kb. The proximity of these two pairs of AR genes and the sequence similarity that exists among all the ARs strongly suggest that they are evolutionarily related. Moreover, they likely arose from a common ancestral receptor gene and subsequently diverged through gene duplication and chromosomal duplication to perform their distinctive roles in mediation the physiological effects of catecholamines. The AR genes thus provide a paradigm for understanding the evolution of such structurally conserved yet functionally divergent families off receptor molecules

  4. Primetime for Learning Genes.

    Science.gov (United States)

    Keifer, Joyce

    2017-02-11

    Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.

  5. DGGE based whole-gene mutation scanning of the dystrophlin gene in Duchenne and Becker muscular dystrophy patients

    NARCIS (Netherlands)

    Hofstra, RMW; Mulder, IM; Vossen, R; de Koning-Gans, PAM; Kraak, M; Ginjaar, IB; van der Hout, AH; Bakker, E; Buys, CHCM; van Essen, AJ; den Dunnen, JT

    2004-01-01

    Duchenne and Becker muscular dystrophy (DMD and BMD) are caused by mutations in the dystrophin gene. Large rearrangements in the gene are found in about two,thirds of DMD patients, with similar to60% carrying deletions and 5-10% carrying duplications. Most of the remaining 30-35% of patients are

  6. Loss of Major DNase I Hypersensitive Sites in Duplicatedglobin Gene Cluster Incompletely Silences HBB Gene Expression

    Czech Academy of Sciences Publication Activity Database

    Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.

    2016-01-01

    Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016

  7. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  8. Genes and Social Behavior

    OpenAIRE

    Robinson, Gene E.; Fernald, Russell D.; Clayton, David F.

    2008-01-01

    What specific genes and regulatory sequences contribute to the organization and functioning of brain circuits that support social behavior? How does social experience interact with information in the genome to modulate these brain circuits? Here we address these questions by highlighting progress that has been made in identifying and understanding two key “vectors of influence” that link genes, brain, and social behavior: 1) social information alters gene readout in the brain to influence beh...

  9. History of gene therapy.

    Science.gov (United States)

    Wirth, Thomas; Parker, Nigel; Ylä-Herttuala, Seppo

    2013-08-10

    Two decades after the initial gene therapy trials and more than 1700 approved clinical trials worldwide we not only have gained much new information and knowledge regarding gene therapy in general, but also learned to understand the concern that has persisted in society. Despite the setbacks gene therapy has faced, success stories have increasingly emerged. Examples for these are the positive recommendation for a gene therapy product (Glybera) by the EMA for approval in the European Union and the positive trials for the treatment of ADA deficiency, SCID-X1 and adrenoleukodystrophy. Nevertheless, our knowledge continues to grow and during the course of time more safety data has become available that helps us to develop better gene therapy approaches. Also, with the increased understanding of molecular medicine, we have been able to develop more specific and efficient gene transfer vectors which are now producing clinical results. In this review, we will take a historical view and highlight some of the milestones that had an important impact on the development of gene therapy. We will also discuss briefly the safety and ethical aspects of gene therapy and address some concerns that have been connected with gene therapy as an important therapeutic modality. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  11. Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster

    OpenAIRE

    Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.

    1994-01-01

    The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...

  12. Norrie disease and MAO genes: nearest neighbors.

    Science.gov (United States)

    Chen, Z Y; Denney, R M; Breakefield, X O

    1995-01-01

    The Norrie disease and MAO genes are tandemly arranged in the p11.4-p11.3 region of the human X chromosome in the order tel-MAOA-MAOB-NDP-cent. This relationship is conserved in the mouse in the order tel-MAOB-MAOA-NDP-cent. The MAO genes appear to have arisen by tandem duplication of an ancestral MAO gene, but their positional relationship to NDP appears to be random. Distinctive X-linked syndromes have been described for mutations in the MAOA and NDP genes, and in addition, individuals have been identified with contiguous gene syndromes due to chromosomal deletions which encompass two or three of these genes. Loss of function of the NDP gene causes a syndrome of congenital blindness and progressive hearing loss, sometimes accompanied by signs of CNS dysfunction, including variable mental retardation and psychiatric symptoms. Other mutations in the NDP gene have been found to underlie another X-linked eye disease, exudative vitreo-retinopathy. An MAOA deficiency state has been described in one family to date, with features of altered amine and amine metabolite levels, low normal intelligence, apparent difficulty in impulse control and cardiovascular difficulty in affected males. A contiguous gene syndrome in which all three genes are lacking, as well as other as yet unidentified flanking genes, results in severe mental retardation, small stature, seizures and congenital blindness, as well as altered amine and amine metabolites. Issues that remain to be resolved are the function of the NDP gene product, the frequency and phenotype of the MAOA deficiency state, and the possible occurrence and phenotype of an MAOB deficiency state.

  13. Chromatin loops, gene positioning, and gene expression

    NARCIS (Netherlands)

    Holwerda, S.; de Laat, W.

    2012-01-01

    Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

  14. Your Genes, Your Choices

    Science.gov (United States)

    Table of Contents Your Genes, Your Choices describes the Human Genome Project, the science behind it, and the ethical, legal, and social issues that are ... Nothing could be further from the truth. Your Genes, Your Choices points out how the progress of ...

  15. DNA repair genes

    International Nuclear Information System (INIS)

    Morimyo, Mitsuoki

    1995-01-01

    Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)

  16. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  17. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  18. Radionuclide reporter gene imaging

    International Nuclear Information System (INIS)

    Min, Jung Joon

    2004-01-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases

  19. Radionuclide reporter gene imaging

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Joon [School of Medicine, Chonnam National Univ., Gwangju (Korea, Republic of)

    2004-04-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases.

  20. The low-recombining pericentromeric region of barley restricts gene diversity and evolution but not gene expression

    Science.gov (United States)

    Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J

    2014-01-01

    The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331

  1. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    that transferred genes may be evolutionarily important in generating mitochondrial genetic diversity. Finally, the complex relationships within each lineage of transferred genes imply a surprisingly complicated history of these genes in Plantago subsequent to their acquisition via HGT and this history probably involves some combination of additional transfers (including intracellular transfer), gene duplication, differential loss and mutation-rate variation. Unravelling this history will probably require sequencing multiple mitochondrial and nuclear genomes from Plantago. See Commentary: http://www.biomedcentral.com/1741-7007/8/147. PMID:21176201

  2. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    mitochondrial copies suggests that transferred genes may be evolutionarily important in generating mitochondrial genetic diversity. Finally, the complex relationships within each lineage of transferred genes imply a surprisingly complicated history of these genes in Plantago subsequent to their acquisition via HGT and this history probably involves some combination of additional transfers (including intracellular transfer, gene duplication, differential loss and mutation-rate variation. Unravelling this history will probably require sequencing multiple mitochondrial and nuclear genomes from Plantago. See Commentary: http://www.biomedcentral.com/1741-7007/8/147.

  3. Gene amplification in carcinogenesis

    Directory of Open Access Journals (Sweden)

    Lucimari Bizari

    2006-01-01

    Full Text Available Gene amplification increases the number of genes in a genome and can give rise to karyotype abnormalities called double minutes (DM and homogeneously staining regions (HSR, both of which have been widely observed in human tumors but are also known to play a major role during embryonic development due to the fact that they are responsible for the programmed increase of gene expression. The etiology of gene amplification during carcinogenesis is not yet completely understood but can be considered a result of genetic instability. Gene amplification leads to an increase in protein expression and provides a selective advantage during cell growth. Oncogenes such as CCND1, c-MET, c-MYC, ERBB2, EGFR and MDM2 are amplified in human tumors and can be associated with increased expression of their respective proteins or not. In general, gene amplification is associated with more aggressive tumors, metastases, resistance to chemotherapy and a decrease in the period during which the patient stays free of the disease. This review discusses the major role of gene amplification in the progression of carcinomas, formation of genetic markers and as possible therapeutic targets for the development of drugs for the treatment of some types of tumors.

  4. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  5. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Science.gov (United States)

    Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun

    2015-01-01

    Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  6. Co-evolution of secondary metabolite gene clusters and their host

    DEFF Research Database (Denmark)

    Kjærbølling, Inge; Vesth, Tammi Camilla; Frisvad, Jens Christian

    Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of speci....... We investigate the dynamic evolutionary relationship between the cluster and the host by examining the genes within the cluster and the number of homologous genes found within the host and in closely related species.......Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of species...

  7. Methanogenesis and methane genes

    International Nuclear Information System (INIS)

    Reeve, J.N.; Shref, B.A.

    1991-01-01

    An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)

  8. Gene Dosage Analysis in a Clinical Environment: Gene-Targeted Microarrays as the Platform-of-Choice

    Directory of Open Access Journals (Sweden)

    Donald R. Love

    2013-03-01

    Full Text Available The role of gene deletion and duplication in the aetiology of disease has become increasingly evident over the last decade. In addition to the classical deletion/duplication disorders diagnosed using molecular techniques, such as Duchenne Muscular Dystrophy and Charcot-Marie-Tooth Neuropathy Type 1A, the significance of partial or whole gene deletions in the pathogenesis of a large number single-gene disorders is becoming more apparent. A variety of dosage analysis methods are available to the diagnostic laboratory but the widespread application of many of these techniques is limited by the expense of the kits/reagents and restrictive targeting to a particular gene or portion of a gene. These limitations are particularly important in the context of a small diagnostic laboratory with modest sample throughput. We have developed a gene-targeted, custom-designed comparative genomic hybridisation (CGH array that allows twelve clinical samples to be interrogated simultaneously for exonic deletions/duplications within any gene (or panel of genes on the array. We report here on the use of the array in the analysis of a series of clinical samples processed by our laboratory over a twelve-month period. The array has proven itself to be robust, flexible and highly suited to the diagnostic environment.

  9. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  10. Finding Genes for Schizophrenia

    OpenAIRE

    Åberg, Karolina

    2005-01-01

    Schizophrenia is one of our most common psychiatric diseases. It severely affects all aspects of psychological functions and results in loss of contact with reality. No cure exists and the treatments available today produce only partial relief for disease symptoms. The aim of this work is to better understand the etiology of schizophrenia by identification of candidate genes and gene pathways involved in the development of the disease. In a preliminarily study, the effects of medication and g...

  11. Epigenetics: beyond genes

    CSIR Research Space (South Africa)

    Fossey, A

    2009-06-01

    Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...

  12. Gene-Gene and Gene-Environment Interactions in the Etiology of Breast Cancer

    National Research Council Canada - National Science Library

    Adegoke, Olufemi

    2003-01-01

    The objective of this CDA is to evaluate the gene-gene and gene-environment interactions in the etiology of breast cancer in two ongoing case-control studies, the Shanghai Breast Cancer Study (SBCS...

  13. Radiosensitivity and genes

    Energy Technology Data Exchange (ETDEWEB)

    Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.

  14. Radiosensitivity and genes

    International Nuclear Information System (INIS)

    Hu Qiyue; Lun Mingyue

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation

  15. Evidence for homosexuality gene

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  16. The Mycoplasma hominis vaa gene displays a mosaic gene structure

    DEFF Research Database (Denmark)

    Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.

    1998-01-01

    Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...

  17. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  18. Genome-Wide Identification and Evolution of HECT Genes in Soybean

    Directory of Open Access Journals (Sweden)

    Xianwen Meng

    2015-04-01

    Full Text Available Proteins containing domains homologous to the E6-associated protein (E6-AP carboxyl terminus (HECT are an important class of E3 ubiquitin ligases involved in the ubiquitin proteasome pathway. HECT-type E3s play crucial roles in plant growth and development. However, current understanding of plant HECT genes and their evolution is very limited. In this study, we performed a genome-wide analysis of the HECT domain-containing genes in soybean. Using high-quality genome sequences, we identified 19 soybean HECT genes. The predicted HECT genes were distributed unevenly across 15 of 20 chromosomes. Nineteen of these genes were inferred to be segmentally duplicated gene pairs, suggesting that in soybean, segmental duplications have made a significant contribution to the expansion of the HECT gene family. Phylogenetic analysis showed that these HECT genes can be divided into seven groups, among which gene structure and domain architecture was relatively well-conserved. The Ka/Ks ratios show that after the duplication events, duplicated HECT genes underwent purifying selection. Moreover, expression analysis reveals that 15 of the HECT genes in soybean are differentially expressed in 14 tissues, and are often highly expressed in the flowers and roots. In summary, this work provides useful information on which further functional studies of soybean HECT genes can be based.

  19. The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis

    DEFF Research Database (Denmark)

    Lin, Senjie; Cheng, Shifeng; Song, Bo

    2015-01-01

    Symbiodinium-specific gene families. No whole-genome duplication was observed, but instead we found active (retro) transposition and gene family expansion, especially in processes important for successful symbiosis with corals. We also documented genes potentially governing sexual reproduction and cyst...... the molecular basis and evolution of coral symbiosis....

  20. Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

    Science.gov (United States)

    Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

  1. The WRKY Transcription Factor Genes in Lotus japonicus.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun

    2014-01-01

    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (LjWRKY) genes can be classified into three groups (I-III). Investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6. Researchers previously believed that group II and III WRKY domains were derived from the C-terminal WRKY domain of group I. Our results suggest that some WRKY genes in group II originated from the N-terminal domain of group I WRKY genes. Additional evidence to support this hypothesis was obtained by Medicago truncatula WRKY (MtWRKY) protein motif analysis. We found that LjWRKY and MtWRKY group III genes are under purifying selection, suggesting that WRKY genes will become increasingly structured and functionally conserved.

  2. FunGene: the functional gene pipeline and repository.

    Science.gov (United States)

    Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

    2013-01-01

    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  3. FunGene: the Functional Gene Pipeline and Repository

    Directory of Open Access Journals (Sweden)

    Jordan A. Fish

    2013-10-01

    Full Text Available Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer.While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/ offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  4. Gene therapy prospects--intranasal delivery of therapeutic genes.

    Science.gov (United States)

    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

    2012-01-01

    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  5. Radionuclide reporter gene imaging for cardiac gene therapy

    International Nuclear Information System (INIS)

    Inubushi, Masayuki; Tamaki, Nagara

    2007-01-01

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  6. GoGene: gene annotation in the fast lane.

    Science.gov (United States)

    Plake, Conrad; Royer, Loic; Winnenburg, Rainer; Hakenberg, Jörg; Schroeder, Michael

    2009-07-01

    High-throughput screens such as microarrays and RNAi screens produce huge amounts of data. They typically result in hundreds of genes, which are often further explored and clustered via enriched GeneOntology terms. The strength of such analyses is that they build on high-quality manual annotations provided with the GeneOntology. However, the weakness is that annotations are restricted to process, function and location and that they do not cover all known genes in model organisms. GoGene addresses this weakness by complementing high-quality manual annotation with high-throughput text mining extracting co-occurrences of genes and ontology terms from literature. GoGene contains over 4,000,000 associations between genes and gene-related terms for 10 model organisms extracted from more than 18,000,000 PubMed entries. It does not cover only process, function and location of genes, but also biomedical categories such as diseases, compounds, techniques and mutations. By bringing it all together, GoGene provides the most recent and most complete facts about genes and can rank them according to novelty and importance. GoGene accepts keywords, gene lists, gene sequences and protein sequences as input and supports search for genes in PubMed, EntrezGene and via BLAST. Since all associations of genes to terms are supported by evidence in the literature, the results are transparent and can be verified by the user. GoGene is available at http://gopubmed.org/gogene.

  7. Glutamine synthetase gene evolution: A good molecular clock

    International Nuclear Information System (INIS)

    Pesole, G.; Lanvave, C.; Saccone, C.; Bozzetti, M.P.; Preparata, G.

    1991-01-01

    Glutamine synthetase gene evolution in various animals, plants, and bacteria was evaluated by a general stationary Markov model. The evolutionary process proved to be unexpectedly regular even for a time span as long as that between the divergence of prokaryotes from eukaryotes. This enabled us to draw phylogenetic trees for species whose phylogeny cannot be easily reconstructed from the fossil record. The calculation of the times of divergence of the various organelle-specific enzymes led us to hypothesize that the pea and bean chloroplast genes for these enzymes originated from the duplication of nuclear genes as a result of the different metabolic needs of the various species. The data indicate that the duplication of plastid glutamine synthetase genes occurred long after the endosymbiotic events that produced the organelles themselves

  8. Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

    Science.gov (United States)

    Pophaly, Saurabh D; Tellier, Aurélien

    2015-12-01

    The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Genes and inheritance.

    Science.gov (United States)

    Middelton, L A; Peters, K F

    2001-10-01

    The information gained from the Human Genome Project and related genetic research will undoubtedly create significant changes in healthcare practice. It is becoming increasingly clear that nurses in all areas of clinical practice will require a fundamental understanding of basic genetics. This article provides the oncology nurse with an overview of basic genetic concepts, including inheritance patterns of single gene conditions, pedigree construction, chromosome aberrations, and the multifactorial basis underlying the common diseases of adulthood. Normal gene structure and function are introduced and the biochemistry of genetic errors is described.

  10. Neighboring Genes Show Correlated Evolution in Gene Expression

    Science.gov (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  11. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  12. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  13. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  14. Norrie disease gene is distinct from the monoamine oxidase genes

    OpenAIRE

    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

    1989-01-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

  15. Toxin gene determination and evolution in scorpaenoid fish.

    Science.gov (United States)

    Chuang, Po-Shun; Shiao, Jen-Chieh

    2014-09-01

    In this study, we determine the toxin genes from both cDNA and genomic DNA of four scorpaenoid fish and reconstruct their evolutionary relationship. The deduced protein sequences of the two toxin subunits in Sebastapistes strongia, Scorpaenopsis oxycephala, and Sebastiscus marmoratus are about 700 amino acid, similar to the sizes of the stonefish (Synanceia horrida, and Synanceia verrucosa) and lionfish (Pterois antennata and Pterois volitans) toxins previously published. The intron positions are highly conserved among these species, which indicate the applicability of gene finding by using genomic DNA template. The phylogenetic analysis shows that the two toxin subunits were duplicated prior to the speciation of Scorpaenoidei. The precedence of the gene duplication over speciation indicates that the toxin genes may be common to the whole family of Scorpaeniform. Furthermore, one additional toxin gene has been determined in the genomic DNA of Dendrochirus zebra. The phylogenetic analysis suggests that an additional gene duplication occurred before the speciation of the lionfish (Pteroinae) and a pseudogene may be generally present in the lineage of lionfish. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Hidden genes in birds

    Czech Academy of Sciences Publication Activity Database

    Hron, Tomáš; Pajer, Petr; Pačes, Jan; Bartůněk, Petr; Elleder, Daniel

    2015-01-01

    Roč. 16, August 18 (2015) ISSN 1465-6906 R&D Projects: GA MŠk(CZ) LK11215; GA MŠk LO1419 Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:68378050 Keywords : REPETITIVE SEQUENCES * G/C stretches * avian genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.313, year: 2015

  17. Rhabdovirus accessory genes.

    Science.gov (United States)

    Walker, Peter J; Dietzgen, Ralf G; Joubert, D Albert; Blasdell, Kim R

    2011-12-01

    The Rhabdoviridae is one of the most ecologically diverse families of RNA viruses with members infecting a wide range of organisms including placental mammals, marsupials, birds, reptiles, fish, insects and plants. The availability of complete nucleotide sequences for an increasing number of rhabdoviruses has revealed that their ecological diversity is reflected in the diversity and complexity of their genomes. The five canonical rhabdovirus structural protein genes (N, P, M, G and L) that are shared by all rhabdoviruses are overprinted, overlapped and interspersed with a multitude of novel and diverse accessory genes. Although not essential for replication in cell culture, several of these genes have been shown to have roles associated with pathogenesis and apoptosis in animals, and cell-to-cell movement in plants. Others appear to be secreted or have the characteristics of membrane-anchored glycoproteins or viroporins. However, most encode proteins of unknown function that are unrelated to any other known proteins. Understanding the roles of these accessory genes and the strategies by which rhabdoviruses use them to engage, divert and re-direct cellular processes will not only present opportunities to develop new anti-viral therapies but may also reveal aspects of cellar function that have broader significance in biology, agriculture and medicine. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  18. Targeting fumonisin biosynthetic genes

    Science.gov (United States)

    The fungus Fusarium is an agricultural problem because it can cause disease on most crop plants and can contaminate crops with mycotoxins. There is considerable variation in the presence/absence and genomic location of gene clusters responsible for synthesis of mycotoxins and other secondary metabol...

  19. Radio-induced genes

    International Nuclear Information System (INIS)

    Rigaud, O.; Kazmaier, M.

    2000-01-01

    The monitoring system of the DNA integrity of an irradiated cell does not satisfy oneself to recruit the enzymes allowing the repair of detected damages. It sends an alarm signal whom transmission leads to the activation of specific genes in charge of stopping the cell cycle, the time to make the repair works, or to lead to the elimination of a too much damaged cell. Among the numerous genes participating to the monitoring of cell response to irradiation, the target genes of the mammalian P53 protein are particularly studied. Caretaker of the genome, this protein play a central part in the cell response to ionizing radiations. this response is less studied among plants. A way to tackle it is to be interested in the radioinduced genes identification in the vegetal cell, while taking advantage of knowledge got in the animal field. The knowledge of the complete genome of the arabette (arabidopsis thaliana), the model plant and the arising of new techniques allow to lead this research at a previously unknown rhythm in vegetal biology. (N.C.)

  20. The Gene Guessing Game

    OpenAIRE

    Dunham, Ian

    2000-01-01

    A recent flurry of publications and media attention has revived interest in the question of how many genes exist in the human genome. Here, I review the estimates and use genomic sequence data from human chromosomes 21 and 22 to establish my own prediction.

  1. Targeting trichothecene biosynthetic genes

    NARCIS (Netherlands)

    Wei, Songhong; Lee, van der Theo; Verstappen, Els; Gent, van Marga; Waalwijk, Cees

    2017-01-01

    Biosynthesis of trichothecenes requires the involvement of at least 15 genes, most of which have been targeted for PCR. Qualitative PCRs are used to assign chemotypes to individual isolates, e.g., the capacity to produce type A and/or type B trichothecenes. Many regions in the core cluster

  2. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    a gene in the opposite orientation in a cultured plant cell line and observed that the ..... started emerging in early 1990s from the work carried out by the. It is believed that ... cause human diseases such as cervical cancer, hepatitis, measles.

  3. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  4. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  5. Genes2FANs: connecting genes through functional association networks

    Science.gov (United States)

    2012-01-01

    Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs), researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI) network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our finding that disease genes in

  6. Industrial scale gene synthesis.

    Science.gov (United States)

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. The chromosomal arrangement of six soybean leghemoglobin genes

    DEFF Research Database (Denmark)

    Bojsen, Kirsten; Abildsten, Dorte; Jensen, Erik Ø

    1983-01-01

    Clones containing six leghemoglobin (Lb) genes have been isolated from two genomic libraries of soybean. They encompass two independent DNA regions: a 40-kb region containing four genes in the order 5' Lba-Lbc(1)-[unk]Lb-Lbc(3) 3' with the same transcriptional polarity, and another 40-kb region...... containing two genes in the order 5' Lbc(4)-Lbc(2) 3' with the same polarity. The order in which the Lb genes are arranged in the soybean genome imply that they are activated in the opposite order to which they are arranged on the chromosome. There is a close similarity between corresponding DNA regions...... differs from that of the Lb genes. The existence of two very similar Lb gene clusters in soybean suggest that soybean may have evolved from an ancestral form by genome duplication. Udgivelsesdato: 1983-null...

  8. Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

    Science.gov (United States)

    Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

    2018-03-08

    The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

  9. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  10. Using gene expression noise to understand gene regulation

    NARCIS (Netherlands)

    Munsky, B.; Neuert, G.; van Oudenaarden, A.

    2012-01-01

    Phenotypic variation is ubiquitous in biology and is often traceable to underlying genetic and environmental variation. However, even genetically identical cells in identical environments display variable phenotypes. Stochastic gene expression, or gene expression "noise," has been suggested as a

  11. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  12. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  13. Genes, stress, and depression.

    Science.gov (United States)

    Wurtman, Richard J

    2005-05-01

    A relationship between genetic makeup and susceptibility to major depressive disorder (MDD) has long been suspected on the basis of family and twin studies. A metaanalysis of reports on the basis of twin studies has estimated MDD's degree of heritability to be 0.33 (confidence interval, 0.26-0.39). Among families exhibiting an increased prevalence of MDD, risk of developing the illness was enhanced in members exposed to a highly stressful environment. Aberrant genes can predispose to depression in a number of ways, for example, by diminishing production of growth factors that act during brain development. An aberrant gene could also increase or decrease a neurotransmitter's release into synapses, its actions, or its duration of activity. The gene products of greatest interest at present are those involved in the synthesis and actions of serotonin; among them, the serotonin-uptake protein localized within the terminals and dendrites of serotonin-releasing neurons. It has been found that the Vmax of platelet serotonin uptake is low in some patients with MDD; also, Vmax is highly correlated in twins. Antidepressant drugs such as the selective serotonin reuptake inhibitors act on this uptake protein. The specific genetic locus causing serotonin uptake to be lower in some patients with major depression involves a polymorphic region (5-HTTLPR) in the promoter region of the gene for the uptake protein. The gene itself exists as several alleles, the short "S" allele and the long "L" allele. The S variant is associated with less, and the L variant with more, of the uptake protein. The effect of stressful life events on depressive symptoms in young adults was found to be significantly stronger among SS or SL subjects than among LL subjects. Neuroimaging studies showed that people with the SS or SL alleles exhibited a greater activation of the amygdala in response to fearful stimuli than those with LL. It has been reported recently that mutations in the gene that controls

  14. Improved methods and resources for paramecium genomics: transcription units, gene annotation and gene expression.

    Science.gov (United States)

    Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda

    2017-06-26

    The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis

  15. Vertebrate gene predictions and the problem of large genes

    DEFF Research Database (Denmark)

    Wang, Jun; Li, ShengTing; Zhang, Yong

    2003-01-01

    To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistent...

  16. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  17. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  18. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    among these large, multi-domain proteins are due not only to shared ancestry (homology but also to convergent evolution (analogy. During the evolution of these gene families, duplications and other gene rearrangements affecting domain composition, have occurred along with sequence divergence, leading to complex family relationships with accordingly complex functional implications. The functional homologies and analogies among these genes remain to be established empirically.

  19. Gene Structures, Classification, and Expression Models of the DREB Transcription Factor Subfamily in Populus trichocarpa

    Directory of Open Access Journals (Sweden)

    Yunlin Chen

    2013-01-01

    Full Text Available We identified 75 dehydration-responsive element-binding (DREB protein genes in Populus trichocarpa. We analyzed gene structures, phylogenies, domain duplications, genome localizations, and expression profiles. The phylogenic construction suggests that the PtrDREB gene subfamily can be classified broadly into six subtypes (DREB A-1 to A-6 in Populus. The chromosomal localizations of the PtrDREB genes indicated 18 segmental duplication events involving 36 genes and six redundant PtrDREB genes were involved in tandem duplication events. There were fewer introns in the PtrDREB subfamily. The motif composition of PtrDREB was highly conserved in the same subtype. We investigated expression profiles of this gene subfamily from different tissues and/or developmental stages. Sixteen genes present in the digital expression analysis had high levels of transcript accumulation. The microarray results suggest that 18 genes were upregulated. We further examined the stress responsiveness of 15 genes by qRT-PCR. A digital northern analysis showed that the PtrDREB17, 18, and 32 genes were highly induced in leaves under cold stress, and the same expression trends were shown by qRT-PCR. Taken together, these observations may lay the foundation for future functional analyses to unravel the biological roles of Populus’ DREB genes.

  20. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  1. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  2. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  3. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  4. Brains, Genes and Primates

    Science.gov (United States)

    Belmonte, Juan Carlos Izpisua; Callaway, Edward M.; Churchland, Patricia; Caddick, Sarah J.; Feng, Guoping; Homanics, Gregg E.; Lee, Kuo-Fen; Leopold, David A.; Miller, Cory T.; Mitchell, Jude F.; Mitalipov, Shoukhrat; Moutri, Alysson R.; Movshon, J. Anthony; Okano, Hideyuki; Reynolds, John H.; Ringach, Dario; Sejnowski, Terrence J.; Silva, Afonso C.; Strick, Peter L.; Wu, Jun; Zhang, Feng

    2015-01-01

    One of the great strengths of the mouse model is the wide array of genetic tools that have been developed. Striking examples include methods for directed modification of the genome, and for regulated expression or inactivation of genes. Within neuroscience, it is now routine to express reporter genes, neuronal activity indicators and opsins in specific neuronal types in the mouse. However, there are considerable anatomical, physiological, cognitive and behavioral differences between the mouse and the human that, in some areas of inquiry, limit the degree to which insights derived from the mouse can be applied to understanding human neurobiology. Several recent advances have now brought into reach the goal of applying these tools to understanding the primate brain. Here we describe these advances, consider their potential to advance our understanding of the human brain and brain disorders, discuss bioethical considerations, and describe what will be needed to move forward. PMID:25950631

  5. Gene Porter Bridwell

    Science.gov (United States)

    1994-01-01

    Gene Porter Bridwell served as the director of the Marshall Space Flight Center from January 6, 1994 until February 3, 1996, when he retired from NASA after thirty-four years service. Bridwell, a Marshall employee since 1962, had been Marshall's Space Shuttle Projects Office Director and Space Station Redesign Team deputy manager. Under Bridwell, Marshall worked to develop its role as a Center of Excellence for propulsion and for providing access to space.

  6. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  7. Gene doping in modern sport.

    OpenAIRE

    MAREK SAWCZUK; AGNIESZKA MACIEJEWSKA; PAWEL CIESZCZYK,

    2009-01-01

    Background: The subject of this paper is gene doping, which should be understood as "he non-therapeutic use of cells, genes, genetic elements, or of the modulation of gene expression, having the capacity to improve athletic performance". The authors of this work, based on the review of literature and previous research, make an attempt at wider characterization of gene doping and the discussion of related potential threats.Methods: This is a comprehensive survey of literature on the latest app...

  8. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  9. Genealogy and gene trees.

    Science.gov (United States)

    Rasmuson, Marianne

    2008-02-01

    Heredity can be followed in persons or in genes. Persons can be identified only a few generations back, but simplified models indicate that universal ancestors to all now living persons have occurred in the past. Genetic variability can be characterized as variants of DNA sequences. Data are available only from living persons, but from the pattern of variation gene trees can be inferred by means of coalescence models. The merging of lines backwards in time leads to a MRCA (most recent common ancestor). The time and place of living for this inferred person can give insights in human evolutionary history. Demographic processes are incorporated in the model, but since culture and customs are known to influence demography the models used ought to be tested against available genealogy. The Icelandic data base offers a possibility to do so and points to some discrepancies. Mitochondrial DNA and Y chromosome patterns give a rather consistent view of human evolutionary history during the latest 100 000 years but the earlier epochs of human evolution demand gene trees with longer branches. The results of such studies reveal as yet unsolved problems about the sources of our genome.

  10. Gene therapy of cancer and development of therapeutic target gene

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.

  11. Gene therapy of cancer and development of therapeutic target gene

    International Nuclear Information System (INIS)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene

  12. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    Science.gov (United States)

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  13. Genome-wide identification and evolution of the PIN-FORMED (PIN) gene family in Glycine max.

    Science.gov (United States)

    Liu, Yuan; Wei, Haichao

    2017-07-01

    Soybean (Glycine max) is one of the most important crop plants. Wild and cultivated soybean varieties have significant differences worth further investigation, such as plant morphology, seed size, and seed coat development; these characters may be related to auxin biology. The PIN gene family encodes essential transport proteins in cell-to-cell auxin transport, but little research on soybean PIN genes (GmPIN genes) has been done, especially with respect to the evolution and differences between wild and cultivated soybean. In this study, we retrieved 23 GmPIN genes from the latest updated G. max genome database; six GmPIN protein sequences were changed compared with the previous database. Based on the Plant Genome Duplication Database, 18 GmPIN genes have been involved in segment duplication. Three pairs of GmPIN genes arose after the second soybean genome duplication, and six occurred after the first genome duplication. The duplicated GmPIN genes retained similar expression patterns. All the duplicated GmPIN genes experienced purifying selection (K a /K s genome sequence of 17 wild and 14 cultivated soybean varieties. Our research provides useful and comprehensive basic information for understanding GmPIN genes.

  14. Gene electrotransfer in clinical trials

    DEFF Research Database (Denmark)

    Gehl, Julie

    2014-01-01

    Electroporation is increasingly being used for delivery of chemotherapy to tumors. Likewise, gene delivery by electroporation is rapidly gaining momentum for both vaccination purposes and for delivery of genes coding for other therapeutic molecules, such as chronic diseases or cancer. This chapter...... describes how gene therapy may be performed using electric pulses to enhance uptake and expression....

  15. Gene probes: principles and protocols

    National Research Council Canada - National Science Library

    Aquino de Muro, Marilena; Rapley, Ralph

    2002-01-01

    ... of labeled DNA has allowed genes to be mapped to single chromosomes and in many cases to a single chromosome band, promoting significant advance in human genome mapping. Gene Probes: Principles and Protocols presents the principles for gene probe design, labeling, detection, target format, and hybridization conditions together with detailed protocols, accom...

  16. Compositional gradients in Gramineae genes

    DEFF Research Database (Denmark)

    Wong, Gane Ka-Shu; Wang, Jun; Tao, Lin

    2002-01-01

    In this study, we describe a property of Gramineae genes, and perhaps all monocot genes, that is not observed in eudicot genes. Along the direction of transcription, beginning at the junction of the 5'-UTR and the coding region, there are gradients in GC content, codon usage, and amino-acid usage...

  17. Independent Gene Discovery and Testing

    Science.gov (United States)

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  18. Gene function prediction based on Gene Ontology Hierarchy Preserving Hashing.

    Science.gov (United States)

    Zhao, Yingwen; Fu, Guangyuan; Wang, Jun; Guo, Maozu; Yu, Guoxian

    2018-02-23

    Gene Ontology (GO) uses structured vocabularies (or terms) to describe the molecular functions, biological roles, and cellular locations of gene products in a hierarchical ontology. GO annotations associate genes with GO terms and indicate the given gene products carrying out the biological functions described by the relevant terms. However, predicting correct GO annotations for genes from a massive set of GO terms as defined by GO is a difficult challenge. To combat with this challenge, we introduce a Gene Ontology Hierarchy Preserving Hashing (HPHash) based semantic method for gene function prediction. HPHash firstly measures the taxonomic similarity between GO terms. It then uses a hierarchy preserving hashing technique to keep the hierarchical order between GO terms, and to optimize a series of hashing functions to encode massive GO terms via compact binary codes. After that, HPHash utilizes these hashing functions to project the gene-term association matrix into a low-dimensional one and performs semantic similarity based gene function prediction in the low-dimensional space. Experimental results on three model species (Homo sapiens, Mus musculus and Rattus norvegicus) for interspecies gene function prediction show that HPHash performs better than other related approaches and it is robust to the number of hash functions. In addition, we also take HPHash as a plugin for BLAST based gene function prediction. From the experimental results, HPHash again significantly improves the prediction performance. The codes of HPHash are available at: http://mlda.swu.edu.cn/codes.php?name=HPHash. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

    Science.gov (United States)

    Preston, Jill C.; Kellogg, Elizabeth A.

    2006-01-01

    Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

  20. Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene

    International Nuclear Information System (INIS)

    Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.

    1988-01-01

    The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region

  1. Analysis of gene evolution and metabolic pathways using the Candida Gene Order Browser

    LENUS (Irish Health Repository)

    Fitzpatrick, David A

    2010-05-10

    Abstract Background Candida species are the most common cause of opportunistic fungal infection worldwide. Recent sequencing efforts have provided a wealth of Candida genomic data. We have developed the Candida Gene Order Browser (CGOB), an online tool that aids comparative syntenic analyses of Candida species. CGOB incorporates all available Candida clade genome sequences including two Candida albicans isolates (SC5314 and WO-1) and 8 closely related species (Candida dubliniensis, Candida tropicalis, Candida parapsilosis, Lodderomyces elongisporus, Debaryomyces hansenii, Pichia stipitis, Candida guilliermondii and Candida lusitaniae). Saccharomyces cerevisiae is also included as a reference genome. Results CGOB assignments of homology were manually curated based on sequence similarity and synteny. In total CGOB includes 65617 genes arranged into 13625 homology columns. We have also generated improved Candida gene sets by merging\\/removing partial genes in each genome. Interrogation of CGOB revealed that the majority of tandemly duplicated genes are under strong purifying selection in all Candida species. We identified clusters of adjacent genes involved in the same metabolic pathways (such as catabolism of biotin, galactose and N-acetyl glucosamine) and we showed that some clusters are species or lineage-specific. We also identified one example of intron gain in C. albicans. Conclusions Our analysis provides an important resource that is now available for the Candida community. CGOB is available at http:\\/\\/cgob.ucd.ie.

  2. Examining the process of de novo gene birth: an educational primer on "integration of new genes into cellular networks, and their structural maturation".

    Science.gov (United States)

    Frietze, Seth; Leatherman, Judith

    2014-03-01

    New genes that arise from modification of the noncoding portion of a genome rather than being duplicated from parent genes are called de novo genes. These genes, identified by their brief evolution and lack of parent genes, provide an opportunity to study the timeframe in which emerging genes integrate into cellular networks, and how the characteristics of these genes change as they mature into bona fide genes. An article by G. Abrusán provides an opportunity to introduce students to fundamental concepts in evolutionary and comparative genetics and to provide a technical background by which to discuss systems biology approaches when studying the evolutionary process of gene birth. Basic background needed to understand the Abrusán study and details on comparative genomic concepts tailored for a classroom discussion are provided, including discussion questions and a supplemental exercise on navigating a genome database.

  3. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  4. Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genes

    Directory of Open Access Journals (Sweden)

    Lynch Vincent J

    2007-01-01

    Full Text Available Abstract Background Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare. Snake venom phospholipase A2 genes are members of large multigene families with many diverse functions, thus they are excellent models to study the emergence of novel functions after gene duplications. Results Here, I show that positive Darwinian selection and neofunctionalization is common in snake venom phospholipase A2 genes. The pattern of gene duplication and positive selection indicates that adaptive molecular evolution occurs immediately after duplication events as novel functions emerge and continues as gene families diversify and are refined. Surprisingly, adaptive evolution of group-I phospholipases in elapids is also associated with speciation events, suggesting adaptation of the phospholipase arsenal to novel prey species after niche shifts. Mapping the location of sites under positive selection onto the crystal structure of phospholipase A2 identified regions evolving under diversifying selection are located on the molecular surface and are likely protein-protein interactions sites essential for toxin functions. Conclusion These data show that increases in genomic complexity (through gene duplications can lead to phenotypic complexity (venom composition and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.

  5. The ethics of gene therapy.

    Science.gov (United States)

    Chan, Sarah; Harris, John

    2006-10-01

    Recent developments have progressed in areas of science that pertain to gene therapy and its ethical implications. This review discusses the current state of therapeutic gene technologies, including stem cell therapies and genetic modification, and identifies ethical issues of concern in relation to the science of gene therapy and its application, including the ethics of embryonic stem cell research and therapeutic cloning, the risks associated with gene therapy, and the ethics of clinical research in developing new therapeutic technologies. Additionally, ethical issues relating to genetic modification itself are considered: the significance of the human genome, the distinction between therapy and enhancement, and concerns regarding gene therapy as a eugenic practice.

  6. Reconciliation of Gene and Species Trees

    Directory of Open Access Journals (Sweden)

    L. Y. Rusin

    2014-01-01

    Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.

  7. Computational Identification of Novel Genes: Current and Future Perspectives.

    Science.gov (United States)

    Klasberg, Steffen; Bitard-Feildel, Tristan; Mallet, Ludovic

    2016-01-01

    While it has long been thought that all genomic novelties are derived from the existing material, many genes lacking homology to known genes were found in recent genome projects. Some of these novel genes were proposed to have evolved de novo, ie, out of noncoding sequences, whereas some have been shown to follow a duplication and divergence process. Their discovery called for an extension of the historical hypotheses about gene origination. Besides the theoretical breakthrough, increasing evidence accumulated that novel genes play important roles in evolutionary processes, including adaptation and speciation events. Different techniques are available to identify genes and classify them as novel. Their classification as novel is usually based on their similarity to known genes, or lack thereof, detected by comparative genomics or against databases. Computational approaches are further prime methods that can be based on existing models or leveraging biological evidences from experiments. Identification of novel genes remains however a challenging task. With the constant software and technologies updates, no gold standard, and no available benchmark, evaluation and characterization of genomic novelty is a vibrant field. In this review, the classical and state-of-the-art tools for gene prediction are introduced. The current methods for novel gene detection are presented; the methodological strategies and their limits are discussed along with perspective approaches for further studies.

  8. Radiopharmaceuticals to monitor gene transfer

    International Nuclear Information System (INIS)

    Wiebe, L. I.; Morin, K. W.; Knaus, E. E.

    1997-01-01

    Advances in genetic engineering and molecular biology have opened the door to disease treatment by transferring genes to cells that are responsible for the pathological condition being addressed. These genes can serve to supplement or introduce the function of indigenous genes that are either inadequately expressed or that are congenitally absent in the patient. They can introduce new functions such as drug sensitization to provide a unique therapeutic target. Gene transfer is readily monitored in vitro using a range of histochemical and biochemical tests that are ''built in'' to the therapeutic gene cassette. In vivo, in situ monitoring of the gene transfer and gene expression processes can be achieved with these tests only if biopsy is possible. Scintigraphic imaging can offer unique information on both the extent and location of gene expression, provided that an appropriate reporter gene is included in the therapeutic cassette. This overview includes a brief orientation to gene transfer therapy and is followed by a review of current approaches to gene therapy imaging. The concluding section deals with imaging based on radiolabelled nucleoside substrates for herpes simplex type-1 thymidine kinase, with emphasis on IVFRU, a stable potent and selective HSV-1 TK substrate developed in their laboratories

  9. A novel MADS-box gene subfamily with a sister-group relationship to class B floral homeotic genes.

    Science.gov (United States)

    Becker, A; Kaufmann, K; Freialdenhoven, A; Vincent, C; Li, M-A; Saedler, H; Theissen, G

    2002-02-01

    Class B floral homeotic genes specify the identity of petals and stamens during the development of angiosperm flowers. Recently, putative orthologs of these genes have been identified in different gymnosperms. Together, these genes constitute a clade, termed B genes. Here we report that diverse seed plants also contain members of a hitherto unknown sister clade of the B genes, termed B(sister) (B(s)) genes. We have isolated members of the B(s) clade from the gymnosperm Gnetum gnemon, the monocotyledonous angiosperm Zea mays and the eudicots Arabidopsis thaliana and Antirrhinum majus. In addition, MADS-box genes from the basal angiosperm Asarum europaeum and the eudicot Petunia hybrida were identified as B(s) genes. Comprehensive expression studies revealed that B(s) genes are mainly transcribed in female reproductive organs (ovules and carpel walls). This is in clear contrast to the B genes, which are predominantly expressed in male reproductive organs (and in angiosperm petals). Our data suggest that the B(s) genes played an important role during the evolution of the reproductive structures in seed plants. The establishment of distinct B and B(s) gene lineages after duplication of an ancestral gene may have accompanied the evolution of male microsporophylls and female megasporophylls 400-300 million years ago. During flower evolution, expression of B(s) genes diversified, but the focus of expression remained in female reproductive organs. Our findings imply that a clade of highly conserved close relatives of class B floral homeotic genes has been completely overlooked until recently and awaits further evaluation of its developmental and evolutionary importance. Electronic supplementary material to this paper can be obtained by using the Springer Link server located at http://dx.doi.org/10.1007/s00438-001-0615-8.

  10. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

  11. Genome Wide Identification, Evolutionary, and Expression Analysis of VQ Genes from Two Pyrus Species.

    Science.gov (United States)

    Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping

    2018-04-23

    The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .

  12. Genome Wide Identification, Phylogeny, and Expression of Aquaporin Genes in Common Carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Chuanju Dong

    Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an

  13. Nomenclature for alleles of the human carboxylesterase 1 gene

    DEFF Research Database (Denmark)

    Rasmussen, Henrik B.; Madsen, Majbritt B.; Bjerre, Ditte

    2017-01-01

    The carboxylesterase 1 gene (CES1) in humans encodes a hydrolase, which is implicated in the metabolism of several commonly used drugs 1. This gene is located on chromosome 16 with a highly homologous pseudogene, CES1P1, in its proximity. A duplicated segment of CES1 replaces most of CES1P1 in some...... appears to be low 8,13. The formation of hybrids consisting of a gene and a related pseudogene has been reported for other genes than CES1. This includes the hybrids of the gene encoding cytochrome P450 2D6 (CYP2D6) and pseudogene CYP2D7, that is, the so-called CYP2D7/D6 hybrids 14......,15. These are categorized as CYP2D6 variants and not as variants of pseudogene CYP2D716....

  14. [Molecular mechanisms in sex determination: from gene regulation to pathology].

    Science.gov (United States)

    Ravel, C; Chantot-Bastaraud, S; Siffroi, J-P

    2004-01-01

    Testis determination is the complex process by which the bipotential gonad becomes a normal testis during embryo development. As a consequence, this process leads to sexual differentiation corresponding to the masculinization of both genital track and external genitalia. The whole phenomenon is under genetic control and is particularly driven by the presence of the Y chromosome and by the SRY gene, which acts as the key initiator of the early steps of testis determination. However, many other autosomal genes, present in both males and females, are expressed during testis formation in a gene activation pathway, which is far to be totally elucidated. All these genes act in a dosage-sensitive manner by which quantitative gene abnormalities, due to chromosomal deletions, duplications or mosaicism, may lead to testis determination failure and sex reversal.

  15. Gene Circuit Analysis of the Terminal Gap Gene huckebein

    Science.gov (United States)

    Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

    2009-01-01

    The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

  16. Maximum Gene-Support Tree

    Directory of Open Access Journals (Sweden)

    Yunfeng Shan

    2008-01-01

    Full Text Available Genomes and genes diversify during evolution; however, it is unclear to what extent genes still retain the relationship among species. Model species for molecular phylogenetic studies include yeasts and viruses whose genomes were sequenced as well as plants that have the fossil-supported true phylogenetic trees available. In this study, we generated single gene trees of seven yeast species as well as single gene trees of nine baculovirus species using all the orthologous genes among the species compared. Homologous genes among seven known plants were used for validation of the finding. Four algorithms—maximum parsimony (MP, minimum evolution (ME, maximum likelihood (ML, and neighbor-joining (NJ—were used. Trees were reconstructed before and after weighting the DNA and protein sequence lengths among genes. Rarely a gene can always generate the “true tree” by all the four algorithms. However, the most frequent gene tree, termed “maximum gene-support tree” (MGS tree, or WMGS tree for the weighted one, in yeasts, baculoviruses, or plants was consistently found to be the “true tree” among the species. The results provide insights into the overall degree of divergence of orthologous genes of the genomes analyzed and suggest the following: 1 The true tree relationship among the species studied is still maintained by the largest group of orthologous genes; 2 There are usually more orthologous genes with higher similarities between genetically closer species than between genetically more distant ones; and 3 The maximum gene-support tree reflects the phylogenetic relationship among species in comparison.

  17. The evolution of milk casein genes from tooth genes before the origin of mammals.

    Science.gov (United States)

    Kawasaki, Kazuhiko; Lafont, Anne-Gaelle; Sire, Jean-Yves

    2011-07-01

    Caseins are among cardinal proteins that evolved in the lineage leading to mammals. In milk, caseins and calcium phosphate (CaP) form a huge complex called casein micelle. By forming the micelle, milk maintains high CaP concentrations, which help altricial mammalian neonates to grow bone and teeth. Two types of caseins are known. Ca-sensitive caseins (α(s)- and β-caseins) bind Ca but precipitate at high Ca concentrations, whereas Ca-insensitive casein (κ-casein) does not usually interact with Ca but instead stabilizes the micelle. Thus, it is thought that these two types of caseins are both necessary for stable micelle formation. Both types of caseins show high substitution rates, which make it difficult to elucidate the evolution of caseins. Yet, recent studies have revealed that all casein genes belong to the secretory calcium-binding phosphoprotein (SCPP) gene family that arose by gene duplication. In the present study, we investigated exon-intron structures and phylogenetic distributions of casein and other SCPP genes, particularly the odontogenic ameloblast-associated (ODAM) gene, the SCPP-Pro-Gln-rich 1 (SCPPPQ1) gene, and the follicular dendritic cell secreted peptide (FDCSP) gene. The results suggest that contemporary Ca-sensitive casein genes arose from a putative common ancestor, which we refer to as CSN1/2. The six putative exons comprising CSN1/2 are all found in SCPPPQ1, although ODAM also shares four of these exons. By contrast, the five exons of the Ca-insensitive casein gene are all reminiscent of FDCSP. The phylogenetic distribution of these genes suggests that both SCPPPQ1 and FDCSP arose from ODAM. We thus argue that all casein genes evolved from ODAM via two different pathways; Ca-sensitive casein genes likely originated directly from SCPPPQ1, whereas the Ca-insensitive casein genes directly differentiated from FDCSP. Further, expression of ODAM, SCPPPQ1, and FDCSP was detected in dental tissues, supporting the idea that both types of caseins

  18. A novel noncontiguous duplication in the DMD gene escapes the ...

    Indian Academy of Sciences (India)

    2014-04-16

    Apr 16, 2014 ... 1Instituto de Seguridad y Servicios Sociales de los Trabajadores del ... 2Instituto Nacional de Rehabilitación, Secretaría de Salud, México, C. P. 14389, D.F., México .... (red); deleted probes are Y chromosome control probes.

  19. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  20. Genes and Disease: Prader-Willi Syndrome

    Science.gov (United States)

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... 45K) PDF version of this title (3.8M) Gene sequence Genome view see gene locations Entrez Gene ...

  1. Gene Therapy and Children (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Gene Therapy and Children KidsHealth / For Parents / Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  2. Elusive Origins of the Extra Genes in Aspergillus oryzae

    Science.gov (United States)

    Khaldi, Nora; Wolfe, Kenneth H.

    2008-01-01

    The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939

  3. Elusive origins of the extra genes in Aspergillus oryzae.

    Directory of Open Access Journals (Sweden)

    Nora Khaldi

    Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.

  4. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  5. Mapping of repair genes

    International Nuclear Information System (INIS)

    Hori, Tadaaki

    1985-01-01

    Chromosome mapping of repair genes involved in U.V. sensitivity is reported. Twenty-three of 25 hybrid cells were resistant to U.V. light. Survival curves of 2 U.V.-resistant cell strains, which possessed mouse chromosomes and human chromosome No.7 - 16, were similar to those of wild strain (L5178Y). On the other hand, survival curves of U.V.-sensitive hybrid cells was analogous to those of Q31. There was a definitive difference in the frequency of inducible chromosome aberrations between U.V. resistant and sensitive mouse-human hybrid cells. U.V.-resistant cell strains possessed the ability of excision repair. Analysis of karyotype in hybrid cells showed that the difference in U.V. sensitivity is dependent upon whether or not human chromosome No.13 is present. Synteny test on esterase D-determining locus confirmed that there is an agreement between the presence of chromosome No.13 and the presence of human esterase D activity. These results led to a conclusion that human genes which compensate recessive character of U.V.-sensitive mutant strain, Q31, with mouse-human hybrid cells are located on the locus of chromosome No.13. (Namekawa, K.)

  6. Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-05-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  7. Gene expression in a paleopolyploid: a transcriptome resource for the ciliate Paramecium tetraurelia

    Directory of Open Access Journals (Sweden)

    Kapusta Aurélie

    2010-10-01

    Full Text Available Abstract Background The genome of Paramecium tetraurelia, a unicellular model that belongs to the ciliate phylum, has been shaped by at least 3 successive whole genome duplications (WGD. These dramatic events, which have also been documented in plants, animals and fungi, are resolved over evolutionary time by the loss of one duplicate for the majority of genes. Thanks to a low rate of large scale genome rearrangement in Paramecium, an unprecedented large number of gene duplicates of different ages have been identified, making this organism an outstanding model to investigate the evolutionary consequences of polyploidization. The most recent WGD, with 51% of pre-duplication genes still in 2 copies, provides a snapshot of a phase of rapid gene loss that is not accessible in more ancient polyploids such as yeast. Results We designed a custom oligonucleotide microarray platform for P. tetraurelia genome-wide expression profiling and used the platform to measure gene expression during 1 the sexual cycle of autogamy, 2 growth of new cilia in response to deciliation and 3 biogenesis of secretory granules after massive exocytosis. Genes that are differentially expressed during these time course experiments have expression patterns consistent with a very low rate of subfunctionalization (partition of ancestral functions between duplicated genes in particular since the most recent polyploidization event. Conclusions A public transcriptome resource is now available for Paramecium tetraurelia. The resource has been integrated into the ParameciumDB model organism database, providing searchable access to the data. The microarray platform, freely available through NimbleGen Systems, provides a robust, cost-effective approach for genome-wide expression profiling in P. tetraurelia. The expression data support previous studies showing that at short evolutionary times after a whole genome duplication, gene dosage balance constraints and not functional change are

  8. Evolving chromosomes and gene regulatory networks

    Indian Academy of Sciences (India)

    Aswin

    Genes under H NS control can be. (a) regulated by H NS. (b) regulated by H NS and StpA. Because backup by StpA is partial. Page 19. Gene expression level. H NS regulated xenogenes. Other genes. Page 20 ... recollect: H&NS silences highl transcribable genes. Gene expression level unilateral. Other genes epistatic ...

  9. Bayesian assignment of gene ontology terms to gene expression experiments.

    Science.gov (United States)

    Sykacek, P

    2012-09-15

    Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Source code under GPL license is available from the author. peter.sykacek@boku.ac.at.

  10. Bayesian assignment of gene ontology terms to gene expression experiments

    Science.gov (United States)

    Sykacek, P.

    2012-01-01

    Motivation: Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. Results: This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Availability: Source code under GPL license is available from the author. Contact: peter.sykacek@boku.ac.at PMID:22962488

  11. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  12. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  13. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  14. Generalist genes and learning disabilities.

    Science.gov (United States)

    Plomin, Robert; Kovas, Yulia

    2005-07-01

    The authors reviewed recent quantitative genetic research on learning disabilities that led to the conclusion that genetic diagnoses differ from traditional diagnoses in that the effects of relevant genes are largely general rather than specific. This research suggests that most genes associated with common learning disabilities--language impairment, reading disability, and mathematics disability--are generalists in 3 ways. First, genes that affect common learning disabilities are largely the same genes responsible for normal variation in learning abilities. Second, genes that affect any aspect of a learning disability affect other aspects of the disability. Third, genes that affect one learning disability are also likely to affect other learning disabilities. These quantitative genetic findings have far-reaching implications for molecular genetics and neuroscience as well as psychology. Copyright 2005 APA, all rights reserved.

  15. Divergence and Conservative Evolution of XTNX Genes in Land Plants

    Directory of Open Access Journals (Sweden)

    Yan-Mei Zhang

    2017-10-01

    Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

  16. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  17. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

    Science.gov (United States)

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

    2014-06-01

    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  18. A genetic ensemble approach for gene-gene interaction identification

    Directory of Open Access Journals (Sweden)

    Ho Joshua WK

    2010-10-01

    Full Text Available Abstract Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA and an ensemble of classifiers (called genetic ensemble. Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR and is slightly better than Polymorphism Interaction Analysis (PIA, which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of

  19. Introduction: Cancer Gene Networks.

    Science.gov (United States)

    Clarke, Robert

    2017-01-01

    Constructing, evaluating, and interpreting gene networks generally sits within the broader field of systems biology, which continues to emerge rapidly, particular with respect to its application to understanding the complexity of signaling in the context of cancer biology. For the purposes of this volume, we take a broad definition of systems biology. Considering an organism or disease within an organism as a system, systems biology is the study of the integrated and coordinated interactions of the network(s) of genes, their variants both natural and mutated (e.g., polymorphisms, rearrangements, alternate splicing, mutations), their proteins and isoforms, and the organic and inorganic molecules with which they interact, to execute the biochemical reactions (e.g., as enzymes, substrates, products) that reflect the function of that system. Central to systems biology, and perhaps the only approach that can effectively manage the complexity of such systems, is the building of quantitative multiscale predictive models. The predictions of the models can vary substantially depending on the nature of the model and its inputoutput relationships. For example, a model may predict the outcome of a specific molecular reaction(s), a cellular phenotype (e.g., alive, dead, growth arrest, proliferation, and motility), a change in the respective prevalence of cell or subpopulations, a patient or patient subgroup outcome(s). Such models necessarily require computers. Computational modeling can be thought of as using machine learning and related tools to integrate the very high dimensional data generated from modern, high throughput omics technologies including genomics (next generation sequencing), transcriptomics (gene expression microarrays; RNAseq), metabolomics and proteomics (ultra high performance liquid chromatography, mass spectrometry), and "subomic" technologies to study the kinome, methylome, and others. Mathematical modeling can be thought of as the use of ordinary

  20. Genes, evolution and intelligence.

    Science.gov (United States)

    Bouchard, Thomas J

    2014-11-01

    I argue that the g factor meets the fundamental criteria of a scientific construct more fully than any other conception of intelligence. I briefly discuss the evidence regarding the relationship of brain size to intelligence. A review of a large body of evidence demonstrates that there is a g factor in a wide range of species and that, in the species studied, it relates to brain size and is heritable. These findings suggest that many species have evolved a general-purpose mechanism (a general biological intelligence) for dealing with the environments in which they evolved. In spite of numerous studies with considerable statistical power, we know of very few genes that influence g and the effects are very small. Nevertheless, g appears to be highly polygenic. Given the complexity of the human brain, it is not surprising that that one of its primary faculties-intelligence-is best explained by the near infinitesimal model of quantitative genetics.

  1. Gene therapy for hemophilia

    Science.gov (United States)

    Rogers, Geoffrey L.; Herzog, Roland W.

    2015-01-01

    Hemophilia is an X-linked inherited bleeding disorder consisting of two classifications, hemophilia A and hemophilia B, depending on the underlying mutation. Although the disease is currently treatable with intravenous delivery of replacement recombinant clotting factor, this approach represents a significant cost both monetarily and in terms of quality of life. Gene therapy is an attractive alternative approach to the treatment of hemophilia that would ideally provide life-long correction of clotting activity with a single injection. In this review, we will discuss the multitude of approaches that have been explored for the treatment of both hemophilia A and B, including both in vivo and ex vivo approaches with viral and nonviral delivery vectors. PMID:25553466

  2. Gene therapy and reproductive medicine.

    Science.gov (United States)

    Stribley, John M; Rehman, Khurram S; Niu, Hairong; Christman, Gregory M

    2002-04-01

    To review the literature on the principles of gene therapy and its potential application in reproductive medicine. Literature review. Gene therapy involves transfer of genetic material to target cells using a delivery system, or vector. Attention has primarily focused on viral vectors. Significant problems remain to be overcome including low efficacy of gene transfer, the transient expression of some vectors, safety issues with modified adenoviruses and retroviruses, and ethical concerns. If these issues can be resolved, gene therapy will be applicable to an increasing spectrum of single and multiple gene disorders, as the Human Genome Project data are analyzed, and the genetic component of human disease becomes better understood. Gynecologic gene therapy has advanced to human clinical trials for ovarian carcinoma, and shows potential for the treatment of uterine leiomyomata. Obstetric applications of gene therapy, including fetal gene therapy, remain more distant goals. Concerns about the safety of human gene therapy research are being actively addressed, and remarkable progress in improving DNA transfer has been made. The first treatment success for a genetic disease (severe combined immunodeficiency disease) has been achieved, and ongoing research efforts will eventually yield clinical applications in many spheres of reproductive medicine.

  3. Synthetic sustained gene delivery systems.

    Science.gov (United States)

    Agarwal, Ankit; Mallapragada, Surya K

    2008-01-01

    Gene therapy today is hampered by the need of a safe and efficient gene delivery system that can provide a sustained therapeutic effect without cytotoxicity or unwanted immune responses. Bolus gene delivery in solution results in the loss of delivered factors via lymphatic system and may cause undesired effects by the escape of bioactive molecules to distant sites. Controlled gene delivery systems, acting as localized depot of genes, provide an extended sustained release of genes, giving prolonged maintenance of the therapeutic level of encoded proteins. They also limit the DNA degradation in the nuclease rich extra-cellular environment. While attempts have been made to adapt existing controlled drug delivery technologies, more novel approaches are being investigated for controlled gene delivery. DNA encapsulated in nano/micro spheres of polymers have been administered systemically/orally to be taken up by the targeted tissues and provide sustained release once internalized. Alternatively, DNA entrapped in hydrogels or scaffolds have been injected/implanted in tissues/cavities as platforms for gene delivery. The present review examines these different modalities for sustained delivery of viral and non-viral gene-delivery vectors. Design parameters and release mechanisms of different systems made with synthetic or natural polymers are presented along with their prospective applications and opportunities for continuous development.

  4. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  5. Relationships among msx gene structure and function in zebrafish and other vertebrates.

    Science.gov (United States)

    Ekker, M; Akimenko, M A; Allende, M L; Smith, R; Drouin, G; Langille, R M; Weinberg, E S; Westerfield, M

    1997-10-01

    The zebrafish genome contains at least five msx homeobox genes, msxA, msxB, msxC, msxD, and the newly isolated msxE. Although these genes share structural features common to all Msx genes, phylogenetic analyses of protein sequences indicate that the msx genes from zebrafish are not orthologous to the Msx1 and Msx2 genes of mammals, birds, and amphibians. The zebrafish msxB and msxC are more closely related to each other and to the mouse Msx3. Similarly, although the combinatorial expression of the zebrafish msx genes in the embryonic dorsal neuroectoderm, visceral arches, fins, and sensory organs suggests functional similarities with the Msx genes of other vertebrates, differences in the expression patterns preclude precise assignment of orthological relationships. Distinct duplication events may have given rise to the msx genes of modern fish and other vertebrate lineages whereas many aspects of msx gene functions during embryonic development have been preserved.

  6. Combining phylogenetic and syntenic analyses for understanding the evolution of TCP ECE genes in eudicots.

    Directory of Open Access Journals (Sweden)

    Hélène L Citerne

    Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.

  7. Evaluation of suitable reference genes for gene expression studies ...

    Indian Academy of Sciences (India)

    2011-12-14

    Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...

  8. Are TMEM genes potential candidate genes for panic disorder?

    DEFF Research Database (Denmark)

    NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne

    2014-01-01

    We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...

  9. Classifying genes to the correct Gene Ontology Slim term in Saccharomyces cerevisiae using neighbouring genes with classification learning

    Directory of Open Access Journals (Sweden)

    Tsatsoulis Costas

    2010-05-01

    Full Text Available Abstract Background There is increasing evidence that gene location and surrounding genes influence the functionality of genes in the eukaryotic genome. Knowing the Gene Ontology Slim terms associated with a gene gives us insight into a gene's functionality by informing us how its gene product behaves in a cellular context using three different ontologies: molecular function, biological process, and cellular component. In this study, we analyzed if we could classify a gene in Saccharomyces cerevisiae to its correct Gene Ontology Slim term using information about its location in the genome and information from its nearest-neighbouring genes using classification learning. Results We performed experiments to establish that the MultiBoostAB algorithm using the J48 classifier could correctly classify Gene Ontology Slim terms of a gene given information regarding the gene's location and information from its nearest-neighbouring genes for training. Different neighbourhood sizes were examined to determine how many nearest neighbours should be included around each gene to provide better classification rules. Our results show that by just incorporating neighbour information from each gene's two-nearest neighbours, the percentage of correctly classified genes to their correct Gene Ontology Slim term for each ontology reaches over 80% with high accuracy (reflected in F-measures over 0.80 of the classification rules produced. Conclusions We confirmed that in classifying genes to their correct Gene Ontology Slim term, the inclusion of neighbour information from those genes is beneficial. Knowing the location of a gene and the Gene Ontology Slim information from neighbouring genes gives us insight into that gene's functionality. This benefit is seen by just including information from a gene's two-nearest neighbouring genes.

  10. A scale invariant clustering of genes on human chromosome 7

    Directory of Open Access Journals (Sweden)

    Kendal Wayne S

    2004-01-01

    Full Text Available Abstract Background Vertebrate genes often appear to cluster within the background of nontranscribed genomic DNA. Here an analysis of the physical distribution of gene structures on human chromosome 7 was performed to confirm the presence of clustering, and to elucidate possible underlying statistical and biological mechanisms. Results Clustering of genes was confirmed by virtue of a variance of the number of genes per unit physical length that exceeded the respective mean. Further evidence for clustering came from a power function relationship between the variance and mean that possessed an exponent of 1.51. This power function implied that the spatial distribution of genes on chromosome 7 was scale invariant, and that the underlying statistical distribution had a Poisson-gamma (PG form. A PG distribution for the spatial scattering of genes was validated by stringent comparisons of both the predicted variance to mean power function and its cumulative distribution function to data derived from chromosome 7. Conclusion The PG distribution was consistent with at least two different biological models: In the microrearrangement model, the number of genes per unit length of chromosome represented the contribution of a random number of smaller chromosomal segments that had originated by random breakage and reconstruction of more primitive chromosomes. Each of these smaller segments would have necessarily contained (on average a gamma distributed number of genes. In the gene cluster model, genes would be scattered randomly to begin with. Over evolutionary timescales, tandem duplication, mutation, insertion, deletion and rearrangement could act at these gene sites through a stochastic birth death and immigration process to yield a PG distribution. On the basis of the gene position data alone it was not possible to identify the biological model which best explained the observed clustering. However, the underlying PG statistical model implicated neutral

  11. Dynamic evolution of bitter taste receptor genes in vertebrates

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2009-01-01

    Full Text Available Abstract Background Sensing bitter tastes is crucial for many animals because it can prevent them from ingesting harmful foods. This process is mainly mediated by the bitter taste receptors (T2R, which are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires, and marked variation in repertoire size has been noted among species. However, the mechanisms underlying the evolution of vertebrate T2R genes remain poorly understood. Results To better understand the evolutionary pattern of these genes, we identified 16 T2R gene repertoires based on the high coverage genome sequences of vertebrates and studied the evolutionary changes in the number of T2R genes during birth-and-death evolution using the reconciled-tree method. We found that the number of T2R genes and the fraction of pseudogenes vary extensively among species. Based on the results of phylogenetic analysis, we showed that T2R gene families in teleost fishes are more diverse than those in tetrapods. In addition to the independent gene expansions in teleost fishes, frogs and mammals, lineage-specific gene duplications were also detected in lizards. Furthermore, extensive gains and losses of T2R genes were detected in each lineage during their evolution, resulting in widely differing T2R gene repertoires. Conclusion These results further support the hypotheses that T2R gene repertoires are closely related to the dietary habits of different species and that birth-and-death evolution is associated with adaptations to dietary changes.

  12. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  13. Sugar Lego: gene composition of bacterial carbohydrate metabolism genomic loci.

    Science.gov (United States)

    Kaznadzey, Anna; Shelyakin, Pavel; Gelfand, Mikhail S

    2017-11-25

    Bacterial carbohydrate metabolism is extremely diverse, since carbohydrates serve as a major energy source and are involved in a variety of cellular processes. Bacterial genes belonging to same metabolic pathway are often co-localized in the chromosome, but it is not a strict rule. Gene co-localization in linked to co-evolution and co-regulation. This study focuses on a large-scale analysis of bacterial genomic loci related to the carbohydrate metabolism. We demonstrate that only 53% of 148,000 studied genes from over six hundred bacterial genomes are co-localized in bacterial genomes with other carbohydrate metabolism genes, which points to a significant role of singleton genes. Co-localized genes form cassettes, ranging in size from two to fifteen genes. Two major factors influencing the cassette-forming tendency are gene function and bacterial phylogeny. We have obtained a comprehensive picture of co-localization preferences of genes for nineteen major carbohydrate metabolism functional classes, over two hundred gene orthologous clusters, and thirty bacterial classes, and characterized the cassette variety in size and content among different species, highlighting a significant role of short cassettes. The preference towards co-localization of carbohydrate metabolism genes varies between 40 and 76% for bacterial taxa. Analysis of frequently co-localized genes yielded forty-five significant pairwise links between genes belonging to different functional classes. The number of such links per class range from zero to eight, demonstrating varying preferences of respective genes towards a specific chromosomal neighborhood. Genes from eleven functional classes tend to co-localize with genes from the same class, indicating an important role of clustering of genes with similar functions. At that, in most cases such co-localization does not originate from local duplication events. Overall, we describe a complex web formed by evolutionary relationships of bacterial

  14. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  15. Gene doping: possibilities and practicalities.

    Science.gov (United States)

    Wells, Dominic J

    2009-01-01

    Our ever-increasing understanding of the genetic control of cardiovascular and musculoskeletal function together with recent technical improvements in genetic manipulation generates mounting concern over the possibility of such technology being abused by athletes in their quest for improved performance. Genetic manipulation in the context of athletic performance is commonly referred to as gene doping. A review of the literature was performed to identify the genes and methodologies most likely to be used for gene doping and the technologies that might be used to identify such doping. A large number of candidate performance-enhancing genes have been identified from animal studies, many of them using transgenic mice. Only a limited number have been shown to be effective following gene transfer into adults. Those that seem most likely to be abused are genes that exert their effects locally and leave little, if any, trace in blood or urine. There is currently no evidence that gene doping has yet been undertaken in competitive athletes but the anti-doping authorities will need to remain vigilant in reviewing this rapidly emerging technology. The detection of gene doping involves some different challenges from other agents and a number of promising approaches are currently being explored. 2009 S. Karger AG, Basel

  16. Determining Semantically Related Significant Genes.

    Science.gov (United States)

    Taha, Kamal

    2014-01-01

    GO relation embodies some aspects of existence dependency. If GO term xis existence-dependent on GO term y, the presence of y implies the presence of x. Therefore, the genes annotated with the function of the GO term y are usually functionally and semantically related to the genes annotated with the function of the GO term x. A large number of gene set enrichment analysis methods have been developed in recent years for analyzing gene sets enrichment. However, most of these methods overlook the structural dependencies between GO terms in GO graph by not considering the concept of existence dependency. We propose in this paper a biological search engine called RSGSearch that identifies enriched sets of genes annotated with different functions using the concept of existence dependency. We observe that GO term xcannot be existence-dependent on GO term y, if x- and y- have the same specificity (biological characteristics). After encoding into a numeric format the contributions of GO terms annotating target genes to the semantics of their lowest common ancestors (LCAs), RSGSearch uses microarray experiment to identify the most significant LCA that annotates the result genes. We evaluated RSGSearch experimentally and compared it with five gene set enrichment systems. Results showed marked improvement.

  17. Gene set analysis for GWAS

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Soerensen, Mette

    2014-01-01

    Abstract We discuss the use of modified Kolmogorov-Smirnov (KS) statistics in the context of gene set analysis and review corresponding null and alternative hypotheses. Especially, we show that, when enhancing the impact of highly significant genes in the calculation of the test statistic, the co...

  18. On meme--gene coevolution.

    Science.gov (United States)

    Bull, L; Holland, O; Blackmore, S

    2000-01-01

    In this article we examine the effects of the emergence of a new replicator, memes, on the evolution of a pre-existing replicator, genes. Using a version of the NKCS model we examine the effects of increasing the rate of meme evolution in relation to the rate of gene evolution, for various degrees of interdependence between the two replicators. That is, the effects of memes' (suggested) more rapid rate of evolution in comparison to that of genes is investigated using a tunable model of coevolution. It is found that, for almost any degree of interdependence between the two replicators, as the rate of meme evolution increases, a phase transition-like dynamic occurs under which memes have a significantly detrimental effect on the evolution of genes, quickly resulting in the cessation of effective gene evolution. Conversely, the memes experience a sharp increase in benefit from increasing their rate of evolution. We then examine the effects of enabling genes to reduce the percentage of gene-detrimental evolutionary steps taken by memes. Here a critical region emerges as the comparative rate of meme evolution increases, such that if genes cannot effectively select memes a high percentage of the time, they suffer from meme evolution as if they had almost no selective capability.

  19. Susceptibility Genes in Thyroid Autoimmunity

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ban

    2005-01-01

    Full Text Available The autoimmune thyroid diseases (AITD are complex diseases which are caused by an interaction between susceptibility genes and environmental triggers. Genetic susceptibility in combination with external factors (e.g. dietary iodine is believed to initiate the autoimmune response to thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITD. Various techniques have been employed to identify the genes contributing to the etiology of AITD, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions that are linked with AITD, and in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to Graves' disease (GD and Hashimoto's thyroiditis (HT and some are common to both the diseases, indicating that there is a shared genetic susceptibility to GD and HT. The putative GD and HT susceptibility genes include both immune modifying genes (e.g. HLA, CTLA-4 and thyroid specific genes (e.g. TSHR, Tg. Most likely, these loci interact and their interactions may influence disease phenotype and severity.

  20. Gene polymorphisms in chronic periodontitis

    NARCIS (Netherlands)

    Laine, M.L.; Loos, B.G.; Crielaard, W.

    2010-01-01

    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or

  1. Identification of the gene for Nance-Horan syndrome (NHS).

    Science.gov (United States)

    Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J

    2004-10-01

    The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.

  2. Origins of De Novo Genes in Human and Chimpanzee.

    Science.gov (United States)

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar

    2015-12-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.

  3. Signal Network Analysis of Plant Genes Responding to Ionizing Radiation

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon

    2012-12-01

    In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication

  4. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  5. Imaging after vascular gene therapy

    International Nuclear Information System (INIS)

    Manninen, Hannu I.; Yang, Xiaoming

    2005-01-01

    Targets for cardiovascular gene therapy currently include limiting restenosis after balloon angioplasty and stent placement, inhibiting vein bypass graft intimal hyperplasia/stenosis, therapeutic angiogenesis for cardiac and lower-limb ischemia, and prevention of thrombus formation. While catheter angiography is still standard method to follow-up vascular gene transfer, other modern imaging techniques, especially intravascular ultrasound (IVUS), magnetic resonance (MR), and positron emission tomography (PET) imaging provide complementary information about the therapeutic effect of vascular gene transfer in humans. Although molecular imaging of therapeutic gene expression in the vasculatures is still in its technical development phase, it has already offered basic medical science an extremely useful in vivo evaluation tool for non- or minimally invasive imaging of vascular gene therapy

  6. Function analysis of unknown genes

    DEFF Research Database (Denmark)

    Rogowska-Wrzesinska, A.

    2002-01-01

      This thesis entitled "Function analysis of unknown genes" presents the use of proteome analysis for the characterisation of yeast (Saccharomyces cerevisiae) genes and their products (proteins especially those of unknown function). This study illustrates that proteome analysis can be used...... to describe different aspects of molecular biology of the cell, to study changes that occur in the cell due to overexpression or deletion of a gene and to identify various protein modifications. The biological questions and the results of the described studies show the diversity of the information that can...... genes and proteins. It reports the first global proteome database collecting 36 yeast single gene deletion mutants and selecting over 650 differences between analysed mutants and the wild type strain. The obtained results show that two-dimensional gel electrophoresis and mass spectrometry based proteome...

  7. Atypical haemolytic uraemic syndrome associated with a hybrid complement gene.

    Directory of Open Access Journals (Sweden)

    Julian P Venables

    2006-10-01

    Full Text Available BACKGROUND: Sequence analysis of the regulators of complement activation (RCA cluster of genes at chromosome position 1q32 shows evidence of several large genomic duplications. These duplications have resulted in a high degree of sequence identity between the gene for factor H (CFH and the genes for the five factor H-related proteins (CFHL1-5; aliases CFHR1-5. CFH mutations have been described in association with atypical haemolytic uraemic syndrome (aHUS. The majority of the mutations are missense changes that cluster in the C-terminal region and impair the ability of factor H to regulate surface-bound C3b. Some have arisen as a result of gene conversion between CFH and CFHL1. In this study we tested the hypothesis that nonallelic homologous recombination between low-copy repeats in the RCA cluster could result in the formation of a hybrid CFH/CFHL1 gene that predisposes to the development of aHUS. METHODS AND FINDINGS: In a family with many cases of aHUS that segregate with the RCA cluster we used cDNA analysis, gene sequencing, and Southern blotting to show that affected individuals carry a heterozygous CFH/CFHL1 hybrid gene in which exons 1-21 are derived from CFH and exons 22/23 from CFHL1. This hybrid encodes a protein product identical to a functionally significant CFH mutant (c.3572C>T, S1191L and c.3590T>C, V1197A that has been previously described in association with aHUS. CONCLUSIONS: CFH mutation screening is recommended in all aHUS patients prior to renal transplantation because of the high risk of disease recurrence post-transplant in those known to have a CFH mutation. Because of our finding it will be necessary to implement additional screening strategies that will detect a hybrid CFH/CFHL1 gene.

  8. Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2013-12-01

    Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

  9. The evolution of Dscam genes across the arthropods.

    Science.gov (United States)

    Armitage, Sophie A O; Freiburg, Rebecca Y; Kurtz, Joachim; Bravo, Ignacio G

    2012-04-13

    One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv), which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuron