Directory of Open Access Journals (Sweden)
Marion Ouedraogo
Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.
Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet
2016-02-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.
Duplicability of self-interacting human genes.
LENUS (Irish Health Repository)
Pérez-Bercoff, Asa
2010-01-01
BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN
Li, Zhen; Van de Peer, Yves; De Smet, Riet
2016-01-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215
Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Cheng Zou
2009-07-01
Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.
The odds of duplicate gene persistence after polyploidization
Directory of Open Access Journals (Sweden)
Chain Frédéric JJ
2011-12-01
Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.
Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S
2012-08-19
Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.
Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion
Directory of Open Access Journals (Sweden)
Jeffrey A. Fawcett
2011-02-01
Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.
A role for gene duplication and natural variation of gene expression in the evolution of metabolism.
Directory of Open Access Journals (Sweden)
Daniel J Kliebenstein
Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization
Directory of Open Access Journals (Sweden)
Xi-Yin Wang
2011-01-01
Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.
Functional requirements driving the gene duplication in 12 Drosophila species.
Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui
2013-08-15
Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Effect of Duplicate Genes on Mouse Genetic Robustness: An Update
Directory of Open Access Journals (Sweden)
Zhixi Su
2014-01-01
Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.
Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi
2013-01-01
The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833
Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.
Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M
2017-08-01
Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene
Directory of Open Access Journals (Sweden)
Shomron Noam
2007-11-01
Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-03-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.
Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.
Gout, Jean-Francois; Lynch, Michael
2015-08-01
Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Directory of Open Access Journals (Sweden)
Matthew A Carrigan
Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates
FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT
Directory of Open Access Journals (Sweden)
Khlestkina E.
2012-08-01
Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.
Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.
Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu
2016-09-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.
Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc
2017-11-01
The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster
Directory of Open Access Journals (Sweden)
Jakobek Judy L
2007-07-01
Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Recombination facilitates neofunctionalization of duplicate genes via originalization
Directory of Open Access Journals (Sweden)
Huang Ren
2010-06-01
Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.
Comparative inference of duplicated genes produced by polyploidization in soybean genome.
Yang, Yanmei; Wang, Jinpeng; Di, Jianyong
2013-01-01
Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.
Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.
Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C
2010-02-01
The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.
Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes
Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.
2011-01-01
vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289
Exon duplications in the ATP7A gene
DEFF Research Database (Denmark)
Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko
2011-01-01
the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...
Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu
2016-01-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883
Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish
DEFF Research Database (Denmark)
Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang
2008-01-01
Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...
Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.
Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L
2015-12-01
Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.
Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.
Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J
2016-11-04
Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types
Evolution dynamics of a model for gene duplication under adaptive conflict
Ancliff, Mark; Park, Jeong-Man
2014-06-01
We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.
Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants
Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong
2010-01-01
Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...
Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina
2017-05-01
Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D
2016-09-02
Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Denovan-Wright Eileen M
2009-09-01
Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases
Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu
2011-12-20
The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-01-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Polytomy refinement for the correction of dubious duplications in gene trees.
Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia
2014-09-01
Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Huang Yong
2009-11-01
Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on
Kursel, Lisa E; Malik, Harmit S
2017-06-01
Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.
Directory of Open Access Journals (Sweden)
Hiroyasu Kamei
2008-08-01
Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.
A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR
Energy Technology Data Exchange (ETDEWEB)
Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others
1996-07-01
Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.
International Nuclear Information System (INIS)
Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded
2011-01-01
During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently
On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-01-01
Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.
Directory of Open Access Journals (Sweden)
Brenner Sydney
2008-06-01
Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate
Directory of Open Access Journals (Sweden)
Michael H. Kohn
2008-01-01
Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.
Ascorbate peroxidase-related (APx-R) is not a duplicable gene.
Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia
2011-12-01
Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience
A salmonid EST genomic study: genes, duplications, phylogeny and microarrays
Directory of Open Access Journals (Sweden)
Brahmbhatt Sonal
2008-11-01
Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is
Directory of Open Access Journals (Sweden)
Bergthorsson Ulfar
2011-09-01
Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1
Directory of Open Access Journals (Sweden)
Cho Hyuk
2010-12-01
Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene
Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-06-01
Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.
Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.
Directory of Open Access Journals (Sweden)
Nemanja Vukašinović
Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.
Directory of Open Access Journals (Sweden)
Xiao-Long Wang
2015-01-01
Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.
Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C
2008-02-12
The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.
On Computing Breakpoint Distances for Genomes with Duplicate Genes.
Shao, Mingfu; Moret, Bernard M E
2017-06-01
A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.
Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins
Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.
2014-01-01
Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342
Directory of Open Access Journals (Sweden)
Per Erixon
Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the
Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.
2017-01-01
The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane
Directory of Open Access Journals (Sweden)
Tommy Harding
2017-05-01
Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like
Gene duplication as a major force in evolution
Indian Academy of Sciences (India)
Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...
Duplication and relocation of the functional DPY19L2 gene within low copy repeats
Directory of Open Access Journals (Sweden)
Cheung Joseph
2006-03-01
Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.
Differential retention of metabolic genes following whole-genome duplication.
Gout, Jean-François; Duret, Laurent; Kahn, Daniel
2009-05-01
Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.
Gene duplications in prokaryotes can be associated with environmental adaptation.
Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn
2010-10-20
Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate
Signals of historical interlocus gene conversion in human segmental duplications.
Directory of Open Access Journals (Sweden)
Beth L Dumont
Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.
Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan
2003-08-01
It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.
Gu, Xun; Wang, Yufeng; Gu, Jianying
2002-06-01
The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.
Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G
2014-01-01
Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Directory of Open Access Journals (Sweden)
Jill C Preston
Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
STRIDE: Species Tree Root Inference from Gene Duplication Events.
Emms, David M; Kelly, Steven
2017-12-01
The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V
2016-01-01
Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Directory of Open Access Journals (Sweden)
Olga V Popova
Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even
Gene duplications in prokaryotes can be associated with environmental adaptation
Directory of Open Access Journals (Sweden)
Lempicki Richard A
2010-10-01
Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive
Directory of Open Access Journals (Sweden)
Görel Sundström
Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.
Dong, Shaowei; Adams, Keith L
2011-06-01
Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Luís Filipe Costa Castro
Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the
Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A
2015-06-08
The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo
2012-01-01
Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.
Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J
2011-03-01
In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining
Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris
2018-01-22
Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Simulating evolution of protein complexes through gene duplication and co-option.
Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter
2016-06-21
We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.
Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry
2011-10-15
The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.
Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas
2014-07-01
Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.
Directory of Open Access Journals (Sweden)
Taro Tsujimura
2010-12-01
Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.
Directory of Open Access Journals (Sweden)
Ge Song
2010-04-01
Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub
Directory of Open Access Journals (Sweden)
Venkatachalam Ananda B
2012-07-01
Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures
Directory of Open Access Journals (Sweden)
Kesterson Robert A
2003-04-01
Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.
Directory of Open Access Journals (Sweden)
Tong Jingou
2006-11-01
Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.
Gene duplication and fragmentation in the zebra finch major histocompatibility complex.
Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V
2010-04-01
Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the
Gene duplication and fragmentation in the zebra finch major histocompatibility complex
Directory of Open Access Journals (Sweden)
Burt David W
2010-04-01
Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving
Directory of Open Access Journals (Sweden)
Praveen Baskaran
Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2007-05-01
Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.
Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M
2015-03-15
Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.
Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R
2007-01-01
The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat
Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M
2016-12-13
Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion
Directory of Open Access Journals (Sweden)
Shao Mingfu
2012-12-01
Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.
Directory of Open Access Journals (Sweden)
Shuming Zou
Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.
Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien
2017-05-02
Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.
Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P
2016-05-01
In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.
Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard
2017-03-06
Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.
International Nuclear Information System (INIS)
Essouissi, Imen
2006-01-01
Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)
Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.
2016-01-01
The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025
Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin
2010-07-27
The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.
A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast
DEFF Research Database (Denmark)
Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.
2007-01-01
and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...
Energy Technology Data Exchange (ETDEWEB)
Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL
2009-01-01
Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.
Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi
2015-01-01
Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810
Directory of Open Access Journals (Sweden)
Koch Marcus A
2009-04-01
Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection
Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi
2015-02-15
WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
Chen, Y; Solursh, M
1995-10-01
The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.
Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R
2010-12-01
Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.
Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.
Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe
2015-11-01
A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification
Directory of Open Access Journals (Sweden)
Mara Sangiovanni
2013-12-01
Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.
Directory of Open Access Journals (Sweden)
Xiaoli Jin
2017-06-01
Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.
Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane
2015-07-01
The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.
2012-01-01
Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene
Directory of Open Access Journals (Sweden)
Kane L Greer
2014-01-01
Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.
Holland, Peter W H
2013-01-01
Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.
North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.
Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P
2016-01-01
To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher
2014-05-01
Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Directory of Open Access Journals (Sweden)
V.L. Quadros
2006-07-01
Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.
DEFF Research Database (Denmark)
Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne
2012-01-01
with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...
Are duplicated genes responsible for anthracnose resistance in common bean?
Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida
2017-01-01
The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.
Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila
2014-05-01
Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.
Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene
Directory of Open Access Journals (Sweden)
J. Uberos
2012-01-01
Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.
Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya
2014-01-01
Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.
Directory of Open Access Journals (Sweden)
Jenny U Johansson
2008-11-01
Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.
Tandemly Arrayed Genes in Vertebrate Genomes
Directory of Open Access Journals (Sweden)
Deng Pan
2008-01-01
Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.
Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène
2015-10-05
Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.
Directory of Open Access Journals (Sweden)
Capra Valeria
2012-10-01
Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.
Biedler, James K; Tu, Zhijian
2010-07-08
codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.
Directory of Open Access Journals (Sweden)
Tu Zhijian
2010-07-01
1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.
Evolution of trappin genes in mammals
Directory of Open Access Journals (Sweden)
Furutani Yutaka
2010-01-01
Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.
Refining discordant gene trees.
Górecki, Pawel; Eulenstein, Oliver
2014-01-01
Evolutionary studies are complicated by discordance between gene trees and the species tree in which they evolved. Dealing with discordant trees often relies on comparison costs between gene and species trees, including the well-established Robinson-Foulds, gene duplication, and deep coalescence costs. While these costs have provided credible results for binary rooted gene trees, corresponding cost definitions for non-binary unrooted gene trees, which are frequently occurring in practice, are challenged by biological realism. We propose a natural extension of the well-established costs for comparing unrooted and non-binary gene trees with rooted binary species trees using a binary refinement model. For the duplication cost we describe an efficient algorithm that is based on a linear time reduction and also computes an optimal rooted binary refinement of the given gene tree. Finally, we show that similar reductions lead to solutions for computing the deep coalescence and the Robinson-Foulds costs. Our binary refinement of Robinson-Foulds, gene duplication, and deep coalescence costs for unrooted and non-binary gene trees together with the linear time reductions provided here for computing these costs significantly extends the range of trees that can be incorporated into approaches dealing with discordance.
RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.
Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya
2018-04-24
RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.
A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome
Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de
2012-01-01
De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Directory of Open Access Journals (Sweden)
Yue-zhong Li
2017-04-01
Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.
Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile
2011-07-01
Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the
Directory of Open Access Journals (Sweden)
Philippe Ganot
2011-07-01
Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both
Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.
Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine
2017-04-01
Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
G-NEST: a gene neighborhood scoring tool to identify co-conserved, co-expressed genes
Directory of Open Access Journals (Sweden)
Lemay Danielle G
2012-09-01
Full Text Available Abstract Background In previous studies, gene neighborhoods—spatial clusters of co-expressed genes in the genome—have been defined using arbitrary rules such as requiring adjacency, a minimum number of genes, a fixed window size, or a minimum expression level. In the current study, we developed a Gene Neighborhood Scoring Tool (G-NEST which combines genomic location, gene expression, and evolutionary sequence conservation data to score putative gene neighborhoods across all possible window sizes simultaneously. Results Using G-NEST on atlases of mouse and human tissue expression data, we found that large neighborhoods of ten or more genes are extremely rare in mammalian genomes. When they do occur, neighborhoods are typically composed of families of related genes. Both the highest scoring and the largest neighborhoods in mammalian genomes are formed by tandem gene duplication. Mammalian gene neighborhoods contain highly and variably expressed genes. Co-localized noisy gene pairs exhibit lower evolutionary conservation of their adjacent genome locations, suggesting that their shared transcriptional background may be disadvantageous. Genes that are essential to mammalian survival and reproduction are less likely to occur in neighborhoods, although neighborhoods are enriched with genes that function in mitosis. We also found that gene orientation and protein-protein interactions are partially responsible for maintenance of gene neighborhoods. Conclusions Our experiments using G-NEST confirm that tandem gene duplication is the primary driver of non-random gene order in mammalian genomes. Non-essentiality, co-functionality, gene orientation, and protein-protein interactions are additional forces that maintain gene neighborhoods, especially those formed by tandem duplicates. We expect G-NEST to be useful for other applications such as the identification of core regulatory modules, common transcriptional backgrounds, and chromatin domains. The
Paralogous Genes as a Tool to Study the Regulation of Gene Expression
DEFF Research Database (Denmark)
Hoffmann, Robert D
The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...
Directory of Open Access Journals (Sweden)
Erin S Kelleher
2007-08-01
Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.
Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J
2014-01-01
The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331
Directory of Open Access Journals (Sweden)
Jessica B Hostetler
2016-10-01
Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.
Czech Academy of Sciences Publication Activity Database
Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman
2014-01-01
Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke
2016-01-01
Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under
Gene Dosage Analysis in a Clinical Environment: Gene-Targeted Microarrays as the Platform-of-Choice
Directory of Open Access Journals (Sweden)
Donald R. Love
2013-03-01
Full Text Available The role of gene deletion and duplication in the aetiology of disease has become increasingly evident over the last decade. In addition to the classical deletion/duplication disorders diagnosed using molecular techniques, such as Duchenne Muscular Dystrophy and Charcot-Marie-Tooth Neuropathy Type 1A, the significance of partial or whole gene deletions in the pathogenesis of a large number single-gene disorders is becoming more apparent. A variety of dosage analysis methods are available to the diagnostic laboratory but the widespread application of many of these techniques is limited by the expense of the kits/reagents and restrictive targeting to a particular gene or portion of a gene. These limitations are particularly important in the context of a small diagnostic laboratory with modest sample throughput. We have developed a gene-targeted, custom-designed comparative genomic hybridisation (CGH array that allows twelve clinical samples to be interrogated simultaneously for exonic deletions/duplications within any gene (or panel of genes on the array. We report here on the use of the array in the analysis of a series of clinical samples processed by our laboratory over a twelve-month period. The array has proven itself to be robust, flexible and highly suited to the diagnostic environment.
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Directory of Open Access Journals (Sweden)
Jianfeng Zhou
growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.
Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman
2016-07-02
Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.
Annelid Distal-less/Dlx duplications reveal varied post-duplication fates
Directory of Open Access Journals (Sweden)
Korchagina Natalia
2011-08-01
Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.
Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders
Energy Technology Data Exchange (ETDEWEB)
Mueller, Rachel Lockridge; Boore, Jeffrey L.
2005-06-01
Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.
Duplication of the dystroglycan gene in most branches of teleost fish
Directory of Open Access Journals (Sweden)
Giardina Bruno
2007-05-01
Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details
Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans
International Nuclear Information System (INIS)
Majerfeld, I.H.; Roper, J.A.
1978-01-01
Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers
Gene conversion in the rice genome
DEFF Research Database (Denmark)
Xu, Shuqing; Clark, Terry; Zheng, Hongkun
2008-01-01
-chromosomal conversions distributed between chromosome 1 and 5, 2 and 6, and 3 and 5 are more frequent than genome average (Z-test, P ... is not tightly linked to natural selection in the rice genome. To assess the contribution of segmental duplication on gene conversion statistics, we determined locations of conversion partners with respect to inter-chromosomal segment duplication. The number of conversions associated with segmentation is less...... involved in conversion events. CONCLUSION: The evolution of gene families in the rice genome may have been accelerated by conversion with pseudogenes. Our analysis suggests a possible role for gene conversion in the evolution of pathogen-response genes....
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Karn, Robert C; Laukaitis, Christina M
2014-08-01
In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-Wide Identification and Evolution of HECT Genes in Soybean
Directory of Open Access Journals (Sweden)
Xianwen Meng
2015-04-01
Full Text Available Proteins containing domains homologous to the E6-associated protein (E6-AP carboxyl terminus (HECT are an important class of E3 ubiquitin ligases involved in the ubiquitin proteasome pathway. HECT-type E3s play crucial roles in plant growth and development. However, current understanding of plant HECT genes and their evolution is very limited. In this study, we performed a genome-wide analysis of the HECT domain-containing genes in soybean. Using high-quality genome sequences, we identified 19 soybean HECT genes. The predicted HECT genes were distributed unevenly across 15 of 20 chromosomes. Nineteen of these genes were inferred to be segmentally duplicated gene pairs, suggesting that in soybean, segmental duplications have made a significant contribution to the expansion of the HECT gene family. Phylogenetic analysis showed that these HECT genes can be divided into seven groups, among which gene structure and domain architecture was relatively well-conserved. The Ka/Ks ratios show that after the duplication events, duplicated HECT genes underwent purifying selection. Moreover, expression analysis reveals that 15 of the HECT genes in soybean are differentially expressed in 14 tissues, and are often highly expressed in the flowers and roots. In summary, this work provides useful information on which further functional studies of soybean HECT genes can be based.
XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.
Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David
2012-07-01
Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.
Sorting by Cuts, Joins, and Whole Chromosome Duplications.
Zeira, Ron; Shamir, Ron
2017-02-01
Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.
Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M
2013-08-01
An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.
beta. -Amyloid gene dosage in Alzheimer's disease
Energy Technology Data Exchange (ETDEWEB)
Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E
1988-01-11
The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.
Directory of Open Access Journals (Sweden)
Giao Ngoc Nguyen
2017-08-01
Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.
Directory of Open Access Journals (Sweden)
Jean-François Gout
2010-05-01
Full Text Available The understanding of selective constraints affecting genes is a major issue in biology. It is well established that gene expression level is a major determinant of the rate of protein evolution, but the reasons for this relationship remain highly debated. Here we demonstrate that gene expression is also a major determinant of the evolution of gene dosage: the rate of gene losses after whole genome duplications in the Paramecium lineage is negatively correlated to the level of gene expression, and this relationship is not a byproduct of other factors known to affect the fate of gene duplicates. This indicates that changes in gene dosage are generally more deleterious for highly expressed genes. This rule also holds for other taxa: in yeast, we find a clear relationship between gene expression level and the fitness impact of reduction in gene dosage. To explain these observations, we propose a model based on the fact that the optimal expression level of a gene corresponds to a trade-off between the benefit and cost of its expression. This COSTEX model predicts that selective pressure against mutations changing gene expression level or affecting the encoded protein should on average be stronger in highly expressed genes and hence that both the frequency of gene loss and the rate of protein evolution should correlate negatively with gene expression. Thus, the COSTEX model provides a simple and common explanation for the general relationship observed between the level of gene expression and the different facets of gene evolution.
Toxin gene determination and evolution in scorpaenoid fish.
Chuang, Po-Shun; Shiao, Jen-Chieh
2014-09-01
In this study, we determine the toxin genes from both cDNA and genomic DNA of four scorpaenoid fish and reconstruct their evolutionary relationship. The deduced protein sequences of the two toxin subunits in Sebastapistes strongia, Scorpaenopsis oxycephala, and Sebastiscus marmoratus are about 700 amino acid, similar to the sizes of the stonefish (Synanceia horrida, and Synanceia verrucosa) and lionfish (Pterois antennata and Pterois volitans) toxins previously published. The intron positions are highly conserved among these species, which indicate the applicability of gene finding by using genomic DNA template. The phylogenetic analysis shows that the two toxin subunits were duplicated prior to the speciation of Scorpaenoidei. The precedence of the gene duplication over speciation indicates that the toxin genes may be common to the whole family of Scorpaeniform. Furthermore, one additional toxin gene has been determined in the genomic DNA of Dendrochirus zebra. The phylogenetic analysis suggests that an additional gene duplication occurred before the speciation of the lionfish (Pteroinae) and a pseudogene may be generally present in the lineage of lionfish. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bertram Brenig
Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.
Co-evolution of secondary metabolite gene clusters and their host
DEFF Research Database (Denmark)
Kjærbølling, Inge; Vesth, Tammi Camilla; Frisvad, Jens Christian
Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of speci....... We investigate the dynamic evolutionary relationship between the cluster and the host by examining the genes within the cluster and the number of homologous genes found within the host and in closely related species.......Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of species...
Directory of Open Access Journals (Sweden)
Alireza Eshaghi
Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.
Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.
1997-01-01
We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published
Hrytsenko, Olga; Pohajdak, Bill; Wright, James R
2016-07-03
Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Finding all sorting tandem duplication random loss operations
DEFF Research Database (Denmark)
Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang
2011-01-01
A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...
Genome-wide identification and evolution of the PIN-FORMED (PIN) gene family in Glycine max.
Liu, Yuan; Wei, Haichao
2017-07-01
Soybean (Glycine max) is one of the most important crop plants. Wild and cultivated soybean varieties have significant differences worth further investigation, such as plant morphology, seed size, and seed coat development; these characters may be related to auxin biology. The PIN gene family encodes essential transport proteins in cell-to-cell auxin transport, but little research on soybean PIN genes (GmPIN genes) has been done, especially with respect to the evolution and differences between wild and cultivated soybean. In this study, we retrieved 23 GmPIN genes from the latest updated G. max genome database; six GmPIN protein sequences were changed compared with the previous database. Based on the Plant Genome Duplication Database, 18 GmPIN genes have been involved in segment duplication. Three pairs of GmPIN genes arose after the second soybean genome duplication, and six occurred after the first genome duplication. The duplicated GmPIN genes retained similar expression patterns. All the duplicated GmPIN genes experienced purifying selection (K a /K s genome sequence of 17 wild and 14 cultivated soybean varieties. Our research provides useful and comprehensive basic information for understanding GmPIN genes.
Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael
2008-09-23
initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.
Directory of Open Access Journals (Sweden)
Petit Jean-Michel
2008-09-01
activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.
Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J
2010-10-15
Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.
Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai
2018-04-01
Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.
Two Rounds of Whole Genome Duplication in the AncestralVertebrate
Energy Technology Data Exchange (ETDEWEB)
Dehal, Paramvir; Boore, Jeffrey L.
2005-04-12
The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.
JGI Plant Genomics Gene Annotation Pipeline
Energy Technology Data Exchange (ETDEWEB)
Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese
2014-07-14
Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.
Evolution of the vertebrate Pax4/6 class of genes with focus on its novel member, the Pax10 gene.
Feiner, Nathalie; Meyer, Axel; Kuraku, Shigehiro
2014-06-19
The members of the paired box (Pax) family regulate key developmental pathways in many metazoans as tissue-specific transcription factors. Vertebrate genomes typically possess nine Pax genes (Pax1-9), which are derived from four proto-Pax genes in the vertebrate ancestor that were later expanded through the so-called two-round (2R) whole-genome duplication. A recent study proposed that pax6a genes of a subset of teleost fishes (namely, acanthopterygians) are remnants of a paralog generated in the 2R genome duplication, to be renamed pax6.3, and reported one more group of vertebrate Pax genes (Pax6.2), most closely related to the Pax4/6 class. We propose to designate this new member Pax10 instead and reconstruct the evolutionary history of the Pax4/6/10 class with solid phylogenetic evidence. Our synteny analysis showed that Pax4, -6, and -10 originated in the 2R genome duplications early in vertebrate evolution. The phylogenetic analyses of relationships between teleost pax6a and other Pax4, -6, and -10 genes, however, do not support the proposed hypothesis of an ancient origin of the acanthopterygian pax6a genes in the 2R genome duplication. Instead, we confirmed the traditional scenario that the acanthopterygian pax6a is derived from the more recent teleost-specific genome duplication. Notably, Pax6 is present in all vertebrates surveyed to date, whereas Pax4 and -10 were lost multiple times in independent vertebrate lineages, likely because of their restricted expression patterns: Among Pax6-positive domains, Pax10 has retained expression in the adult retina alone, which we documented through in situ hybridization and quantitative reverse transcription polymerase chain reaction experiments on zebrafish, Xenopus, and anole lizard. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun
2015-01-01
Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Feng-Xia Tian
Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali
2010-07-01
Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
International Nuclear Information System (INIS)
Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.
2006-01-01
The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation
Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.
Directory of Open Access Journals (Sweden)
Todd J Treangen
2011-01-01
Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.
Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.
LENUS (Irish Health Repository)
Vacic, Vladimir
2011-03-24
Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.
Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan
2016-12-12
Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.
Pophaly, Saurabh D; Tellier, Aurélien
2015-12-01
The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine
2014-01-01
Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Directory of Open Access Journals (Sweden)
Florian Jabbour
Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales
Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy
2013-01-01
Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes
Chromosomal organization of adrenergic receptor genes
International Nuclear Information System (INIS)
Yang-Feng, T.L.; Xue, Feiyu; Zhong, Wuwei; Cotecchia, S.; Frielle, T.; Caron, M.G.; Lefkowitz, R.J.; Francke, U.
1990-01-01
The adrenergic receptors (ARs) (subtypes α 1 , α 2 , β 1 , and β 2 ) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. The authors have previously assigned the genes for β 2 -and α 2 -AR to human chromosomes 5 and 10, respectively. By Southern analysis of somatic cell hybrids and in situ chromosomal hybridization, they have now mapped the α 1 -AR gene to chromosome 5q32→q34, the same position as β 2 -AR, and the β 1 -AR gene to chromosome 10q24→q26, the region where α 2 -AR, is located. In mouse, both α 2 -and β 1 -AR genes were assigned to chromosome 19, and the α 1 -AR locus was localized to chromosome 11. Pulsed field gel electrophoresis has shown that the α 1 -and β 2 -AR genes in humans are within 300 kilobases (kb) and the distance between the α 2 - and β 1 -AR genes is <225 kb. The proximity of these two pairs of AR genes and the sequence similarity that exists among all the ARs strongly suggest that they are evolutionarily related. Moreover, they likely arose from a common ancestral receptor gene and subsequently diverged through gene duplication and chromosomal duplication to perform their distinctive roles in mediation the physiological effects of catecholamines. The AR genes thus provide a paradigm for understanding the evolution of such structurally conserved yet functionally divergent families off receptor molecules
Gene expression in a paleopolyploid: a transcriptome resource for the ciliate Paramecium tetraurelia
Directory of Open Access Journals (Sweden)
Kapusta Aurélie
2010-10-01
Full Text Available Abstract Background The genome of Paramecium tetraurelia, a unicellular model that belongs to the ciliate phylum, has been shaped by at least 3 successive whole genome duplications (WGD. These dramatic events, which have also been documented in plants, animals and fungi, are resolved over evolutionary time by the loss of one duplicate for the majority of genes. Thanks to a low rate of large scale genome rearrangement in Paramecium, an unprecedented large number of gene duplicates of different ages have been identified, making this organism an outstanding model to investigate the evolutionary consequences of polyploidization. The most recent WGD, with 51% of pre-duplication genes still in 2 copies, provides a snapshot of a phase of rapid gene loss that is not accessible in more ancient polyploids such as yeast. Results We designed a custom oligonucleotide microarray platform for P. tetraurelia genome-wide expression profiling and used the platform to measure gene expression during 1 the sexual cycle of autogamy, 2 growth of new cilia in response to deciliation and 3 biogenesis of secretory granules after massive exocytosis. Genes that are differentially expressed during these time course experiments have expression patterns consistent with a very low rate of subfunctionalization (partition of ancestral functions between duplicated genes in particular since the most recent polyploidization event. Conclusions A public transcriptome resource is now available for Paramecium tetraurelia. The resource has been integrated into the ParameciumDB model organism database, providing searchable access to the data. The microarray platform, freely available through NimbleGen Systems, provides a robust, cost-effective approach for genome-wide expression profiling in P. tetraurelia. The expression data support previous studies showing that at short evolutionary times after a whole genome duplication, gene dosage balance constraints and not functional change are
Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.
2009-01-01
The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.
Gene duplication and divergence affecting drug content in Cannabis sativa.
Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David
2015-12-01
Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
The Sequence and Analysis of Duplication Rich Human Chromosome 16
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-01-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
The sequence and analysis of duplication rich human chromosome 16
Energy Technology Data Exchange (ETDEWEB)
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-08-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie
2016-11-01
After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.
Glutamine synthetase gene evolution: A good molecular clock
International Nuclear Information System (INIS)
Pesole, G.; Lanvave, C.; Saccone, C.; Bozzetti, M.P.; Preparata, G.
1991-01-01
Glutamine synthetase gene evolution in various animals, plants, and bacteria was evaluated by a general stationary Markov model. The evolutionary process proved to be unexpectedly regular even for a time span as long as that between the divergence of prokaryotes from eukaryotes. This enabled us to draw phylogenetic trees for species whose phylogeny cannot be easily reconstructed from the fossil record. The calculation of the times of divergence of the various organelle-specific enzymes led us to hypothesize that the pea and bean chloroplast genes for these enzymes originated from the duplication of nuclear genes as a result of the different metabolic needs of the various species. The data indicate that the duplication of plastid glutamine synthetase genes occurred long after the endosymbiotic events that produced the organelles themselves
A survey of innovation through duplication in the reduced genomes of twelve parasites.
Directory of Open Access Journals (Sweden)
Jeremy D DeBarry
Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that
Hofstra, RMW; Mulder, IM; Vossen, R; de Koning-Gans, PAM; Kraak, M; Ginjaar, IB; van der Hout, AH; Bakker, E; Buys, CHCM; van Essen, AJ; den Dunnen, JT
2004-01-01
Duchenne and Becker muscular dystrophy (DMD and BMD) are caused by mutations in the dystrophin gene. Large rearrangements in the gene are found in about two,thirds of DMD patients, with similar to60% carrying deletions and 5-10% carrying duplications. Most of the remaining 30-35% of patients are
A genome-wide characterization of microRNA genes in maize.
Directory of Open Access Journals (Sweden)
Lifang Zhang
2009-11-01
Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.
Directory of Open Access Journals (Sweden)
Keith A Hultman
2007-01-01
Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that
Directory of Open Access Journals (Sweden)
Hossein Gouran
2014-09-01
Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.
Directory of Open Access Journals (Sweden)
Fang Liu
Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.
Directory of Open Access Journals (Sweden)
Gabriel Forn-Cuní
Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.
Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong
2015-04-01
Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva
2013-01-01
Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
Directory of Open Access Journals (Sweden)
Fernando Martínez-Alberola
Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Preston, Jill C.; Kellogg, Elizabeth A.
2006-01-01
Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429
Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping
2018-04-23
The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .
The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection
Directory of Open Access Journals (Sweden)
Martens Cindy
2010-06-01
Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.
Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.
Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle
2017-08-01
Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses
Schnable, James C.; Freeling, Michael; Lyons, Eric
2012-01-01
The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519
Directory of Open Access Journals (Sweden)
Saminathan Subburaj
Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are
Han, Yuepeng; Gasic, Ksenija; Sun, Fengjie; Xu, Mingliang; Korban, Schuyler S
2007-06-01
An apple starch-branching enzyme SbeI gene (GenBank Accession No. DQ115404) has been isolated, cloned, and sequenced. The SbeI is a single copy gene in the apple genome, consisting of 14 exons and 13 introns, and covering 6075bp. As detected by RT-PCR, the apple SbeI is expressed at very low levels during early stages of fruit development; while, the highest levels of mRNA transcripts are observed at approximately 44 days post-pollination. Besides fruits, the apple SbeI is also expressed in buds and flowers, and very weakly in leaves. The genomic structure of SbeI in apple is strikingly similar to those reported so far in grasses (Poaceae), with exons 4 through 13 being of identical lengths in both apple and grasses. Moreover, structure similarities in exon lengths have also been detected in SbeII genes of both grasses and eudicots. These findings prompted the investigation of the evolutionary process of the Sbe gene family in angiosperms. A total of 26 Sbe sequences, representing an array of monocots and eudicots, are investigated in this study. Phylogenetic analysis has suggested that Sbe genes have duplicated into SbeI and SbeII prior to the divergence of moncots from eudicots. The SbeII gene is further duplicated into SbeIIa and SbeIIb prior to the radiation of grasses; however, it is not yet clear whether this duplication event has occurred before or after the radiation of the eudicots.
The zebrafish genome: a review and msx gene case study.
Postlethwait, J H
2006-01-01
Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.
Directory of Open Access Journals (Sweden)
Lynch Vincent J
2007-01-01
Full Text Available Abstract Background Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare. Snake venom phospholipase A2 genes are members of large multigene families with many diverse functions, thus they are excellent models to study the emergence of novel functions after gene duplications. Results Here, I show that positive Darwinian selection and neofunctionalization is common in snake venom phospholipase A2 genes. The pattern of gene duplication and positive selection indicates that adaptive molecular evolution occurs immediately after duplication events as novel functions emerge and continues as gene families diversify and are refined. Surprisingly, adaptive evolution of group-I phospholipases in elapids is also associated with speciation events, suggesting adaptation of the phospholipase arsenal to novel prey species after niche shifts. Mapping the location of sites under positive selection onto the crystal structure of phospholipase A2 identified regions evolving under diversifying selection are located on the molecular surface and are likely protein-protein interactions sites essential for toxin functions. Conclusion These data show that increases in genomic complexity (through gene duplications can lead to phenotypic complexity (venom composition and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.
Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda
2017-06-26
The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis
Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula
2014-09-01
The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Peng, Ji-Bin
2011-01-01
TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Tang, Yuehui; Qin, Shanshan; Guo, Yali; Chen, Yanbo; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2016-01-01
The AP2/ERF transcription factors play crucial roles in plant growth, development and responses to biotic and abiotic stresses. A total of 119 AP2/ERF genes (JcAP2/ERFs) have been identified in the physic nut genome; they include 16 AP2, 4 RAV, 1 Soloist, and 98 ERF genes. Phylogenetic analysis indicated that physic nut AP2 genes could be divided into 3 subgroups, while ERF genes could be classed into 11 groups or 43 subgroups. The AP2/ERF genes are non-randomly distributed across the 11 linkage groups of the physic nut genome and retain many duplicates which arose from ancient duplication events. The expression patterns of several JcAP2/ERF duplicates in the physic nut showed differences among four tissues (root, stem, leaf, and seed), and 38 JcAP2/ERF genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots according to analysis of digital gene expression tag data. The expression of JcERF011 was downregulated by salinity stress in physic nut roots. Overexpression of the JcERF011 gene in rice plants increased its sensitivity to salinity stress. The increased expression levels of several salt tolerance-related genes were impaired in the JcERF011-overexpressing plants under salinity stress.
Global Metabolic Reconstruction and Metabolic Gene Evolution in the Cattle Genome
Kim, Woonsu; Park, Hyesun; Seo, Seongwon
2016-01-01
The sequence of cattle genome provided a valuable opportunity to systematically link genetic and metabolic traits of cattle. The objectives of this study were 1) to reconstruct genome-scale cattle-specific metabolic pathways based on the most recent and updated cattle genome build and 2) to identify duplicated metabolic genes in the cattle genome for better understanding of metabolic adaptations in cattle. A bioinformatic pipeline of an organism for amalgamating genomic annotations from multiple sources was updated. Using this, an amalgamated cattle genome database based on UMD_3.1, was created. The amalgamated cattle genome database is composed of a total of 33,292 genes: 19,123 consensus genes between NCBI and Ensembl databases, 8,410 and 5,493 genes only found in NCBI or Ensembl, respectively, and 266 genes from NCBI scaffolds. A metabolic reconstruction of the cattle genome and cattle pathway genome database (PGDB) was also developed using Pathway Tools, followed by an intensive manual curation. The manual curation filled or revised 68 pathway holes, deleted 36 metabolic pathways, and added 23 metabolic pathways. Consequently, the curated cattle PGDB contains 304 metabolic pathways, 2,460 reactions including 2,371 enzymatic reactions, and 4,012 enzymes. Furthermore, this study identified eight duplicated genes in 12 metabolic pathways in the cattle genome compared to human and mouse. Some of these duplicated genes are related with specific hormone biosynthesis and detoxifications. The updated genome-scale metabolic reconstruction is a useful tool for understanding biology and metabolic characteristics in cattle. There has been significant improvements in the quality of cattle genome annotations and the MetaCyc database. The duplicated metabolic genes in the cattle genome compared to human and mouse implies evolutionary changes in the cattle genome and provides a useful information for further research on understanding metabolic adaptations of cattle. PMID
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Genome-wide identification and characterization of the bHLH gene family in tomato.
Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing
2015-01-22
The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis
International Nuclear Information System (INIS)
Popp, R.A.; Marsh, C.L.; Skow, L.C.
1981-01-01
Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues
Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.
Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang
2018-03-08
The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.
Directory of Open Access Journals (Sweden)
Yunlin Chen
2013-01-01
Full Text Available We identified 75 dehydration-responsive element-binding (DREB protein genes in Populus trichocarpa. We analyzed gene structures, phylogenies, domain duplications, genome localizations, and expression profiles. The phylogenic construction suggests that the PtrDREB gene subfamily can be classified broadly into six subtypes (DREB A-1 to A-6 in Populus. The chromosomal localizations of the PtrDREB genes indicated 18 segmental duplication events involving 36 genes and six redundant PtrDREB genes were involved in tandem duplication events. There were fewer introns in the PtrDREB subfamily. The motif composition of PtrDREB was highly conserved in the same subtype. We investigated expression profiles of this gene subfamily from different tissues and/or developmental stages. Sixteen genes present in the digital expression analysis had high levels of transcript accumulation. The microarray results suggest that 18 genes were upregulated. We further examined the stress responsiveness of 15 genes by qRT-PCR. A digital northern analysis showed that the PtrDREB17, 18, and 32 genes were highly induced in leaves under cold stress, and the same expression trends were shown by qRT-PCR. Taken together, these observations may lay the foundation for future functional analyses to unravel the biological roles of Populus’ DREB genes.
Directory of Open Access Journals (Sweden)
Hélène L Citerne
Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C
2015-05-01
Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.
Directory of Open Access Journals (Sweden)
Carlson Sara E
2011-11-01
Full Text Available Abstract Background CYCLOIDEA (CYC-like genes have been implicated in the development of capitulum inflorescences (i.e. flowering heads in Asteraceae, where many small flowers (florets are packed tightly into an inflorescence that resembles a single flower. Several rounds of duplication of CYC-like genes have occurred in Asteraceae, and this is hypothesized to be correlated with the evolution of the capitulum, which in turn has been implicated in the evolutionary success of the group. We investigated the evolution of CYC-like genes in Dipsacaceae (Dipsacales, a plant clade in which capitulum inflorescences originated independently of Asteraceae. Two main inflorescence types are present in Dipsacaceae: (1 radiate species contain two kinds of floret within the flowering head (disk and ray, and (2 discoid species contain only disk florets. To test whether a dynamic pattern of gene duplication, similar to that documented in Asteraceae, is present in Dipsacaceae, and whether these patterns are correlated with different inflorescence types, we inferred a CYC-like gene phylogeny for Dipsacaceae based on representative species from the major lineages. Results We recovered within Dipsacaceae the three major forms of CYC-like genes that have been found in most core eudicots, and identified several additional duplications within each of these clades. We found that the number of CYC-like genes in Dipsacaceae is similar to that reported for members of Asteraceae and that the same gene lineages (CYC1-like and CYC2B-like genes have duplicated in a similar fashion independently in both groups. The number of CYC-like genes recovered for radiate versus discoid species differed, with discoid species having fewer copies of CYC1-like and CYC2B-like genes. Conclusions CYC-like genes have undergone extensive duplication in Dipsacaceae, with radiate species having more copies than discoid species, suggesting a potential role for these genes in the evolution of disk and
Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M
2017-05-15
Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Directory of Open Access Journals (Sweden)
Chuanju Dong
Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an
Energy Technology Data Exchange (ETDEWEB)
Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))
1990-08-28
The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.
The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis
DEFF Research Database (Denmark)
Lin, Senjie; Cheng, Shifeng; Song, Bo
2015-01-01
Symbiodinium-specific gene families. No whole-genome duplication was observed, but instead we found active (retro) transposition and gene family expansion, especially in processes important for successful symbiosis with corals. We also documented genes potentially governing sexual reproduction and cyst...... the molecular basis and evolution of coral symbiosis....
Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj
2015-01-01
The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056
Gene duplication as a major force in evolution
Indian Academy of Sciences (India)
ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...
MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement
Directory of Open Access Journals (Sweden)
Zhang Liqing
2010-01-01
Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
The impact of genome triplication on tandem gene evolution in Brassica rapa
Directory of Open Access Journals (Sweden)
Lu eFang
2012-11-01
Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.
Liu, Shikai; Li, Qi; Liu, Zhanjiang
2013-01-01
Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan
2016-04-01
Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.
New progress in snake mitochondrial gene rearrangement.
Chen, Nian; Zhao, Shujin
2009-08-01
To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.
Candidate Gene Identification of Flowering Time Genes in Cotton
Directory of Open Access Journals (Sweden)
Corrinne E. Grover
2015-07-01
Full Text Available Flowering time control is critically important to all sexually reproducing angiosperms in both natural ecological and agronomic settings. Accordingly, there is much interest in defining the genes involved in the complex flowering-time network and how these respond to natural and artificial selection, the latter often entailing transitions in day-length responses. Here we describe a candidate gene analysis in the cotton genus , which uses homologs from the well-described flowering network to bioinformatically and phylogenetically identify orthologs in the published genome sequence from Ulbr., one of the two model diploid progenitors of the commercially important allopolyploid cottons, L. and L. Presence and patterns of expression were evaluated from 13 aboveground tissues related to flowering for each of the candidate genes using allopolyploid as a model. Furthermore, we use a comparative context to determine copy number variability of each key gene family across 10 published angiosperm genomes. Data suggest a pattern of repeated loss of duplicates following ancient whole-genome doubling events in diverse lineages. The data presented here provide a foundation for understanding both the parallel evolution of day-length neutrality in domesticated cottons and the flowering-time network, in general, in this important crop plant.
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Signal Network Analysis of Plant Genes Responding to Ionizing Radiation
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon
2012-12-01
In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication
Evolution of the DAZ gene and the AZFc region on primate Y chromosomes
Directory of Open Access Journals (Sweden)
Yu Jane-Fang
2008-03-01
Full Text Available Abstract Background The Azoospermia Factor c (AZFc region of the human Y chromosome is a unique product of segmental duplication. It consists almost entirely of very long amplicons, represented by different colors, and is frequently deleted in subfertile men. Most of the AZFc amplicons have high sequence similarity with autosomal segments, indicating recent duplication and transposition to the Y chromosome. The Deleted in Azoospermia (DAZ gene within the red-amplicon arose from an ancestral autosomal DAZ-like (DAZL gene. It varies significantly between different men regarding to its copy number and the numbers of RNA recognition motif and DAZ repeat it encodes. We used Southern analyses to study the evolution of DAZ and AZFc amplicons on the Y chromosomes of primates. Results The Old World monkey rhesus macaque has only one DAZ gene. In contrast, the great apes have multiple copies of DAZ, ranging from 2 copies in bonobos and gorillas to at least 6 copies in orangutans, and these DAZ genes have polymorphic structures similar to those of their human counterparts. Sequences homologous to the various AZFc amplicons are present on the Y chromosomes of some but not all primates, indicating that they arrived on the Y chromosome at different times during primate evolution. Conclusion The duplication and transposition of AZFc amplicons to the human Y chromosome occurred in three waves, i.e., after the branching of the New World monkey, the gorilla, and the chimpanzee/bonobo lineages, respectively. The red-amplicon, one of the first to arrive on the Y chromosome, amplified by inverted duplication followed by direct duplication after the separation of the Old World monkey and the great ape lineages. Subsequent duplication/deletion in the various lineages gave rise to a spectrum of DAZ gene structure and copy number found in today's great apes.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Elusive Origins of the Extra Genes in Aspergillus oryzae
Khaldi, Nora; Wolfe, Kenneth H.
2008-01-01
The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939
Elusive origins of the extra genes in Aspergillus oryzae.
Directory of Open Access Journals (Sweden)
Nora Khaldi
Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.
Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731
Directory of Open Access Journals (Sweden)
Xiang Liu
Full Text Available The ATP-binding cassette (ABC gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Analysis of high-identity segmental duplications in the grapevine genome
Directory of Open Access Journals (Sweden)
Carelli Francesco N
2011-08-01
Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.
2010-01-01
that transferred genes may be evolutionarily important in generating mitochondrial genetic diversity. Finally, the complex relationships within each lineage of transferred genes imply a surprisingly complicated history of these genes in Plantago subsequent to their acquisition via HGT and this history probably involves some combination of additional transfers (including intracellular transfer), gene duplication, differential loss and mutation-rate variation. Unravelling this history will probably require sequencing multiple mitochondrial and nuclear genomes from Plantago. See Commentary: http://www.biomedcentral.com/1741-7007/8/147. PMID:21176201
Directory of Open Access Journals (Sweden)
Hao Weilong
2010-12-01
mitochondrial copies suggests that transferred genes may be evolutionarily important in generating mitochondrial genetic diversity. Finally, the complex relationships within each lineage of transferred genes imply a surprisingly complicated history of these genes in Plantago subsequent to their acquisition via HGT and this history probably involves some combination of additional transfers (including intracellular transfer, gene duplication, differential loss and mutation-rate variation. Unravelling this history will probably require sequencing multiple mitochondrial and nuclear genomes from Plantago. See Commentary: http://www.biomedcentral.com/1741-7007/8/147.
Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene
2016-03-12
Changes in the number of alleles of a chromosome may have an impact upon gene expression. Loss of heterozygosity (LOH) indicates that one allele of a gene has been lost, and knowing the exact copy number of the gene would indicate whether duplication of the remaining allele has occurred. We were interested to determine the copy number of the Adenomatous Polyposis Coli (APC) gene in sporadic colorectal cancers with LOH. We selected 38 carcinomas with LOH for the APC gene region of chromosome 5, as determined by amplification of the CA repeat region within the D5S346 loci. The copy number status of APC was ascertained using the SALSA® MLPA® P043-B1 APC Kit. LOH for the DCC gene, KRAS gene mutation, and microsatellite instability were also evaluated for each tumor, utilizing standard polymerase chain reaction methods. No tumor demonstrated microsatellite instability. LOH of the DCC gene was also present in 33 of 36 (91.7%) informative tumors. A KRAS gene mutation was present in 16 of the 38 (42.1%) tumors. Twenty-four (63.2%) of the tumors were copy number neutral, 10 (26.3%) tumors demonstrated major loss, while two (5.3%) showed partial loss. Two tumors (5.3%) had copy number gain. Results of APC and DCC LOH, KRAS and microsatellite instability indicate our colorectal cancer cases were typical of sporadic cancers following the 'chromosomal instability' pathway. The majority of our colorectal carcinomas with LOH for APC gene are copy number neutral. However, one-third of our cases showed copy number loss, suggesting that duplication of the remaining allele is not required for the development of a colorectal carcinoma.
International Nuclear Information System (INIS)
Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene
2016-01-01
Changes in the number of alleles of a chromosome may have an impact upon gene expression. Loss of heterozygosity (LOH) indicates that one allele of a gene has been lost, and knowing the exact copy number of the gene would indicate whether duplication of the remaining allele has occurred. We were interested to determine the copy number of the Adenomatous Polyposis Coli (APC) gene in sporadic colorectal cancers with LOH. We selected 38 carcinomas with LOH for the APC gene region of chromosome 5, as determined by amplification of the CA repeat region within the D5S346 loci. The copy number status of APC was ascertained using the SALSA® MLPA® P043-B1 APC Kit. LOH for the DCC gene, KRAS gene mutation, and microsatellite instability were also evaluated for each tumor, utilizing standard polymerase chain reaction methods. No tumor demonstrated microsatellite instability. LOH of the DCC gene was also present in 33 of 36 (91.7 %) informative tumors. A KRAS gene mutation was present in 16 of the 38 (42.1 %) tumors. Twenty-four (63.2 %) of the tumors were copy number neutral, 10 (26.3 %) tumors demonstrated major loss, while two (5.3 %) showed partial loss. Two tumors (5.3 %) had copy number gain. Results of APC and DCC LOH, KRAS and microsatellite instability indicate our colorectal cancer cases were typical of sporadic cancers following the ‘chromosomal instability’ pathway. The majority of our colorectal carcinomas with LOH for APC gene are copy number neutral. However, one-third of our cases showed copy number loss, suggesting that duplication of the remaining allele is not required for the development of a colorectal carcinoma
Hoffmann, Robert D; Palmgren, Michael
2016-06-13
Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.
Directory of Open Access Journals (Sweden)
Brenner Sydney
2009-02-01
neurohypophysial hormone, designated as [Ile4]vasotocin. Conclusion The vasopressin- and oxytocin-family of neurohypophysial hormones evolved in a common ancestor of jawed vertebrates through tandem duplication of the ancestral vasotocin gene. The duplicated genes were linked tail-to-head like their homologs in elephant shark, coelacanth and non-eutherian tetrapods. In contrast to the conserved linkage of the neurohypophysial genes in these vertebrates, the neurohypophysial hormone gene locus has experienced extensive rearrangements in the teleost lineage.
Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet
Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....
Comparative sequence analysis of nitrogen fixation-related genes in six legumes
Directory of Open Access Journals (Sweden)
Dong Hyun eKim
2013-08-01
Full Text Available Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e. Medicago truncatula (Mt, Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc, Phaseolus vulgaris (Pv and Glycine max (Gm. Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks and nonsynonymous substitutions per nonsynonymous site (Ka between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the farthest distance between Mt and Pv in 6 legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reported some interesting observations e.g. no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed.
Genome-wide analysis of WRKY gene family in Cucumis sativus.
Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan
2011-09-28
WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.
Czech Academy of Sciences Publication Activity Database
Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.
2016-01-01
Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016
Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou
2017-09-18
The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450
"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Zhang Guofan
2009-02-01
Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
The zebrafish progranulin gene family and antisense transcripts
Directory of Open Access Journals (Sweden)
Baranowski David
2005-11-01
Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial
Early events in the evolution of spider silk genes.
Directory of Open Access Journals (Sweden)
James Starrett
Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid
The chromosomal arrangement of six soybean leghemoglobin genes
DEFF Research Database (Denmark)
Bojsen, Kirsten; Abildsten, Dorte; Jensen, Erik Ø
1983-01-01
Clones containing six leghemoglobin (Lb) genes have been isolated from two genomic libraries of soybean. They encompass two independent DNA regions: a 40-kb region containing four genes in the order 5' Lba-Lbc(1)-[unk]Lb-Lbc(3) 3' with the same transcriptional polarity, and another 40-kb region...... containing two genes in the order 5' Lbc(4)-Lbc(2) 3' with the same polarity. The order in which the Lb genes are arranged in the soybean genome imply that they are activated in the opposite order to which they are arranged on the chromosome. There is a close similarity between corresponding DNA regions...... differs from that of the Lb genes. The existence of two very similar Lb gene clusters in soybean suggest that soybean may have evolved from an ancestral form by genome duplication. Udgivelsesdato: 1983-null...
Frietze, Seth; Leatherman, Judith
2014-03-01
New genes that arise from modification of the noncoding portion of a genome rather than being duplicated from parent genes are called de novo genes. These genes, identified by their brief evolution and lack of parent genes, provide an opportunity to study the timeframe in which emerging genes integrate into cellular networks, and how the characteristics of these genes change as they mature into bona fide genes. An article by G. Abrusán provides an opportunity to introduce students to fundamental concepts in evolutionary and comparative genetics and to provide a technical background by which to discuss systems biology approaches when studying the evolutionary process of gene birth. Basic background needed to understand the Abrusán study and details on comparative genomic concepts tailored for a classroom discussion are provided, including discussion questions and a supplemental exercise on navigating a genome database.
The evolution of Dscam genes across the arthropods.
Armitage, Sophie A O; Freiburg, Rebecca Y; Kurtz, Joachim; Bravo, Ignacio G
2012-04-13
One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv), which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuronal wiring where the extreme variability at the somatic level is required for axonal guidance, and it plays a role in immunity where the variability has been hypothesised to relate to recognition of different antigens. Dscam-hv has been found across the Pancrustacea. Additionally, three paralogous non-hypervariable Dscam-like genes have also been described for D. melanogaster. Here we took a bioinformatics approach, building profile Hidden Markov Models to search across species for putative orthologs to the Dscam genes and for hypervariable alternatively spliced exons, and inferring the phylogenetic relationships among them. Our aims were to examine whether Dscam orthologs exist outside the Bilateria, whether the origin of Dscam-hv could lie outside the Pancrustacea, when the Dscam-like orthologs arose, how many alternatively spliced exons of each exon cluster were present in the most common recent ancestor, and how these clusters evolved. Our results suggest that the origin of Dscam genes may lie after the split between the Cnidaria and the Bilateria and supports the hypothesis that Dscam-hv originated in the common ancestor of the Pancrustacea. Our phylogeny of Dscam gene family members shows six well-supported clades: five containing Dscam-like genes and one containing all the Dscam-hv genes, a seventh clade contains arachnid putative Dscam genes. Furthermore, the exon clusters appear to have experienced different evolutionary histories. Dscam genes have undergone independent duplication events in the insects and
The evolution of Dscam genes across the arthropods
Directory of Open Access Journals (Sweden)
Armitage Sophie AO
2012-04-01
undergone independent duplication events in the insects and in an arachnid genome, which adds to the more well-known tandem duplications that have taken place within Dscam-hv genes. Therefore, two forms of gene expansion seem to be active within this gene family. The evolutionary history of this dynamic gene family will be further unfolded as genomes of species from more disparate groups become available.
Analysis of gene evolution and metabolic pathways using the Candida Gene Order Browser
LENUS (Irish Health Repository)
Fitzpatrick, David A
2010-05-10
Abstract Background Candida species are the most common cause of opportunistic fungal infection worldwide. Recent sequencing efforts have provided a wealth of Candida genomic data. We have developed the Candida Gene Order Browser (CGOB), an online tool that aids comparative syntenic analyses of Candida species. CGOB incorporates all available Candida clade genome sequences including two Candida albicans isolates (SC5314 and WO-1) and 8 closely related species (Candida dubliniensis, Candida tropicalis, Candida parapsilosis, Lodderomyces elongisporus, Debaryomyces hansenii, Pichia stipitis, Candida guilliermondii and Candida lusitaniae). Saccharomyces cerevisiae is also included as a reference genome. Results CGOB assignments of homology were manually curated based on sequence similarity and synteny. In total CGOB includes 65617 genes arranged into 13625 homology columns. We have also generated improved Candida gene sets by merging\\/removing partial genes in each genome. Interrogation of CGOB revealed that the majority of tandemly duplicated genes are under strong purifying selection in all Candida species. We identified clusters of adjacent genes involved in the same metabolic pathways (such as catabolism of biotin, galactose and N-acetyl glucosamine) and we showed that some clusters are species or lineage-specific. We also identified one example of intron gain in C. albicans. Conclusions Our analysis provides an important resource that is now available for the Candida community. CGOB is available at http:\\/\\/cgob.ucd.ie.
Genome-wide identification and characterization of WRKY gene family in peanut
Directory of Open Access Journals (Sweden)
Hui eSong
2016-04-01
Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.
Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun
2016-01-01
WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
Directory of Open Access Journals (Sweden)
Laura Ferguson
2014-10-01
Full Text Available Gene duplications within the conserved Hox cluster are rare in animal evolution, but in Lepidoptera an array of divergent Hox-related genes (Shx genes has been reported between pb and zen. Here, we use genome sequencing of five lepidopteran species (Polygonia c-album, Pararge aegeria, Callimorpha dominula, Cameraria ohridella, Hepialus sylvina plus a caddisfly outgroup (Glyphotaelius pellucidus to trace the evolution of the lepidopteran Shx genes. We demonstrate that Shx genes originated by tandem duplication of zen early in the evolution of large clade Ditrysia; Shx are not found in a caddisfly and a member of the basally diverging Hepialidae (swift moths. Four distinct Shx genes were generated early in ditrysian evolution, and were stably retained in all descendent Lepidoptera except the silkmoth which has additional duplications. Despite extensive sequence divergence, molecular modelling indicates that all four Shx genes have the potential to encode stable homeodomains. The four Shx genes have distinct spatiotemporal expression patterns in early development of the Speckled Wood butterfly (Pararge aegeria, with ShxC demarcating the future sites of extraembryonic tissue formation via strikingly localised maternal RNA in the oocyte. All four genes are also expressed in presumptive serosal cells, prior to the onset of zen expression. Lepidopteran Shx genes represent an unusual example of Hox cluster expansion and integration of novel genes into ancient developmental regulatory networks.
Genome-Wide Analysis of the NAC Gene Family in Physic Nut (Jatropha curcas L.).
Wu, Zhenying; Xu, Xueqin; Xiong, Wangdan; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Wu, Guojiang; Jiang, Huawu
2015-01-01
The NAC proteins (NAM, ATAF1/2 and CUC2) are plant-specific transcriptional regulators that have a conserved NAM domain in the N-terminus. They are involved in various biological processes, including both biotic and abiotic stress responses. In the present study, a total of 100 NAC genes (JcNAC) were identified in physic nut (Jatropha curcas L.). Based on phylogenetic analysis and gene structures, 83 JcNAC genes were classified as members of, or proposed to be diverged from, 39 previously predicted orthologous groups (OGs) of NAC sequences. Physic nut has a single intron-containing NAC gene subfamily that has been lost in many plants. The JcNAC genes are non-randomly distributed across the 11 linkage groups of the physic nut genome, and appear to be preferentially retained duplicates that arose from both ancient and recent duplication events. Digital gene expression analysis indicates that some of the JcNAC genes have tissue-specific expression profiles (e.g. in leaves, roots, stem cortex or seeds), and 29 genes differentially respond to abiotic stresses (drought, salinity, phosphorus deficiency and nitrogen deficiency). Our results will be helpful for further functional analysis of the NAC genes in physic nut.
Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.
Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W
2017-11-01
Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Genome-wide Identification and Expression Analysis of Half-size ABCG Genes in Malus × domestica
Directory of Open Access Journals (Sweden)
Juanjuan MA
2018-03-01
Full Text Available Half-size adenosine triphosphate-binding cassette transporter subgroup G (ABCG genes play crucial roles in regulating the movements of a variety of substrates and have been well studied in several plants. However, half-size ABCGs have not been characterized in detail in apple (Malus × domestica Borkh.. Here, we performed a genome-wide identification and expression analysis of the half-size ABCG gene family in apple. A total of 46 apple half-size ABCGs were identified and divided into six clusters according to the phylogenetic analysis. A gene structural analysis showed that most half-size ABCGs in the same cluster shared a similar exon–intron organization. A gene duplication analysis showed that segmental, tandem and whole-genome duplications could account for the expansion of half-size ABCG transporters in M. domestica. Moreover, a promoter scan, digital expression analysis and RNA-seq revealed that MdABCG21 may be involved in root's cytokinin transport and that ABCG17 may be involved in the lateral bud development of M. spectabilis ‘Bly114’ by mediating cytokinin transport. The data presented here lay the foundation for further investigations into the biological and physiological processes and functions of half-size ABCG genes in apple. Keywords: apple, ABCG gene, duplication, gene expression
Fingert, John H; Robin, Alan L; Scheetz, Todd E; Kwon, Young H; Liebmann, Jeffrey M; Ritch, Robert; Alward, Wallace L M
2016-08-01
To investigate the role of TANK-binding kinase 1 ( TBK1 ) gene copy-number variations (ie, gene duplications and triplications) in the pathophysiology of various open-angle glaucomas. In previous studies, we discovered that copy-number variations in the TBK1 gene are associated with normal-tension glaucoma. Here, we investigated the prevalence of copy-number variations in cohorts of patients with other open-angle glaucomas-juvenile-onset open-angle glaucoma (n=30), pigmentary glaucoma (n=209), exfoliation glaucoma (n=225), and steroid-induced glaucoma (n=79)-using a quantitative polymerase chain reaction assay. No TBK1 gene copy-number variations were detected in patients with juvenile-onset open-angle glaucoma, pigmentary glaucoma, or steroid-induced glaucoma. A TBK1 gene duplication was detected in one (0.44%) of the 225 exfoliation glaucoma patients. TBK1 gene copy-number variations (gene duplications and triplications) have been previously associated with normal-tension glaucoma. An exploration of other open-angle glaucomas detected a TBK1 copy-number variation in a patient with exfoliation glaucoma, which is the first example of a TBK1 mutation in a glaucoma patient with a diagnosis other than normal-tension glaucoma. A broader phenotypic range may be associated with TBK1 copy-number variations, although mutations in this gene are most often detected in patients with normal-tension glaucoma.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster
Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.
1994-01-01
The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
among these large, multi-domain proteins are due not only to shared ancestry (homology but also to convergent evolution (analogy. During the evolution of these gene families, duplications and other gene rearrangements affecting domain composition, have occurred along with sequence divergence, leading to complex family relationships with accordingly complex functional implications. The functional homologies and analogies among these genes remain to be established empirically.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
A conserved segmental duplication within ELA.
Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C
2010-12-01
The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.
Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin
2015-09-01
In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.
Cao, Yunpeng; Han, Yahui; Meng, Dandan; Abdullah, Muhammad; Li, Dahui; Jin, Qing; Lin, Yi; Cai, Yongping
2018-04-20
PHD-finger proteins, which belongs to the type of zinc finger family, and that play an important role in the regulation of both transcription and the chromatin state in eukaryotes. Currently, PHD-finger proteins have been well studied in animals, while few studies have been carried out on their function in plants. In the present study, 129 non-redundant PHD-finger genes were identified from 5 Rosaceae species (pear, apple, strawberry, mei, and peach); among them, 31 genes were identified in pear. Subsequently, we carried out a bioinformatics analysis of the PHD-finger genes. Thirty-one PbPHD genes were divided into 7 subfamilies based on the phylogenetic analysis, which are consistent with the intron-exon and conserved motif analyses. In addition, we identified five segmental duplication events, implying that the segmental duplications might be a crucial role in the expansion of the PHD-finger gene family in pear. The microsynteny analysis of five Rosaceae species showed that there were independent duplication events in addition to the genome-wide duplication of the pear genome. Subsequently, ten expressed PHD-finger genes of pear fruit were identified using qRT-PCR, and one of these genes, PbPHD10, was identified as an important candidate gene for the regulation of lignin synthesis. Our research provides useful information for the further analysis of the function of PHD-finger gene family in pear.
The WRKY Transcription Factor Genes in Lotus japonicus.
Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun
2014-01-01
WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (LjWRKY) genes can be classified into three groups (I-III). Investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6. Researchers previously believed that group II and III WRKY domains were derived from the C-terminal WRKY domain of group I. Our results suggest that some WRKY genes in group II originated from the N-terminal domain of group I WRKY genes. Additional evidence to support this hypothesis was obtained by Medicago truncatula WRKY (MtWRKY) protein motif analysis. We found that LjWRKY and MtWRKY group III genes are under purifying selection, suggesting that WRKY genes will become increasingly structured and functionally conserved.
Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui
2017-01-01
Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.
Gene divergence of homeologous regions associated with a major seed protein content QTL in soybean
Directory of Open Access Journals (Sweden)
Puji eLestari
2013-06-01
Full Text Available Understanding several modes of duplication contributing on the present genome structure is getting an attention because it could be related to numerous agronomically important traits. Since soybean serves as a rich protein source for animal feeds and human consumption, breeding efforts in soybean have been directed toward enhancing seed protein content. The publicly available soybean sequences and its genomically featured elements facilitate comprehending of quantitative trait loci (QTL for seed protein content in concordance with homeologous regions in soybean genome. Although parts of chromosome (Chr 20 and Chr 10 showed synteny, QTLs for seed protein content present only on Chr 20. Using comparative analysis of gene contents in recently duplicated genomic regions harboring QTL for protein/oil content on Chrs 20 and 10, a total of 27 genes are present in duplicated regions of both chromosomes. Notably, 4 tandem duplicates of the putative homeobox protein 22 (HB22 are present only on Chr 20 and this Medicago truncatula homolog expressed in endosperm at seed filling stage. These tandem duplicates could contribute on the protein/oil QTL of Chr 20. Our study suggests that non-shared gene contents within the duplicated genomic regions might lead to absence/presence of QTL related to protein/oil content.
Inferring species trees from incongruent multi-copy gene trees using the Robinson-Foulds distance
2013-01-01
Background Constructing species trees from multi-copy gene trees remains a challenging problem in phylogenetics. One difficulty is that the underlying genes can be incongruent due to evolutionary processes such as gene duplication and loss, deep coalescence, or lateral gene transfer. Gene tree estimation errors may further exacerbate the difficulties of species tree estimation. Results We present a new approach for inferring species trees from incongruent multi-copy gene trees that is based on a generalization of the Robinson-Foulds (RF) distance measure to multi-labeled trees (mul-trees). We prove that it is NP-hard to compute the RF distance between two mul-trees; however, it is easy to calculate this distance between a mul-tree and a singly-labeled species tree. Motivated by this, we formulate the RF problem for mul-trees (MulRF) as follows: Given a collection of multi-copy gene trees, find a singly-labeled species tree that minimizes the total RF distance from the input mul-trees. We develop and implement a fast SPR-based heuristic algorithm for the NP-hard MulRF problem. We compare the performance of the MulRF method (available at http://genome.cs.iastate.edu/CBL/MulRF/) with several gene tree parsimony approaches using gene tree simulations that incorporate gene tree error, gene duplications and losses, and/or lateral transfer. The MulRF method produces more accurate species trees than gene tree parsimony approaches. We also demonstrate that the MulRF method infers in minutes a credible plant species tree from a collection of nearly 2,000 gene trees. Conclusions Our new phylogenetic inference method, based on a generalized RF distance, makes it possible to quickly estimate species trees from large genomic data sets. Since the MulRF method, unlike gene tree parsimony, is based on a generic tree distance measure, it is appealing for analyses of genomic data sets, in which many processes such as deep coalescence, recombination, gene duplication and losses as
Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters
Energy Technology Data Exchange (ETDEWEB)
Santini, Simona; Boore, Jeffrey L.; Meyer, Axel
2003-12-31
Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.
Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Lu, Kun; Xu, Xinfu; Wang, Rui; Li, Jiana; Qu, Cunmin
2017-10-24
The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed ( Brassica napus ). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B . napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B . napus and its parental lines and for molecular breeding studies of bZIP genes in B . napus .
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Venkatachalam, Ananda B; Fontenot, Quenton; Farrara, Allyse; Wright, Jonathan M
2018-03-01
With the advent of high-throughput DNA sequencing technology, the genomic sequence of many disparate species has led to the relatively new discipline of genomics, the study of genome structure, function and evolution. Much work has been focused on the role of whole genome duplications (WGD) in the architecture of extant vertebrate genomes, particularly those of teleost fishes which underwent a WGD early in the teleost radiation >230 million years ago (mya). Our past work has focused on the fate of duplicated copies of a multigene family coding for the intracellular lipid-binding protein (iLBP) genes in the teleost fishes. To define the evolutionary processes that determined the fate of duplicated genes and generated the structure of extant fish genomes, however, requires comparative genomic analysis with a fish lineage that diverged before the teleost WGD, such as the spotted gar (Lepisosteus oculatus), an ancient, air-breathing, ray-finned fish. Here, we describe the genomic organization, chromosomal location and tissue-specific expression of a subfamily of the iLBP genes that code for fatty acid-binding proteins (Fabps) in spotted gar. Based on this work, we have defined the minimum suite of fabp genes prior to their duplication in the teleost lineages ~230-400 mya. Spotted gar, therefore, serves as an appropriate outgroup, or ancestral/ancient fish, that did not undergo the teleost-specific WGD. As such, analyses of the spatio-temporal regulation of spotted gar genes provides a foundation to determine whether the duplicated fabp genes have been retained in teleost genomes owing to either sub- or neofunctionalization. Copyright © 2017 Elsevier Inc. All rights reserved.
Origination of an X-linked testes chimeric gene by illegitimate recombination in Drosophila.
Directory of Open Access Journals (Sweden)
J Roman Arguello
2006-05-01
Full Text Available The formation of chimeric gene structures provides important routes by which novel proteins and functions are introduced into genomes. Signatures of these events have been identified in organisms from wide phylogenic distributions. However, the ability to characterize the early phases of these evolutionary processes has been difficult due to the ancient age of the genes or to the limitations of strictly computational approaches. While examples involving retrotransposition exist, our understanding of chimeric genes originating via illegitimate recombination is limited to speculations based on ancient genes or transfection experiments. Here we report a case of a young chimeric gene that has originated by illegitimate recombination in Drosophila. This gene was created within the last 2-3 million years, prior to the speciation of Drosophila simulans, Drosophila sechellia, and Drosophila mauritiana. The duplication, which involved the Bällchen gene on Chromosome 3R, was partial, removing substantial 3' coding sequence. Subsequent to the duplication onto the X chromosome, intergenic sequence was recruited into the protein-coding region creating a chimeric peptide with approximately 33 new amino acid residues. In addition, a novel intron-containing 5' UTR and novel 3' UTR evolved. We further found that this new X-linked gene has evolved testes-specific expression. Following speciation of the D. simulans complex, this novel gene evolved lineage-specifically with evidence for positive selection acting along the D. simulans branch.
Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.
He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan
2012-07-01
WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.
A novel MADS-box gene subfamily with a sister-group relationship to class B floral homeotic genes.
Becker, A; Kaufmann, K; Freialdenhoven, A; Vincent, C; Li, M-A; Saedler, H; Theissen, G
2002-02-01
Class B floral homeotic genes specify the identity of petals and stamens during the development of angiosperm flowers. Recently, putative orthologs of these genes have been identified in different gymnosperms. Together, these genes constitute a clade, termed B genes. Here we report that diverse seed plants also contain members of a hitherto unknown sister clade of the B genes, termed B(sister) (B(s)) genes. We have isolated members of the B(s) clade from the gymnosperm Gnetum gnemon, the monocotyledonous angiosperm Zea mays and the eudicots Arabidopsis thaliana and Antirrhinum majus. In addition, MADS-box genes from the basal angiosperm Asarum europaeum and the eudicot Petunia hybrida were identified as B(s) genes. Comprehensive expression studies revealed that B(s) genes are mainly transcribed in female reproductive organs (ovules and carpel walls). This is in clear contrast to the B genes, which are predominantly expressed in male reproductive organs (and in angiosperm petals). Our data suggest that the B(s) genes played an important role during the evolution of the reproductive structures in seed plants. The establishment of distinct B and B(s) gene lineages after duplication of an ancestral gene may have accompanied the evolution of male microsporophylls and female megasporophylls 400-300 million years ago. During flower evolution, expression of B(s) genes diversified, but the focus of expression remained in female reproductive organs. Our findings imply that a clade of highly conserved close relatives of class B floral homeotic genes has been completely overlooked until recently and awaits further evaluation of its developmental and evolutionary importance. Electronic supplementary material to this paper can be obtained by using the Springer Link server located at http://dx.doi.org/10.1007/s00438-001-0615-8.
Human ETS2 gene on chromosome 21 is not rearranged in Alzheimer disease
International Nuclear Information System (INIS)
Sacchi, N.; Nalbantoglu, J.; Sergovich, F.R.; Papas, T.S.
1988-01-01
The human ETS2 gene, a member of the ETS gene family, with sequence homology with the retroviral ets sequence of the avian erythroblastosis retrovirus E26 is located on chromosome 21. Molecular genetic analysis of Down syndrome (DS) patients with partial trisomy 21 allowed us to reinforce the supposition that ETS2 may be a gene of the minimal DS genetic region. It was originally proposed that a duplication of a portion of the DS region represents the genetic basis of Alzheimer disease, a condition associated also with DS. No evidence of either rearrangements or duplications of ETS2 could be detected in DNA from fibroblasts and brain tissue of Alzheimer disease patients with either the sporadic or the familiar form of the disease. Thus, an altered ETS2 gene dosage does not seem to be a genetic cause or component of Alzheimer disease
Zevering, C E; Moritz, C; Heideman, A; Sturm, R A
1991-11-01
Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.
Gene conversion homogenizes the CMT1A paralogous repeats
Directory of Open Access Journals (Sweden)
Hurles Matthew E
2001-12-01
Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.
Singh, Param Priya; Arora, Jatin; Isambert, Hervé
2015-07-01
Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Jaramillo, Vinicio D Armijos; Sukno, Serenella A; Thon, Michael R
2015-01-02
Horizontal gene transfer (HGT) is the stable transmission of genetic material between organisms by means other than vertical inheritance. HGT has an important role in the evolution of prokaryotes but is relatively rare in eukaryotes. HGT has been shown to contribute to virulence in eukaryotic pathogens. We studied the importance of HGT in plant pathogenic fungi by identifying horizontally transferred genes in the genomes of three members of the genus Colletotrichum. We identified eleven HGT events from bacteria into members of the genus Colletotrichum or their ancestors. The HGT events include genes involved in amino acid, lipid and sugar metabolism as well as lytic enzymes. Additionally, the putative minimal dates of transference were calculated using a time calibrated phylogenetic tree. This analysis reveals a constant flux of genes from bacteria to fungi throughout the evolution of subphylum Pezizomycotina. Genes that are typically transferred by HGT are those that are constantly subject to gene duplication and gene loss. The functions of some of these genes suggest roles in niche adaptation and virulence. We found no evidence of a burst of HGT events coinciding with major geological events. In contrast, HGT appears to be a constant, albeit rare phenomenon in the Pezizomycotina, occurring at a steady rate during their evolution.
A rare FANCA gene variation as a breast cancer susceptibility allele in an Iranian population.
Abbasi, Sakineh; Rasouli, Mina
2017-06-01
Fanconi Anemia (FA) is an autosomal recessive syndrome characterized by congenital abnormalities, progressive bone marrow failure and Fanconi anemia complementation group A (FANCA) is also a potential breast and ovarian cancer susceptibility gene. A novel allele with tandem duplication of 13 base pair sequence in promoter region was identified. To investigate whether the 13 base pair sequence of tandem duplication in promoter region of the FANCA gene is of high penetrance in patients with breast cancer and to determine if the presence of the duplicated allele was associated with an altered risk of breast cancer, the present study screened DNA in blood samples from 304 breast cancer patients and 295 normal individuals as controls. The duplication allele had a frequency of 35.4 and 21.2% in patients with breast cancer and normal controls, respectively. There was a significant increase in the frequency of the duplication allele in patients with familial breast cancer compared with controls (45.1%, P=0.001). Furthermore, the estimated risk of breast cancer in individuals with a homozygote [odds ratio (OR), 4.093; 95% confidence intervals (CI), 1.957‑8.561] or heterozygote duplicated genotype (OR, 3.315; 95% CI, 1.996‑5.506) was higher compared with the corresponding normal homozygote genotype. In conclusion, the present study indicated that the higher the frequency of the duplicated allele, the higher the risk of breast cancer. To the best of our knowledge, the present study is the first to report FANCA gene duplication in patients with breast cancer.
MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.
Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S
2012-04-01
Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.
Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.
2014-01-01
Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety
Effect of method of deduplication on estimation of differential gene expression using RNA-seq
Directory of Open Access Journals (Sweden)
Anna V. Klepikova
2017-03-01
Full Text Available Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI. We also analyzed the influence of sequencing layout (single read or paired end and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
Zhong , Lei; Yu , Xiaomu; Tong , Jingou
2006-01-01
Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...
Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène
2013-01-01
Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy
Directory of Open Access Journals (Sweden)
David Cohen
Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of
Zhang, Z; Cavalier-Smith, T; Green, B R
2001-08-01
Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.
Functional evolution of ADAMTS genes: Evidence from analyses of phylogeny and gene organization
Directory of Open Access Journals (Sweden)
Van Meir Erwin G
2005-02-01
Full Text Available Abstract Background The ADAMTS (A Disintegrin-like and Metalloprotease with Thrombospondin motifs proteins are a family of metalloproteases with sequence similarity to the ADAM proteases, that contain the thrombospondin type 1 sequence repeat motifs (TSRs common to extracellular matrix proteins. ADAMTS proteins have recently gained attention with the discovery of their role in a variety of diseases, including tissue and blood disorders, cancer, osteoarthritis, Alzheimer's and the genetic syndromes Weill-Marchesani syndrome (ADAMTS10, thrombotic thrombocytopenic purpura (ADAMTS13, and Ehlers-Danlos syndrome type VIIC (ADAMTS2 in humans and belted white-spotting mutation in mice (ADAMTS20. Results Phylogenetic analysis and comparison of the exon/intron organization of vertebrate (Homo, Mus, Fugu, chordate (Ciona and invertebrate (Drosophila and Caenorhabditis ADAMTS homologs has elucidated the evolutionary relationships of this important gene family, which comprises 19 members in humans. Conclusions The evolutionary history of ADAMTS genes in vertebrate genomes has been marked by rampant gene duplication, including a retrotransposition that gave rise to a distinct ADAMTS subfamily (ADAMTS1, -4, -5, -8, -15 that may have distinct aggrecanase and angiogenesis functions.
Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin
2017-06-01
Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.
Directory of Open Access Journals (Sweden)
Hui Song
Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.
2010-07-22
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
Directory of Open Access Journals (Sweden)
Yating Dong
Full Text Available Aldehyde dehydrogenases (ALDHs are a superfamily of enzymes which play important role in the scavenging of active aldehydes molecules. In present work, a comprehensive whole-genomic study of ALDH gene superfamily was carried out for an allotetraploid cultivated cotton species, G. hirsutum, as well as in parallel relative to their diploid progenitors, G. arboreum and G. raimondii. Totally, 30 and 58 ALDH gene sequences belong to 10 families were identified from diploid and allotetraploid cotton species, respectively. The gene structures among the members from same families were highly conserved. Whole-genome duplication and segmental duplication might be the major driver for the expansion of ALDH gene superfamily in G. hirsutum. In addition, the expression patterns of GhALDH genes were diverse across tissues. Most GhALDH genes were induced or repressed by salt stress in upland cotton. Our observation shed lights on the molecular evolutionary properties of ALDH genes in diploid cottons and their alloallotetraploid derivatives. It may be useful to mine key genes for improvement of cotton response to salt stress.
Nomenclature for alleles of the human carboxylesterase 1 gene
DEFF Research Database (Denmark)
Rasmussen, Henrik B.; Madsen, Majbritt B.; Bjerre, Ditte
2017-01-01
The carboxylesterase 1 gene (CES1) in humans encodes a hydrolase, which is implicated in the metabolism of several commonly used drugs 1. This gene is located on chromosome 16 with a highly homologous pseudogene, CES1P1, in its proximity. A duplicated segment of CES1 replaces most of CES1P1 in some...... appears to be low 8,13. The formation of hybrids consisting of a gene and a related pseudogene has been reported for other genes than CES1. This includes the hybrids of the gene encoding cytochrome P450 2D6 (CYP2D6) and pseudogene CYP2D7, that is, the so-called CYP2D7/D6 hybrids 14......,15. These are categorized as CYP2D6 variants and not as variants of pseudogene CYP2D716....
Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.
Directory of Open Access Journals (Sweden)
Mohammed Uddin
Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.
The evolution of milk casein genes from tooth genes before the origin of mammals.
Kawasaki, Kazuhiko; Lafont, Anne-Gaelle; Sire, Jean-Yves
2011-07-01
Caseins are among cardinal proteins that evolved in the lineage leading to mammals. In milk, caseins and calcium phosphate (CaP) form a huge complex called casein micelle. By forming the micelle, milk maintains high CaP concentrations, which help altricial mammalian neonates to grow bone and teeth. Two types of caseins are known. Ca-sensitive caseins (α(s)- and β-caseins) bind Ca but precipitate at high Ca concentrations, whereas Ca-insensitive casein (κ-casein) does not usually interact with Ca but instead stabilizes the micelle. Thus, it is thought that these two types of caseins are both necessary for stable micelle formation. Both types of caseins show high substitution rates, which make it difficult to elucidate the evolution of caseins. Yet, recent studies have revealed that all casein genes belong to the secretory calcium-binding phosphoprotein (SCPP) gene family that arose by gene duplication. In the present study, we investigated exon-intron structures and phylogenetic distributions of casein and other SCPP genes, particularly the odontogenic ameloblast-associated (ODAM) gene, the SCPP-Pro-Gln-rich 1 (SCPPPQ1) gene, and the follicular dendritic cell secreted peptide (FDCSP) gene. The results suggest that contemporary Ca-sensitive casein genes arose from a putative common ancestor, which we refer to as CSN1/2. The six putative exons comprising CSN1/2 are all found in SCPPPQ1, although ODAM also shares four of these exons. By contrast, the five exons of the Ca-insensitive casein gene are all reminiscent of FDCSP. The phylogenetic distribution of these genes suggests that both SCPPPQ1 and FDCSP arose from ODAM. We thus argue that all casein genes evolved from ODAM via two different pathways; Ca-sensitive casein genes likely originated directly from SCPPPQ1, whereas the Ca-insensitive casein genes directly differentiated from FDCSP. Further, expression of ODAM, SCPPPQ1, and FDCSP was detected in dental tissues, supporting the idea that both types of caseins
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Atypical haemolytic uraemic syndrome associated with a hybrid complement gene.
Directory of Open Access Journals (Sweden)
Julian P Venables
2006-10-01
Full Text Available BACKGROUND: Sequence analysis of the regulators of complement activation (RCA cluster of genes at chromosome position 1q32 shows evidence of several large genomic duplications. These duplications have resulted in a high degree of sequence identity between the gene for factor H (CFH and the genes for the five factor H-related proteins (CFHL1-5; aliases CFHR1-5. CFH mutations have been described in association with atypical haemolytic uraemic syndrome (aHUS. The majority of the mutations are missense changes that cluster in the C-terminal region and impair the ability of factor H to regulate surface-bound C3b. Some have arisen as a result of gene conversion between CFH and CFHL1. In this study we tested the hypothesis that nonallelic homologous recombination between low-copy repeats in the RCA cluster could result in the formation of a hybrid CFH/CFHL1 gene that predisposes to the development of aHUS. METHODS AND FINDINGS: In a family with many cases of aHUS that segregate with the RCA cluster we used cDNA analysis, gene sequencing, and Southern blotting to show that affected individuals carry a heterozygous CFH/CFHL1 hybrid gene in which exons 1-21 are derived from CFH and exons 22/23 from CFHL1. This hybrid encodes a protein product identical to a functionally significant CFH mutant (c.3572C>T, S1191L and c.3590T>C, V1197A that has been previously described in association with aHUS. CONCLUSIONS: CFH mutation screening is recommended in all aHUS patients prior to renal transplantation because of the high risk of disease recurrence post-transplant in those known to have a CFH mutation. Because of our finding it will be necessary to implement additional screening strategies that will detect a hybrid CFH/CFHL1 gene.
Bright, Lydia J; Gout, Jean-Francois; Lynch, Michael
2017-04-15
New gene functions arise within existing gene families as a result of gene duplication and subsequent diversification. To gain insight into the steps that led to the functional diversification of paralogues, we tracked duplicate retention patterns, expression-level divergence, and subcellular markers of functional diversification in the Rab GTPase gene family in three Paramecium aurelia species. After whole-genome duplication, Rab GTPase duplicates are more highly retained than other genes in the genome but appear to be diverging more rapidly in expression levels, consistent with early steps in functional diversification. However, by localizing specific Rab proteins in Paramecium cells, we found that paralogues from the two most recent whole-genome duplications had virtually identical localization patterns, and that less closely related paralogues showed evidence of both conservation and diversification. The functionally conserved paralogues appear to target to compartments associated with both endocytic and phagocytic recycling functions, confirming evolutionary and functional links between the two pathways in a divergent eukaryotic lineage. Because the functionally diversifying paralogues are still closely related to and derived from a clade of functionally conserved Rab11 genes, we were able to pinpoint three specific amino acid residues that may be driving the change in the localization and thus the function in these proteins. © 2017 Bright et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation
Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.
The detection of large deletions or duplications in genomic DNA.
Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R
2002-11-01
While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.
[Molecular mechanisms in sex determination: from gene regulation to pathology].
Ravel, C; Chantot-Bastaraud, S; Siffroi, J-P
2004-01-01
Testis determination is the complex process by which the bipotential gonad becomes a normal testis during embryo development. As a consequence, this process leads to sexual differentiation corresponding to the masculinization of both genital track and external genitalia. The whole phenomenon is under genetic control and is particularly driven by the presence of the Y chromosome and by the SRY gene, which acts as the key initiator of the early steps of testis determination. However, many other autosomal genes, present in both males and females, are expressed during testis formation in a gene activation pathway, which is far to be totally elucidated. All these genes act in a dosage-sensitive manner by which quantitative gene abnormalities, due to chromosomal deletions, duplications or mosaicism, may lead to testis determination failure and sex reversal.
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.
Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P
2017-07-31
The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.
Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex
Directory of Open Access Journals (Sweden)
Susanne Sattler
2012-01-01
Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.
Directory of Open Access Journals (Sweden)
Sanjay Premi
Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.
Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura
2017-12-08
Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.
The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?
Directory of Open Access Journals (Sweden)
Haendler Bernard
2008-12-01
Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be
Norrie disease and MAO genes: nearest neighbors.
Chen, Z Y; Denney, R M; Breakefield, X O
1995-01-01
The Norrie disease and MAO genes are tandemly arranged in the p11.4-p11.3 region of the human X chromosome in the order tel-MAOA-MAOB-NDP-cent. This relationship is conserved in the mouse in the order tel-MAOB-MAOA-NDP-cent. The MAO genes appear to have arisen by tandem duplication of an ancestral MAO gene, but their positional relationship to NDP appears to be random. Distinctive X-linked syndromes have been described for mutations in the MAOA and NDP genes, and in addition, individuals have been identified with contiguous gene syndromes due to chromosomal deletions which encompass two or three of these genes. Loss of function of the NDP gene causes a syndrome of congenital blindness and progressive hearing loss, sometimes accompanied by signs of CNS dysfunction, including variable mental retardation and psychiatric symptoms. Other mutations in the NDP gene have been found to underlie another X-linked eye disease, exudative vitreo-retinopathy. An MAOA deficiency state has been described in one family to date, with features of altered amine and amine metabolite levels, low normal intelligence, apparent difficulty in impulse control and cardiovascular difficulty in affected males. A contiguous gene syndrome in which all three genes are lacking, as well as other as yet unidentified flanking genes, results in severe mental retardation, small stature, seizures and congenital blindness, as well as altered amine and amine metabolites. Issues that remain to be resolved are the function of the NDP gene product, the frequency and phenotype of the MAOA deficiency state, and the possible occurrence and phenotype of an MAOB deficiency state.
Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.
2013-01-01
Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion.
Directory of Open Access Journals (Sweden)
Jeffrey J Coleman
2009-08-01
Full Text Available The ascomycetous fungus Nectria haematococca, (asexual name Fusarium solani, is a member of a group of >50 species known as the "Fusarium solani species complex". Members of this complex have diverse biological properties including the ability to cause disease on >100 genera of plants and opportunistic infections in humans. The current research analyzed the most extensively studied member of this complex, N. haematococca mating population VI (MPVI. Several genes controlling the ability of individual isolates of this species to colonize specific habitats are located on supernumerary chromosomes. Optical mapping revealed that the sequenced isolate has 17 chromosomes ranging from 530 kb to 6.52 Mb and that the physical size of the genome, 54.43 Mb, and the number of predicted genes, 15,707, are among the largest reported for ascomycetes. Two classes of genes have contributed to gene expansion: specific genes that are not found in other fungi including its closest sequenced relative, Fusarium graminearum; and genes that commonly occur as single copies in other fungi but are present as multiple copies in N. haematococca MPVI. Some of these additional genes appear to have resulted from gene duplication events, while others may have been acquired through horizontal gene transfer. The supernumerary nature of three chromosomes, 14, 15, and 17, was confirmed by their absence in pulsed field gel electrophoresis experiments of some isolates and by demonstrating that these isolates lacked chromosome-specific sequences found on the ends of these chromosomes. These supernumerary chromosomes contain more repeat sequences, are enriched in unique and duplicated genes, and have a lower G+C content in comparison to the other chromosomes. Although the origin(s of the extra genes and the supernumerary chromosomes is not known, the gene expansion and its large genome size are consistent with this species' diverse range of habitats. Furthermore, the presence of unique
The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion
Energy Technology Data Exchange (ETDEWEB)
Coleman, J.J.; Rounsley, S.D.; Rodriguez-Carres, M.; Kuo, A.; Wasmann, C.c.; Grimwood, J.; Schmutz, J.; Taga, M.; White, G.J.; Zhuo, S.; Schwartz, D.C.; Freitag, M.; Ma, L.-J.; Danchin, E.G.J.; Henrissat, B.; Cutinho, P.M.; Nelson, D.R.; Straney, D.; Napoli, C.A.; Baker, B.M.; Gribskov, M.; Rep, M.; Kroken, S.; Molnar, I.; Rensing, C.; Kennell, J.C.; Zamora, J.; Farman, M.L.; Selker, E.U.; Salamov, A.; Shapiro, H.; Pangilinan, J.; Lindquist, E.; Lamers, C.; Grigoriev, I.V.; Geiser, D.M.; Covert, S.F.; Temporini, S.; VanEtten, H.D.
2009-04-20
The ascomycetous fungus Nectria haematococca, (asexual name Fusarium solani), is a member of a group of .50 species known as the"Fusarium solani species complex". Members of this complex have diverse biological properties including the ability to cause disease on .100 genera of plants and opportunistic infections in humans. The current research analyzed the most extensively studied member of this complex, N. haematococca mating population VI (MPVI). Several genes controlling the ability of individual isolates of this species to colonize specific habitats are located on supernumerary chromosomes. Optical mapping revealed that the sequenced isolate has 17 chromosomes ranging from 530 kb to 6.52 Mb and that the physical size of the genome, 54.43 Mb, and the number of predicted genes, 15,707, are among the largest reported for ascomycetes. Two classes of genes have contributed to gene expansion: specific genes that are not found in other fungi including its closest sequenced relative, Fusarium graminearum; and genes that commonly occur as single copies in other fungi but are present as multiple copies in N. haematococca MPVI. Some of these additional genes appear to have resulted from gene duplication events, while others may have been acquired through horizontal gene transfer. The supernumerary nature of three chromosomes, 14, 15, and 17, was confirmed by their absence in pulsed field gel electrophoresis experiments of some isolates and by demonstrating that these isolates lacked chromosome-specific sequences found on the ends of these chromosomes. These supernumerary chromosomes contain more repeat sequences, are enriched in unique and duplicated genes, and have a lower G+C content in comparison to the other chromosomes. Although the origin(s) of the extra genes and the supernumerary chromosomes is not known, the gene expansion and its large genome size are consistent with this species' diverse range of habitats. Furthermore, the presence of unique genes on
Directory of Open Access Journals (Sweden)
Alicia Blaker-Lee
2012-11-01
Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.
Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).
Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2015-11-01
The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.
Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C
2010-12-01
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu
2018-01-10
Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.
Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.
2012-01-01
Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055
Engsontia, Patamarerk; Sangket, Unitsa; Chotigeat, Wilaiwan; Satasook, Chutamas
2014-08-01
Lepidoptera (comprised of butterflies and moths) is one of the largest groups of insects, including more than 160,000 described species. Chemoreception plays important roles in the adaptation of these species to a wide range of niches, e.g., plant hosts, egg-laying sites, and mates. This study investigated the molecular evolution of the lepidopteran odorant (Or) and gustatory receptor (Gr) genes using recently identified genes from Bombyx mori, Danaus plexippus, Heliconius melpomene, Plutella xylostella, Heliothis virescens, Manduca sexta, Cydia pomonella, and Spodoptera littoralis. A limited number of cases of large lineage-specific gene expansion are observed (except in the P. xylostella lineage), possibly due to selection against tandem gene duplication. There has been strong purifying selection during the evolution of both lepidopteran odorant and gustatory genes, as shown by the low ω values estimated through CodeML analysis, ranging from 0.0093 to 0.3926. However, purifying selection has been relaxed on some amino acid sites in these receptors, leading to sequence divergence, which is a precursor of positive selection on these sequences. Signatures of positive selection were detected only in a few loci from the lineage-specific analysis. Estimation of gene gains and losses suggests that the common ancestor of the Lepidoptera had fewer Or genes compared to extant species and an even more reduced number of Gr genes, particularly within the bitter receptor clade. Multiple gene gains and a few gene losses occurred during the evolution of Lepidoptera. Gene family expansion may be associated with the adaptation of lepidopteran species to plant hosts, especially after angiosperm radiation. Phylogenetic analysis of the moth sex pheromone receptor genes suggested that chromosomal translocations have occurred several times. New sex pheromone receptors have arisen through tandem gene duplication. Positive selection was detected at some amino acid sites predicted to be
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Relationships among msx gene structure and function in zebrafish and other vertebrates.
Ekker, M; Akimenko, M A; Allende, M L; Smith, R; Drouin, G; Langille, R M; Weinberg, E S; Westerfield, M
1997-10-01
The zebrafish genome contains at least five msx homeobox genes, msxA, msxB, msxC, msxD, and the newly isolated msxE. Although these genes share structural features common to all Msx genes, phylogenetic analyses of protein sequences indicate that the msx genes from zebrafish are not orthologous to the Msx1 and Msx2 genes of mammals, birds, and amphibians. The zebrafish msxB and msxC are more closely related to each other and to the mouse Msx3. Similarly, although the combinatorial expression of the zebrafish msx genes in the embryonic dorsal neuroectoderm, visceral arches, fins, and sensory organs suggests functional similarities with the Msx genes of other vertebrates, differences in the expression patterns preclude precise assignment of orthological relationships. Distinct duplication events may have given rise to the msx genes of modern fish and other vertebrate lineages whereas many aspects of msx gene functions during embryonic development have been preserved.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Dong, Chun-Juan; Shang, Qing-Mao
2013-07-01
Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.
Evolutionary patterns of RNA-based duplication in non-mammalian chordates.
Directory of Open Access Journals (Sweden)
Ming Chen
Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.
Suthanthiram, Backiyarani; Subbaraya, Uma; Marimuthu Somasundram, Saraswathi; Muthu, Mayilvaganan
2016-01-01
The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1) MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2) MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3) MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4) cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or repressors in a
Directory of Open Access Journals (Sweden)
Raja Kaliyappan
Full Text Available The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1 MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2 MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3 MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4 cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or
Reconciliation of Gene and Species Trees
Directory of Open Access Journals (Sweden)
L. Y. Rusin
2014-01-01
Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Computational Identification of Novel Genes: Current and Future Perspectives.
Klasberg, Steffen; Bitard-Feildel, Tristan; Mallet, Ludovic
2016-01-01
While it has long been thought that all genomic novelties are derived from the existing material, many genes lacking homology to known genes were found in recent genome projects. Some of these novel genes were proposed to have evolved de novo, ie, out of noncoding sequences, whereas some have been shown to follow a duplication and divergence process. Their discovery called for an extension of the historical hypotheses about gene origination. Besides the theoretical breakthrough, increasing evidence accumulated that novel genes play important roles in evolutionary processes, including adaptation and speciation events. Different techniques are available to identify genes and classify them as novel. Their classification as novel is usually based on their similarity to known genes, or lack thereof, detected by comparative genomics or against databases. Computational approaches are further prime methods that can be based on existing models or leveraging biological evidences from experiments. Identification of novel genes remains however a challenging task. With the constant software and technologies updates, no gold standard, and no available benchmark, evaluation and characterization of genomic novelty is a vibrant field. In this review, the classical and state-of-the-art tools for gene prediction are introduced. The current methods for novel gene detection are presented; the methodological strategies and their limits are discussed along with perspective approaches for further studies.
Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan
2013-11-02
Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the
Côté, Olivier; Viel, Laurent; Bienzle, Dorothee
2013-12-01
Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.
Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek
2014-01-01
Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Directory of Open Access Journals (Sweden)
Choi Beom-Soon
2008-12-01
Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between
Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.
Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan
2013-01-01
Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.
Identification of the gene for Nance-Horan syndrome (NHS).
Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J
2004-10-01
The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.
Kumazawa, Yoshinori; Endo, Hideki
2004-04-30
The mitochondrial genome of the Komodo dragon (Varanus komodoensis) was nearly completely sequenced, except for two highly repetitive noncoding regions. An efficient sequencing method for squamate mitochondrial genomes was established by combining the long polymerase chain reaction (PCR) technology and a set of reptile-oriented primers designed for nested PCR amplifications. It was found that the mitochondrial genome had novel gene arrangements in which genes from NADH dehydrogenase subunit 6 to proline tRNA were extensively shuffled with duplicate control regions. These control regions had 99% sequence similarity over 700 bp. Although snake mitochondrial genomes are also known to possess duplicate control regions with nearly identical sequences, the location of the second control region suggested independent occurrence of the duplication on lineages leading to snakes and the Komodo dragon. Another feature of the mitochondrial genome of the Komodo dragon was the considerable number of tandem repeats, including sequences with a strong secondary structure, as a possible site for the slipped-strand mispairing in replication. These observations are consistent with hypotheses that tandem duplications via the slipped-strand mispairing may induce mitochondrial gene rearrangements and may serve to maintain similar copies of the control region.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Birth and death of genes linked to chromosomal inversion
Furuta, Yoshikazu; Kawai, Mikihiko; Yahara, Koji; Takahashi, Noriko; Handa, Naofumi; Tsuru, Takeshi; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo
2011-01-01
The birth and death of genes is central to adaptive evolution, yet the underlying genome dynamics remain elusive. The availability of closely related complete genome sequences helps to follow changes in gene contents and clarify their relationship to overall genome organization. Helicobacter pylori, bacteria in our stomach, are known for their extreme genome plasticity through mutation and recombination and will make a good target for such an analysis. In comparing their complete genome sequences, we found that gain and loss of genes (loci) for outer membrane proteins, which mediate host interaction, occurred at breakpoints of chromosomal inversions. Sequence comparison there revealed a unique mechanism of DNA duplication: DNA duplication associated with inversion. In this process, a DNA segment at one chromosomal locus is copied and inserted, in an inverted orientation, into a distant locus on the same chromosome, while the entire region between these two loci is also inverted. Recognition of this and three more inversion modes, which occur through reciprocal recombination between long or short sequence similarity or adjacent to a mobile element, allowed reconstruction of synteny evolution through inversion events in this species. These results will guide the interpretation of extensive DNA sequencing results for understanding long- and short-term genome evolution in various organisms and in cancer cells. PMID:21212362
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph
2017-06-01
Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio
2015-01-01
We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
The duplication 17p13.3 phenotype
DEFF Research Database (Denmark)
Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica
2013-01-01
. Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....
Directory of Open Access Journals (Sweden)
Levasseur Anthony
2011-02-01
Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.
Directory of Open Access Journals (Sweden)
Katja Nowick
Full Text Available The molecular changes underlying major phenotypic differences between humans and other primates are not well understood, but alterations in gene regulation are likely to play a major role. Here we performed a thorough evolutionary analysis of the largest family of primate transcription factors, the Krüppel-type zinc finger (KZNF gene family. We identified and curated gene and pseudogene models for KZNFs in three primate species, chimpanzee, orangutan and rhesus macaque, to allow for a comparison with the curated set of human KZNFs. We show that the recent evolutionary history of primate KZNFs has been complex, including many lineage-specific duplications and deletions. We found 213 species-specific KZNFs, among them 7 human-specific and 23 chimpanzee-specific genes. Two human-specific genes were validated experimentally. Ten genes have been lost in humans and 13 in chimpanzees, either through deletion or pseudogenization. We also identified 30 KZNF orthologs with human-specific and 42 with chimpanzee-specific sequence changes that are predicted to affect DNA binding properties of the proteins. Eleven of these genes show signatures of accelerated evolution, suggesting positive selection between humans and chimpanzees. During primate evolution the most extensive re-shaping of the KZNF repertoire, including most gene additions, pseudogenizations, and structural changes occurred within the subfamily homininae. Using zinc finger (ZNF binding predictions, we suggest potential impact these changes have had on human gene regulatory networks. The large species differences in this family of TFs stands in stark contrast to the overall high conservation of primate genomes and potentially represents a potent driver of primate evolution.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Dynamic evolution of bitter taste receptor genes in vertebrates
Directory of Open Access Journals (Sweden)
Jones Gareth
2009-01-01
Full Text Available Abstract Background Sensing bitter tastes is crucial for many animals because it can prevent them from ingesting harmful foods. This process is mainly mediated by the bitter taste receptors (T2R, which are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires, and marked variation in repertoire size has been noted among species. However, the mechanisms underlying the evolution of vertebrate T2R genes remain poorly understood. Results To better understand the evolutionary pattern of these genes, we identified 16 T2R gene repertoires based on the high coverage genome sequences of vertebrates and studied the evolutionary changes in the number of T2R genes during birth-and-death evolution using the reconciled-tree method. We found that the number of T2R genes and the fraction of pseudogenes vary extensively among species. Based on the results of phylogenetic analysis, we showed that T2R gene families in teleost fishes are more diverse than those in tetrapods. In addition to the independent gene expansions in teleost fishes, frogs and mammals, lineage-specific gene duplications were also detected in lizards. Furthermore, extensive gains and losses of T2R genes were detected in each lineage during their evolution, resulting in widely differing T2R gene repertoires. Conclusion These results further support the hypotheses that T2R gene repertoires are closely related to the dietary habits of different species and that birth-and-death evolution is associated with adaptations to dietary changes.
2009-01-01
duplicated during evolution, although a separate evolutive origin for the ial and penDE genes, is also discussed. PMID:19470155
International Nuclear Information System (INIS)
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-01-01
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-04-29
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
Directory of Open Access Journals (Sweden)
Campbell Ian G
2005-04-01
Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.
Albadine, Roula; Latour, Mathieu; Toubaji, Antoun; Haffner, Michael; Isaacs, William B; A Platz, Elizabeth; Meeker, Alan K; Demarzo, Angelo M; Epstein, Jonathan I; Netto, George J
2009-11-01
Minute prostatic adenocarcinomas are considered to be of insufficient virulence. Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. A total of 45 consecutive prostatectomies with minute adenocarcinoma were used for tissue microarray construction. A total of 63 consecutive non-minimal, Gleason Score 6 tumors, from a separate PSA Era prostatectomy tissue microarray, were used for comparison. FISH was carried out using ERG break-apart probes. Tumors were assessed for fusion by deletion (Edel) or split (Esplit), duplicated fusions and low-level copy number gain in normal ERG gene locus. Minute adenocarcinomas: Fusion was evaluable in 32/45 tumors (71%). Fifteen out of 32 (47%) tumors were positive for fusion. Six (19%) were of the Edel class and 7 (22%) were classified as combined Edel+Esplit. Non-minute adenocarcinomas (pT2): Fusion was identified in 20/30 tumors (67%). Four (13%) were of Edel class and 5 (17%) were combined Edel+Esplit. Duplicated fusions were encountered in 5 (16%) tumors. Non-minute adenocarcinomas (pT3): Fusion was identified in 19/33 (58%). Fusion was due to a deletion in 6 (18%) tumors. Seven tumors (21%) were classified as combined Edel+Esplit. One tumor showed Esplit alone. Duplicated fusions were encountered in 3 (9%) cases. The incidence of duplicated fusions was higher in non-minute adenocarcinomas (13 vs 0%; P=0.03). A trend for higher incidence of low-level copy number gain in normal ERG gene locus without fusion was noted in non-minute adenocarcinomas (10 vs 0%; P=0.07). We found a TMPRSS2-ERG fusion rate of 47% in minute adenocarcinomas. The latter is not significantly different from that of grade matched non-minute adenocarcinomas. The incidence of duplicated fusion was higher in non-minute adenocarcinomas. Our finding of comparable rate of TMPRSS2-ERG fusion in minute adenocarcinomas may argue
... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...
Wei, Menghan; Wang, Sanhong; Dong, Hui; Cai, Binhua; Tao, Jianmin
2016-01-01
As one of the Ca2+ sensors, calcium-dependent protein kinase (CPK) plays vital roles in immune and stress signaling, growth and development, and hormone responses, etc. Recently, the whole genome of apple (Malus × domestica), pear (Pyrus communis), peach (Prunus persica), plum (Prunus mume) and strawberry (Fragaria vesca) in Rosaceae family has been fully sequenced. However, little is known about the CPK gene family in these Rosaceae species. In this study, 123 CPK genes were identified from five Rosaceae species, including 37 apple CPKs, 37 pear CPKs, 17 peach CPKs, 16 strawberry CPKs, and 16 plum CPKs. Based on the phylogenetic tree topology and structural characteristics, we divided the CPK gene family into 4 distinct subfamilies: Group I, II, III, and IV. Whole-genome duplication (WGD) or segmental duplication played vital roles in the expansion of the CPK in these Rosaceae species. Most of segmental duplication pairs in peach and plum may have arisen from the γ triplication (~140 million years ago [MYA]), while in apple genome, many duplicated genes may have been derived from a recent WGD (30~45 MYA). Purifying selection also played a critical role in the function evolution of CPK family genes. Expression of apple CPK genes in response to apple pathotype of Alternaria alternata was verified by analysis of quantitative real-time RT-PCR (qPCR). Expression data demonstrated that CPK genes in apple might have evolved independently in different biological contexts. The analysis of evolution history and expression profile laid a foundation for further examining the function and complexity of the CPK gene family in Rosaceae.
Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.
Van Bel, Michiel; Coppens, Frederik
2017-01-01
Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .
Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi
2011-01-01
Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816
Directory of Open Access Journals (Sweden)
Philippe Lashermes
2016-09-01
Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Cuypers, Thomas D; Hogeweg, Paulien
2014-04-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Directory of Open Access Journals (Sweden)
Thomas D Cuypers
2014-04-01
Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.
Directory of Open Access Journals (Sweden)
Wei-Jun Chen
2015-01-01
Full Text Available CCCH zinc finger proteins, which are characterized by the presence of three cysteine residues and one histidine residue, play important roles in RNA processing in plants. Subfamily IX CCCH proteins were recently shown to function in stress tolerances. In this study, we analyzed CCCH IX genes in Zea mays, Oryza sativa, and Sorghum bicolor. These genes, which are almost intronless, were divided into four groups based on phylogenetic analysis. Microsynteny analysis revealed microsynteny in regions of some gene pairs, indicating that segmental duplication has played an important role in the expansion of this gene family. In addition, we calculated the dates of duplication by Ks analysis, finding that all microsynteny blocks were formed after the monocot-eudicot divergence. We found that deletions, multiplications, and inversions were shown to have occurred over the course of evolution. Moreover, the Ka/Ks ratios indicated that the genes in these three grass species are under strong purifying selection. Finally, we investigated the evolutionary patterns of some gene pairs conferring tolerance to abiotic stress, laying the foundation for future functional studies of these transcription factors.
Kim, Seon-Hee; Bae, Young-An
2017-09-01
Tyrosinase provides an essential activity during egg production in diverse platyhelminths by mediating sclerotization of eggshells. In this study, we investigated the genomic and evolutionary features of tyrosinases in parasitic platyhelminths whose genomic information is available. A pair of paralogous tyrosinases was detected in most trematodes, whereas they were lost in cyclophyllidean cestodes. A pseudophyllidean cestode displaying egg biology similar to that of trematodes possessed an orthologous gene. Interestingly, one of the paralogous tyrosinases appeared to have been multiplied into three copies in Clonorchis sinensis and Opisthorchis viverrini. In addition, a fifth tyrosinase gene that was minimally transcribed through all developmental stages was further detected in these opisthorchiid genomes. Phylogenetic analyses demonstrated that the tyrosinase gene has undergone duplication at least three times in platyhelminths. The additional opisthorchiid gene arose from the first duplication. A paralogous copy generated from these gene duplications, except for the last one, seemed to be lost in the major neodermatans lineages. In C. sinensis, tyrosinase gene expressions were initiated following sexual maturation and the levels were significantly enhanced by the presence of O2 and bile. Taken together, our data suggest that tyrosinase has evolved lineage-specifically across platyhelminths related to its copy number and induction mechanism.
Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana
2014-01-01
The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for
Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.
Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H
2014-01-01
Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.
Garcia, Nelson; Messing, Joachim
2017-01-01
The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90) to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs). Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.
Directory of Open Access Journals (Sweden)
Nelson Garcia
2017-11-01
Full Text Available The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90 to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs. Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.
Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.
Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison
2008-03-01
Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.
Divergence and Conservative Evolution of XTNX Genes in Land Plants
Directory of Open Access Journals (Sweden)
Yan-Mei Zhang
2017-10-01
Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.
Genetics Home Reference: 7q11.23 duplication syndrome
... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...
Fungi that have the enzymes cyanase and carbonic anhydrase show a limited capacity to detoxify cyanate, a fungicide employed by both plants and humans. Here, we describe a novel two-gene cluster that comprises duplicated cyanase and carbonic anhydrase copies, which we name the CCA gene cluster, trac...
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua
2015-04-18
Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to
An amphioxus Msx gene expressed predominantly in the dorsal neural tube.
Sharman, A C; Shimeld, S M; Holland, P W
1999-04-01
Genomic and cDNA clones of an Msx class homeobox gene were isolated from amphioxus (Branchiostoma floridae). The gene, AmphiMsx, is expressed in the neural plate from late gastrulation; in later embryos it is expressed in dorsal cells of the neural tube, excluding anterior and posterior regions, in an irregular reiterated pattern. There is transient expression in dorsal cells within somites, reminiscent of migrating neural crest cells of vertebrates. In larvae, mRNA is detected in two patches of anterior ectoderm proposed to be placodes. Evolutionary analyses show there is little phylogenetic information in Msx protein sequences; however, it is likely that duplication of Msx genes occurred in the vertebrate lineage.
High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes
DEFF Research Database (Denmark)
Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu
2006-01-01
Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...
Directory of Open Access Journals (Sweden)
Menghan Wei
Full Text Available As one of the Ca2+ sensors, calcium-dependent protein kinase (CPK plays vital roles in immune and stress signaling, growth and development, and hormone responses, etc. Recently, the whole genome of apple (Malus × domestica, pear (Pyrus communis, peach (Prunus persica, plum (Prunus mume and strawberry (Fragaria vesca in Rosaceae family has been fully sequenced. However, little is known about the CPK gene family in these Rosaceae species. In this study, 123 CPK genes were identified from five Rosaceae species, including 37 apple CPKs, 37 pear CPKs, 17 peach CPKs, 16 strawberry CPKs, and 16 plum CPKs. Based on the phylogenetic tree topology and structural characteristics, we divided the CPK gene family into 4 distinct subfamilies: Group I, II, III, and IV. Whole-genome duplication (WGD or segmental duplication played vital roles in the expansion of the CPK in these Rosaceae species. Most of segmental duplication pairs in peach and plum may have arisen from the γ triplication (~140 million years ago [MYA], while in apple genome, many duplicated genes may have been derived from a recent WGD (30~45 MYA. Purifying selection also played a critical role in the function evolution of CPK family genes. Expression of apple CPK genes in response to apple pathotype of Alternaria alternata was verified by analysis of quantitative real-time RT-PCR (qPCR. Expression data demonstrated that CPK genes in apple might have evolved independently in different biological contexts. The analysis of evolution history and expression profile laid a foundation for further examining the function and complexity of the CPK gene family in Rosaceae.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
[Analysis of genetic models and gene effects on main agronomy characters in rapeseed].
Li, J; Qiu, J; Tang, Z; Shen, L
1992-01-01
According to four different genetic models, the genetic patterns of 8 agronomy traits were analysed by using the data of 24 generations which included positive and negative cross of 81008 x Tower, both of the varieties are of good quality. The results showed that none of 8 characters could fit in with additive-dominance models. Epistasis was found in all of these characters, and it has significant effect on generation means. Seed weight/plant and some other main yield characters are controlled by duplicate interaction genes. The interaction between triple genes or multiple genes needs to be utilized in yield heterosis.
Li, Yang I; Kong, Lesheng; Ponting, Chris P; Haerty, Wilfried
2013-01-01
Sequencing of vertebrate genomes permits changes in distinct protein families, including gene gains and losses, to be ascribed to lineage-specific phenotypes. A prominent example of this is the large-scale duplication of beta-keratin genes in the ancestors of birds, which was crucial to the subsequent evolution of their beaks, claws, and feathers. Evidence suggests that the shell of Pseudomys nelsoni contains at least 16 beta-keratins proteins, but it is unknown whether this is a complete set and whether their corresponding genes are orthologous to avian beak, claw, or feather beta-keratin genes. To address these issues and to better understand the evolution of the turtle shell at a molecular level, we surveyed the diversity of beta-keratin genes from the genome assemblies of three turtles, Chrysemys picta, Pelodiscus sinensis, and Chelonia mydas, which together represent over 160 Myr of chelonian evolution. For these three turtles, we found 200 beta-keratins, which indicate that, as for birds, a large expansion of beta-keratin genes in turtles occurred concomitantly with the evolution of a unique phenotype, namely, their plastron and carapace. Phylogenetic reconstruction of beta-keratin gene evolution suggests that separate waves of gene duplication within a single genomic location gave rise to scales, claws, and feathers in birds, and independently the scutes of the shell in turtles.
Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M
2017-06-01
The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Mutated genes as research tool
International Nuclear Information System (INIS)
1981-01-01
Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of
Origins of De Novo Genes in Human and Chimpanzee.
Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar
2015-12-01
The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.
The Fanconi anemia/BRCA gene network in zebrafish: Embryonic expression and comparative genomics
Titus, Tom A.; Yan, Yi-Lin; Wilson, Catherine; Starks, Amber M.; Frohnmayer, Jonathan D.; Canestro, Cristian; Rodriguez-Mari, Adriana; He, Xinjun; Postlethwait, John H.
2008-01-01
Fanconi anemia (FA) is a genic disease resulting in bone marrow failure, high cancer risks, and infertility, and developmental anomalies including microphthalmia, microcephaly, hypoplastic radius and thumb. Here we present cDNA sequences, genetic mapping, and genomic analyses for the four previously undescribed zebrafish FA genes (fanci, fancj, fancm, and fancn, and show that they reverted to single copy after the teleost genome duplication. We tested the hypothesis that FA genes are expresse...
Gene expression and gene therapy imaging
International Nuclear Information System (INIS)
Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.
2007-01-01
The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)
A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.
Directory of Open Access Journals (Sweden)
Jeroen Dobbelaere
2008-09-01
Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.
Fish Suppressors of Cytokine Signaling (SOCS): Gene Discovery, Modulation of Expression and Function
Wang, Tiehui; Gorgoglione, Bartolomeo; Maehr, Tanja; Holland, Jason W.; Vecino, Jose L. González; Wadsworth, Simon; Secombes, Christopher J.
2011-01-01
The intracellular suppressors of cytokine signaling (SOCS) family members, including CISH and SOCS1 to 7 in mammals, are important regulators of cytokine signaling pathways. So far, the orthologues of all the eight mammalian SOCS members have been identified in fish, with several of them having multiple copies. Whilst fish CISH, SOCS3, and SOCS5 paralogues are possibly the result of the fish-specific whole genome duplication event, gene duplication or lineage-specific genome duplication may also contribute to some paralogues, as with the three trout SOCS2s and three zebrafish SOCS5s. Fish SOCS genes are broadly expressed and also show species-specific expression patterns. They can be upregulated by cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-21, by immune stimulants such as LPS, poly I:C, and PMA, as well as by viral, bacterial, and parasitic infections in member- and species-dependent manners. Initial functional studies demonstrate conserved mechanisms of fish SOCS action via JAK/STAT pathways. PMID:22203897
Clinical study of DMD gene point mutation causing Becker muscular dystrophy
Directory of Open Access Journals (Sweden)
Ji-qing CAO
2015-07-01
Full Text Available Background DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD. Methods Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA. Results Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C. Conclusions DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005
Biedrzycka, Aleksandra; O'Connor, Emily; Sebastian, Alvaro; Migalska, Magdalena; Radwan, Jacek; Zając, Tadeusz; Bielański, Wojciech; Solarz, Wojciech; Ćmiel, Adam; Westerdahl, Helena
2017-07-05
Recent work suggests that gene duplications may play an important role in the evolution of immunity genes. Passerine birds, and in particular Sylvioidea warblers, have highly duplicated major histocompatibility complex (MHC) genes, which are key in immunity, compared to other vertebrates. However, reasons for this high MHC gene copy number are yet unclear. High-throughput sequencing (HTS) allows MHC genotyping even in individuals with extremely duplicated genes. This HTS data can reveal evidence of selection, which may help to unravel the putative functions of different gene copies, i.e. neofunctionalization. We performed exhaustive genotyping of MHC class I in a Sylvioidea warbler, the sedge warbler, Acrocephalus schoenobaenus, using the Illumina MiSeq technique on individuals from a wild study population. The MHC diversity in 863 genotyped individuals by far exceeds that of any other bird species described to date. A single individual could carry up to 65 different alleles, a large proportion of which are expressed (transcribed). The MHC alleles were of three different lengths differing in evidence of selection, diversity and divergence within our study population. Alleles without any deletions and alleles containing a 6 bp deletion showed characteristics of classical MHC genes, with evidence of multiple sites subject to positive selection and high sequence divergence. In contrast, alleles containing a 3 bp deletion had no sites subject to positive selection and had low divergence. Our results suggest that sedge warbler MHC alleles that either have no deletion, or contain a 6 bp deletion, encode classical antigen presenting MHC molecules. In contrast, MHC alleles containing a 3 bp deletion may encode molecules with a different function. This study demonstrates that highly duplicated MHC genes can be characterised with HTS and that selection patterns can be useful for revealing neofunctionalization. Importantly, our results highlight the need to consider the
Hox gene clusters in the Indonesian coelacanth, Latimeria menadoensis
Koh, Esther G. L.; Lam, Kevin; Christoffels, Alan; Erdmann, Mark V.; Brenner, Sydney; Venkatesh, Byrappa
2003-01-01
The Hox genes encode transcription factors that play a key role in specifying body plans of metazoans. They are organized into clusters that contain up to 13 paralogue group members. The complex morphology of vertebrates has been attributed to the duplication of Hox clusters during vertebrate evolution. In contrast to the single Hox cluster in the amphioxus (Branchiostoma floridae), an invertebrate-chordate, mammals have four clusters containing 39 Hox genes. Ray-finned fishes (Actinopterygii) such as zebrafish and fugu possess more than four Hox clusters. The coelacanth occupies a basal phylogenetic position among lobe-finned fishes (Sarcopterygii), which gave rise to the tetrapod lineage. The lobe fins of sarcopterygians are considered to be the evolutionary precursors of tetrapod limbs. Thus, the characterization of Hox genes in the coelacanth should provide insights into the origin of tetrapod limbs. We have cloned the complete second exon of 33 Hox genes from the Indonesian coelacanth, Latimeria menadoensis, by extensive PCR survey and genome walking. Phylogenetic analysis shows that 32 of these genes have orthologs in the four mammalian HOX clusters, including three genes (HoxA6, D1, and D8) that are absent in ray-finned fishes. The remaining coelacanth gene is an ortholog of hoxc1 found in zebrafish but absent in mammals. Our results suggest that coelacanths have four Hox clusters bearing a gene complement more similar to mammals than to ray-finned fishes, but with an additional gene, HoxC1, which has been lost during the evolution of mammals from lobe-finned fishes. PMID:12547909
Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon
Directory of Open Access Journals (Sweden)
Shenglong Tan
2012-01-01
Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.
Monte Carlo simulation of a simple gene network yields new evolutionary insights.
Andrecut, M; Cloud, D; Kauffman, S A
2008-02-07
Monte Carlo simulations of a genetic toggle switch show that its behavior can be more complex than analytic models would suggest. We show here that as a result of the interplay between frequent and infrequent reaction events, such a switch can have more stable states than an analytic model would predict, and that the number and character of these states depend to a large extent on the propensity of transcription factors to bind to and dissociate from promoters. The effects of gene duplications differ even more; in analytic models, these seem to result in the disappearance of bi-stability and thus a loss of the switching function, but a Monte Carlo simulation shows that they can result in the appearance of new stable states without the loss of old ones, and thus in an increase of the complexity of the switch's behavior which may facilitate the evolution of new cellular functions. These differences are of interest with respect to the evolution of gene networks, particularly in clonal lines of cancer cells, where the duplication of active genes is an extremely common event, and often seems to result in the appearance of viable new cellular phenotypes.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation
Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.
2014-01-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Thomas D Cuypers; Paulien Hogeweg
2014-01-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...
Miller, Hilary C; O'Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A; Edwards, Scott
2015-05-07
Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. Copyright © 2015 Miller et al.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gong, Ming; Chen, Mingjie; Wang, Hong; Zhu, Qiuming; Tan, Qi
2015-01-01
Cryogenic autolysis is a typical phenomenon of abnormal metabolism in Volvariella volvacea. Recent studies have identified 20 significantly up-regulated genes via high-throughput sequencing of the mRNAs expressed in the mycelia of V. volvacea after cold exposure. Among these significantly up-regulated genes, 15 annotated genes were used for functional annotation cluster analysis. Our results showed that the cyclin-like F-box domain (FBDC) formed the functional cluster with the lowest P-value. We also observed a significant expansion of FBDC families in V. volvacea. Among these, the FBDC3 family displayed the maximal gene expansion in V. volvacea. Gene expression profiling analysis revealed only one FBDC gene in V. volvacea (FBDV1) that was significantly up-regulated, which is located in the FBDC3 family. Comparative genomics analysis revealed the homologous sequences of FBDV1 with high similarity were clustered on the same scaffold. However, FBDV1 was located far from these clusters, indicating the divergence of duplicated genes. Relative time estimation and rate test provided evidence for the divergence of FBDV1 after recent duplications. Real-time RT-PCR analysis confirmed that the expression of the FBDV1 was significantly up-regulated (P autolysis of V. volvacea. © 2015 by The Mycological Society of America.
Chromosome mapping of dragline silk genes in the genomes of widow spiders (Araneae, Theridiidae.
Directory of Open Access Journals (Sweden)
Yonghui Zhao
Full Text Available With its incredible strength and toughness, spider dragline silk is widely lauded for its impressive material properties. Dragline silk is composed of two structural proteins, MaSp1 and MaSp2, which are encoded by members of the spidroin gene family. While previous studies have characterized the genes that encode the constituent proteins of spider silks, nothing is known about the physical location of these genes. We determined karyotypes and sex chromosome organization for the widow spiders, Latrodectus hesperus and L. geometricus (Araneae, Theridiidae. We then used fluorescence in situ hybridization to map the genomic locations of the genes for the silk proteins that compose the remarkable spider dragline. These genes included three loci for the MaSp1 protein and the single locus for the MaSp2 protein. In addition, we mapped a MaSp1 pseudogene. All the MaSp1 gene copies and pseudogene localized to a single chromosomal region while MaSp2 was located on a different chromosome of L. hesperus. Using probes derived from L. hesperus, we comparatively mapped all three MaSp1 loci to a single region of a L. geometricus chromosome. As with L. hesperus, MaSp2 was found on a separate L. geometricus chromosome, thus again unlinked to the MaSp1 loci. These results indicate orthology of the corresponding chromosomal regions in the two widow genomes. Moreover, the occurrence of multiple MaSp1 loci in a conserved gene cluster across species suggests that MaSp1 proliferated by tandem duplication in a common ancestor of L. geometricus and L. hesperus. Unequal crossover events during recombination could have given rise to the gene copies and could also maintain sequence similarity among gene copies over time. Further comparative mapping with taxa of increasing divergence from Latrodectus will pinpoint when the MaSp1 duplication events occurred and the phylogenetic distribution of silk gene linkage patterns.
Directory of Open Access Journals (Sweden)
Gersende Maugars
Full Text Available Thyroid-stimulating hormone (TSH is composed of a specific β subunit and an α subunit that is shared with the two pituitary gonadotropins. The three β subunits derive from a common ancestral gene through two genome duplications (1R and 2R that took place before the radiation of vertebrates. Analysis of genomic data from phylogenetically relevant species allowed us to identify an additional Tshβ subunit-related gene that was generated through 2R. This gene, named Tshβ2, present in cartilaginous fish, little skate and elephant shark, and in early lobe-finned fish, coelacanth and lungfish, was lost in ray-finned fish and tetrapods. The absence of a second type of TSH receptor (Tshr gene in these species suggests that both TSHs act through the same receptor. A novel Tshβ sister gene, named Tshβ3, was generated through the third genomic duplication (3R that occurred early in the teleost lineage. Tshβ3 is present in most teleost groups but was lostin tedraodontiforms. The 3R also generated a second Tshr, named Tshrb. Interestingly, the new Tshrb was translocated from its original chromosomic position after the emergence of eels and was then maintained in its new position. Tshrb was lost in tetraodontiforms and in ostariophysians including zebrafish although the latter species have two TSHs, suggesting that TSHRb may be dispensable. The tissue distribution of duplicated Tshβs and Tshrs was studied in the European eel. The endocrine thyrotropic function in the eel would be essentially mediated by the classical Tshβ and Tshra, which are mainly expressed in the pituitary and thyroid, respectively. Tshβ3 and Tshrb showed a similar distribution pattern in the brain, pituitary, ovary and adipose tissue, suggesting a possible paracrine/autocrine mode of action in these non-thyroidal tissues. Further studies will be needed to determine the binding specificity of the two receptors and how these two TSH systems are interrelated.
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Sibout, Richard; Proost, Sebastian; Hansen, Bjoern Oest; Vaid, Neha; Giorgi, Federico M; Ho-Yue-Kuang, Severine; Legée, Frédéric; Cézart, Laurent; Bouchabké-Coussa, Oumaya; Soulhat, Camille; Provart, Nicholas; Pasha, Asher; Le Bris, Philippe; Roujol, David; Hofte, Herman; Jamet, Elisabeth; Lapierre, Catherine; Persson, Staffan; Mutwil, Marek
2017-08-01
While Brachypodium distachyon (Brachypodium) is an emerging model for grasses, no expression atlas or gene coexpression network is available. Such tools are of high importance to provide insights into the function of Brachypodium genes. We present a detailed Brachypodium expression atlas, capturing gene expression in its major organs at different developmental stages. The data were integrated into a large-scale coexpression database ( www.gene2function.de), enabling identification of duplicated pathways and conserved processes across 10 plant species, thus allowing genome-wide inference of gene function. We highlight the importance of the atlas and the platform through the identification of duplicated cell wall modules, and show that a lignin biosynthesis module is conserved across angiosperms. We identified and functionally characterised a putative ferulate 5-hydroxylase gene through overexpression of it in Brachypodium, which resulted in an increase in lignin syringyl units and reduced lignin content of mature stems, and led to improved saccharification of the stem biomass. Our Brachypodium expression atlas thus provides a powerful resource to reveal functionally related genes, which may advance our understanding of important biological processes in grasses. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Eunyoung Seo
2016-08-01
Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.
Imaging gene expression in gene therapy
International Nuclear Information System (INIS)
Wiebe, Leonard I.
1997-01-01
Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented
Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong
2012-03-01
Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.
Isolation and characterization of CXC receptor genes in a range of elasmobranchs.
Goostrey, Anna; Jones, Gareth; Secombes, Christopher J
2005-01-01
The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.
Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl
2017-01-01
Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Emergence of a Homo sapiens-specific gene family and chromosome 16p11.2 CNV susceptibility.
Nuttle, Xander; Giannuzzi, Giuliana; Duyzend, Michael H; Schraiber, Joshua G; Narvaiza, Iñigo; Sudmant, Peter H; Penn, Osnat; Chiatante, Giorgia; Malig, Maika; Huddleston, John; Benner, Chris; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Stessman, Holly A F; Marchetto, Maria C N; Denman, Laura; Harshman, Lana; Baker, Carl; Raja, Archana; Penewit, Kelsi; Janke, Nicolette; Tang, W Joyce; Ventura, Mario; Banci, Lucia; Antonacci, Francesca; Akey, Joshua M; Amemiya, Chris T; Gage, Fred H; Reymond, Alexandre; Eichler, Evan E
2016-08-11
Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CNV) at chromosome 16p11.2 accounts for approximately 1% of cases of autism and is mediated by a complex set of segmental duplications, many of which arose recently during human evolution. Here we reconstruct the evolutionary history of the locus and identify bolA family member 2 (BOLA2) as a gene duplicated exclusively in Homo sapiens. We estimate that a 95-kilobase-pair segment containing BOLA2 duplicated across the critical region approximately 282 thousand years ago (ka), one of the latest among a series of genomic changes that dramatically restructured the locus during hominid evolution. All humans examined carried one or more copies of the duplication, which nearly fixed early in the human lineage--a pattern unlikely to have arisen so rapidly in the absence of selection (P sapiens-specific duplication. In summary, the duplicative transposition of BOLA2 at the root of the H. sapiens lineage about 282 ka simultaneously increased copy number of a gene associated with iron homeostasis and predisposed our species to recurrent rearrangements associated with disease.
Imaging gene expression in gene therapy
Energy Technology Data Exchange (ETDEWEB)
Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research
1997-12-31
Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented
Improvisation in evolution of genes and genomes: whose structure is it anyway?
Shakhnovich, Boris E; Shakhnovich, Eugene I
2008-06-01
Significant progress has been made in recent years in a variety of seemingly unrelated fields such as sequencing, protein structure prediction, and high-throughput transcriptomics and metabolomics. At the same time, new microscopic models have been developed that made it possible to analyze the evolution of genes and genomes from first principles. The results from these efforts enable, for the first time, a comprehensive insight into the evolution of complex systems and organisms on all scales--from sequences to organisms and populations. Every newly sequenced genome uncovers new genes, families, and folds. Where do these new genes come from? How do gene duplication and subsequent divergence of sequence and structure affect the fitness of the organism? What role does regulation play in the evolution of proteins and folds? Emerging synergism between data and modeling provides first robust answers to these questions.
Molecular identification of the chitinase genes in Plasmodium relictum.
Garcia-Longoria, Luz; Hellgren, Olof; Bensch, Staffan
2014-06-18
Malaria parasites need to synthesize chitinase in order to go through the peritrophic membrane, which is created around the mosquito midgut, to complete its life cycle. In mammalian malaria species, the chitinase gene comprises either a large or a short copy. In the avian malaria parasites Plasmodium gallinaceum both copies are present, suggesting that a gene duplication in the ancestor to these extant species preceded the loss of either the long or the short copy in Plasmodium parasites of mammals. Plasmodium gallinaceum is not the most widespread and harmful parasite of birds. This study is the first to search for and identify the chitinase gene in one of the most prevalent avian malaria parasites, Plasmodium relictum. Both copies of P. gallinaceum chitinase were used as reference sequences for primer design. Different sequences of Plasmodium spp. were used to build the phylogenetic tree of chitinase gene. The gene encoding for chitinase was identified in isolates of two mitochondrial lineages of P. relictum (SGS1 and GRW4). The chitinase found in these two lineages consists both of the long (PrCHT1) and the short (PrCHT2) copy. The genetic differences found in the long copy of the chitinase gene between SGS1 and GRW4 were higher than the difference observed for the cytochrome b gene. The identification of both copies in P. relictum sheds light on the phylogenetic relationship of the chitinase gene in the genus Plasmodium. Due to its high variability, the chitinase gene could be used to study the genetic population structure in isolates from different host species and geographic regions.
Co-Expression of Neighboring Genes in the Zebrafish (Danio rerio Genome
Directory of Open Access Journals (Sweden)
Daryi Wang
2009-08-01
Full Text Available Neighboring genes in the eukaryotic genome have a tendency to express concurrently, and the proximity of two adjacent genes is often considered a possible explanation for their co-expression behavior. However, the actual contribution of the physical distance between two genes to their co-expression behavior has yet to be defined. To further investigate this issue, we studied the co-expression of neighboring genes in zebrafish, which has a compact genome and has experienced a whole genome duplication event. Our analysis shows that the proportion of highly co-expressed neighboring pairs (Pearson’s correlation coefficient R>0.7 is low (0.24% ~ 0.67%; however, it is still significantly higher than that of random pairs. In particular, the statistical result implies that the co-expression tendency of neighboring pairs is negatively correlated with their physical distance. Our findings therefore suggest that physical distance may play an important role in the co-expression of neighboring genes. Possible mechanisms related to the neighboring genes’ co-expression are also discussed.
Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D
2012-12-01
NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.
A large-scale international meta-analysis of paraoxonase gene polymorphisms in sporadic ALS
Wills, A-M.; Cronin, S.; Slowik, A.; Kasperaviciute, D.; Van Es, M. A.; Morahan, J. M.; Valdmanis, P. N.; Meininger, V.; Melki, J.; Shaw, C. E.; Rouleau, G. A.; Fisher, E. M. C.; Shaw, P. J.; Morrison, K. E.; Pamphlett, R.; Van den Berg, L. H.; Figlewicz, D. A.; Andersen, P. M.; Al-Chalabi, A.; Hardiman, O.; Purcell, S.; Landers, J. E.; Brown, R. H.
2009-01-01
Background: Six candidate gene studies report a genetic association of DNA variants within the paraoxonase locus with sporadic amyotrophic lateral sclerosis (ALS). However, several other large studies, including five genome-wide association studies, have not duplicated this finding. Methods: We
Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.
Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph
2017-10-01
During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.
2010-01-01
Background Oysters are morphologically plastic and hence difficult subjects for taxonomic and evolutionary studies. It is long been suspected, based on the extraordinary species diversity observed, that Asia Pacific is the epicenter of oyster speciation. To understand the species diversity and its evolutionary history, we collected five Crassostrea species from Asia and sequenced their complete mitochondrial (mt) genomes in addition to two newly released Asian oysters (C. iredalei and Saccostrea mordax) for a comprehensive analysis. Results The six Asian Crassostrea mt genomes ranged from 18,226 to 22,446 bp in size, and all coded for 39 genes (12 proteins, 2 rRNAs and 25 tRNAs) on the same strand. Their genomes contained a split of the rrnL gene and duplication of trnM, trnK and trnQ genes. They shared the same gene order that differed from an Atlantic sister species by as many as nine tRNA changes (6 transpositions and 3 duplications) and even differed significantly from S. mordax in protein-coding genes. Phylogenetic analysis indicates that the six Asian Crassostrea species emerged between 3 and 43 Myr ago, while the Atlantic species evolved 83 Myr ago. Conclusions The complete conservation of gene order in the six Asian Crassostrea species over 43 Myr is highly unusual given the remarkable rate of rearrangements in their sister species and other bivalves. It provides strong evidence for the recent speciation of the six Crassostrea species in Asia. It further indicates that changes in mt gene order may not be strictly a function of time but subject to other constraints that are presently not well understood. PMID:21189147
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M
2017-05-01
Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo
2010-04-01
Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.
Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao
2013-10-03
WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates
Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.
2007-12-20
Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.
Baker, Richard H; Wilkinson, Gerald S
2010-09-16
Chromosomal location has a significant effect on the evolutionary dynamics of genes involved in sexual dimorphism, impacting both the pattern of sex-specific gene expression and the rate of duplication and protein evolution for these genes. For nearly all non-model organisms, however, knowledge of chromosomal gene content is minimal and difficult to obtain on a genomic scale. In this study, we utilized Comparative Genomic Hybridization (CGH), using probes designed from EST sequence, to identify genes located on the X chromosome of four species in the stalk-eyed fly genus Teleopsis. Analysis of log(2) ratio values of female-to-male hybridization intensities from the CGH microarrays for over 3,400 genes reveals a strongly bimodal distribution that clearly differentiates autosomal from X-linked genes for all four species. Genotyping of 33 and linkage mapping of 28 of these genes in Teleopsis dalmanni indicate the CGH results correctly identified chromosomal location in all cases. Syntenic comparison with Drosophila indicates that 90% of the X-linked genes in Teleopsis are homologous to genes located on chromosome 2L in Drosophila melanogaster, suggesting the formation of a nearly complete neo-X chromosome from Muller element B in the dipteran lineage leading to Teleopsis. Analysis of gene movement both relative to Drosophila and within Teleopsis indicates that gene movement is significantly associated with 1) rates of protein evolution, 2) the pattern of gene duplication, and 3) the evolution of eyespan sexual dimorphism. Overall, this study reveals that diopsids are a critical group for understanding the evolution of sex chromosomes within Diptera. In addition, we demonstrate that CGH is a useful technique for identifying chromosomal sex-linkage and should be applicable to other organisms with EST or partial genomic information.
Directory of Open Access Journals (Sweden)
Richard H Baker
2010-09-01
Full Text Available Chromosomal location has a significant effect on the evolutionary dynamics of genes involved in sexual dimorphism, impacting both the pattern of sex-specific gene expression and the rate of duplication and protein evolution for these genes. For nearly all non-model organisms, however, knowledge of chromosomal gene content is minimal and difficult to obtain on a genomic scale. In this study, we utilized Comparative Genomic Hybridization (CGH, using probes designed from EST sequence, to identify genes located on the X chromosome of four species in the stalk-eyed fly genus Teleopsis. Analysis of log(2 ratio values of female-to-male hybridization intensities from the CGH microarrays for over 3,400 genes reveals a strongly bimodal distribution that clearly differentiates autosomal from X-linked genes for all four species. Genotyping of 33 and linkage mapping of 28 of these genes in Teleopsis dalmanni indicate the CGH results correctly identified chromosomal location in all cases. Syntenic comparison with Drosophila indicates that 90% of the X-linked genes in Teleopsis are homologous to genes located on chromosome 2L in Drosophila melanogaster, suggesting the formation of a nearly complete neo-X chromosome from Muller element B in the dipteran lineage leading to Teleopsis. Analysis of gene movement both relative to Drosophila and within Teleopsis indicates that gene movement is significantly associated with 1 rates of protein evolution, 2 the pattern of gene duplication, and 3 the evolution of eyespan sexual dimorphism. Overall, this study reveals that diopsids are a critical group for understanding the evolution of sex chromosomes within Diptera. In addition, we demonstrate that CGH is a useful technique for identifying chromosomal sex-linkage and should be applicable to other organisms with EST or partial genomic information.
A scale invariant clustering of genes on human chromosome 7
Directory of Open Access Journals (Sweden)
Kendal Wayne S
2004-01-01
Full Text Available Abstract Background Vertebrate genes often appear to cluster within the background of nontranscribed genomic DNA. Here an analysis of the physical distribution of gene structures on human chromosome 7 was performed to confirm the presence of clustering, and to elucidate possible underlying statistical and biological mechanisms. Results Clustering of genes was confirmed by virtue of a variance of the number of genes per unit physical length that exceeded the respective mean. Further evidence for clustering came from a power function relationship between the variance and mean that possessed an exponent of 1.51. This power function implied that the spatial distribution of genes on chromosome 7 was scale invariant, and that the underlying statistical distribution had a Poisson-gamma (PG form. A PG distribution for the spatial scattering of genes was validated by stringent comparisons of both the predicted variance to mean power function and its cumulative distribution function to data derived from chromosome 7. Conclusion The PG distribution was consistent with at least two different biological models: In the microrearrangement model, the number of genes per unit length of chromosome represented the contribution of a random number of smaller chromosomal segments that had originated by random breakage and reconstruction of more primitive chromosomes. Each of these smaller segments would have necessarily contained (on average a gamma distributed number of genes. In the gene cluster model, genes would be scattered randomly to begin with. Over evolutionary timescales, tandem duplication, mutation, insertion, deletion and rearrangement could act at these gene sites through a stochastic birth death and immigration process to yield a PG distribution. On the basis of the gene position data alone it was not possible to identify the biological model which best explained the observed clustering. However, the underlying PG statistical model implicated neutral
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Chen, Jianqing; Yin, Hao; Gu, Jinping; Li, Leiting; Liu, Zhe; Jiang, Xueting; Zhou, Hongsheng; Wei, Shuwei; Zhang, Shaoling; Wu, Juyou
2015-01-01
The cyclic nucleotide-gated channel (CNGC) family is involved in the uptake of various cations, such as Ca(2+), to regulate plant growth and respond to biotic and abiotic stresses. However, there is far less information about this family in woody plants such as pear. Here, we provided a genome-wide identification and analysis of the CNGC gene family in pear. Phylogenetic analysis showed that the 21 pear CNGC genes could be divided into five groups (I, II, III, IVA and IVB). The majority of gene duplications in pear appeared to have been caused by segmental duplication and occurred 32.94-39.14 million years ago. Evolutionary analysis showed that positive selection had driven the evolution of pear CNGCs. Motif analyses showed that Group I CNGCs generally contained 26 motifs, which was the greatest number of motifs in all CNGC groups. Among these, eight motifs were shared by each group, suggesting that these domains play a conservative role in CNGC activity. Tissue-specific expression analysis indicated that functional diversification of the duplicated CNGC genes was a major feature of long-term evolution. Our results also suggested that the P-S6 and PBC & hinge domains had co-evolved during the evolution. These results provide valuable information to increase our understanding of the function, evolution and expression analyses of the CNGC gene family in higher plants. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Marchiani Valentina
2011-06-01
Full Text Available Abstract Background The breadth of the clinical spectrum underlying Pelizaeus-Merzbacher disease and spastic paraplegia type 2 is due to the extensive allelic heterogeneity in the X-linked PLP1 gene encoding myelin proteolipid protein (PLP. PLP1 mutations range from gene duplications of variable size found in 60-70% of patients to intragenic lesions present in 15-20% of patients. Methods Forty-eight male patients from 38 unrelated families with a PLP1-related disorder were studied. All DNA samples were screened for PLP1 gene duplications using real-time PCR. PLP1 gene sequencing analysis was performed on patients negative for the duplication. The mutational status of all 14 potential carrier mothers of the familial PLP1 gene mutation was determined as well as 15/24 potential carrier mothers of the PLP1 duplication. Results and Conclusions PLP1 gene duplications were identified in 24 of the unrelated patients whereas a variety of intragenic PLP1 mutations were found in the remaining 14 patients. Of the 14 different intragenic lesions, 11 were novel; these included one nonsense and 7 missense mutations, a 657-bp deletion, a microdeletion and a microduplication. The functional significance of the novel PLP1 missense mutations, all occurring at evolutionarily conserved residues, was analysed by the MutPred tool whereas their potential effect on splicing was ascertained using the Skippy algorithm and a neural network. Although MutPred predicted that all 7 novel missense mutations would be likely to be deleterious, in silico analysis indicated that four of them (p.Leu146Val, p.Leu159Pro, p.Thr230Ile, p.Ala247Asp might cause exon skipping by altering exonic splicing elements. These predictions were then investigated in vitro for both p.Leu146Val and p.Thr230Ile by means of RNA or minigene studies and were subsequently confirmed in the case of p.Leu146Val. Peripheral neuropathy was noted in four patients harbouring intragenic mutations that altered RNA